Skip to main content
Cellular and Molecular Life Sciences: CMLS logoLink to Cellular and Molecular Life Sciences: CMLS
. 2026 Jan 30;83(1):91. doi: 10.1007/s00018-025-06076-y

A recently evolved domain of the human ING1 epigenetic regulator targets mitochondria and induces senescence

Jessica Bertschmann 1,#, Grace Liu 1,#, Mahbod Djamshidi 1, Katy Heshmatazad 1, Yury Romanov 2, Jasleen Dhaliwahl 1, Hamed Hojjat 1, Yang Yang 1, A P Jason de Koning 1, Karl Riabowol 1,3,, Alexander Hill 1,
PMCID: PMC12876503  PMID: 41617915

Abstract

ING proteins are epigenetic readers, targeting histone acetyl transferase (HAT; ING3-5) or histone deacetylase (HDAC; ING1-2) complexes to modify gene expression. Expression of the ING1a alternatively expressed isoform of ING1 increases markedly with cell age and in response to other exogenous stresses that induce senescence. Overexpression of ING1a rapidly induces cell senescence in human cells by affecting transcription to inhibit endocytosis and activate the retinoblastoma (Rb) cell cycle checkpoint pathway. In this study we detected ING1a expression in several primary and immortalized human cell types, but we were unable to detect ING1a expression in fibroblasts derived from other species. To identify ING1a homologs or orthologs in other species we searched available databases and found that sequences corresponding to the unique region of the ING1a isoform were only found in humans and gorillas, with truncated versions found in orangutans, chimpanzees, mandrills and macaques. In contrast, the ING1b isoform and other ING genes such as ING3-5 are well conserved evolutionarily, including in vascular plants and fungi. ING1a inhibited metabolic activity in numerous primary and established human cells and in Macaca mulatta fibroblasts, but not in murine fibroblasts. The unique amino-terminal region of ING1a we have designated the senescence-associated domain (SAD) targeted ING1a to mitochondria while ING1a missing this sequence was localized exclusively to nucleoli and nuclei and was less effective in inhibing cell cycle progression or inducing senescence-associated beta-galactosidase activity. Considering the natural induction of this isoform as human cells age in culture, expression of ING1a may contribute to limiting the replicative lifespan of cells through altering nuclear transcription, and in a subset of primates, by a distinct mitochondrial mechanism.

Supplementary Information

The online version contains supplementary material available at 10.1007/s00018-025-06076-y.

Keywords: Senescence, Epigenetic, ING1a, Evolution, Mitochondria

Introduction

Cellular senescence is a process in which cells undergo stable proliferative arrest. Senescent cells remain viable and metabolically active but develop distinct phenotypes including alterations in their ability to respond to mitogens, morphology, chromatin architecture, and secretome. With each round of somatic cell division and DNA replication, the tandemly repeated (TTAGGG)n telomeric DNA sequence at the ends of chromosomes become progressively shorter [1] due to the end replication problem [2, 3]. When the telomeres or a subset of telomeres reach a critically short length, TRF2 levels and telomere density decrease [4] to a point where an ATM-initiated and p53- mediated damage signal induces a transcriptional response to inhibit cell growth, a phenomenon termed replicative senescence [1, 57]. Other forms of cell stress can also induce senescence including ionizing radiation, oxidative damage, chemotherapeutic agents, as well as overactivation of oncogenes and tumor suppressors. Recent studies have shown that increased induction of senescence and/or impaired clearance of senescent cells results in their accumulation in several tissues where they contribute to age‐ dependent tissue dysfunction and several age‐related diseases [8, 9], indicating that cell senescence is a causal factor contributing to organismal aging.

Senescing cells show altered epigenetic regulation and gene expression including increased transcription of the p16 and p21 cyclin dependent kinase inhibitors (CDKi) and upregulation of pro-survival pathways to resist apoptosis [10]. Senescent cells also develop senescence-associated heterochromatic foci (SAHF) containing trimethylated lysine 9 of histone 3 (H3K9me3), heterochromatin protein 1 homologue-γ (HP1γ) and macroH2A. SAHF are enriched in Rb protein and silence genes required for proliferation [11]. In yeast and mammals, there also appears to be potential interaction between independent epigenetic and mitochondrial pathways to drive cells towards distinguishable aging states based upon mitochondrial decline, chromatin silencing or telomere dysfunction [12, 13].

Five ING genes encode multiple isoforms of a family of adapter proteins (ING1-5) [14] that target histone acetyltransferase (HAT) and histone deacetylase (HDAC) complexes to the trimethylated histone 3 lysine 4 (H3K4Me3) histone mark [15]. ING1 acts as an epigenetic reader by binding H3K4Me3 with its plant homeodomain (PHD) form of zinc finger [16] and recruiting the Sin3a histone deacetylase (HDAC) complex to affect chromatin structure and alter gene transcription. The ING1 gene encodes two major isoforms, p33ING1b and p47ING1a, and alternative promoter usage in senescent fibroblasts increases the INGla:INGlb isoform ratio from what is seen in low passage cells by ~ 30-fold [17]. ING1a&b share several domains including a lamin interacting domain (LID) allowing them to bind with high affinity to lamin A [18], an essential component of the nuclear lamina and inner nuclear membrane that is mutated in the Hutchinson-Gilford form of premature aging [19]. They also have nuclear localization signals (NLS) targeting them to the nucleus and short, basic nucleolar targeting sequences (NTS) within the NLS that direct them to different chromatin domains within the nucleoli where they exert their activity [20], altering rDNA transcription [21, 22] and inducing apoptosis [23]. However, the ING1a and ING1b isoforms have significantly different effects in cells, with ING1b generally inducing apoptosis and ING1a inducing senescence. Overexpression of ING1a induces senescence more rapidly than oxidative stress, chemotherapeutics like doxorubicin or overexpression of ras [24] and appears to exert this effect through inhibition of endocytosis, resulting in increased levels of Rb, and of the p16MTS1 and p57KIP2 inhibitors of Rb phosphorylation [25]. Similarly, an increasing number of other ING gene splice variants are being described with varying and sometimes opposing activities [26]. In addition, conflicting data regarding the ability of certain isoforms of ING1 to either induce apoptosis [27, 28] or to induce senescence [29, 30] perhaps depending on cell type have been reported, and experiments done in murine versus human cells can lead to different conclusions given the existence of different isoforms in these species [31]. Given these contrasting observations we have undertaken a set of experiments to define the species in which the ING1a isoform can be found and to test the effects of altering ING1a levels upon cell growth, apoptosis and senescence. We find that ING1a is only found in humans and closely related primates and has biological effects in cells from these species, but not in cells from other species. It promotes the induction of senescence, but not apoptosis in cells in which the unique ING1a-specific sequence is found and it localizes to both nuclear and mitochondrial locations to promote senescence by both transcriptional effects and by inducing mitochondrial dysfunction.

