Skip to main content
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2025 Oct 11;67(1):424–436. doi: 10.1111/epi.18649

Nanoparticle‐encapsulated neuropeptide Y provides robust seizure protection in SCN1A‐derived epilepsy

Samantha L Reed 1, Lauren M Aiani 1, Eesha Faiz 1, Emmanuel Adediran 2, Morris Benveniste 3, Kevin S Murnane 4,5,6, Martin D'Souza 2, Andrew Escayg 1,, Jennifer C Wong 1,7
PMCID: PMC12893274  PMID: 41074603

Abstract

Objective

Neuropeptides have garnered great interest as potential treatments for epilepsy due to their impact on neuronal excitability through modulation of ion channels and neurotransmitter receptor activity. Neuropeptide Y (NPY) is a 36‐amino acid neuropeptide that is expressed primarily by γ‐aminobutyric acidergic (GABAergic) interneurons. NPY has widespread effects on the brain, at both the cellular (e.g., reducing excitatory glutamatergic transmission) and circuit levels (e.g., increasing food intake, improving learning and memory, increasing seizure resistance). Previous studies have demonstrated antiseizure effects of NPY following invasive brain delivery methods or gene therapy approaches to increase the expression of NPY or its receptor activity. However, these routes of administration pose challenges for translation into clinical practice.

Methods

To overcome these obstacles, we generated a nanoparticle formulation to encapsulate neuropeptides. In the current study, we evaluated the ability of nanoparticle‐encapsulated NPY (NP‐NPY) to increase resistance to 6 Hz‐, pentylenetetrazole‐, and hyperthermia‐induced seizures in mouse models of SCN1A‐derived epilepsy. We also examined the ability of NP‐NPY treatment to protect against spontaneous seizures in Scn1a +/− mutant mice, a model of Dravet syndrome. Quantitative reverse transcription polymerase chain reaction was performed to compare expression levels of NPY and its receptors in hippocampi from Scn1a +/− mutants and wild‐type littermates.

Results

We found that intranasal NP‐NPY administration was able to provide robust protection against induced seizures in two mouse models of SCN1A‐derived epilepsy and reduce spontaneous seizure frequency in Scn1a +/− mutant mice.

Significance

These results provide support for further evaluation of NP‐NPY as a treatment for SCN1A‐derived epilepsy and possibly other epilepsy subtypes.

Keywords: Dravet syndrome, epilepsy, nanoparticle, neuropeptide Y, SCN1A


Key points.

  • NP‐NPY was able to increase resistance against induced seizures in two models of SCN1A‐derived epilepsy.

  • NP‐NPY was able to increase resistance against hyperthermia‐induced seizures in female but not male Scn1a +/− mutants.

  • NP‐NPY was able to reduce spontaneous seizure frequency by 65% in Scn1a +/− mutants.

1. INTRODUCTION

Epilepsy, characterized by recurrent spontaneous seizures, is one of the most common neurological disorders. Individuals with epilepsy present with focal or generalized seizure types and may also display behavioral comorbidities that can include cognitive and social deficits. Advances in sequencing technology have led to the discovery of many epilepsy genes, highlighting the important contribution of genetics to the etiology of epilepsy. 1 , 2 , 3 , 4

Mutations in the voltage‐gated sodium channel SCN1A, encoding Nav1.1, underlie a number of epilepsy subtypes, including Dravet syndrome (DS) and genetic epilepsy with febrile seizures plus (GEFS+). DS is a severe, treatment‐resistant disorder characterized by early‐life febrile seizures and the subsequent development of multiple seizure types, including atypical absence, focal, and generalized tonic–clonic seizures. 5 , 6 Patients with DS often exhibit intellectual disability, social deficits, and a number of other behavioral challenges. 7 GEFS+ is an inherited disorder that is characterized by febrile seizures that persist beyond 6 years of age and epilepsy in adulthood. 8 Seizure control and the amelioration of nonseizure clinical features in patients with SCN1A mutations are often inadequate with available antiseizure medications, underscoring the need to develop more efficacious treatments. Scn1a mouse models recapitulate key disease features including increased susceptibility to hyperthermia‐induced seizures, spontaneous seizures, and behavioral abnormalities, 9 , 10 , 11 and provide a valuable tool for treatment development. 12 , 13 , 14 , 15 , 16

Neuropeptides, including neuropeptide Y (NPY), galanin, somatostatin, and oxytocin have garnered interest as potential treatments for epilepsy due to their ability to alter neuronal excitability through modulation of ion channels and neurotransmitter receptor activity. 17 , 18 , 19 , 20 , 21 NPY is a 36‐amino acid neuropeptide that is primarily released by γ‐aminobutyric acidergic (GABAergic) interneurons. 21 , 22 NPY has widespread effects on the brain, at both the cellular (e.g., reducing excitatory glutamatergic transmission) and circuit levels (e.g., increasing food intake, improving learning and memory, and increasing seizure resistance). 21 , 23 , 24

Intracerebroventricular (ICV) administration of NPY in rodent models suppresses epileptiform activity following electrical stimulation of the hippocampus, 25 decreases susceptibility to pentylenetetrazole (PTZ)‐induced seizures, 26 and reduces the severity of kainic acid (KA)‐induced seizures. 27 , 28 In contrast, constitutive NPY knockout mice exhibit increased susceptibility to PTZ‐induced seizures 29 and increased mortality following administration of the proconvulsant KA. 30 There is also evidence that NPY can reduce spontaneous seizure frequency. For example, ICV administration of NPY significantly reduced the frequency of absence seizures in the Genetic Absence Epilepsy Rat From Strasbourg (GAERS). 31 , 32 Furthermore, increasing hippocampal NPY levels using adeno‐associated viral vectors (AAVs) in rat models of temporal lobe epilepsy resulted in a 40%–75% reduction in seizure frequency. 33 , 34 In a study performed on resected tissue from patients with temporal lobe epilepsy, Wickham et al., found that NPY application significantly inhibited epileptiform activity in the dentate gyrus, increased the interspike interval, and significantly reduced the number of action potentials. 35 Together, these studies provide evidence that increasing brain NPY expression or levels produces antiseizure effects.

In addition to its antiseizure effects, NPY administration has been shown to reduce apoptosis after KA administration in cultured neurons 36 and rodent models. 37 , 38 Furthermore, NPY modulates immune cell function by reducing microglia activation and the release of inflammatory cytokines such as IL‐1β in vitro. 39 , 40 In rodent models, ICV administration of NPY has been shown to decrease anxiety‐like behavior in behavioral paradigms such as the elevated‐plus maze, light–dark box, and Vogel conflict test and depressive‐like behavior in the forced swim test. 41 , 42 , 43 , 44 Thus, NPY could be efficacious in treating anxiety and depression, which are often comorbid with epilepsy. 45

Although the antiseizure effects of NPY have been achieved by intracerebral administration 25 , 27 and gene therapy strategies that increase the expression of NPY or its receptors, 34 , 46 , 47 , 48 these approaches are invasive and pose challenges for translation into clinical practice. Intranasal administration of NPY provides an alternative, less invasive, route of administration and has been shown to attenuate symptoms of posttraumatic stress disorder (PTSD) in rodent models. 49 , 50 However, intranasal administration of free NPY might provide limited clinical benefit due to its short half‐life (<20 min in human plasma) and poor brain penetrance. 51 , 52 To overcome these obstacles, we developed a nanoparticle‐based system to encapsulate and deliver neuropeptides. 14 , 53 , 54 Other groups have used metal‐based nanoparticles to increase the brain penetrance of neuropeptides. 55 However, peptide carriers, due to their natural amino acid composition, offer several advantages over metal‐based systems, including lower immunogenicity and toxicity and increased biocompatibility and biodegradability. 55 , 56 , 57 We also previously demonstrated that our nanoparticle formulation does not result in an inflammatory response or motor toxicity following repeated intranasal administration. 14 In the current study, we encapsulated NPY in peptide‐based nanoparticles (NP‐NPY) and evaluated the ability of NP‐NPY to increase seizure resistance in two mouse models of Scn1a‐derived epilepsy.

