Summary
Transfer RNA (tRNA), its post-transcriptional modifications, and tRNA-derived fragments (tRFs) play essential roles in cellular processes and gene regulation. Here, we present a fast and efficient tRNA enrichment protocol using silica spin columns. To analyze tRNA and tRFs, we describe steps for DNA probe labeling, tRNA separation on polyacrylamide (PAA) gels, and RNA transfer, UV crosslinking, and non-radioactive northern blotting. Additionally, this protocol describes the use of chemical affinity modifiers, enabling the detection of chemical modifications in specific tRNA isoacceptors.
Subject areas: Cell Biology, Molecular Biology, Molecular/Chemical Probes
Graphical abstract

Highlights
-
•
Steps for tRNA enrichment from total RNA using silica spin columns
-
•
Procedure for DNA probe biotinylation via terminal deoxynucleotidyl transferase
-
•
Instructions for non-radioactive chemiluminescent northern blotting
Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.
Transfer RNA (tRNA), its post-transcriptional modifications, and tRNA-derived fragments (tRFs) play essential roles in cellular processes and gene regulation. Here, we present a fast and efficient tRNA enrichment protocol using silica spin columns. To analyze tRNA and tRFs, we describe steps for DNA probe labeling, tRNA separation on polyacrylamide (PAA) gels, and RNA transfer, UV crosslinking, and non-radioactive northern blotting. Additionally, this protocol describes the use of chemical affinity modifiers, enabling the detection of chemical modifications in specific tRNA isoacceptors.
Before you begin
The tRNA enrichment method presented here requires total RNA of good quality and purity. For total RNA extraction, various extraction techniques can be employed depending on the organism of interest. Ensure that the initial total RNA does not contain contaminants, such as lipids. Although the tRNA isolation method is broadly applicable to total RNA extracted from any organism, this protocol demonstrates tRNA isolation from bacteria and yeast. It should be noted that the resulting tRNA fraction, while consisting predominantly of tRNAs, also contains other short RNAs (<120 nt). The tRNA fraction prepared according to this method is suitable for various downstream applications, including sequencing and mass spectrometry analyses.
The design of probes is critical for achieving specific and accurate Northern blot detection. Enzymatic probe labeling facilitates the testing of multiple probe designs without the need for costly commercial labeling. When designing probes for tRNA detection, it is advisable to consult modification data from resources such as MODOMICS1 to account for possible tRNA modifications that may interfere with probe hybridization. Once the newly designed probes are validated (see probe design and synthesis), commercial biotin-labeled versions can be obtained for long-term use (for further information see Expected outcomes). In this protocol, three validated probes are presented: two targeting tRNA-Leu-UAG and tRNA-His-GUG from the gram-negative bacterium Shewanella glacialimarina TZS-4T,2 and one targeting tRNA-Glu-UUC from Saccharomyces cerevisiae BY4741.
Innovation
Existing tRNA purification protocols are predominantly based on anion-exchange chromatography, which utilizes selective tRNA binding to quaternary amino groups in the presence of sodium ions.2,3,4 Even though such techniques yield tRNA of sufficient purity, they are laborious and require extensive handling times, in addition to which the purified tRNA often elutes into multiple fractions, necessitating additional precipitation steps.3 Furthermore, these approaches may also use FPLC or HPLC equipment, which further limits their applicability. In contrast, this protocol describes an optimized silica spin column tRNA enrichment method, which enables simple and fast isolation while minimizing undesired rRNA contamination. The resulting tRNA is ready to use for downstream analyses, such as northern blotting or RNA mass spectrometry.
While significant advancements have been made in chemiluminescent blotting methods,5,6,7 the existing methods typically use commercial probes with a single biotin label. In this protocol, the detection sensitivity is substantially enhanced by incorporating multiple biotin-carrying nucleotides using a terminal deoxynucleotidyl transferase (TdT), resulting in improved detection of targets with low abundance, such as single tRNA isoacceptors and tRNA-derived fragments.
Probe design and synthesis
Timing: 1 h to 5 days (depending on DNA synthesis service supplier)
General probe design recommendations and considerations: New probe designs should, if possible, avoid the anticodon loop region as the presence of certain nucleoside modifications can reduce the hybridization efficiency.8,9 We recommend to initially design two probes per tRNA isoacceptor —one complementary to 5′-region and the other to the 3′-region. Next, assess the specificity of each probe in silico by aligning the sequence against the transcriptome of closely related species or any organisms that may represent undesired cross-reactivity (e.g., when analyzing tRNAs from mixed cultures). Moreover, probe specificity should also be validated by performing northern blots on target RNA and include appropriate controls, such as in vitro transcribed target RNA and/or RNA from closely related species. Consequently, if successful, probe designs targeting the same RNA should provide similar results. For further information, please refer to the troubleshooting section.
-
1.Design the DNA oligonucleotide probe for detection of desired tRNA.
-
a.For a successful design, carefully consider key factors, such as probe sequence length, GC content, and sequence specificity. The probes used with the hybridization buffer defined in this protocol should have the following properties:
-
i.Melting temperature: 65°C to 85°C.
-
ii.GC content: 45%–80%.
-
iii.Length: 28 to 35 nt.
-
i.
-
a.
Note: Calculate Tm of each probe using IDT’s OligoAnalyzer tool (https://www.idtdna.com/calc/analyzer) using the following parameters: 500 mM Na+, 0.0001 μM oligo conc., 0 mM Mg2+, 0 mM dNTPs conc.
-
2.Synthesize the DNA probes using your DNA synthesis service of choice.
-
a.Desalting provides sufficient probe purity for labeling.
-
a.
-
3.
Upon arrival, dissolve DNA probes in RNase-free water to 100 μM concentration. Store at −20°C.
Total RNA isolation
Timing: 1–2 days (depending on the organism)
-
4.
Grow cells in an appropriate medium and collect as recommended.
- 5.
Note: Yeast total RNA isolated by acidic phenol method4 is enriched for tRNA and will result in higher yields after tRNA purification.
Note: Total RNA can be also isolated by commercial column-based kits. However, make sure that the kit isolates RNAs longer than 20 nt.
CRITICAL: When isolating total RNA from tissue, ensure that total RNA samples do not contain lipids, as their presence will interfere with RNA binding to the silica column10 during tRNA enrichment, resulting in a decreased tRNA yield.
-
6.
Dissolve total RNA in RNase-free water and determine the concentration by measuring absorbance at 260 nm or by fluorescent methods (e.g., Qubit). Store at −80°C.
Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Bacterial and virus strains | ||
| Shewanella glacialimarina TZS-4T | DSMZ | 115441 |
| Saccharomyces cerevisiae BY4741 (ATCC 201388) | ATCC | 201388 |
| Chemicals, peptides, and recombinant proteins | ||
| 1 mM Biotin-16-dCTP | Jena Bioscience | NU-809-BIO16-S |
| Acetic acid (glacial) | Fisher Chemical | A/0360/PB17 |
| Acrylamide/bis 19:1, 40% (w/v) solution | Fisher BioReagents | BP14061 |
| Acrylamide/bis 29:1, 40% (w/v) solution | Fisher BioReagents | BP14081 |
| 3-(acryloylamino)benzeneboronic acid | Apollo Scientific | OR40723 |
| [(N-Acryloylamino)phenyl]mercuric chloride | Toronto Research Chemicals | TRC-A191380-1MG |
| Ammonium persulfate (APS) | Thermo Scientific Chemicals | 327081000 |
| Boric acid | Fisher Chemical | B/3800/60 |
| Bromophenol blue | Fisher BioReagents | BP115-25 |
| Disodium hydrogen phosphate, anhydrous | Fisher BioReagents | BP332500 |
| EDTA | Thermo Scientific Chemicals | 118432500 |
| Ethanol (Aa purity; >99.7%) | Anora Group Oyj | 1025874 |
| Ethylene glycol diacetate | Thermo Scientific | 176225000 |
| Formamide | Fisher BioReagents | BP228100 |
| GeneRuler Ultra Low Range DNA Ladder | Thermo Scientific | SM1211 |
| Guanidine thiocyanate | Fisher BioReagents | BP2211 |
| Hydrochloric acid | Fisher Chemical | H/1150/PB15 |
| Low Range ssRNA Ladder | New England Biolabs | N0364S |
| N,N,N′,N′-tetramethylethylenediamine (TEMED) | Fisher BioReagents | BP150-20 |
| Phosphoric acid | Fisher Chemical | O/0450/PB15 |
| Potassium chloride | Fisher Chemical | P/4240/60 |
| Potassium dihydrogen phosphate | Thermo Scientific Chemicals | 205925000 |
| Potassium hydroxide | Fisher Chemical | P/5560/60 |
| Sodium chloride | Fisher Chemical | S/3120/53 |
| Sodium citrate dihydrate | Fisher BioReagents | BP327-500 |
| Sodium dodecyl sulphate (SDS) | Fisher BioReagents | BP166-500 |
| Sodium hydroxide | Fisher Chemical | S/4920/60 |
| SYBR Gold Nucleic Acid Gel Stain | Invitrogen | S11494 |
| Tris base | Fisher BioReagents | BP1521 |
| TriTrack DNA Loading Dye (6×) | Thermo Scientific | R1161 |
| Tween-20 | Fisher BioReagents | BP337-500 |
| Urea | Thermo Scientific Chemicals | 197460050 |
| Xylene cyanol FF | Fisher BioReagents | BP56510 |
| Critical commercial assays | ||
| Pierce High Sensitivity Streptavidin-HRP | Thermo Scientific | 21130 |
| Terminal Transferase (TdT) | New England Biolabs | M0315S |
| Blocking reagent | Roche | 11096176001 |
| Pierce ECL Western Blotting Substrate | Thermo Scientific | 32209 |
| Oligonucleotides | ||
| SCer_tRNA-Glu(UUC) probe GCGTGATGTGATAGCCGTTACACTATATCGG |
This paper | N/A |
| ShG-tRNA-His(GUG) probe ATCCGGGACTCTACCAACTGAGCTACAATCA | This paper | N/A |
| ShG-tRNA-Leu(UAG) probe CGGGAAGAGAGACTTGAACTCTCACACCTTGCGGCA |
This paper | N/A |
| Software and algorithms | ||
| Image Lab, version 6.0.0. build 25 | Bio-Rad | N/A |
| Other | ||
| Amersham Hybond-N+ nylon membrane (20 cm × 3 m) | Cytiva | RPN203B |
| Grade 3MM Chr Cellulose Chromatography Paper (23 cm × 100 m) | Cytiva | 3030–700 |
| NucleoSpin RNA silica columns (200 μg binding capacity) | Macherey-Nagel | 740955.50S |
| PowerPac HC High-Current Power Supply | Bio-Rad | 1645052 |
| Trans-Blot SD Semi-Dry Transfer Cell | Bio-Rad | 1703940 |
| QB Series Dry Block Heating System | Grant | QBD2 |
| UVP crosslinker CL-3000 | Analytik Jena | 849-95-0615-02 |
| Hybridization tubes | Analytik Jena | 7019401 |
| Hybridization oven | Thermo Scientific | 6243 |
| pH meter | Mettler Toledo | 30266628 |
| Roller | Bio-Rad | 1651279 |
| ChemiDoc Imaging System | Bio-Rad | 12003153 |
| Vertical electrophoresis apparatus | C.B.S. Scientific | DASG-400 |
| Power Supply (HC) | Bio-Rad | 1645052 |
| Water bath | Fisherbrand | FSGPD02 |
Materials and equipment
Long RNA binding buffer (LBB)
| Reagent | Final concentration | Amount |
|---|---|---|
| Guanidinium thiocyanate | 5 M | 59.1 g |
| 1 M Tris pH 7.0 | 50 mM | 5 mL |
| RNase-free water | N/A | Up to 100 mL |
| Total | N/A | 100 mL |
Dissolve guanidium thiocyanate in ∼60–70 mL RNase-free water. Once dissolved, add remaining components and adjust to final volume with RNase-free water. Store at ambient temperature for up to 12 months.
CRITICAL: Do not use if the buffer precipitated during storage.
Short RNA binding buffer (SBB)
| Reagent | Final concentration | Amount |
|---|---|---|
| Ethylene glycol diacetate | 80% | 800 μL |
| LBB (5 M Guanidinium thiocyanate, 50 mM Tris pH 7.0) |
1 M | 200 μL |
| Total | N/A | 1 mL |
Prepare freshly before use.
Note: The SBB buffer is conveniently prepared by mixing LBB with EGDA in 1:4 ratio (e.g. 200 μL LBB and 800 μL of EGDA). Processing of one sample requires ∼700 μL.
Chaotropic wash buffer (CWB)
| Reagent | Final concentration | Amount |
|---|---|---|
| 5M Guanidine thiocyanate | 1.6 M | 32 mL |
| Ethanol (pure) | 66% | 66 mL |
| 1M Tris, pH 7.0 | 20 mM | 2 mL |
| Total | N/A | 100 mL |
Mix all components together and store at ambient temperature for up to 12 months.