Materials and methods

Genomic DNA sequence alignment

The genomic sequences used for multiple sequence alignment were obtained from the National Centre for Biotechnology Information (NCBI) website. Genomic sequences were aligned with Multiple Alignment using Fast Fourier Transform [32] through the European Bioinformatics Institute (EMBL-EBI). A common tree of species was retrieved from the NCBI taxonomy site and populated with primate species (http://www.ncbi.nlm.nih.gov/Taxonomy/CommonTree/www.cmt.cgi).

Generation of phylogenetic trees

To determine the presence or absence of different ING proteins in organisms from different lineages, a common tree of species was generated from (http://www.ncbi.nlm.nih.gov/Taxonomy/CommonTree/www.cmt.cgi), the NCBI taxonomy site, and then from selected representative organisms with fully sequenced and annotated genomes. A total of 60 eukaryotes from the following kingdoms were selected: Animalia, Plantae, Fungi, Protista, Archaeplastida and supergroups SAR, Chromista, and Excavata. Each genome was individually searched using all ING sequences as a query. The candidate ING sequences were then used as a p-BLAST query against a non-redundant Homo sapiens protein database to confirm their identity. Multiple sequence alignments for the ING proteins were performed using MUSCLE with default settings. For trimming poorly aligned regions, trimAL was employed to generate better quality alignments. PhyML version 3.0 was employed to construct phylogenetic trees using a maximum-likelihood method while PhyloT and iTOL were used in the circular tree generation. Trees were built for ING1 and ING2, ING3, ING4 and ING5.

Generating the expression constructs and mutagenesis

pCIBN-hTRF1-tagRFP-T (Addgene# 103811) was linearized by PCR amplification using primers L (Table 1). ING1a and ING1b were PCR amplified with overlapping regions to linearized vector using ING1a Fw and ING1b_Fw and ING1a_Re primers (Table 1) and cloned into the vector using an NEB Gibson assembly kit. The deletion of N- (residues 1–160) and C-Terminal (residues 161–422) regions of ING1a and the intrinsically disordered region of ING1b (residues 125–200 inclusive) were performed by whole plasmid amplification using ING1aΔN, ING1aΔC and ING1bΔIDR primers, respectively (Table 1). Briefly, the parent plasmid used as the template and the PCR reaction performed using mutagenesis primers for 15 cycles with Hot start Q5 polymerase and the products, were digested by DpnI to remove the non-mutated methylated plasmids, for 1 h at 37 °C. The digested products were then transformed into chemically competent bacteria. The transformed cells were grown on LB-agar plates having 50 µg/ml kanamycin. 5–8 colonies were screened for desired mutations and the results were confirmed by sequencing using CMV_f and RFP_Seq_r primers (Table 1).

Table 1.

Primer sequences used for generating expression constructs

Name Sequence
L_Fw GGTGGCGCTAGCGGATC
L_Re GTGCTGTTCCAGGGCCCCAAGCTTATGGTGTCTAAGGGCG
ING1a_Fw GAACCGTCAGATCCGCTAGCGCCACCATGTCCTTCGTGGAATGTCCTTATC
ING1b_Fw GAACCGTCAGATCCGCTAGCGCCACCATGTTGAGTCCTGCCAACG
ING1_Re CATAAGCTTGGGGCCCTGGAACAGCACCTCCAGCCTGTTGTAAGCCCTCTC
ING1a∆N_Fw CTAGCGCCACCATGCCGCGACCCGC
ING1a∆N_Re GCGGGTCGCGGCATGGTGGCGCTAG
ING1a∆C_Fw GTTCGGACCGCCTCCTGGAGGTGCTGTTC
ING1a∆C_Re GAACAGCACCTCCAGGAGGCGGTCCGAAC
ING1b∆IDR_Fw GACACAGCGGGCAACGCCGACCTCCCCAT
ING1b∆IDR_Re ATGGGGAGGTCGGCGTTGCCCGCTGTGTC
CMV_f TGTCGTAACAACTCCGCC
RFP_seq_r CTCGACCACCTTGATTCTC

Cell culture, Transfection and imaging

AG06249 cells were grown in Eagles MEM (Alpha Modification with nucleosides) and 2 mM L-glutamine supplemented with 10% FBS. All other cells were grown in DMEM with 2 mM L-glutamine supplemented with 10% FBS and except after transfection, the media contained 100 U/ml of penicillin and 100 µg/ml streptomycin. Cells were transfected with the expression constructs using a Lonza 4D-Nucleofector™ System using the CA- 137 program for fibroblasts and the nucleofected cells were plated in 8 or 18 well ibidi µ-Slides. Cells were grown for 16–40 h after nucleofection, stained by MitoTracker™ Deep Red FM (ThermoFisher) as suggested by the manufacturer and imaged using a Zeiss LSM880 equipped with an Airyscan detector. In brief, the growth media was changed with growth media containing 200 nM of MitoTracker™ Deep Red FM for 20 min followed by two washes with complete media and 20 min of cell recovery in complete media. Cells were then fixed and permeabilized with 0.5% Triton-X100 in PBS and the TagRFP tagged proteins stained for a better signal to noise ratio with RFP-Booster Alexa Fluor® 568 nanobodies (Chromotek, Germany) for 1 h at room temperature. Cells were then washed four times with PBS, counterstained with Hoechst 33342 and mounted using SlowFade™ Diamond Antifade Mount (ThermoFisher). To study the effect of overexpressed proteins on the ratio of transfected cells, a total of 27 fields for each transfected construct were imaged using a 63X lens with 1.4 numerical aperture at 1X zoom and the number of transfected cells and total number of nuclei counterstained with Hoechst 33342 were counted. For localization studies, transfected cells were imaged using the Airyscan detector using the aforementioned lens and a 2-4X zoom.