2. MATERIALS AND METHODS

2.1. Animals

CF1 mice (strain: 023, Charles River) were used to generate dose–response curves using the 6 Hz seizure induction paradigm. Heterozygous mice expressing the human SCN1A R1648H mutation (RH/+) 11 were maintained by backcrossing to C57BL/6J (strain: 000664, Jackson Laboratories). Heterozygous Scn1a knockout mice (Scn1a +/−, strain: 037107‐JAX, MMRRC) were maintained on the 129 background (strain: 129S6/EvTac, Taconic), and experimental mice were generated by crossing Scn1a +/− mice to C57BL/6J. Adult (2‐4 months) male CF1 mice, RH/+ mutants, Scn1a +/− mutants, and respective wild‐type (WT) littermates were used to evaluate the effect of NP‐NPY administration on 6 Hz‐ and PTZ‐induced seizures. The effect of NP‐NPY on hyperthermia‐induced seizures was evaluated in male and female Scn1a +/− mutants and WT littermates at postnatal days 22–23 (P22–P23). The effect of NP‐NPY on spontaneous seizure frequency was evaluated in P20–P21 male and female Scn1a +/− mutants that had been subjected to rapid hyperthermia priming as previously described. 16 For quantitative reverse transcription polymerase chain reaction (qRT‐PCR) analysis, male and female Scn1a +/− mutants (P20–P21) were subjected to the rapid hyperthermia priming, 16 and 24 h later, hippocampi were isolated from the primed mice and sex‐ and age‐matched naïve Scn1a +/− and WT littermates. Mice were housed on a 12‐h light/dark cycle with food and water available ad libitum. All experiments were performed in accordance with the guidelines of the Institutional Animal Care and Use Committee of Emory University.

2.2. Generation and characterization of NP‐NPY

Full‐length NPY (Genscript) or a cleaved version of NPY (CNPY; Genscript) were encapsulated in polymeric bovine serum albumin (BSA) nanoparticles as previously described. 14 , 53 , 54 A 50 μL aliquot of the nanoparticle suspension was diluted with 1.5 mL distilled water, and particle size and zeta potential were measured using a Malvern Zetasizer (Malvern Instruments). Rabies virus glycoprotein (RVG) was conjugated to the surface of the BSA nanoparticles as demonstrated by Fourier transform infrared (FTIR) spectroscopy (Figure 1). The FTIR spectra were recorded using an IRAffinity‐1S spectrometer (Shimadzu Corporation).

FIGURE 1.

FIGURE 1

FTIR spectrum data of brain‐targeting ligand rabies virus glycoprotein (RVG) conjugated to nanoparticles. RVG spectra show two main peaks that are linked with amide I and amide II vibrations at 1650 cm−1 and 1540 cm−1, respectively. The amide vibrations indicated the conjugation of RVG to bovine serum albumin (BSA) was successful.

2.3. Administration of NPY

NP‐NPY or NP‐CNPY was prepared as a suspension at a concentration of 50 μg/50 μL vehicle (10% Tween 80 in 0.9% sterile saline). Free unencapsulated NPY was also prepared at a concentration of 50 μg/50 μL vehicle. Empty nanoparticles, free unencapsulated NPY, NP‐NPY, and NP‐CNPY were administered intranasally as previously described. 14

2.4. Seizure induction

2.4.1.  6 Hz‐induced seizures

CF1 mice as well as RH/+ mutants and Scn1a +/− mutants and their respective WT littermates were subjected to 6 Hz seizure induction as previously described. 12 , 13 , 58 , 59 , 60 , 61 , 62 , 63 , 64 , 65 A topical anesthetic (0.5% proparacaine hydrochloride ophthalmic solution, MedVet) was applied to the cornea, and mice were manually restrained and subjected to corneal stimulation at 20–44 mA (ECT Unit 57 800, Ugo Basile). The resulting behavioral seizures were scored on a modified Racine scale: RS0, no abnormal behavior; RS1, immobile for >3 s; RS2, rearing, forelimb clonus, head bobbing; and RS3, generalized tonic–clonic seizure (GTCS) with loss of posture. Susceptibility to 6 Hz‐induced seizures was examined 2 or 4 h after intranasal administration.

2.4.2. PTZ‐induced seizures

CF1 mice as well as RH/+ mutants and Scn1a +/− mutants and their respective WT littermates were subjected to PTZ‐induced seizures as previously described. 12 , 13 , 14 , 61 , 62 , 64 Mice were administered PTZ subcutaneously (85–115 mg/kg) and observed for 30 min. The latencies to the first myoclonic jerk and GTCS were recorded. Susceptibility to PTZ‐induced seizures was examined 2 h after intranasal administration.

2.4.3. Hyperthermia‐induced seizures

Scn1a +/− mutants and WT littermates (P22–P23) were subjected to hyperthermia‐induced seizures as previously described. 12 , 13 , 14 , 64 The core body temperature of each mouse was maintained at 37.5°C for 10 min and then increased by 0.5°C every 2 min until a GTCS was observed or a core body temperature of 42.5°C was reached. The body temperature at which the mouse exhibited a GTCS was recorded. Susceptibility to hyperthermia‐induced seizures was examined 2 h after intranasal NP‐NPY administration.

2.4.4. Spontaneous seizures

To increase the frequency of spontaneous seizures, Scn1a +/− mutants and WT littermates (P20–P21) were subjected to hyperthermia priming as previously described. 16 Two hours after priming, mice were intranasally administered the first dose of either NP‐NPY (30 μg NPY) or empty nanoparticles and placed into clear acrylic chambers (either in pairs or trios). The next day (approximately 18 h after the first dose), we began intranasal administration of either NP‐NPY or empty nanoparticles at 10:00 a.m. and 5:00 p.m. each day, and this treatment was continued for 4 days. Mice were continuously video recorded during this period. The daily number of spontaneous seizures was determined from the recorded video.

2.5. Repeated NP‐NPY administration

To determine whether repeated nanoparticle or NPY administration can cause long‐term changes that alter NP‐NPY‐mediated seizure protection, 2‐month old male CF1 mice were intranasally administered vehicle, empty nanoparticles, or NP‐NPY (150 μg NPY) daily for 4 days. Two weeks after the last treatment, all of the mice were intranasally administered empty nanoparticles or NP‐NPY, and susceptibility to 6 Hz‐induced seizures (22 mA) was examined 2 h later. The cohorts of mice (n = 7–8 mice/group) were as follows (i.e., first treatment:second treatment 2 weeks later): (1) vehicle:empty nanoparticles, (2) vehicle:NP‐NPY, (3) empty nanoparticles:NP‐NPY, and (4) NP‐NPY:NP‐NPY.

2.6. Rotarod

The rotarod was used to evaluate motor coordination in male Scn1a +/− mutants and WT littermates (n = 10–11/group) as previously described. 14 Two hours following intranasal administration of empty nanoparticles or NP‐NPY (50 μg NPY), each mouse was subjected to two 1‐min training trials on a constant slow‐moving rotarod (5 rpm, Ugo Basile). Following the two training trials, the mice were subjected to a test trial on an accelerating rotarod (4–40 rpm over a 5‐min period). The latency to fall off the rotarod was recorded for each mouse.

2.7. Quantitative reverse transcription polymerase chain reaction (qRT‐PCR)

Male and female Scn1a +/− mice (P20–P21) were subjected to hyperthermia priming as previously described. 16 Twenty‐four hours later, hippocampi were isolated from the primed mice as well as from sex‐ and age‐matched naïve Scn1a +/− and WT littermates (n = 8 mice/group). Total RNA was extracted using the Qiagen RNeasy Lipid Tissue Mini Kit (#74804), and cDNA synthesis was conducted using Invitrogen SuperScript III First‐Strand Synthesis System (#18080051) according to the manufacturer's instructions. qRT‐PCR was conducted in triplicate using a BioRad CFX96 Real‐Time PCR Detection System and SYBR Green fluorescent dye (BioRad iQ SYBR Green Supermix) with the following primers: NPY (forward: TCGTGTGTTTGGGCATTCTG, reverse: TGGATCTCTTGCCATATCTCTGT), NPY1R (forward: CGGCCCACTCTGCTTTATATTC, reverse: ATGATCTGGTGGTTCCAGTCG), NPY2R (forward: GACCATTACCATCAGCGAAGG, reverse: ACCTCCGAGTGAATGGCATC), NPY5R (forward: GGAGAAGCACCTAACCGTTC, reverse: GTGACAGATGCAGTACACCAG), and actin (forward: CAGCTTCTTTGCAGCTCCTT, reverse: ACGATGGAGGGGAATACAGC). Each primer pair produced standard curves with 90%–110% efficiency. Cycle threshold values were normalized to actin (ΔCt) and then normalized to the control group (WT) for each sex (ΔΔCt). The ΔΔCt was converted to fold change by using the equation 2(−ΔΔCt).