Ethanol wash buffer (EWB)
| Reagent | Final concentration | Amount |
|---|---|---|
| 1M Tris, pH 7.5 | 10 mM | 1 mL |
| 5M NaCl | 20 mM | 400 μL |
| Ethanol (pure) | 80% | 80 mL |
| RNase-free water | N/A | Up to 100 mL |
| Total | N/A | 100 mL |
Mix NaCl with Tris and RNase-free water. Then add ethanol and mix well. Store at ambient temperature for up to 12 months.
Note: Adding concentrated NaCl directly to ethanol will lead to NaCl precipitation. The precipitate dissolves quickly after addition of water. In case of precipitation, mix solution well until precipitate disappears. This does not impact the functionality of the solution.
10× PBS
| Reagent | Final concentration | Amount |
|---|---|---|
| Sodium chloride | 1.37 M | 80 g |
| Potassium chloride | 27 mM | 2 g |
| Disodium hydrogen phosphate | 100 mM | 14.2 g |
| Potassium dihydrogen phosphate | 18 mM | 2.4 g |
| RNase-free water | N/A | Up to 1 L |
| Total | N/A | 1 L |
Dissolve all components in RNase-free water, adjust pH to 7.4 with NaOH or HCl and filter (0.2 μm) the final solution. Store at ambient temperature up to a year.
20× SSC
| Reagent | Final concentration | Amount |
|---|---|---|
| Sodium chloride | 3 M | 175.3 g |
| Trisodium citrate | 0.3 M | 88.3 g |
| RNase-free water | N/A | Up to 1 L |
| Total | N/A | 1 L |
Dissolve all components in RNase-free water. Adjust pH to 7.0 with NaOH or HCl and filter (0.2 μm). Store at ambient temperature for up to a year.
5× TBE
| Reagent | Final concentration | Amount |
|---|---|---|
| Tris base | 450 mM | 54 g |
| Boric acid | 450 mM | 27.5 g |
| 0.5 M EDTA, pH 8.0 | 10 mM | 20 mL |
| RNase-free water | N/A | Up to 1 L |
| Total | N/A | 1 L |
Dissolve all components in RNase-free water and filter (0.2 μm) the final solution. Store at ambient temperature up to a year.
50× TAE
| Reagent | Final concentration | Amount |
|---|---|---|
| Tris base | 2 M | 242 g |
| Glacial acetic acid | 1 M | 57.1 mL |
| 0.5 M EDTA, pH 8.0 | 50 mM | 100 mL |
| RNase-free water | N/A | Up to 1 L |
| Total | N/A | 1 L |
Dissolve all components in RNase-free water and filter (0.2 μm) the final solution. Store at ambient temperature up to a year.
2× RNA loading dye
| Reagent | Final concentration | Amount |
|---|---|---|
| Formamide | 90% (v/v) | 9 mL |
| 5× TBE | 0.5× | 1 mL |
| 20% SDS | 0.05% | 25 μL |
| Bromophenol blue | 0.025% | 2.5 mg |
| Xylene cyanol FF | 0.01% | 1 mg |
| Total | N/A | ∼10 mL |
Store at ambient temperature for up to three months or at −20°C for up to two years.
Native PAA gel, 12% (14 × 10 cm)
| Reagent | Final concentration | Amount |
|---|---|---|
| 5× TBE | 1× | 4 mL |
| Acrylamide/bis 19:1, 40% (w/v) solution | 12% | 6 mL |
| 10% APS | 0.1% | 200 μL |
| TEMED | 0.1% | 20 μL |
| RNase-free water | N/A | 10 mL |
| Total | N/A | ∼20 mL |
Prepare fresh before use.
Note: Smaller volumes might be sufficient for gels of other sizes, e.g. 7 mL of gel mixture is sufficient for mini gels (8.6×6.7 cm). Re-calculate the component amounts according to the used gel size.
Denaturing PAA Gel Buffer A
| Reagent | Final concentration | Amount |
|---|---|---|
| 5× TBE | 0.5× | 20 mL |
| Urea | 7M | 84.08 g |
| RNase-free water | N/A | Up to 200 mL |
| Total | N/A | 200 mL |
Dissolve all components in RNase-free water and filter (0.2 μm) the final solution. Store at 4°C for <12 months.
Note: For APB gels, substitute 5× TBE with 50× TAE. The final concentration of TAE should be 1×. Recalculate the added component amounts accordingly.
Denaturing PAA Gel Buffer B
| Reagent | Final concentration | Amount |
|---|---|---|
| 5× TBE | 0.5× | 20 mL |
| Acrylamide/bis 19:1, 40% (w/v) solution | 20% | 100 mL |
| Urea | 7M | 84.08 g |
| RNase-free water | N/A | Up to 200 mL |
| Total | N/A | 200 mL |
Dissolve urea directly in the 40% acrylamide and TBE. Mild heating (<40°C) can be applied to speed up the process. Once dissolved, adjust to final volume with RNase-free water, filter (0.2 μm) and store at 4°C for <12 months.
Note: For APB gels, substitute 5× TBE with 50× TAE. The final concentration of TAE should be 1×. Recalculate the added component amounts accordingly.
Alternatives: For improved resolution in APB gels, we recommend using acrylamide/bis 29:1.
Denaturing PAA gel, 10% (14×10 cm)
| Reagent | Final concentration | Amount |
|---|---|---|
| Buffer A | N/A | 10 mL |
| Buffer B | 10% (acrylamide) | 10 mL |
| TEMED | 0.1% | 20 μL |
| 10% APS | 0.1% | 200 μL |
| Total | N/A | ∼20 mL |
Prepare fresh, immediately before use.
Note: For APM gels (14×10 cm), use TBE based gel buffers as described in table above. Mix buffer A and B, add 200 μL of 1 mg/mL APM stock (prepared in 100% formamide). Vortex thoroughly. Add TEMED and APS and cast the gel.
Note: For APB gels (14×10 cm), use TAE based gel buffers (see notes for Buffer A and B preparation). Mix Buffer A and Buffer B, add 50 mg of APB to the mixture and dissolve by vortexing. Once dissolved, add TEMED and 10% APS and cast the gel.
Note: Smaller volumes might be sufficient for gels of other sizes, e.g. 7 mL of gel mixture is sufficient for mini gels (8.6×6.7 cm). Re-calculate the component amounts according to the used gel size.
0.5M phosphate buffer, pH 7.2
| Reagent | Final concentration | Amount |
|---|---|---|
| Disodium hydrogen phosphate | 0.5 M | 7.1 g |
| RNase-free water | N/A | 100 mL |
| Total | N/A | 100 mL |
Dissolve solid compound in RNase-free water. Then, adjust the pH to 7.2 using phosphoric acid.