Cell transduction and viability assay

Hs68 human skin fibroblasts, human U2OS osteosarcoma cells, AG06249 Rhesus monkey skin fibroblasts and mouse embryo fibroblasts (MEFs) were seeded in 96 well plates and were grown for 24 h before being transduced with adenoviral vectors expressing GFP, ING1a and ING1b as previously described [25]. Fields of cells were counted 12, 24 and 48 h after transduction to estimate effects on cell number. Cells cultured for 48 h after transduction were assayed using HS Alamar Blue dye to estimate viability. In brief, dye diluted 10 times in growth media was added to the cells, which were incubated for 2–3 h before the amount of reduced dye was measured with a plate fluorimeter using excitation at 560 nm and emission at 590 nm. The fluorescent readout of each cell type was normalized to the readout of the cells transduced with GFP expressing adenoviral vectors. All statistical analyses were performed using GraphPad prism version 8.

RNAseq analysis of cells ectopically expressing ING1a

Hs68 primary diploid fibroblasts were infected with an adenovirus expressing GFP as a negative control or with adenovirus expressing GFP plus ING1a under the control of separate promoters as described [25]. RNA preparation, RNAseq and analysis of genes inhibited or induced > 1.5-fold by ING1a was done as described. Tables of genes whose abundance was affected positively or negatively are available as supplementary Tables 1 & 2 upon request.

Results

ING1a contains a unique amino terminal sequence and is expressed at higher levels as cells undergo senescence in vitro

In humans the ING1 gene is found in a subtelomeric region of chromosome 13 (Fig. 1A) and encodes two major protein coding isoforms, ING1a and ING1b. Although otherwise identical, p33ING1b contains a 45 amino acid amino terminal region containing a PCNA-Interacting-Protein (PIP) domain [33] while p47ING1a has a 188 amino terminal domain that is unique in the human genome that we have called the senescence-associated domain (SAD; Fig. 1B). We found previously that ING1a expression increased as primary human diploid fibroblasts (HDFs) approached senescence, and ectopic expression of ING1a rapidly induced a senescent phenotype in HDFs that closely resembles replicative senescence with loss of proliferation, the formation of senescence-associated heterochromatic foci (SAHF) and high levels of SA-β-gal activity [17, 24]. To better understand the range of cells that expressed ING1a, total RNA was isolated from primary and established human and murine fibroblasts and epithelial cells, and from cells derived from hamster, dog, monkey, rat and fruit flies. After reverse transcription and amplification by PCR using the primers indicated in Table 1, we noted that ING1a transcripts were not found in non-human cells (Fig. 1C), and that high passage primary dermal Hs68 fibroblasts expressed ~ fourfold higher levels of ING1a that low passage Hs68 cells (Fig. 1D) similar to a previous report [17]. Fibroblasts derived from a patient with the Hutchinson-Gilford progeria syndrome form of premature aging also expressed high levels of ING1a and other human primary (WS2, WI38) and established cancer (HELA, MCF7) cells expressed detectable levels of ING1a. Blotting of protein lysates from low and high passage WI-38 and Hs68 cells confirmed that higher levels of ING1a transcripts resulted in higher levels of ING1a protein in high passage cells and that primary dermal Hs68 fibroblasts expressed higher levels of ING1a than WI-38 lung fibroblasts (Fig. 1E).

Fig. 1.

Fig. 1

Fig. 1

Human ING1a structure and expression levels. A The ING1 genomic locus is in the subtelometic region of chromosome 13q34. B ING1a and ING1b are the major isoforms expressed in humans. Shared functional domains include: partial bromodomains (PBD), lamin interacting domains (LID), nuclear localization sequences (NLS) containing nucleolar translocation signals (NTS), plant homeodomains (PHD), and a polybasic region (PBR) that binds signaling phospholipids and serves as a ubiquitin interacting motif (UIM). ING1b encodes a PCNA interacting protein (PIP) motif and ING1a encodes a senescence associated domain (SAD). C and D Total RNA was isolated from primary Hs68 dermal fibroblasts at low and high (old) passage, from WI38 lung fibroblasts, dermal fibroblasts from patients with the premature aging syndromes Hutchinson-Gilford Progeria Syndrome (PROG) or Werners Syndrome (WS2), from breast (MCF7) and ovarian (HeLa) cancer cell lines and from the other species indicated. RT-PCR was performed, and C) products were run on acrylamide gels, stained with ethidium bromide and photographed under UV light. The spike-in and H3F3A serve as amplification and loading controls. D RNA from the human cell lines and strains indicated were subjected to RT-PCR and values were normalized against GAPDH with Hs68 set to a value of 1. n = 3 biological replicates. E Total protein lysates were prepared from low passage and high passage WI-38 and Hs68 fibroblasts and following electrophoresis through 10% denaturing polyacrylamide gels and transfer to PVDF membranes, were blotted using a 1:500 dilution of ING1 antibody or 1:5000 dilution of anti-alpha-tubulin

ING1a is only found in a subset of primate species

To understand why we could detect ING1b, but not ING1a mRNA in non-human vertebrates we undertook a directed phylogenetic analysis to extend our previous analysis [14] of the ING family. In contrast to ING1b that is found in all members of the domain Eukaryota examined, ING1a appeared to only be encoded in Homo sapiens and closely related primates (Fig. 2A). To represent the phylogeny of the closely related ING4 and ING5 we plotted the data in a linear manner as shown in Fig. 2B that also highlights the recent emergence if ING1a. To compare a greater number of primate species and ask which of the primate genomes encode an ING1a sequence like that found in humans, multiple sequence alignments were done with an emphasis on ATG start codons. As seen in Fig. 2C, while three other primates encode the most upstream ATG homologous to that found in the human sequence, the chimpanzee sequence also encodes a downstream stop codon. Most of the remaining primates have ATG codons substituted with ACG that might serve as translational initiation points [34] but in orangutans and mandrills a downstream ATG likely results in truncated SAD regions. This relationship is further highlighted in Fig. 2D that shows alignments of primate sequences that have partial ING1a sequences with human full-length ING1a. The sequence of Ing1a in Gorilla gorilla encodes a protein of exactly the same number of amino acids while the Pongo abelii genome encodes amino acids 30–188 of the 188 amino acid human ING1a SAD domain to produce a 393 amino acid Ing1a isoform. Although the rhesus monkey (Macaca mulatta) gene also encodes a stop codon early in the presumptive ING1a gene, as seen in Fig. 2E, an in frame ATG occurs at amino acid 140, indicating that a truncated form of ING1a (188–139 = 49 amino acid) may be produced. Other vertebrates do not encode a recognizable ING1a isoform although they do contain well conserved ING1b, and ING2-5 homologs (Fig. 2A and B). Examination of the 422, 393 and 283 amino acid sequences of human, orangutan and macaque ING1a using the AlphaFold 3 protein structure prediction program [35] indicates that the SAD is largely unstructured (Fig. 3), containing only a short region of alpha helix while other structured regions of ING1a encoding the PHD, LID and PBR are relatively unchanged.