2.8. Statistical analyses

A Kruskal–Wallis test followed by Dunn's multiple comparisons was used to compare Racine scores following administration of empty nanoparticles and each dose of NP‐NPY for generation of the dose–response curve. The same analyses were also used to compare Racine scores in CF1 mice after treatment with empty nanoparticles, free unencapsulated NPY, and NP‐NPY. A Kruskal–Wallis test followed by Dunn's multiple comparisons was also used to compare Racine scores following administration of empty nanoparticles or NP‐NPY after repeated intranasal administration of vehicle, empty nanoparticles, or NP‐NPY. A Mann–Whitney test was used to compare Racine scores of CF1 mice administered empty nanoparticles and NP‐NPY or NP‐CNPY following 6 Hz seizure induction. A Friedman test was used to compare Racine scores of RH/+ and WT littermates, and Scn1a +/− and WT littermates administered empty nanoparticles and NP‐NPY following 6 Hz seizure induction. A log‐rank Mantel–Cox test was used to compare CF1 mice, RH/+ and WT littermates, and Scn1a +/− and WT littermates administered empty nanoparticles, NP‐NPY, or NP‐CNPY following PTZ administration or acute hyperthermia seizure induction. A repeated two‐way analysis of variance (ANOVA) was used to compare the effect of empty nanoparticles and NP‐NPY on daily spontaneous seizure frequency over the 4‐day observation period. An unpaired Student's t‐test was used to compare the total number of seizures during the 4‐day observation period between Scn1a +/− mutants treated with empty nanoparticles or NP‐NPY. A two‐way ANOVA was used to compare the latency to fall off the rotarod between groups. A one‐way ANOVA followed by Tukey's multiple comparisons test was used to compare the ΔΔCt values of NPY and its receptors.

3. RESULTS

3.1. Particle size and zeta potential of RVG conjugated to BSA nanoparticles

The average sizes (in nm) of the empty nanoparticles and NP‐NPY were 137.0 ± 3.67 and 140.3 ± .45, respectively. The average charges (in mV) of the empty nanoparticles and NP‐NPY were −20.5 ± .49 and −16.0 ± .48, respectively. This high negative charge reflects the ability of the nanoparticles to repel each other and remain in suspension, thereby providing better physical stability.

3.2. NP‐NPY protects against 6 Hz‐ and PTZ‐induced seizures in CF1 mice

We first generated a dose–response curve using the 6 Hz seizure induction paradigm. CF1 mice were intranasally administered empty nanoparticles or NP‐NPY (50–225 μg NPY), and 2 h later, they were subjected to 6 Hz seizure induction at 22 mA. All of the CF1 mice (n = 12) administered empty nanoparticles exhibited an RS2 seizure. NP‐NPY at doses of 100 μg, 150 μg, and 225 μg provided significant seizure protection (Figure 2A). We selected the 150 μg NP‐NPY dose for all subsequent experiments in adult mice. When this dose of NP‐NPY was retested in a separate cohort of CF1 mice, we found that all CF1 mice administered empty nanoparticles or free unencapsulated NPY exhibited an RS2 seizure, whereas five of seven CF1 mice treated with NP‐NPY were protected against 6 Hz seizures (Figure 2B). Given that we observed no seizure protection following intranasal administration of free unencapsulated NPY, we only used empty nanoparticles as the control for all subsequent experiments. We next determined whether NP‐NPY would protect at twice the convulsive current (2xCC; 44 mA). When tested at 2xCC, four of 10 CF1 mice administered NP‐NPY were protected (RS0, Figure 2C). We also tested the ability of NP‐NPY to protect against PTZ‐induced seizures and found that NP‐NPY significantly increased the latency to the first GTCS (Figure 2D). Notably, 20% (2/10) of CF1 mice administered NP‐NPY did not exhibit a PTZ‐induced GTCS during the observation period.

FIGURE 2.

FIGURE 2

Nanoparticle‐encapsulated neuropeptide Y (NP‐NPY) protects against induced seizures in CF1 mice. (A) Dose–response curve generated using the 6 Hz seizure induction paradigm (22 mA). We found that 100 μg, 150 μg, and 225 μg NPY were able to increase seizure resistance in CF1 mice (n = 10–12/group). (B) All mice administered empty nanoparticles or free unencapsulated NPY (150 μg) seized (RS2), whereas five of seven NP‐NPY (150 μg NPY)‐treated CF1 mice were protected against 6 Hz seizures (22 mA). (C) NP‐NPY (150 μg NPY) protected four of 10 mice from 6 Hz‐induced seizures when tested at twice the convulsive current (2xCC; 44 mA; n = 10/group). (D) NP‐NPY (150 μg NPY) was able to increase resistance against pentylenetetrazole (PTZ)‐induced seizures (n = 10/group). (E) Nanoparticle‐encapsulated cleaved version of NPY (NP‐CNPY; 150 μg CNPY) protected two of 10 mice from 6 Hz‐induced seizures when tested at 2xCC (44 mA; n = 9/group). (F) NP‐CNPY (150 μg CNPY) was able to increase resistance against PTZ‐induced seizures (n = 10/group). (G) Repeated NP‐NPY administration does not affect NP‐NPY‐mediated seizure protection. All vehicle:empty‐treated mice (7/7) exhibited an RS2 seizure. All NP‐NPY:NP‐NPY‐treated mice (8/8) were protected against 6 Hz seizures (22 mA). Top row of the x‐axis label indicates the 4‐day repeated treatment; bottom row of the x‐axis label indicates the acute treatment after 2 weeks. n = 7–8/group. *p ≤ .05, **p < .01, ***p < .001, ****p < .0001. GTCS, generalized tonic–clonic seizure.

3.3. NP‐CNPY provides comparable seizure protection

Previous studies have suggested that residues 13–36 of the NPY amino acid sequence preferentially bind to NPY receptors that are involved in seizure protection. 66 , 67 , 68 Therefore, we generated a nanoparticle preparation of cleaved NPY (CNPY) consisting of only amino acids 13‐36 (NP‐CNPY). To compare the relative effectiveness of NP‐NPY and NP‐CNPY, we tested the ability of 150 μg NP‐CNPY to prevent 6 Hz‐induced seizures at 2xCC in CF1 mice (Figure 2E). Compared to NP‐NPY‐treated CF1 mice (Figure 2C), less protection was observed with NP‐CNPY, as only two treated mice received a score of RS0 (Figure 2E). Similar to NP‐NPY, NP‐CNPY (150 μg) also resulted in a significant increase in the latency to the first GTCS following PTZ administration (Figure 2F). Given that we observed slightly greater seizure protection with NP‐NPY treatment, this preparation was used for all subsequent experiments.