CRITICAL: pH adjustment takes only a few mL of 50% phosphoric acid. Do not use concentrated acid! Filter (0.2 μm) and store at RT.
5% Roche blocking reagent (RBR) stock
| Reagent | Final concentration | Amount |
|---|---|---|
| Roche blocking reagent (RBR) | 5% | 5 g |
| 0.05 M phosphate buffer, pH 7.2 | 0.05 M | 100 mL |
| Total | N/A | 100 mL |
Dissolve 5 g in ∼80 mL of 0.05 M phosphate buffer, pH 7.2 by heating it in a microwave oven. The 0.05 M phosphate buffer is prepared by diluting 0.5 M phosphate buffer, pH 7.2 with RNase-free water. Make sure the reagent is properly dissolved. Cool down, adjust to 100 mL and aliquot. Store at −20°C up to a year.
CRITICAL: Do not boil the solution as it will lead to irreversible precipitation of the blocking reagent.
Pre-/hybridization buffer
| Reagent | Final concentration | Amount |
|---|---|---|
| 0.5 M phosphate buffer, pH 7.2 | 0.25 M | 50 mL |
| 0.5 M EDTA | 1 mM | 0.2 mL |
| 20% SDS | 10% | 50 mL |
| Roche blocking reagent (RBR) | 0.5% | 0.5 g |
| Total | N/A | ∼100 mL |
Dissolve RBR in 0.5M phosphate buffer by heating it in a microwave oven. When all RBR is properly dissolved let the bottle cool down (∼ambient to 45°C). Then, add rest of the components and mix well. Use directly or let cool down closer ambient temperature before storing at 4°C.
Note: Hybridization buffer will heavily precipitate at 4°C. Prior to use, warm up the buffer at 65°C in a water bath to dissolve it completely. This step can take up to 1 h. The hybridization buffer can be heated and cooled multiple times.
Membrane wash buffer
| Reagent | Final concentration | Amount |
|---|---|---|
| 20× SSC | 2× | 100 mL |
| 20% SDS | 0.1% | 5 mL |
| RNase-free water | N/A | Up to 1 L |
| Total | N/A | 1 L |
Prepare as indicated using pre-made components. Store at ambient temperature for up to a year.
Blocking buffer
| Reagent | Final concentration | Amount |
|---|---|---|
| 10× PBS | 1× | 12 mL |
| 10% Tween-20 | 0.3% | 3.6 mL |
| 5% RBR | 2% | 48 mL |
| RNase-free water | N/A | Up to 120 mL |
| Total | N/A | 120 mL |
Prepare freshly before use. Do not store for more than 1–2 days at 4°C. When using the blocking buffer from 4°C, warm up the buffer at 45°C and let it cool down before use. The same applies when preparing fresh buffer from frozen 5% RBR - warm the RBR at 45°C to dissolve it properly before adding other components.
CRITICAL: Do not use blocking buffer if it contains any precipitate. This will result in inefficient blocking and higher background!
PBS wash buffer
| Reagent | Final concentration | Amount |
|---|---|---|
| 10× PBS | 1× | 100 mL |
| 10% Tween-20 | 0.3% | 30 mL |
| RNase-free water | N/A | Up to 1 L |
| Total | N/A | 1 L |
Prepare as indicated using pre-made components. Store at ambient temperature for up to a year.
Detection buffer
| Reagent | Final concentration | Amount |
|---|---|---|
| Potassium dihydrogen phosphate | 0.05 M | 6.8 g |
| RNase-free water | N/A | Up to 1 L |
| Total | N/A | 1 L |
Dissolve potassium dihydrogen phosphate in ∼800 mL. Adjust with 5M KOH to pH 6.0. Fill up to 1 L and filter (0.2 μm). Store at 4°C for up to 6 months.
CRITICAL: To minimize RNase contamination, adhere to standard RNA handling procedures throughout the protocol. Use RNase-free plasticware and glassware (baked at 180°C–220°C for several hours).
CRITICAL: Acrylamide/bis solutions, guanidine thiocyanate, TRIzol, formamide and SDS are harmful. Follow appropriate protective measures and institutional guidelines for handling and disposal.
Alternatives: Gel electrophoresis system can be substituted by any other vertical electrophoresis system (e.g. Mini-PROTEAN Tetra Cell, Bio-Rad) which uses smaller (mini) gels. This enables the use of commercial pre-cast gels, such as Criterion TBE-Urea Precast Gels, Bio-Rad.
Alternatives: DNA probes can be ordered either 3′ or 5′ pre-biotinylated.
Alternatives: Commercial denaturing 2× RNA loading dyes can be used (e.g. RNA Gel Loading Dye (2×), Thermo Scientific, R0641).
Alternatives: More sensitive chemiluminescent substrate can be used (e.g. SuperSignal West Pico PLUS, Thermo Scientific, 34580) to enhance the signal detection.
Step-by-step method details
tRNA enrichment from total RNA
Timing: 20–60 min (depending on number of samples)
This section describes the two-step tRNA enrichment method, whereby RNA molecules shorter than 120 nt are selectively recovered from total RNA (Figure 1A). Optionally, this isolation process may also be applied as a one-step method to obtain RNA molecules longer than 120 nt.
Note: The method employs a two-column purification strategy using distinct binding conditions. In the first column purification step, the binding conditions (2.3M guanidine thiocyanate (GITC), 35% ethylene glycol diacetate (EGDA)) are optimized for binding RNA molecules longer than 120 nucleotides while shorter RNAs, including tRNAs, remain unbound and are collected in the flowthrough (FT). In the subsequent column purification step, the binding conditions (1.6M GITC, 60% EGDA) are adjusted to capture all RNA species present in the flowthrough from the first column.
CRITICAL: Make sure that all steps are performed at ambient temperature and the samples are mixed thoroughly. Do not place RNA mixed with isolation buffers on ice at any point. Only the initial total RNA dilution and final long and short RNA fractions eluted in RNase-free water should be kept on ice.
Note: tRNA yields depend on the quality and purity of total RNA used for enrichment. See troubleshooting 1 for further guidance.
Note: For isolation of long RNAs (>120 nt), perform optional steps a–g.
-
1.
Dissolve and/or dilute 80–100 μg of DNA-free total RNA with RNase-free water to a final volume of 100 μL.
Note: Total RNA does not need to be DNase treated, but excessive DNA contamination will decrease the tRNA yields.
Note: Total RNA should be dissolved in RNase-free water. The ideal concentration is >1 μg/μL. If the concentration of total RNA is <1 μg/μL, concentrate RNA by precipitation or vacuum concentration. Alternatively, perform the first purification step with multiple columns and then pool the FT for the second column step where the short RNAs are bound to the column. For further details, see troubleshooting 1.