Fig. 2.

Fig. 2

Fig. 2

Fig. 2

Fig. 2

Fig. 2

ING1a phylogeny. The ING1a isoform is found exclusively in Homo sapiens and closely related species. A Phylogenetic trees were generated for ING1 to ING5. All ING sequences were obtained from the NCBI protein database using PSI-BLAST. Sequences were then aligned using the software MUSCLE and trimAL was used to delete regions with too many gaps. The phylogenetic tree was generated and visualized using phyloT and Interactive Tree of Life (iTOL), respectively. Note: An ING4/5 ring is present to visualize the evolution of the precursor protein from which the two individual members, ING4 and ING5, evolved. B Phylogenetic trees were generated for ING1 to ING5 as in Fig. 1A but are plotted to highlight the divergence of ING4 and ING5 and recent emergence of ING1a. All ING sequences were obtained from the NCBI protein database using PSI-BLAST. Sequences were then aligned using the software MUSCLE and trimAL was used to delete regions with too many gaps. A maximum-likelihood phylogenetic tree with bootstrap support was then created using the PhyML program. C Multiple sequence alignment of loci encoding ING1 show that ING1a is conserved in Homo sapiens and the closely related primates Pan paniscus, Gorilla gorilla, Pongo abelii, and Mandrillus leucophaeus. Most primates have an ACG in place of the ATG start codon of the ING1a exon. A common species tree from http://www.ncbi.nlm.nih.gov/Taxonomy/CommonTree/www.cmt.cgi was populated with primate species. Genomic sequences corresponding to the ING1a locus were aligned using MAFFT (Multiple Alignment using Fast Fourier Transform). D Multiple sequence alignment of loci encoding ING1 show that ING1a is well conserved between Homo sapiens and the closely related primate Gorilla gorilla. Sequences corresponding to some of the 188 amino acid human and gorilla SAD are also found in Pongo abelii where it is 159 amino acids, in Pan troglodytes and Pan paniscus where it is 45 amino acids and in Mandrillus leucophaeus where it is 49 amino acids. Multiple alignment for primate ING1a amino acid sequences was generated by MUSCLE. Blosum62 quality score was calculated in Jalview. E Sequence alignment of ING1a between Homo sapiens and Macaca mulatta. Although not as closely related to Homo sapiens ING1a as Gorilla gorilla or Pongo abelii, Macaca mulatta nonetheless encodes sequence strongly resembling the senescence associated domain of ING1a from amino acid 140–188, similar to the sequence found in Mandrillus leucophaeus where it is 49 amino acids long. Multiple alignment for primate ING1a amino acid sequences was generated by MUSCLE. Blosum62 quality score was calculated in Jalview

Fig. 3.

Fig. 3

Predicted ING1a structure and domains. A AlphaFold 3 protein structure predictions are shown for Homo sapiens (A and B), Pongo abelli (C and D) and Macaca mulatta (E and F). Identified domains of ING1a are shown in panels A and C and E and corresponding predictions of general helical, sheet or unstructured loop regions are shown in panels B and D and F. The human 188 amino acid senescence associated domain (SAD) sequence unique to ING1a begins at the amino terminus and is predicted to be largely unstructured. The plant homeodomain (PHD) form of zinc finger found in the ING proteins that interacts with the histone H3K4Me3 mark of active transcription is the most highly conserved domain of the ING proteins. The lamin interaction domain (LID) is a sequence unique to the ING proteins in the human proteome and binds lamin A with high affinity. The unstructured nuclear localization sequence (NLS) contains two basic nucleolar targeting signals that drive ING1 to nucleoli under conditions of stress. The polybasic region (PBR) at the carboxyl terminus of ING1 binds signaling phospholipids for activation of ING1 as well as serving as a ubiquitin interacting motif through which ING1 stabilizes the TP53 tumor suppressor

ING1a overexpression inhibits cell growth in primate cells

To test the effect of human ING1a on the growth of different cell types, total metabolic activity of cells infected with an ING1a expression construct was measured 48 h after infection with adenovirus expressing GFP or adenovirus expressing ING1a plus GFP, using an Alamar Blue assay as a measure of growth. Compared to adeno-GFP infected cells, normal human Hs68 skin fibroblasts and immortalized U2OS osteosarcoma cells infected with adeno-ING1a-GFP showed a decrease in proliferation as did Macaca mulatta fibroblasts (AGO6249 cells, Fig. 4A). The magnitude of this effect was relatively modest, which may be due to slight growth inhibition by the adeno-GFP construct as well, but the effect was statistically significant and observations are consistent with previous studies examining the effects of ING1a on human cells [17, 24, 25]. However, primary mouse embryo fibroblasts (MEF) were not affected by expression of ING1a. These observations are consistent with the absence of interaction with downstream senescence-inducing machinery in murine cells and with conservation of the senescence-inducing ability of both full- length and truncated ING1a isoforms found in great apes and old-world monkeys, respectively. To test the effect of the ING1a SAD domain in isolation, we transfected cells with ING1a expression constructs containing or lacking this region, tagged with red fluorescent protein (TagRFP). Cells transfected with ING1a-TagRFP showed a significant decrease in the ratio of transfected to total cell number from 16 to 40 h (Fig. 4B) consistent with results from the Alamar Blue assay. Expression of the RFP-tagged SAD domain resulted in further reduction in the numbers of cells being detected at both the 16 and 40 h time points (Fig. 4B and supplementary Figure S1) with lower numbers of cells at 40 h, suggesting a strong and rapid inhibition of growth, consistent with the rapid induction of senescence by ING1a seen previously [17, 24]. When an ING1a construct lacking the SAD (ΔN-ING1a) was compared to an intact ING1a construct, loss of the SAD reduced the ability of the protein to reduce metabolic activity as measured by Alamar Blue assay in a time course experiment (Fig. 4C), consistent with a role for the SAD in inducing senescence. Cell cycle analysis (Supplementary Figure S3) and staining for senscence-associated beta-galactosidase (Supplementary Figure S4) confirmed that the SAD inhibited cell cycle progression and was responsible for inducing beta-galactosidase activity.

Fig. 4.