3.4. Repeated intranasal NP‐NPY administration does not affect NP‐NPY‐mediated seizure protection 2 weeks after administration

To determine whether repeated intranasal nanoparticle or NP‐NPY administration affects subsequent NP‐NPY‐mediated seizure protection, we administered vehicle, empty nanoparticles, or NP‐NPY to CF1 mice for 4 days. Two weeks later, the mice were acutely administered either empty nanoparticles or NP‐NPY (150 μg NPY) and subjected to 6 Hz seizure induction 2 h later. As expected, we found that all of the mice that received repeated vehicle treatment followed by empty nanoparticle administration exhibited RS2 seizures (Figure 2G). Furthermore, we found that six of seven mice that received repeated vehicle treatment followed by acute administration of NP‐NPY were protected against 6 Hz seizures. Notably, we found that six of seven mice that received repeated empty nanoparticle treatment followed by acute administration of NP‐NPY and all (8/8) mice that received repeated NP‐NPY treatment followed by acute administration of NP‐NPY were protected against 6 Hz seizures (Figure 2G). These observations demonstrate that repeated intranasal administration of nanoparticles or NP‐NPY does not affect subsequent NP‐NPY‐mediated seizure protection.

3.5. NP‐NPY provides robust seizure protection in two Scn1a mouse models

We next examined the ability of NP‐NPY to protect against induced seizures in RH/+ and Scn1a +/− mutants. Significant seizure protection was observed in both Scn1a mutants when 6 Hz seizures were induced 2 h after intranasal NP‐NPY administration (150 μg NPY; Figure 3A,D). When the mice were retested 2 h later (i.e., 4 h after intranasal administration), seizure protection was maintained in the RH/+ mutants (Figure 3B); however, protection was lost in the Scn1a +/− mutants (Figure 3E). We also observed more robust protection against PTZ‐induced seizures in the RH/+ mutants (Figure 3C) compared to Scn1a +/− mutants (Figure 3F). Specifically, 40% (4/10) RH/+ mutants and 70% (7/10) of their WT littermates did not exhibit a PTZ‐induced GTCS during the 30‐min observation period following NP‐NPY treatment (Figure 3C). In contrast, although NP‐NPY treatment was able to significantly increase the latency to the first GTCS following PTZ administration in the Scn1a +/− mutants, all of the mutants and 80% (8/10) of their WT littermates had a GTCS during the observation period (Figure 3F).

FIGURE 3.

FIGURE 3

Nanoparticle‐encapsulated neuropeptide Y (NP‐NPY) protects against induced seizures in two Scn1a mouse models. (A, B) NP‐NPY (150 μg NPY) provided protection against 6 Hz seizures (24 mA) in RH/+ mice at (A) 2 h and (B) 4 h after intranasal administration (n = 9/group). (C) NP‐NPY (150 μg NPY) significantly increased the latency to the first pentylenetetrazole (PTZ)‐induced generalized tonic–clonic seizure (GTCS) in RH/+ mutants and wild‐type (WT) littermates (n = 9–10/group). (D, E) NP‐NPY (150 μg NPY) protected against 6 Hz seizures in Scn1a +/− mutants at (D) 2 h but not (E) 4 h after intranasal administration (n = 7–9/group). (F) NP‐NPY was able to significantly increase resistance to the first PTZ‐induced GTCS in Scn1a +/− mutants and WT littermates (n = 7–10/group). (G) We observed no difference in the temperature at which the first hyperthermia‐induced GTCS occurred when comparing male Scn1a +/− mutants treated with empty nanoparticles and NP‐NPY (30 μg NPY; n = 9–11/group). (H) Female Scn1a +/− mutants treated with NP‐NPY exhibited a significant increase in the temperature at which the first hyperthermia‐induced GTCS occurred, and notably, two of 11 mutants did not exhibit a GTCS (n = 10–11/group). **p < .01, ***p < .001, ****p < .0001.

3.6. NP‐NPY increases resistance to hyperthermia‐induced seizures in female Scn1a +/− mutants

Because febrile seizures are frequently observed in patients with SCN1A mutations, we investigated whether NP‐NPY could protect against hyperthermia‐induced seizures in the Scn1a +/− mutants (P22‐23). Regardless of treatment, we observed no difference in the temperature at which male Scn1a +/− mutants exhibited a GTCS (Figure 3G). In contrast, NP‐NPY treatment resulted in a statistically significant increase in the temperature at which the female Scn1a +/− mutants exhibited a GTCS (Figure 3H). Furthermore, two of 11 NP‐NPY‐treated female Scn1a +/− mutants did not exhibit a GTCS during the testing period.

3.7. NP‐NPY reduces spontaneous seizure frequency in Scn1a +/− mutants

We next evaluated whether NP‐NPY could protect against spontaneous seizures in Scn1a +/− mutants. To increase the frequency of spontaneous seizures, Scn1a +/− mutants (P20–P21) were first subjected to rapid hyperthermia induction (“priming”) as previously described. 16 Mice were administered NP‐NPY (30 μg NPY) or empty nanoparticles 2 h after priming and then twice per day during 4 days of continuous observation. We excluded three mice from our analyses due to mortality during the period of observation; two mice had been treated with empty nanoparticles, and one mouse had received NP‐NPY. We found no difference in seizure frequency between male and female Scn1a +/− mutants; therefore, we combined both sexes for analysis. NP‐NPY treatment resulted in a significant decrease in spontaneous seizure frequency during the 4‐day observation period (Figure 4A). Importantly, NP‐NPY‐treated Scn1a +/− mutants had 65% fewer seizures compared to Scn1a +/− mutants treated with empty nanoparticles (Figure 4B).

FIGURE 4.

FIGURE 4

Nanoparticle‐encapsulated neuropeptide Y (NP‐NPY) reduces spontaneous seizure frequency in Scn1a +/− mutants. (A) Average number of spontaneous seizures recording during 4 days of observation in Scn1a +/− mutants treated with NP‐NPY or empty nanoparticles. (B) NP‐NPY‐treated Scn1a +/− mutants exhibited 65% fewer spontaneous seizures compared to mutants administered empty nanoparticles (n = 17 mice/group). *p ≤ .05.

3.8. NP‐NPY does not alter motor coordination in Scn1a +/− mutants

To determine whether intranasal NP‐NPY administration adversely alters motor coordination, we administered either NP‐NPY (50 μg NPY) or empty nanoparticles to Scn1a +/− mutants and WT littermates. Two hours after intranasal administration, motor coordination was assessed using the rotarod as previously described. 14 Regardless of genotype, we observed no differences in the latency to fall off the accelerating rotarod between mice treated with NP‐NPY or empty nanoparticles (Figure 5), demonstrating that intranasal administration of NP‐NPY does not alter motor coordination in Scn1a +/− mutants or their WT littermates.

FIGURE 5.

FIGURE 5

Nanoparticle‐encapsulated neuropeptide Y (NP‐NPY) does not alter motor coordination in Scn1a +/− mutants or wild‐type (WT) littermates. Regardless of genotype, the latency to fall off an accelerating rotarod was not significantly different between mice treated with empty nanoparticles or NP‐NPY (n = 10–11/group).

3.9. Reduced expression of NPY1R and NPY2R following hyperthermia priming in Scn1a +/− mutants

Because the ability of NP‐NPY to protect Scn1a +/− mutants against hyperthermia‐induced seizures was sex‐dependent, we examined the expression of NPY and its receptors in male and female Scn1a +/− mutant mice. Hippocampi were collected from male and female Scn1a +/− mutants 24 h after hyperthermia priming, as well as age‐ and sex‐matched naïve Scn1a +/− mutants and WT littermates. We did not observe any sex‐specific differences in the expression of NPY and its receptors; therefore, we combined the data from both sexes for further analysis. We found no statistically significant differences in expression of NPY or NPY5R between WT, naïve Scn1a +/− mutants, or primed Scn1a +/− mutants (Figure 6A,D). However, we observed reduced expression of NPY1R in primed Scn1a +/− mutants, when compared to both WT mice and naïve Scn1a +/− mutants (Figure 6B). We also observed reduced expression of NPY2R in primed Scn1a +/− mutants when compared to WT littermates.

FIGURE 6.

FIGURE 6

Expression of NPY1R and NPY2R are reduced following hyperthermia priming in Scn1a +/− mutants. (A) No difference in neuropeptide Y (NPY) mRNA expression was observed between wild‐type (WT), naïve Scn1a +/− mutants, and primed Scn1a +/− mutants. (B) NPY1R mRNA expression was reduced in primed Scn1a +/− mutants compared to WT mice and naïve Scn1a +/− mutants. (C) NPY2R mRNA expression was reduced in primed Scn1a +/− mutants compared to WT mice. (D) NPY5R mRNA expression was comparable between WT, naïve Scn1a +/− mutants, and primed Scn1a +/− mutants. n = 7–8/group/sex. *p ≤ .05, **p < .01.