-
2.
Mix the diluted total RNA with 250 μL of Long RNA Binding Buffer (LBB). Vortex thoroughly.
-
3.
Add 190 μL of 100% ethylene glycol diacetate (EGDA). Mix thoroughly and incubate for 2 min at ambient temperature.
Note: The appearance of a white precipitate is indicative of DNA contamination. This may reduce tRNA yields.
-
4.
To bind long RNAs, load the mixture onto the column (placed into a 2 mL collection tube).
-
5.
Spin column for 1 min at 11 000×g.
-
6.
Collect FT. Proceed to step 7 for isolation of short RNAs.
CRITICAL: DO NOT discard the FT, as it contains the short RNAs.
Note: For long RNAs, continue with optional steps a-g at the end of this section.
-
7.
Mix FT from step 6 (∼540 μL) with 675 μL of Short RNA Binding Buffer (SBB). Vortex thoroughly and incubate for 1 min at ambient temperature.
CRITICAL: Always use freshly prepared SBB!
-
8.Bind short RNAs to silica column:
-
a.Load half (∼600 μL) of the mixture to a fresh silica spin column.Note: Maximum loading volume is 700 μL.
-
b.Spin for 1 min at 3 000×g.
-
c.Discard FT and reload the column with the remaining solution.
-
d.Spin for 1 min at 3 000×g.
-
e.Discard FT and continue with step 9.
-
a.
-
9.
Wash column with 500 μL Chaotropic Wash Buffer (CWB). Spin for 1 min at 13 000×g. Discard FT.
-
10.
Wash column with 500 μL Ethanol Wash Buffer (EWB). Spin for 1 min at 13 000×g. Discard FT.
-
11.
Repeat step 10.
-
12.
Spin empty column for 2 min 13 000×g to dry the column.
-
13.Transfer column to a new 1.5 mL tube and elute short RNA by adding 50 μL of RNase-free water.
-
a.Incubate for 1–2 min.
-
b.Spin column for 1 min at 13 000×g.
-
a.
-
14.Measure RNA concentration and check purity (presence of tRNA cluster and absence of small rRNA; see example in Figure 1A) on a 10% PAA-UREA gel. Store at −80°C until further analysis.Optional: Isolate long RNA from first column according to the instructions below:
-
a.Place column to new 2 mL collection tube.
-
b.Wash column with 500 μL CWB. Spin for 1 min at 13 000×g. Discard FT.
-
c.Wash column with 500 μL EWB. Spin for 1 min at 13 000×g. Discard FT.
-
d.Repeat step c.
-
e.Spin empty column for 2 min 13 000×g to dry the column.
-
f.Transfer column to new 1.5 mL tube and elute long RNA by adding 50 μL of RNase-free water. Incubate for 1–2 min. Then spin column for 1 min at 13 000×g.
-
g.Store at −80°C until further analysis.
Pause point: The isolated tRNA in RNase-free water can be stored at −80°C long-term if stored properly and freeze-thaw cycles are avoided.
-
a.
Figure 1.
tRNA enrichment, quality control steps and expected outcomes of the Northern blot protocol
(A) Bacterial total RNA and tRNA from Shewanella glacialimarina infected by bacteriophage (100 ng for each lane) analyzed on 10% urea-PAA gel to verify purity and quality of isolated tRNA. Note the enrichment of tRNA fragments (tRFs) in the tRNA fractions compared to total RNA. Numbers on the left correspond to the Low Range ssRNA Ladder.
(B) Native 12% PAA gel analysis of 0.4 pmol of unlabeled (−) and labeled (+) probes confirming successful biotinylation. Ladder - Ultra-low range DNA ladder. Asterisks indicate biotin labeled probe carrying 1 (∗), 2 (∗∗) or 3 (∗∗∗) biotins.
(C) Comparison of signal intensity between probes labeled with a single biotin or multiple biotins.
(D) Analysis of bacterial total RNA (2 μg) by gel electrophoresis (left) and detection of tRNA-Leu and its stress-induced (phage infection) fragments (tRF; right) using long (14×10 cm) 12% urea-PAA gels. Ladder - Low Range ssRNA Ladder.
(E) Detection of tRNA-Leu and tRNA-Leu fragment in Shewanella glacialimarina using a range (12.5–500 ng) of purified tRNA. tRNA sample is same as in panel A.
(F) Typical Northern blot detection of bacterial tRNA-His. Total RNA (2 μg) and tRNA (200 ng) are separated on 10% urea-PAA mini (8.6×6.7 cm) gels (left), followed by verification of transfer (middle) and finally, tRNA-His is detected by chemiluminescent northern blot (right). Analysis is performed in duplicates (R1 and R2).
(G) Utilization of chemiluminescent northern blot for detection of queuosinylated tRNA-His (right) in bacteria using 0.25% APB and TAE based urea-PAA mini gels (left). Δtgt serves as non-queuosinylated control of wild-type (wt) strain. Gel and samples were prepared as described in ref.11
(H) Chemiluminescent northern blot detection of thiolated tRNA-Glu (right) in yeast using 10% urea-PAA mini gels containing 10 μg/mL APM (left). Gel and transfer were performed as described in this protocol.
Biotinylation of DNA probes
Timing: 3–4 h
This section describes a method for enzymatic 3′ end labeling of DNA probes with biotin using Terminal Deoxynucleotidyl Transferase (TdT). The following reaction setup produces 1-3 nt long biotin-16-dCTP tails. Biotinylation efficiency is verified by probe analysis on native PAA gel (Figure 1B).
CRITICAL: Before assembling the reaction, allow all components to reach ambient temperature, except for biotin-16-dCTP and TdT enzyme, which should be kept on ice or at −20°C, respectively.
-
15.
Dilute unlabeled DNA oligo to 1 pmol/μL in RNase-/DNase-free water. Mix well and briefly spin to collect all liquid to the bottom of the tube.
-
16.
Assemble the biotinylation reaction.
Biotinylation reaction
| Reagent | Final concentration | Amount per 1 reaction |
|---|---|---|
| RNase/DNase-free water | N/A | 34 μL |
| 10× TdT buffer | 1× | 5 μL |
| 2.5 mM CoCl2 solution | 0.25 mM | 5 μL |
| 1 pmol/μL DNA probe | 0.1 pmol/μL | 5 μL |
| 1 mM Biotin-16-dCTP | 0.01 mM | 0.5 μL |
| 20 U/μL Terminal Transferase (TdT) | 0.2 U/μL | 0.5 μL |
| Total | N/A | 50 μL |
CRITICAL: DO NOT place the individual reaction components or the reaction itself on ice! The use of cold components or cooling down the reaction mixture will result in poor labeling efficiency. For further details see troubleshooting 2.