Fig. 4

ING1a overexpression inhibits cell proliferation in primate cells. A Human foreskin fibroblasts (Hs68), human osteosarcoma cells (U2OS), Macaca mulatta fibroblasts (AG06249) and mouse embryo fibroblast (MEF) cells were grown for 24 h in 96-well plates, then transduced with adenoviral particles overexpressing either ING1a or green fluorescent protein (GFP). 48 h post transduction, each cell type was assessed using an AlamarBlue™ assay, and normalization of fluorescence from AlamarBlue™ in ING1a to GFP overexpression treatments, was used to estimate cell proliferation. Data are from 3 biological replicates with *** indicating p < 0.01 by student’s t test. B) Primary Hs68 fibroblast cells were transfected with RFP, ING1a-RFP, or ING1aΔC-TagRFP using a Lonza-4D Nucleofector™ system and plated in ibidi µ-Slides, then grown for either 16 or 40 h. Cells were then fixed and counterstained with Hoechst 33342, and a total of 27 fields for each transfected construct was taken and quantified. Cell proliferation in the presence of overexpressed protein was estimated by taking the ratio of RFP to Hoechst 33342 in each condition. ** indicates p < 0.05. C) Time course of metabolic activity. Hs68 cells were electroporated using Lonzo kit (VPG-1004) and nucleofector I instrument with empty vector, ING1a-T2A-EGFP, or ΔN-ING1a-T2A-EGFP expression plasmids. Cells were assayed in triplicate at 24, 48, and 72 h timepoints for their metabolic activity as estimated by Alamar Blue assay

ING1a localizes to the nucleus and to the cytoplasm in association with mitochondria

To ask how ING1a, and in particular how the SAD of ING1a might be inhibiting primate cell growth, we examined the subcellular localization of the SAD, full length ING1a and the common region of ING1a and ING1b using Airyscan super-resolution confocal imaging in normal Hs68 fibroblasts. Control TagRFP protein localized diffusely throughout the cell in both nuclear and cytoplasmic locations (Fig. 5A). Full-length ING1a-TagRFP appeared to localize in both nuclear and cytosolic locales but in a punctate pattern (Fig. 5B). ING1a-TagRFP formed small but distinct foci in the cytoplasm that co-localized with mitochondria undergoing fission, but the majority of ING1a localized to nuclei. Expression of full-length ING1a in mouse embryo fibroblasts also gave staining in both the cytoplasm and nucleus with a subset of ING1a colocalizing with mitochondria (Supplementary Figure S2). In contrast, distribution of the ING1aΔC-TagRFP (RFP- tagged SAD) was entirely cytosolic and co-stained with mitochondria as estimated by co- localization with signal from the far red MitoTracker fluorescent dye (Fig. 5A). Unlike ING1b that localizes largely to the nucleus and nucleoli [20], the nuclear fraction of ING1a distributed relatively evenly throughout the nucleoplasm. In contrast, ING1a lacking the SAD (ING1a∆N-RFP) localized exclusively to the nucleus, with significant enrichment in the nucleolus. Despite the mitochondrial localization of the SAD, we found no evidence of a canonical mitochondrial localization sequence in the SAD using iPSORT, MitoProt II or TargetP mitochondrial sorting programs. However, most proteins that are targeted to mitochondria are relatively amphipathic and examination of the SAD with a program to predict hydrophobicity and amphipathicity [36] indicated that the SAD had alternating regions of hydrophobicity and was of an amphipathic nature (Fig. 5C). In addition, examination of the SAD using the MitoFates program [37] confirmed the existence of a matrix metalloprotease cleavage site and TOM20 recognition motifs near the amino terminus of the SAD (Fig. 5D), consistent with mitochondrial targeting.

Fig. 5.

Fig. 5

Fig. 5

The senescence associated domain (SAD) of ING1a targets mitochondria. A Primary Hs68 fibroblasts were transfected with expression constructs encoding TagRFP or TagRFP fused to the carboxyl terminus of full-length ING1a (ING1a-TagRFP), ING1a lacking the conserved carboxyl region of ING1 (ING1aDC-TagRFP) or ING1a lacking the amino terminal SAD sequence (ING1aDN-TagRFP). Cell were grown for 48 h and then fixed and stained with Hoechst 33342 to indicate nuclei and mitotracker to identify mitochondria. RFP fluorescence showing the location of free TagRFP or of TagRFP conjugated to different regions of ING1 are false colored green. B Higher magnification image of a fibroblast expressing full-length ING1a. White arrows identify intact mitochondria (lower cell) or mitochondria undergoing fission (upper cell) and the yellow arrow identifies cytoplasmic ING1a. C Analysis of the ING1a SAD region (amino acids 1–188) indicated an alternating hydrophilic/hydrophobic region as well as a modest degree of amphipathicity. D Output from the independent MitoFates program confirms a region of amphipathicity in the SAD, as well as the presence of a protease cleavage site and TOM20 recognition motifs characteristic of proteins targeted to mitochondria

Discussion

Phylogenetic analysis of the ING family of genes has shown that the precursor of the ING4 and ING5 genes is the most ancient of the ING family, being seen in algae, diatoms and amoebas among others, while fruit flies and all the vertebrates examined duplicated this gene into separate ING4 and ING5 sequences (Fig. 2A and B) [40]. Indeed, vertebrates encode five different ING genes (ING1-5), with most encoding several isoforms [14]. In humans, we and others have identified four possible ING1 isoforms [14, 26] with the ING1a and ING1b protein variants being expressed in many cell types but the two shorter potential isoforms encoded by ING1c and ING1d have not been detected in cells under normal conditions. One exception to this is when ING1b is massively overexpressed it is possible to detect the ING1c isoform that results from initiation from an internal ATG codon. When we undertook an in silico analysis of the ING1 gene we noted that while most organisms had a variant encoding an ING1b protein, sequences corresponding to the human ING1a variant were only found in primates, with gorillas having a nearly identical sequence (Fig. 2C and D), orangutans having a slightly shorter sequence, and chimpanzees, macaques and mandrills having even shorter versions of ING1a. Other mammals do not appear to have any form of ING1a despite having well conserved versions of ING1b. This begs the question of what function the ING1a protein exerts in higher primates, especially since our limited functional data suggests that human ING1a is expressed at higher levels in cells undergoing normal and premature senescence (Fig. 1C and E) and that ectopic overexpression of ING1a inhibits the growth of normal and transformed human cells as well as macaque fibroblasts but has little or no effect on the growth of mouse embryo fibroblasts (Fig. 4A).