4. DISCUSSION

In the current study, we demonstrate that intranasal administration of nanoparticle‐encapsulated NPY provides robust seizure protection in Scn1a mutants and WT mice. These observations are consistent with previous studies that demonstrated the ability of NPY to increase seizure resistance when directly administered into the brain of WT rodents. 26 , 69 Using our nanoparticle formulation, we are able to overcome challenges associated with the short half‐life and poor blood–brain barrier penetrance of free NPY. 51 , 52 , 70 Accordingly, although no seizure protection was observed 2 h after intranasal administration of free NPY, we observed robust protection against 6 Hz‐induced seizures in WT mice that were administered NP‐NPY (Figure 2B). Protection against 6 Hz‐induced seizures was observed for up to 4 h in the RH/+ mutants (Figure 3B); however, the Scn1a +/− mutants were not protected at this later timepoint (Figure 3E). It is possible that a higher dose of NP‐NPY may be required to sustain seizure protection in the more severely affected Scn1a +/− mutants.

Febrile seizures are a prominent clinical feature in patients with SCN1A mutations, and mice with Scn1a mutations are susceptible to hyperthermia‐induced seizures. Following the administration of empty nanoparticles, male and female Scn1a +/− mutants exhibited the first GTCS at comparable temperatures. Surprisingly, we found that whereas the administration of NP‐NPY to male Scn1a +/− mutants did not significantly alter resistance to the first hyperthermia‐induced GTCS, robust protection was achieved in female Scn1a +/− mutants. This observation indicates a sex difference in the response to NPY, although mice are not sexually mature at the age tested (P22–P23).

Sexual dimorphism in hippocampal NPY peptide levels has previously been reported in sexually immature and mature rats, with females having less NPY than males. 71 , 72 Brain region‐specific differences in NPY levels have also been observed between male and female rats. 71 , 73 , 74 , 75 However, we did not observe any statistically significant sex differences in hippocampal mRNA levels of NPY or its receptors in Scn1a +/− mutants or WT littermates. It is possible that other factors such as receptor affinity, 75 receptor localization, 76 , 77 or the rate of NPY degradation 78 , 79 , 80 could have contributed to the observed sex‐specific effect of NP‐NPY treatment on hyperthermia‐induced seizures in the Scn1a +/− mutant mice. Sex differences in the biodistribution of the nanoparticles 81 , 82 are also a possibility. For example, in a traumatic brain injury model, female mice exhibited significantly higher nanoparticle distribution (2.5X higher) and robust macromolecular tracer accumulation (3X higher) in the brain 24 h post injury, highlighting potential sex‐dependent differences in blood–brain barrier permeability that may influence therapeutic efficacy. 81 Together, these observations suggest a complex interplay of hormonal 83 , 84 and physiological factors that may contribute to sex‐specific responses to nanoparticle‐based therapies.

NPY receptors are G‐protein coupled receptors that are expressed in multiple brain regions in both humans and rodents. 85 , 86 Previous studies demonstrated that hippocampal slices from both NPY2R and NPY5R knockout mice show decreased sensitivity to the inhibitory effect of NPY,69 and the administration of NPY2R/NPY5R agonists resulted in increased resistance to KA‐ and PTZ‐induced seizures. 87 , 88 Furthermore, examination of RNA‐seq data from a previous study by Hawkins et al. 89 revealed a decrease in NPY2R expression (false discovery rate = .05106) in Scn1a +/− mutants with a history of spontaneous seizures when compared to mutants without seizures. Therefore, it is possible that the reduction in NPY2R expression observed after hyperthermia priming in Scn1a +/− mice contributes to the resulting increase in spontaneous seizure frequency. In contrast, antagonism of NPY1R increases resistance to PTZ‐ and KA‐induced seizures in rodent models, 88 , 90 and NPY1R knockout mice exhibit decreased mortality following KA‐induced seizures. 85 Thus, the reduction in NPY1R expression observed in the hyperthermia‐primed Scn1a +/− mutants (Figure 6B) might reflect a compensatory mechanism aimed at protecting the hippocampus from further damage.

Interestingly, we observed a 65% reduction in spontaneous seizure frequency over the 4‐day observation period in the Scn1a +/− mutants treated with NP‐NPY (Figure 4). Previous studies utilizing AAV expression of NPY in the hippocampus of rat models of temporal lobe epilepsy achieved 40%–75% reduction in spontaneous seizure frequency. 33 , 34 In addition, ICV administration of NPY in the GAERS rat model yielded an approximately 60% reduction in the frequency of absence seizures. 31 , 32 Thus, we were able to similarly achieve robust protection against spontaneous seizures in the Scn1a +/− mutants by using the less invasive approach of intranasal administration of NP‐NPY.

In the current study, we found that NP‐NPY was able to significantly increase seizure resistance in two mouse models of Scn1a‐derived epilepsy, and we were able to reduce spontaneous seizure frequency by 65% in the Scn1a +/− mutants. Using the same neuropeptide encapsulation strategy, we previously demonstrated that a nanoparticle‐encapsulated preparation of oxytocin (NP‐OT) provided robust and sustained protection against induced seizures in Scn1a mutant mice.

In addition to the seizure protective effects of NP‐NPY, we also explored the effect of NP‐NPY on motor coordination in Scn1a +/− mutant mice. We observed no adverse effect on rotarod performance in mice treated with NP‐NPY. However, NPY has also been shown to modulate other behaviors. For example, NPY resulted in less anxiety and depressive‐like behavior when a rodent model of PTSD was examined in the elevated plus maze and forced swim test, 49 , 91 respectively. Moreover, direct brain administration of NPY prolonged recognition memory in a novel object recognition task. 92 Additional studies should therefore be undertaken to evaluate the ability of NPY to ameliorate the behavioral abnormalities observed in Scn1a mutants. 10 , 11 , 14 , 93 In future studies, this nanoparticle encapsulation strategy could be used to explore the potential of packaging combinations of different neuropeptides within the same nanoparticle to take advantage of their different properties and achieve maximum efficacy for the treatment of epilepsy and other neurological disorders.

AUTHOR CONTRIBUTIONS

Samantha L. Reed: Investigation; data curation; formal analysis; writing—original draft preparation; writing—review and editing. Lauren M. Aiani: Investigation; data curation. Eesha Faiz: Investigation; data curation. Emmanuel Adediran: Data curation; writing—review and editing. Morris Benveniste: Conceptualization (supporting); writing—review and editing; funding acquisition. Kevin S. Murnane: Conceptualization (supporting); writing—review and editing; funding acquisition (lead). Martin D'Souza: Conceptualization (supporting); writing—review and editing; funding acquisition. Andrew Escayg: Conceptualization (lead); writing—review and editing; funding acquisition (lead). Jennifer C. Wong: Conceptualization (lead); investigation; data curation; formal analysis; writing—original draft preparation; writing—review and editing; funding acquisition.

CONFLICT OF INTEREST STATEMENT

None of the authors has any conflict of interest to disclose.

ETHICS STATEMENT

All experiments were conducted in accordance with the Emory University institutional and animal care and use committee and the Animal Research: Reporting of In Vivo Experiments guidelines. We confirm that we have read the Journal's position on issues involved in ethical publication and affirm that this report is consistent with those guidelines.

ACKNOWLEDGMENTS

The authors would like to acknowledge Dr. Quinn Eastman for editorial assistance. This project was supported by the National Institutes of Health (A.E. and K.S.M., R01NS120676).

Reed SL, Aiani LM, Faiz E, Adediran E, Benveniste M, Murnane KS, et al. Nanoparticle‐encapsulated neuropeptide Y provides robust seizure protection in SCN1A‐derived epilepsy. Epilepsia. 2026;67:424–436. 10.1111/epi.18649

DATA AVAILABILITY STATEMENT

Data are available upon request.