CRITICAL: Avoid repeated freeze-thawing Biotin-16-dCTP as this will degrade the nucleotide.
Note: When more probe is needed, do not scale up a single reaction; instead, perform multiple reactions.
CRITICAL: TdT may become inactivated if it comes into direct contact with undiluted 10× TdT buffer or CoCl2 solution. Hence, when preparing the mastermix for labeling multiple reactions, combine all components except TdT and Biotin-16-dCTP. Mix thoroughly and only then add TdT and Biotin-16-dCTP. Mix again, aliquot 45 μL into tubes and add the DNA probe.
-
17.
Incubate at 37°C for 60 minutes.
-
18.
Stop the reaction by incubation at 70°C for 10 minutes.
-
19.
Prepare 12% native PAA gel (14 × 10 cm) to verify the labeling of probes and let it polymerase for 30–40 min.
-
20.Prepare gel samples from labeled and unlabeled probe:
-
a.1 μL oligo (1 pmol/μL) + 9 μL MQ + 2 μL 6× DNA LB.
-
b.5 μL from finished and deactivated labeling reaction + 1 μL 6× DNA LB.
-
a.
-
21.Place gel to electrophoresis tank filled with 1×TBE buffer.
-
a.Remove comb and rinse wells using needle and syringe to remove any polyacrylamide pieces.
-
a.
-
22.
Load 5 μL from each sample to gel and run at 150 V for 90 min.
Note: Electrophoresis time may vary based on the size of the gel. For optimal separation, run the gel until the Orange G dye is approximately 1–2 cm from bottom of the gel.
-
23.Disassemble gel electrophoresis and stain gel in 10 000× SYBR Gold dilution in 1×TBE.
-
a.Stain the gel in box with gentle shaking for at least 5 min.
-
a.
-
24.
Visualize gel using UV or blue-light transilluminator.
Note: The labeled probe should appear as a slower migrating DNA band as compared to the unlabeled probe. Similarly, the addition of multiple biotins to the probe is visible as multiple DNA bands of increasing size (see Figure 1B and expected outcomes).
-
25.
Prepare 10 μL (1 pmol) aliquots of labeled probes.
-
26.
Store aliquoted probes at −80°C for up to 3 months.
CRITICAL: Do not freeze-thaw the probe.
(t)RNA separation on PAA gels
Timing: 2–3 h
This section describes the separation of total RNA or tRNA by denaturing polyacrylamide gel electrophoresis.
Note: We routinely use 8%–10% gels (14×10 cm gels), but denser (up to 15%) gels can be used for detection of shorter RNAs, specifically tRFs (Figure 1D). The following method can be also used to verify the purity of tRNA fractions (Figure 1A). Furthermore, we provide alternative steps for gel electrophoresis for detection of tRNAs carrying queuosine (Q) and thiol modifications.
-
27.
Thaw tRNA and/or total RNA samples on ice.
-
28.
Prepare a 10% UREA-PAA denaturing gel and allow it to polymerize for 30–40 min.
Note: For detection of Q or thiol modifications, prepare gels containing 0.25% ABP or 10 μg/mL APM, respectively, as described in the materials and equipment section.
-
29.Meanwhile, prepare samples in 2× RNA loading dye. The recommended sample amount is 200 ng/lane for tRNA and 2 μg/lane for total RNA, respectively.
-
a.Denature at 80°C for 5 min.
-
b.Place immediately on ice and incubate for 1–2 min.Note: RNA samples mixed with 2× RNA loading dye can be prepared in advance and stored at −80°C. Before gel loading, denature them as described in step 29.
CRITICAL: Concerns only Q detection on APB gels; samples need to be deacetylated prior to mixing with 2x RNA loading dye. Prepare deacetylated gel samples as described in table below.Component Final conc./amount Amount per 1 sample 1 M Tris, pH 9.0 0.1 M 1 μL Total RNA or tRNA 5 μg or 500 ng 9 μL Total N/A 10 μL i. Incubate for 30 min at 37°C.ii. Mix with 10 μL of 2× RNA loading dye.iii. Denaturate at 80°C for 5 min.iv. Place immediately on ice and incubate for 1–2 min. Load 8 μL/lane (in step 31).
-
a.
-
30.Place gel to electrophoresis tank filled with 0.5× TBE buffer.
-
a.Pre-run gel at 200V, 20 min.
-
b.Just before loading the gel, rinse wells using syringe and needle to remove urea.
-
a.
-
31.
Load samples to gel and run at 200 V for 90–120 min.
Note: Electrophoresis time may vary based on the size and type of the gel. For optimal separation, run the gel until the bromophenol blue dye is about to run off from the gel. The tested parameters used for APM, APB and other sized gels are in Table 1.
Table 1.
Suitable electrophoresis and transfer parameters for alternative gel sizes
| Procedure | Gel/membrane size |
|
|---|---|---|
| 14×10 cm (large) | 8.6×6.7 cm (mini) | |
| Gel pre-run and electrophoresis (10% gels, TBE or TAE) | 200 V, 20 min (pre-run) 200 V, 90–120 min |
150 V, 20 min (pre-run) 150 V, 80–100 min |
| RNA transfer to membrane (TBE gels) | 400 mA, 45 min | 300 mA, 45 min |
| RNA transfer to membrane (TBE gels containing APM) | 400 mA, 60 min | 300 mA, 60 min |
| RNA transfer to membrane (TAE gels containing APB) | n.d | 250 mA, 30 min |
n.d. not determined (no test performed).
-
32.After electrophoresis, disassemble the gel from the apparatus.
-
a.Transfer the gel to a RNase-free box containing 10 000× diluted SYBR Gold in 0.5× TBE.
-
b.Stain the gel for 3-5 min with gentle shaking.
-
c.Visualize the gel by transillumination and save the image (Figures 1F–1H, left panel).
-
a.
Note: After imaging, transfer the gel back to the staining solution to prevent the gel from drying out.
RNA transfer and UV crosslinking
Timing: 2–3 h
This section describes how resolved (t)RNA is transferred from the gel to a positively charged Amersham™ Hybond-N+ nylon membrane. The RNA is then immobilized on the membrane by UV crosslinking.
Note: This protocol demonstrates the transfer of ∼14×10 cm, 1 mm thick gels, but gels of other sizes can also be used. Where applicable, guidance for handling differently sized gels is provided and tested conditions used for RNA transfer from APM and APB gels are in Table 1.