The expression of ING1a occurs as human fibroblasts approach a state of replicative senescence [17, 41] and expression can also be induced by oxidative stress-induced senescence [25]. The results of this study and previous reports noting that ING1a blocks cell growth and induces senescence via the p16/Rb pathway suggest that expression of the recently evolved SAD of ING1a blocks cell growth and induces senescence, largely through altering transcription [25] and by effects at the mitochondria. A mitochondrial role is consistent with the ability of Rb to localize to and affect mitochondrial permeability [38] and with studies in yeast where mitochondria interacting with the epigenetic landscape enforce two different forms of cell aging dependent upon chromatin silencing and mitochondrial pathways [39]. It is also consistent with previous studies showing that ING1 [42] and the closely related ING2 [43] proteins co-localize with mitochondria to regulate apoptosis and metabolic homeostasis, respectively. This ability of ING1a to inhibit growth appears to be related to the presence of the SAD (Figs. 3C, 4B, and S3, S4) and correlates with the SAD localizing to mitochondria (Fig. 5). Although the SAD does not contain any sequences strongly resembling mitochondrial targeting sequences (MTSs) according to some MTS detection programs, proteins targeted to mitochondria generally show some degree of amphipathicity and have alternating hydrophobic and hydrophilic regions, as well as protease sites that facilitate mitochondrial import upon cleavage of an import sequence [44]. Examination of the SAD by an on-line amphipathicity prediction program [36] showed that the SAD did have some characteristics of a protein imported to mitochondria while an independent prediction program (MitoFates [37],) identified a region of amphipathicity, as well as a protease cleavage site and candidate TOM20 recognition motifs frequently found in proteins imported into mitochondria.

Conclusions

The observations made in this study suggest that the ING1a protein that is induced during senescence may have functions at the mitochondria that contribute to the inhibition of cell growth and the induction of senescence, by affecting mitochondrial energy generation as previously reported for the ING2 protein [43].

Supplementary Information

Below is the link to the electronic supplementary material.

Acknowledgements

We thank the Arnie Charbonneau Cancer Institute's Microscopy Facility for use of equipment and Arthur Dantas for thoughtful discussion.

Abbreviations

ATM

Ataxia telangiectasia mutated kinase

CMV

CytoMegalovirus

EBI

European bioinformatics institute

GFP

Green fluorescent protein

HAT

Histone acetyl-transferase

HDAC

Histone de-acetylase

HDF

Human diploid fibroblast

H3K9me3

Histone 3 lysine 9 methyl 3

HP1γ

Heterochromatin protein 1 homologue-γ

ING1a

Inhibitor of growth 1a

LID

Lamin-interacting domain

MEFs

Mouse embryo fibroblasts

MEM

Minimal essential medium

NCBI

National centre for biotechnology information

NLS

Nuclear localization signal

NTS

Nucleolar targeting sequences

PBR

Poly basic region

PCR

Polymerase chain reaction

PHD

Plant homeo domain

PIP

PCNA-interacting-protein domain

RFP

Red fluorescent protein

Rb

Retinoblastoma

SAD

Senescence associated domain

SAHF

Senescence-associated heterochromatic foci

TOM20

Translocase of outer mitochondrial membrane 20

TRF2

Telomere repeat-binding factor 2

Author contributions

JB and JdK undertook the initial in silico analyses of ING1a evolution and RT-PCR analyses, GL updated and integrated ING1a data and data graphing, MD undertook western blotting, cell cycle analysis and SA-BGal assays, KH carried out the flow cytometry for the cell-cycle analysis and the RFP-intensity comparisons, YR confirmed ING1 protein effects on mitochondrial integrity by immunofluorescence, JD helped with tissue culture, HH generated constructs, nucleofected and imaged the cells for performing viability assays, YY coordinated cell based assays and maintained cell stocks, JdK assisted with evolutionary bioinformatics analysis, KR secured funding, conceived the experiments and edited the manuscript, AH undertook ING1a growth and reporter assays and GL and AH updated in silico bioinformatics analyses and helped perform final editing of the manuscript before submission.

Funding

Canadian Institutes of Health Research,PJT-178099,Karl Riabowol.

Data availability

Tables of genes whose abundance was affected positively or negatively by ectopic expression of ING1a in normal primary Hs68 fibroblasts are available as supplementary Tables 1 & 2 upon request from KR (karl@ucalgary.ca).

Declarations

This study was supported by grants to KR from the Alberta Children's Hospital Research Institute and the Canadian Institutes of Health Research (project grant PJT-178099). The authors have no relevant financial or non-financial interests to disclose.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Jessica Bertschmann and Grace Liu contributed equally to this work.

Contributor Information

Karl Riabowol, Email: karl@ucalgary.ca.

Alexander Hill, Email: alexander.hill@ucalgary.ca.