REFERENCES

  • 1. Perucca P, Bahlo M, Berkovic SF. The genetics of epilepsy. Annu Rev Genomics Hum Genet. 2020;21:205–230. [DOI] [PubMed] [Google Scholar]
  • 2. Butler KM, da Silva C, Alexander JJ, Hegde M, Escayg A. Diagnostic yield from 339 epilepsy patients screened on a clinical gene panel. Pediatr Neurol. 2017;77:61–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Epi C. Exome sequencing of 20,979 individuals with epilepsy reveals shared and distinct ultra‐rare genetic risk across disorder subtypes. Nat Neurosci. 2024;27(10):1864–1879. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. International League Against Epilepsy Consortium on Complex E . GWAS meta‐analysis of over 29,000 people with epilepsy identifies 26 risk loci and subtype‐specific genetic architecture. Nat Genet. 2023;55(9):1471–1482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Claes L, Del‐Favero J, Ceulemans B, Lagae L, Van Broeckhoven C, De Jonghe P. De novo mutations in the sodium‐channel gene SCN1A cause severe myoclonic epilepsy of infancy. Am J Hum Genet. 2001;68(6):1327–1332. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Mei D, Cetica V, Marini C, Guerrini R. Dravet syndrome as part of the clinical and genetic spectrum of sodium channel epilepsies and encephalopathies. Epilepsia. 2019;60(Suppl 3):S2–S7. [DOI] [PubMed] [Google Scholar]
  • 7. Jansson JS, Hallbook T, Reilly C. Intellectual functioning and behavior in Dravet syndrome: a systematic review. Epilepsy Behav. 2020;108:107079. [DOI] [PubMed] [Google Scholar]
  • 8. Escayg A, MacDonald BT, Meisler MH, Baulac S, Huberfeld G, An‐Gourfinkel I, et al. Mutations of SCN1A, encoding a neuronal sodium channel, in two families with GEFS+2. Nat Genet. 2000;24(4):343–345. [DOI] [PubMed] [Google Scholar]
  • 9. Yu FH, Mantegazza M, Westenbroek RE, Robbins CA, Kalume F, Burton KA, et al. Reduced sodium current in GABAergic interneurons in a mouse model of severe myoclonic epilepsy in infancy. Nat Neurosci. 2006;9(9):1142–1149. [DOI] [PubMed] [Google Scholar]
  • 10. Miller AR, Hawkins NA, McCollom CE, Kearney JA. Mapping genetic modifiers of survival in a mouse model of Dravet syndrome. Genes Brain Behav. 2014;13(2):163–172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Martin MS, Dutt K, Papale LA, Dube CM, Dutton SB, de Haan G, et al. Altered function of the SCN1A voltage‐gated sodium channel leads to gamma‐aminobutyric acid‐ergic (GABAergic) interneuron abnormalities. J Biol Chem. 2010;285(13):9823–9834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Wong JC, Thelin JT, Escayg A. Donepezil increases resistance to induced seizures in a mouse model of Dravet syndrome. Ann Clin Transl Neurol. 2019;6(8):1566–1571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Wong JC, Dutton SB, Collins SD, Schachter S, Escayg A. Huperzine a provides robust and sustained protection against induced seizures in Scn1a mutant mice. Front Pharmacol. 2016;7:357. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Wong JC, Shapiro L, Thelin JT, Heaton EC, Zaman RU, D'Souza MJ, et al. Nanoparticle encapsulated oxytocin increases resistance to induced seizures and restores social behavior in Scn1a‐derived epilepsy. Neurobiol Dis. 2021;147:105147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Kaplan JS, Stella N, Catterall WA, Westenbroek RE. Cannabidiol attenuates seizures and social deficits in a mouse model of Dravet syndrome. Proc Natl Acad Sci USA. 2017;114(42):11229–11234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Hawkins NA, Anderson LL, Gertler TS, Laux L, George AL Jr, Kearney JA. Screening of conventional anticonvulsants in a genetic mouse model of epilepsy. Ann Clin Transl Neurol. 2017;4(5):326–339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Kovac S, Walker MC. Neuropeptides in epilepsy. Neuropeptides. 2013;47(6):467–475. [DOI] [PubMed] [Google Scholar]
  • 18. Sun QQ, Huguenard JR, Prince DA. Neuropeptide Y receptors differentially modulate G‐protein‐activated inwardly rectifying K+ channels and high‐voltage‐activated Ca2+ channels in rat thalamic neurons. J Physiol. 2001;531(Pt 1):67–79. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Molosh AI, Sajdyk TJ, Truitt WA, Zhu W, Oxford GS, Shekhar A. NPY Y1 receptors differentially modulate GABAA and NMDA receptors via divergent signal‐transduction pathways to reduce excitability of amygdala neurons. Neuropsychopharmacology. 2013;38(7):1352–1364. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Lerner JT, Sankar R, Mazarati AM. Galanin and Epilepsy. Exp Suppl. 2010;102:183–194. [DOI] [PubMed] [Google Scholar]
  • 21. Cattaneo S, Verlengia G, Marino P, Simonato M, Bettegazzi B. NPY and gene therapy for epilepsy: how, when, … and Y. Front Mol Neurosci. 2020;13:608001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Karagiannis A, Gallopin T, David C, Battaglia D, Geoffroy H, Rossier J, et al. Classification of NPY‐expressing neocortical interneurons. J Neurosci. 2009;29(11):3642–3659. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Lundberg JM, Franco‐Cereceda A, Hemsen A, Lacroix JS, Pernow J. Pharmacology of noradrenaline and neuropeptide tyrosine (NPY)‐mediated sympathetic cotransmission. Fundam Clin Pharmacol. 1990;4(4):373–391. [DOI] [PubMed] [Google Scholar]
  • 24. Sperk G, Hamilton T, Colmers WF. Neuropeptide Y in the dentate gyrus. Prog Brain Res. 2007;163:285–297. [DOI] [PubMed] [Google Scholar]
  • 25. Woldbye DP, Madsen TM, Larsen PJ, Mikkelsen JD, Bolwig TG. Neuropeptide Y inhibits hippocampal seizures and wet dog shakes. Brain Res. 1996;737(1–2):162–168. [DOI] [PubMed] [Google Scholar]
  • 26. Woldbye DP. Antiepileptic effects of NPY on pentylenetetrazole seizures. Regul Pept. 1998;75–76:279–282. [DOI] [PubMed] [Google Scholar]
  • 27. Woldbye DP, Larsen PJ, Mikkelsen JD, Klemp K, Madsen TM, Bolwig TG. Powerful inhibition of kainic acid seizures by neuropeptide Y via Y5‐like receptors. Nat Med. 1997;3(7):761–764. [DOI] [PubMed] [Google Scholar]
  • 28. Madsen TM, Woldbye DP, Bolwig TG, Mikkelsen JD. Kainic acid seizure suppression by neuropeptide Y is not correlated to immediate early gene mRNA levels in rats. Neurosci Lett. 1999;271(1):21–24. [DOI] [PubMed] [Google Scholar]
  • 29. Erickson JC, Clegg KE, Palmiter RD. Sensitivity to leptin and susceptibility to seizures of mice lacking neuropeptide Y. Nature. 1996;381(6581):415–421. [DOI] [PubMed] [Google Scholar]
  • 30. Baraban SC, Hollopeter G, Erickson JC, Schwartzkroin PA, Palmiter RD. Knock‐out mice reveal a critical antiepileptic role for neuropeptide Y. J Neurosci. 1997;17(23):8927–8936. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Stroud LM, O'Brien TJ, Jupp B, Wallengren C, Morris MJ. Neuropeptide Y suppresses absence seizures in a genetic rat model. Brain Res. 2005;1033(2):151–156. [DOI] [PubMed] [Google Scholar]
  • 32. Morris MJ, Gannan E, Stroud LM, Beck‐Sickinger AG, O'Brien TJ. Neuropeptide Y suppresses absence seizures in a genetic rat model primarily through effects on Y receptors. Eur J Neurosci. 2007;25(4):1136–1143. [DOI] [PubMed] [Google Scholar]