CRITICAL: Always use clean tweezers when handling membranes and assembling the blot. When handling the gel, use new and clean nitril gloves.
-
33.Prepare material for semi-dry transfer.
-
a.6 sheets of 3MM filter paper (pre-cut by user to 23×14 cm).
-
b.Nylon membrane (pre-cut by user to 14×10 cm).
-
c.PAA gel with our separated (t)RNA in SYBR Gold staining solution or in 0.5× TBE.
-
a.
-
34.
Soak the filter papers and membrane in 0.5× TBE for at least 20 min.
Optional: Although unnecessary in our tests, supplementing 0.5× TBE with 10 mM DTT may improve transfer efficiency of APM gels. For more information, see troubleshooting 4.
-
35.Using tweezers, assemble the semi-dry transfer (from bottom up):
-
a.Place the wet 3MM filter paper on the anode (bottom) of the semi-dry transfer apparatus.
-
b.Gently roll out the bubbles with a roller.
-
c.Repeat steps a-b twice (i.e., 3 sheets of filter paper in total).
-
d.Place the wet membrane on top of the filter papers.
-
e.Place the gel on the membrane. Align the top left corner of the gel with the membrane. Gently remove bubbles using your fingers. Use clean gloves when handling the gel.
-
f.One-by-one, place another set of 3 sheets of wet 3MM filter paper on top of the gel (as described in steps a-b).
-
a.
CRITICAL: Do not use the roller directly on the gel or the membrane. Furthermore, to avoid moving the assembly, only apply gentle pressure when removing bubbles with the roller. Make sure to roll out the air bubbles after each filter paper is added, otherwise it is very easy to trap air bubbles between the layers. The best practice for removing air bubbles is to gently roll from the center of the assembly towards the outer edge in all four directions—center to right, left, up, and down. Rolling from right to left or top to bottom near the edges can reintroduce bubbles, especially in larger gels, where this issue is more pronounced.
Note: A short (or shortened) single-use serological pipette can be used instead of a roller.
-
36.
Gently remove excess liquid from the anode using paper towels.
CRITICAL: Make sure the stack is sufficiently wetted with 0.5× TBE to ensure uniform transfer.
-
37.
Carefully place the lid on the assembly. Apply even pressure until the lid lock clicks into place.
-
38.
Transfer with 400 mA for 45 min.
CRITICAL: To protect the semi-dry transfer apparatus, set the voltage limit to 24 V when using high current power sources, such as Bio-Rad PowerPac HC.
Note: For transfer conditions of mini gels (8.6 × 6.7 cm) and gels containing APM or APB, see Table 1.
-
39.
After transfer, gently disassemble the transfer stack with tweezers.
Note: During the disassembly of the transfer stack, the membrane can be marked with a pencil. This is particularly useful when the membrane will be cut into multiple pieces after crosslinking, allowing simultaneous testing of several probes on different sections.
Optional: After the transfer, re-stain the gel with 10 000× SYBR Gold solution to ensure that transfer was successful, and no air bubbles were present (Figure 1F, middle panel).
-
40.
Briefly rinse the membrane with RNase-free water to remove any residual gel pieces.
-
41.
Dry the membrane between 2 sheets of 3MM filter paper for few minutes.
-
42.
Before crosslinking, place the dried membrane with the RNA side facing up on a sheet of slightly dampened (with RNase-free water or 2xSSC) 3MM filter paper. Wrap the membrane and filter paper together in a single layer of single-use plastic wrap or cling film.
Note: The 3 MM filter paper provides support for easier handling and protects the membrane from contamination. When wrapping, avoid trapping any air bubbles between the membrane and the plastic foil. For direct storage of the membrane after crosslinking, use a dry filter paper as support; however, wrapping the membrane in plastic foil may be slightly more difficult in this case.
-
43.
Place the membrane with the RNA side up to the center of the crosslinker. Crosslink twice using UV wavelength 254 nm and 120 mJ/cm2 energy as settings.
Pause point: To store the membrane, dry it between two clean filter papers and wrap in plastic foil to protect from scratches and contamination. The UV crosslinked membrane can be stored indefinitely at ambient temperature.
-
44.
Proceed to membrane pre-hybridization.
Chemiluminescent northern blot
Timing: 2 days
In this section, biotinylated probes specific to tRNAs and tRNA-derived fragments are hybridized to the RNA containing membrane, followed by chemiluminescent probe detection using streptavidin-HRP conjugate and a chemiluminescence substrate.
Note: Reagent volumes should be adjusted according to the membrane and container size. Unless otherwise specified, all washes are performed at room temperature.
CRITICAL: Throughout the procedure, always handle the membrane with tweezers to prevent contamination.
-
45.
Warm the pre-/hybridization buffer at 65°C in a water bath to dissolve any precipitate, mixing occasionally to aid dissolution.
Note: Dissolving the precipitate can take up to 60 min. Therefore, start with this step at the beginning of transfer.
-
46.
Once dissolved, transfer 15 mL of hybridization buffer to the hybridization tube and place the tube and the remaining buffer to the hybridization oven (set to 42°C–50°C).
Note: The hybridization temperature may need to be individually optimized for each probe. However, 42°C–50°C is suitable for most probes designed in accordance with this protocol.
-
47.
Unwrap the crosslinked membrane from the plastic wrap (see step 43) and briefly dip it into a container with membrane wash buffer (2× SSC, 0.1% SDS). Remove excess buffer by lightly tapping one edge of the membrane on a paper towel.
Note: Wetting the membrane with membrane wash buffer makes it easier to place the membrane into the hybridization tube.
-
48.
Transfer membrane to pre-warmed hybridization buffer in the tube.
CRITICAL: Ensure that the membrane is correctly positioned, and that the RNA side is facing the inside of the hybridization bottle. To prevent excessive background signal, ensure that the membrane does not dry at any point after adding the hybridization buffer.
-
49.
Incubate the membrane in the hybridization oven for >1 h with slow rotation (10–15 rpm).
-
50.
Next, discard the buffer from the tube and add 15 mL of fresh hybridization buffer.
-
51.
In a 1.5 mL tube, mix 500 μL of hybridization buffer and a 10-40 μL (1–4 pmol) aliquot of biotinylated DNA probe.
Note: We successfully used as little as 1 pmol of probe for detection of tRNA isoacceptors and tRNA fragments. However, if the probe is old and/or more samples are loaded onto the gel, a higher probe amount may improve overall signal strength.
CRITICAL: When using commercially labeled probe carrying a single biotin, it may be necessary to use significantly more probe (10- to 50- fold) or more sensitive chemiluminescent substrate (ECL) to reach similar signal intensity as with TdT labeled probe (Figure 1C, troubleshooting 4).