References

  • 1.Harley CB, Futcher AB, Greider CW (1990) Telomeres shorten during ageing of human fibroblasts. Nature 345(6274):458–460. 10.1038/345458a0 [DOI] [PubMed] [Google Scholar]
  • 2.Watson JD (1972) Origin of concatemeric T7 DNA. Nat New Biol 239(94):197–201. 10.1038/newbio239197a0 [DOI] [PubMed] [Google Scholar]
  • 3.Olovnikov AM (1973) A theory of marginotomy. The incomplete copying of template margin in enzymic synthesis of polynucleotides and biological significance of the phenomenon. J Theor Biol 41(1):181–90. 10.1016/0022-5193(73)90198-7 [DOI] [PubMed] [Google Scholar]
  • 4.Adam N, Yang Y, Djamshidi M, Seifan S, Ting NSY, Glover J, Touret N, Gordon PMK, Warriyar V, Krowicki H, Garcia CK, Savage SA, Goodarzi AA, Baird DM, Beattie TL, Riabowol K (2025) HTERT increases TRF2 to induce telomere compaction and extend cell replicative lifespan. Aging Cell May 15:e70105. 10.1111/acel.70105 [DOI] [PMC free article] [PubMed]
  • 5.Hayflick L, Moorhead PS (1961) The serial cultivation of human diploid cell strains. Exp Cell Res 25:585–621. 10.1016/0014-4827(61)90192-6 [DOI] [PubMed] [Google Scholar]
  • 6.Atadja P, Wong H, Garkavtsev I, Veillette C, Riabowol K (1995) Increased activity of p53 in senescing fibroblasts. Proc Natl Acad Sci USA 92(18):8348–8352. 10.1073/pnas.92.18.8348 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Vaziri H, West MD, Allsopp RC, Davison TS, Wu YS, Arrowsmith CH, Poirier GG, Benchimol S (1997) ATM-dependent telomere loss in aging human diploid fibroblasts and DNA damage lead to the post-translational activation of p53 protein involving poly(ADP-ribose) polymerase. EMBO J 16(19):6018–6033. 10.1093/emboj/16.19.6018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Baker DJ, Wijshake T, Tchkonia T, LeBrasseur NK, Childs BG, van de Sluis B, Kirkland JL, van Deursen JM (2011) Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature 479(7372):232–236. 10.1038/nature10600 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Ogrodnik M, Carlos Acosta J, Adams PD, di d’Adda Fagagna F, Baker DJ, Bishop CL, Chandra T, Collado M, Gil J, Gorgoulis V, Gruber F, Hara E, Jansen-Dürr P, Jurk D, Khosla S, Kirkland JL, Krizhanovsky V, Minamino T, Niedernhofer LJ, Passos JF, Ring NAR, Redl H, Robbins PD, Rodier F, Scharffetter-Kochanek K, Sedivy JM, Sikora E, Witwer K, von Zglinicki T, Yun MH, Grillari J, Demaria M (2024) Guidelines for minimal information on cellular senescence experimentation in vivo. Cell 187(16):4150–4175. 10.1016/j.cell.2024.05.059 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Zhu Y, Tchkonia T, Pirtskhalava T, Gower AC, Ding H, Giorgadze N, Palmer AK, Ikeno Y, Hubbard GB, Lenburg M, O’Hara SP, LaRusso NF, Miller JD, Roos CM, Verzosa GC, LeBrasseur NK, Wren JD, Farr JN, Khosla S, Stout MB, McGowan SJ, Fuhrmann-Stroissnigg H, Gurkar AU, Zhao J, Colangelo D, Dorronsoro A, Ling YY, Barghouthy AS, Navarro DC, Sano T, Robbins PD, Niedernhofer LJ, Kirkland JL (2015) The achilles’ heel of senescent cells: from transcriptome to senolytic drugs. Aging Cell 14(4):644–658. 10.1111/acel.12344 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Narita M, Nũnez S, Heard E, Narita M, Lin AW, Hearn SA, Spector DL, Hannon GJ, Lowe SW (2003) Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell 113(6):703–716. 10.1016/s0092-8674(03)00401-x [DOI] [PubMed] [Google Scholar]
  • 12.Li Y, Jiang Y, Paxman J, O’Laughlin R, Klepin S, Zhu Y, Pillus L, Tsimring LS, Hasty J, Hao N (2020) A programmable fate decision landscape underlies single-cell aging in yeast. Science 69(6501):325–329. 10.1126/science.aax9552 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Sullivan DI, Bello FM, Silva AG, Redding KM, Giordano L, Hinchie AM, Loughridge KE, Mora AL, Königshoff M, Kaufman BA, Jurczak MJ, Alder JK (2023) Intact mitochondrial function in the setting of telomere-induced senescence. Aging Cell 22(10):e13941. 10.1111/acel.13941 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.He GH, Helbing CC, Wagner MJ, Sensen CW, Riabowol K (2005) Phylogenetic analysis of the ING family of PHD finger proteins. Mol Biol Evol 22(1):104–116. 10.1093/molbev/msh256 [DOI] [PubMed] [Google Scholar]
  • 15.Doyon Y, Cayrou C, Ullah M, Landry AJ, Côté V, Selleck W, Lane WS, Tan S, Yang XJ, Côté J (2006) ING tumor suppressor proteins are critical regulators of chromatin acetylation required for genome expression and perpetuation. Mol Cell 21(1):51–64. 10.1016/j.molcel.2005.12.007 [DOI] [PubMed] [Google Scholar]
  • 16.Peña PV, Davrazou F, Shi X, Walter KL, Verkhusha VV, Gozani O, Zhao R, Kutateladze TG (2006) Molecular mechanism of histone H3K4me3 recognition by plant homeodomain of ING2. Nature 442(7098):100–103. 10.1038/nature04814 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Soliman MA, Berardi P, Pastyryeva S, Bonnefin P, Feng X, Colina A, Young D, Riabowol K (2008) ING1a expression increases during replicative senescence and induces a senescent phenotype. Aging Cell 7(6):783–794. 10.1111/j.1474-9726.2008.00427.x [DOI] [PubMed] [Google Scholar]
  • 18.Han X, Feng X, Rattner JB, Smith H, Bose P, Suzuki K, Soliman MA, Scott MS, Burke BE, Riabowol K (2008) Tethering by lamin A stabilizes and targets the ING1 tumour suppressor. Nat Cell Biol 10(11):1333–1340. 10.1038/ncb1792 [DOI] [PubMed] [Google Scholar]
  • 19.Eriksson M, Brown WT, Gordon LB, Glynn MW, Singer J, Scott L, Erdos MR, Robbins CM, Moses TY, Berglund P, Dutra A, Pak E, Durkin S, Csoka AB, Boehnke M, Glover TW, Collins FS (2003) Recurrent de novo point mutations in lamin A cause Hutchinson-Gilford progeria syndrome. Nature 423(6937):293–298. 10.1038/nature01629 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Scott M, Boisvert FM, Vieyra D, Johnston RN, Bazett-Jones DP, Riabowol K (2001) UV induces nucleolar translocation of ING1 through two distinct nucleolar targeting sequences. Nucleic Acids Res 29(10):2052–2058. 10.1093/nar/29.10.2052 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Rajarajacholan UK, Thalappilly S, Riabowol K (2017) ING1 regulates rRNA levels by altering nucleolar chromatin structure and mTOR localization. Nucleic Acids Res 45(4):1776–1792. 10.1093/nar/gkw1161 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Trinh DA, Shirakawa R, Kimura T, Sakata N, Goto K, Horiuchi H (2019) Inhibitor of growth 4 (ING4) is a positive regulator of rRNA synthesis. Sci Rep 9(1):17235. 