  • 33. Noe F, Pool AH, Nissinen J, Gobbi M, Bland R, Rizzi M, et al. Neuropeptide Y gene therapy decreases chronic spontaneous seizures in a rat model of temporal lobe epilepsy. Brain. 2008;131(Pt 6):1506–1515. [DOI] [PubMed] [Google Scholar]
  • 34. Richichi C, Lin EJ, Stefanin D, Colella D, Ravizza T, Grignaschi G, et al. Anticonvulsant and antiepileptogenic effects mediated by adeno‐associated virus vector neuropeptide Y expression in the rat hippocampus. J Neurosci. 2004;24(12):3051–3059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Wickham J, Ledri M, Bengzon J, Jespersen B, Pinborg LH, Englund E, et al. Inhibition of epileptiform activity by neuropeptide Y in brain tissue from drug‐resistant temporal lobe epilepsy patients. Sci Rep. 2019;9(1):19393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Smialowska M, Domin H, Zieba B, Kozniewska E, Michalik R, Piotrowski P, et al. Neuroprotective effects of neuropeptide Y‐Y2 and Y5 receptor agonists in vitro and in vivo. Neuropeptides. 2009;43(3):235–249. [DOI] [PubMed] [Google Scholar]
  • 37. Smialowska M, Wieronska JM, Szewczyk B. Neuroprotective effect of NPY on kainate neurotoxicity in the hippocampus. Pol J Pharmacol. 2003;55(6):979–986. [PubMed] [Google Scholar]
  • 38. Wu YF, Li SB. Neuropeptide Y expression in mouse hippocampus and its role in neuronal excitotoxicity. Acta Pharmacol Sin. 2005;26(1):63–68. [DOI] [PubMed] [Google Scholar]
  • 39. Ferreira R, Santos T, Cortes L, Cochaud S, Agasse F, Silva AP, et al. Neuropeptide Y inhibits interleukin‐1 beta‐induced microglia motility. J Neurochem. 2012;120(1):93–105. [DOI] [PubMed] [Google Scholar]
  • 40. Ferreira R, Xapelli S, Santos T, Silva AP, Cristovao A, Cortes L, et al. Neuropeptide Y modulation of interleukin‐1beta (IL‐1beta)‐induced nitric oxide production in microglia. J Biol Chem. 2010;285(53):41921–41934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Redrobe JP, Dumont Y, Fournier A, Quirion R. The neuropeptide Y (NPY) Y1 receptor subtype mediates NPY‐induced antidepressant‐like activity in the mouse forced swimming test. Neuropsychopharmacology. 2002;26(5):615–624. [DOI] [PubMed] [Google Scholar]
  • 42. Stogner KA, Holmes PV. Neuropeptide‐Y exerts antidepressant‐like effects in the forced swim test in rats. Eur J Pharmacol. 2000;387(2):R9–R10. [DOI] [PubMed] [Google Scholar]
  • 43. Heilig M, Soderpalm B, Engel JA, Widerlov E. Centrally administered neuropeptide Y (NPY) produces anxiolytic‐like effects in animal anxiety models. Psychopharmacology. 1989;98(4):524–529. [DOI] [PubMed] [Google Scholar]
  • 44. Pich EM, Agnati LF, Zini I, Marrama P, Carani C. Neuropeptide Y produces anxiolytic effects in spontaneously hypertensive rats. Peptides. 1993;14(5):909–912. [DOI] [PubMed] [Google Scholar]
  • 45. Mula M, Kanner AM, Jette N, Sander JW. Psychiatric comorbidities in people with epilepsy. Neurol Clin Pract. 2021;11(2):e112–e120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Noe F, Frasca A, Balducci C, Carli M, Sperk G, Ferraguti F, et al. Neuropeptide Y overexpression using recombinant adeno‐associated viral vectors. Neurotherapeutics. 2009;6(2):300–306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Sorensen AT, Kanter‐Schlifke I, Lin EJ, During MJ, Kokaia M. Activity‐dependent volume transmission by transgene NPY attenuates glutamate release and LTP in the subiculum. Mol Cell Neurosci. 2008;39(2):229–237. [DOI] [PubMed] [Google Scholar]
  • 48. Noe F, Nissinen J, Pitkanen A, Gobbi M, Sperk G, During M, et al. Gene therapy in epilepsy: the focus on NPY. Peptides. 2007;28(2):377–383. [DOI] [PubMed] [Google Scholar]
  • 49. Serova LI, Laukova M, Alaluf LG, Pucillo L, Sabban EL. Intranasal neuropeptide Y reverses anxiety and depressive‐like behavior impaired by single prolonged stress PTSD model. Eur Neuropsychopharmacol. 2014;24(1):142–147. [DOI] [PubMed] [Google Scholar]
  • 50. Serova LI, Tillinger A, Alaluf LG, Laukova M, Keegan K, Sabban EL. Single intranasal neuropeptide Y infusion attenuates development of PTSD‐like symptoms to traumatic stress in rats. Neuroscience. 2013;236:298–312. [DOI] [PubMed] [Google Scholar]
  • 51. Grouzmann E, Fathi M, Gillet M, de Torrente A, Cavadas C, Brunner H, et al. Disappearance rate of catecholamines, total metanephrines, and neuropeptide Y from the plasma of patients after resection of pheochromocytoma. Clin Chem. 2001;47(6):1075–1082. [PubMed] [Google Scholar]
  • 52. Pernow J, Lundberg JM, Kaijser L. Vasoconstrictor effects in vivo and plasma disappearance rate of neuropeptide Y in man. Life Sci. 1987;40(1):47–54. [DOI] [PubMed] [Google Scholar]
  • 53. Zaman RU, Mulla NS, Braz Gomes K, D'Souza C, Murnane KS, D'Souza MJ. Nanoparticle formulations that allow for sustained delivery and brain targeting of the neuropeptide oxytocin. Int J Pharm. 2018;548(1):698–706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Oppong‐Damoah A, Zaman RU, D'Souza MJ, Murnane KS. Nanoparticle encapsulation increases the brain penetrance and duration of action of intranasal oxytocin. Horm Behav. 2019;108:20–29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Vinzant N, Scholl JL, Wu CM, Kindle T, Koodali R, Forster GL. Iron oxide nanoparticle delivery of peptides to the brain: reversal of anxiety during drug withdrawal. Front Neurosci. 2017;11:608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Guo S, Wang J, Wang Q, Wang J, Qin S, Li W. Advances in peptide‐based drug delivery systems. Heliyon. 2024;10(4):e26009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Tesauro D, Accardo A, Diaferia C, Milano V, Guillon J, Ronga L, et al. Peptide‐based drug‐delivery Systems in Biotechnological Applications: recent advances and perspectives. Molecules. 2019;24(2):351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Barton ME, Klein BD, Wolf HH, White HS. Pharmacological characterization of the 6 Hz psychomotor seizure model of partial epilepsy. Epilepsy Res. 2001;47(3):217–227. [DOI] [PubMed] [Google Scholar]
  • 59. Inglis GAS, Wong JC, Butler KM, Thelin JT, Mistretta OC, Wu X, et al. Mutations in the Scn8a DIIS4 voltage sensor reveal new distinctions among hypomorphic and null nav 1.6 sodium channels. Genes Brain Behav. 2020;19(4):e12612. [DOI] [PubMed] [Google Scholar]