10.1038/s41598-019-53767-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Li N, Zhao G, Chen T, Xue L, Ma L, Niu J, Tong T (2012) Nucleolar protein CSIG is required for p33ING1 function in UV-induced apoptosis. Cell Death Dis 3(3):e283. 10.1038/cddis.2012.22 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Rajarajacholan UK, Riabowol K (2015) Aging with ING: a comparative study of different forms of stress induced premature senescence. Oncotarget 6(33):34118–34127. 10.18632/oncotarget.5947 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Rajarajacholan UK, Thalappilly S, Riabowol K (2013) The ING1a tumor suppressor regulates endocytosis to induce cellular senescence via the Rb-E2F pathway. PLoS Biol 11(3):e1001502. 10.1371/journal.pbio.1001502 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Melekhova A, Baniahmad A (2021) ING tumour suppressors and ING splice variants as coregulators of the androgen receptor signalling in prostate cancer. Cells 10(10):2599. 10.3390/cells10102599 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Helbing CC, Veillette C, Riabowol K, Johnston RN, Garkavtsev I (1997) A novel candidate tumor suppressor, ING1, is involved in the regulation of apoptosis. Cancer Res 57(7):1255–1258 [PubMed] [Google Scholar]
  • 28.Vieyra D, Toyama T, Hara Y, Boland D, Johnston R, Riabowol K (2002) ING1 isoforms differentially affect apoptosis in a cell age-dependent manner. Cancer Res 62(15):4445–4452 [PubMed] [Google Scholar]
  • 29.Li N, Li Q, Cao X, Zhao G, Xue L, Tong T (2011) The tumor suppressor p33ING1b upregulates p16INK4a expression and induces cellular senescence. FEBS Lett 585(19):3106–3112. 10.1016/j.febslet.2011.08.044 [DOI] [PubMed] [Google Scholar]
  • 30.Esmaeili M, Jennek S, Ludwig S, Klitzsch A, Kraft F, Melle C, Baniahmad A (2016) The tumor suppressor ING1b is a novel corepressor for the androgen receptor and induces cellular senescence in prostate cancer cells. J Mol Cell Biol 8(3):207–220. 10.1093/jmcb/mjw007 [DOI] [PubMed] [Google Scholar]
  • 31.Guérillon C, Larrieu D, Pedeux R (2013) ING1 and ING2: multifaceted tumor suppressor genes. Cell Mol Life Sci 70(20):3753–3772. 10.1007/s00018-013-1270-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Katoh K, Standley DM (2013) Mafft multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol 30(4):772–780. 10.1093/molbev/mst010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Scott M, Bonnefin P, Vieyra D, Boisvert FM, Young D, Bazett-Jones DP, Riabowol K (2001) UV-induced binding of ING1 to PCNA regulates the induction of apoptosis. J Cell Sci 114(Pt 19):3455–3462. 10.1242/jcs.114.19.3455 [DOI] [PubMed] [Google Scholar]
  • 34.Ivanov IP, Firth AE, Michel AM, Atkins JF, Baranov PV (2011) Identification of evolutionarily conserved non-AUG-initiated N-terminal extensions in human coding sequences. Nucleic Acids Res 39(10):4220–4234. 10.1093/nar/gkr007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Varadi M, Bertoni D, Magana P, Paramval U, Pidruchna I, Radhakrishnan M, Tsenkov M, Nair S, Mirdita M, Yeo J, Kovalevskiy O, Tunyasuvunakool K, Laydon A, Žídek A, Tomlinson H, Hariharan D, Abrahamson J, Green T, Jumper J, Birney E, Steinegger M, Hassabis D, Velankar S (2024) Alphafold protein structure database in 2024: providing structure coverage for over 214 million protein sequences. Nucleic Acids Res 52(D1):D368–D375. 10.1093/nar/gkad1011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Zhai Y, Saier MH Jr (2001) A web-based program (WHAT) for the simultaneous prediction of hydropathy, amphipathicity, secondary structure and transmembrane topology for a single protein sequence. J Mol Microbiol Biotechnol 3(4):501–502 [PubMed] [Google Scholar]
  • 37.Fukasawa Y, Tsuji J, Fu SC, Tomii K, Horton P, Imai K (2015) Mitofates: improved prediction of mitochondrial targeting sequences and their cleavage sites. Mol Cell Proteomics 14(4):1113–1126. 10.1074/mcp.M114.043083 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Hilgendorf KI, Leshchiner ES, Nedelcu S, Maynard MA, Calo E, Ianari A, Walensky LD, Lees JA (2013) The retinoblastoma protein induces apoptosis directly at the mitochondria. Genes Dev 27(9):1003–1015. 10.1101/gad.211326.112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Li Y, Jiang Y, Paxman J, O’Laughlin R, Klepin S, Zhu Y, Pillus L, Tsimring LS, Hasty J, Hao N (2020) A programmable fate decision landscape underlies single-cell aging in yeast. Science 369(6501):325–329. 10.1126/science.aax9552 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Després PC, Dubé AK, Picard MÈ, Grenier J, Shi R, Landry CR (2024) Compensatory mutations potentiate constructive neutral evolution by gene duplication. Science 385(6710):770–775. 10.1126/science.ado5719 [DOI] [PubMed] [Google Scholar]
  • 41.Bertschmann J, Thalappilly S, Riabowol K (2019) The ING1a model of rapid cell senescence. Mech Ageing Dev 177:109–117. 10.1016/j.mad.2018.06.004 [DOI] [PubMed] [Google Scholar]
  • 42.Bose P, Thakur S, Thalappilly S, Ahn BY, Satpathy S, Feng X, Suzuki K, Kim SW, Riabowol K (2013) ING1 induces apoptosis through direct effects at the mitochondria. Cell Death Dis 4(9):e788. 10.1038/cddis.2013.321 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Ricordel C, Chaillot L, Blondel A, Archambeau J, Jouan F, Mouche A, Tiercin M, Burel A, Lena H, Desrues B, Guillaudeux T, Pedeux R (2021) Ing2 tumor suppressive protein translocates into mitochondria and is involved in cellular metabolism homeostasis. Oncogene 40(24):4111–4123. 10.1038/s41388-021-01832-3 [DOI] [PubMed] [Google Scholar]
  • 44.Needs HI, Glover E, Pereira GC, Witt A, Hübner W, Dodding MP, Henley JM, Collinson I (2024) Rescue of mitochondrial import failure by intercellular organellar transfer. Nat Commun 15(1):988. 10.1038/s41467-024-45283-2 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

Tables of genes whose abundance was affected positively or negatively by ectopic expression of ING1a in normal primary Hs68 fibroblasts are available as supplementary Tables 1 & 2 upon request from KR (karl@ucalgary.ca).


Articles from Cellular and Molecular Life Sciences: CMLS are provided here courtesy of Springer

RESOURCES