  • 60. Lamar T, Vanoye CG, Calhoun J, Wong JC, Dutton SBB, Jorge BS, et al. SCN3A deficiency associated with increased seizure susceptibility. Neurobiol Dis. 2017;102:38–48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Shapiro L, Escayg A, Wong JC. Cannabidiol increases seizure resistance and improves behavior in an Scn8a mouse model. Front Pharmacol. 2022;13:815950. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62. Shapiro L, Wong JC, Escayg A. Reduced cannabinoid 2 receptor activity increases susceptibility to induced seizures in mice. Epilepsia. 2019;60(12):2359–2369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Shiu FH, Wong JC, Yamamoto T, Lala T, Purcell RH, Owino S, et al. Mice lacking full length Adgrb1 (Bai1) exhibit social deficits, increased seizure susceptibility, and altered brain development. Exp Neurol. 2022;351:113994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64. Wong JC, Grieco SF, Dutt K, Chen L, Thelin JT, Inglis GAS, et al. Autistic‐like behavior, spontaneous seizures, and increased neuronal excitability in a Scn8a mouse model. Neuropsychopharmacology. 2021;46:2011–2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65. Wong JC, Butler KM, Shapiro L, Thelin JT, Mattison KA, Garber KB, et al. Pathogenic in‐frame variants in SCN8A: expanding the genetic landscape of SCN8A‐associated disease. Front Pharmacol. 2021;12:748415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66. Brothers SP, Wahlestedt C. Therapeutic potential of neuropeptide Y (NPY) receptor ligands. EMBO Mol Med. 2010;2(11):429–439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67. Guo H, Castro PA, Palmiter RD, Baraban SC. Y5 receptors mediate neuropeptide Y actions at excitatory synapses in area CA3 of the mouse hippocampus. J Neurophysiol. 2002;87(1):558–566. [DOI] [PubMed] [Google Scholar]
  • 68. O'Shea D, Morgan DG, Meeran K, Edwards CM, Turton MD, Choi SJ, et al. Neuropeptide Y induced feeding in the rat is mediated by a novel receptor. Endocrinology. 1997;138(1):196–202. [DOI] [PubMed] [Google Scholar]
  • 69. Baraban SC. Antiepileptic actions of neuropeptide Y in the mouse hippocampus require Y5 receptors. Epilepsia. 2002;43(Suppl 5):9–13. [DOI] [PubMed] [Google Scholar]
  • 70. Potter EK. Cardiac vagal action and plasma levels of neuropeptide Y following intravenous injection in the dog. Neurosci Lett. 1987;77(2):243–247. [DOI] [PubMed] [Google Scholar]
  • 71. Rugarn O, Hammar M, Theodorsson A, Theodorsson E, Stenfors C. Sex differences in neuropeptide distribution in the rat brain. Peptides. 1999;20(1):81–86. [DOI] [PubMed] [Google Scholar]
  • 72. Bjornebekk A, Mathe AA, Gruber SH, Brene S. Social isolation increases number of newly proliferated cells in hippocampus in female flinders sensitive line rats. Hippocampus. 2007;17(12):1193–1200. [DOI] [PubMed] [Google Scholar]
  • 73. Sahu A, Phelps CP, White JD, Crowley WR, Kalra SP, Kalra PS. Steroidal regulation of hypothalamic neuropeptide Y release and gene expression. Endocrinology. 1992;130(6):3331–3336. [DOI] [PubMed] [Google Scholar]
  • 74. Urban JH, Bauer‐Dantoin AC, Levine JE. Neuropeptide Y gene expression in the arcuate nucleus: sexual dimorphism and modulation by testosterone. Endocrinology. 1993;132(1):139–145. [DOI] [PubMed] [Google Scholar]
  • 75. Michel MC, Lewejohann K, Farke W, Bischoff A, Feth F, Rascher W. Regulation of NPY/NPY Y1 receptor/G protein system in rat brain cortex. Am J Phys. 1995;268(1 Pt 2):R192–R200. [DOI] [PubMed] [Google Scholar]
  • 76. Liu Y, Wu D, Qu MY, He JL, Yuan M, Zhao M, et al. Neuropeptide Y‐mediated sex‐ and afferent‐specific neurotransmissions contribute to sexual dimorphism of baroreflex afferent function. Oncotarget. 2016;7(40):66135–66148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77. Nahvi RJ, Sabban EL. Sex differences in the neuropeptide Y system and implications for stress related disorders. Biomolecules. 2020;10(9):1248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78. Glenn TC, Krause DN, Duckles SP. Vascular responses to neuropeptide Y are greater in female than male rats. Naunyn Schmiedeberg's Arch Pharmacol. 1997;355(1):111–118. [DOI] [PubMed] [Google Scholar]
  • 79. Zukowska‐Grojec Z. Neuropeptide Y. A novel sympathetic stress hormone and more. Ann N Y Acad Sci. 1995;771:219–233. [DOI] [PubMed] [Google Scholar]
  • 80. Jackson DN, Milne KJ, Noble EG, Shoemaker JK. Gender‐modulated endogenous baseline neuropeptide Y Y1‐receptor activation in the hindlimb of Sprague‐Dawley rats. J Physiol. 2005;562(Pt 1):285–294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81. Bharadwaj VN, Copeland C, Mathew E, Newbern J, Anderson TR, Lifshitz J, et al. Sex‐dependent macromolecule and nanoparticle delivery in experimental brain injury. Tissue Eng Part A. 2020;26(13–14):688–701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82. Poley M, Chen G, Sharf‐Pauker N, Avital A, Kaduri M, Sela M, et al. Sex‐based differences in the biodistribution of nanoparticles and their effect on hormonal, immune, and metabolic function. Adv Nanobiomed Res. 2022;2(12). [Google Scholar]
  • 83. McDonald JK, Lumpkin MD, Samson WK, McCann SM. Neuropeptide Y affects secretion of luteinizing hormone and growth hormone in ovariectomized rats. Proc Natl Acad Sci USA. 1985;82(2):561–564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84. Kerkerian L, Guy J, Lefevre G, Pelletier G. Effects of neuropeptide Y (NPY) on the release of anterior pituitary hormones in the rat. Peptides. 1985;6(6):1201–1204. [DOI] [PubMed] [Google Scholar]
  • 85. Lin S, Boey D, Herzog H. NPY and Y receptors: lessons from transgenic and knockout models. Neuropeptides. 2004;38(4):189–200. [DOI] [PubMed] [Google Scholar]
  • 86. Zhang Y, Liu CY, Chen WC, Shi YC, Wang CM, Lin S, et al. Regulation of neuropeptide Y in body microenvironments and its potential application in therapies: a review. Cell Biosci. 2021;11(1):151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87. El Bahh B, Balosso S, Hamilton T, Herzog H, Beck‐Sickinger AG, Sperk G, et al. The anti‐epileptic actions of neuropeptide Y in the hippocampus are mediated by Y2 and not Y5 receptors. Eur J Neurosci. 2005;22(6):1417–1430. [DOI] [PubMed] [Google Scholar]
  • 88. Vezzani A, Moneta D, Mule F, Ravizza T, Gobbi M, French‐Mullen J. Plastic changes in neuropeptide Y receptor subtypes in experimental models of limbic seizures. Epilepsia. 2000;41(Suppl 6):S115–S121. [DOI] [PubMed] [Google Scholar]
  • 89. Hawkins NA, Calhoun JD, Huffman AM, Kearney JA. Gene expression profiling in a mouse model of Dravet syndrome. Exp Neurol. 2019;311:247–256. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90. Gariboldi M, Conti M, Cavaleri D, Samanin R, Vezzani A. Anticonvulsant properties of BIBP3226, a non‐peptide selective antagonist at neuropeptide Y Y1 receptors. Eur J Neurosci. 1998;10(2):757–759. [DOI] [PubMed] [Google Scholar]
  • 91. Nwokafor C, Serova LI, Nahvi RJ, McCloskey J, Sabban EL. Activation of NPY receptor subtype 1 by [D‐his(26)]NPY is sufficient to prevent development of anxiety and depressive like effects in the single prolonged stress rodent model of PTSD. Neuropeptides. 2020;80:102001. [DOI] [PubMed] [Google Scholar]
  • 92. Kornhuber J, Zoicas I. Neuropeptide Y prolongs non‐social memory and differentially affects acquisition, consolidation, and retrieval of non‐social and social memory in male mice. Sci Rep. 2017;7(1):6821. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 93. Han S, Tai C, Westenbroek RE, Yu FH, Cheah CS, Potter GB, et al. Autistic‐like behaviour in Scn1a+/− mice and rescue by enhanced GABA‐mediated neurotransmission. Nature. 2012;489(7416):385–390. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data are available upon request.


Articles from Epilepsia are provided here courtesy of Wiley

RESOURCES