-
52.
Denature the probe for 2 min at 95°C, then cool on ice for 2 min.
CRITICAL: Do not keep the denatured probe on ice for an extended period, as this can cause the hybridization buffer to precipitate.
-
53.Add the denatured probe directly to the tube containing the hybridization buffer and membrane.
-
a.Avoid pipetting the probe directly onto the membrane; instead, dispense it at the bottom of the tube.
-
b.Mix the tube thoroughly to ensure even distribution.
-
a.
-
54.
Incubate the membrane in the oven for 12–16 h at 42°C–50°C with slow rotation (10-15 rpm).
-
55.
On the following day, gently remove the membrane from the hybridization tube and rinse it briefly in membrane wash buffer (2× SSC, 0.1% SDS).
Note: Before removing the membrane from the hybridization tube, make sure that the fresh blocking buffer is ready (see materials and equipment).
-
56.
Wash the membrane in membrane wash buffer (2× SSC, 0.1% SDS) for 5 min.
-
57.
Discard the buffer and repeat the previous step with fresh membrane wash buffer.
Note: If the blots have a strong background, more stringent wash buffers can be used (see troubleshooting 3).
-
58.
Transfer the membrane to a clean container and briefly rinse it with a few mL of PBS wash buffer.
-
59.
Add blocking buffer to completely cover the membrane, then incubate for 60 min with gentle shaking.
Note: Make sure the membrane is completely covered with blocking buffer. 60 mL is usually sufficient for large membranes (14×10 cm) while 20–30 mL is adequate for smaller membranes (8.6×6.7 cm). However, depending on the size of the container used, additional buffer may be needed.
Note: At this point, take ECL components to warm up at 20°C–22°C (if stored at 4°C).
-
60.
Shortly before finishing the blocking incubation (step 59), prepare a 1:30 000 dilution of streptavidin-HRP conjugate in blocking buffer.
-
61.
Discard blocking buffer from Step 59 and add blocking buffer with streptavidin-HRP (step 60) to the membrane. Incubate 30 min with gentle shaking.
-
62.
Transfer the membrane into a clean container and briefly rinse the membrane with PBS wash buffer.
-
63.
Wash membrane 4 × 5 min with PBS wash buffer with gentle shaking. For efficient washing, the membrane should be freely floating in the buffer.
-
64.
Transfer the membrane into a clean container and briefly rinse the membrane with detection buffer.
-
65.
Add detection buffer to the membrane. Incubate membrane for at least 5 min with gentle shaking.
Note: The membrane can be incubated in detection buffer for up to 2–3 h before chemiluminescent detection. Ensure there is always enough buffer to prevent the membrane from drying.
-
66.
Prepare the chemiluminescent substrate (ECL) by mixing luminol/enhancer solution with stable peroxide solution as indicated by manufacturer. For a 14×10 cm membrane, prepare 5–6 mL of the solution.
-
67.
Remove the membrane from the detection buffer and gently blot the edges on a paper towel to drain any excess liquid.
-
68.
Transfer the membrane to a clean container with the RNA side facing up and add chemiluminescent substrate onto the membrane. Protect from light and incubate for 5 min without shaking.
CRITICAL: If the substrate volume is insufficient for the container size, place the membrane RNA side down onto the liquid to prevent it from drying out.
-
69.
Remove the membrane from the substrate and gently blot the edges on a paper towel to drain excess liquid. Wrap the moist membrane in plastic wrap.
CRITICAL: Do not allow the membrane to dry! Avoid trapping air bubbles between the plastic wrap and the membrane.
Note: Air bubbles can be gently pressed out with a roller or fingers.
-
70.
Visualize the signal using a chemiluminescent imaging system (e.g., ChemiDoc MP, Bio-Rad). Optimize the exposure time to ensure efficient signal detection.
Note: For the Chemidoc MP, we recommend using the auto rapid mode with recommended binning size. For weaker signals, manual exposure of 300–1200 s might be necessary. In case no signal is obtained, consult troubleshooting 4.
-
71.
Take a colorimetric picture of the membrane to see its positioning. Pictures can be overlayed and analyzed in the Image Lab software.
Expected outcomes
This protocol describes a method for tRNA enrichment from yeast and bacteria, but it is readily applicable for other organisms. It effectively enriches for tRNA while longer RNA molecules are efficiently removed. Typical tRNA yields from TRIzol isolated bacterial total RNA2 are 9–10 μg, while 4–5 μg can be obtained from yeast total RNA isolated with hot phenol.12 In contrast, the acidic phenol method4 can yield up to 20 μg of yeast tRNA. Isolated tRNA can be utilized for visual inspection to confirm the presence of tRNA-derived fragments (Figure 1A) or further analyzed by sequencing, mass spectrometry and/or Northern blot (Figures 1E–1H).
The Northern blot method described here utilizes enzymatic biotinylation of standard DNA probes (Figure 1B). This allows multiple probe designs to be validated without the need for commercial labeling, which significantly reduces the cost. However, commercially labeled probes can be used, albeit at a reduced sensitivity compared to TdT labeled probes (Figure 1C). This can be compensated by using a higher amount of probe or a more sensitive chemiluminescent substrate.5,6 Furthermore, the Northern blot with chemiluminescent detection is sensitive enough to distinguish individual tRNA isoacceptors and tRNA-derived fragments from as little as 25 ng of tRNA fraction (Figures 1D–1F). This method is compatible with other well-established blotting techniques, such as the detection of queuosinylated or thiolated RNA using 0.25% APB gels (Figure 1G)11 or 10 μg/mL APM gels (Figure 1H),4,13 respectively.
Limitations
The tRNA enrichment method presented here is compatible with virtually any total RNA sample; albeit the main limitation is the minimum amount of total RNA required. For samples with low total RNA input, columns with smaller binding capacities should be used to ensure efficient enrichment. Additionally, pre-tRNAs close to or longer than 120 nt will not be detectable in the tRNA fractions.
The success of the Northern blot depends on the design of the DNA probes. Designing probes for tRNA isoacceptors can be challenging due to their high sequence similarity. Furthermore, the obtained signal intensity varies with target tRNA or RNA abundance. Hence, low-abundance molecules may go undetected. It is also important to recognize that Northern blot results are semiquantitative, and complementary methods may be required for a comprehensive quantitative analysis.
Troubleshooting
Problem 1
Low yields from tRNA enrichment.
Potential solution
-
•
Too high DNA contamination of total RNA used for isolation. Perform DNase treatment of the total RNA.
-
•
Poor integrity of total RNA. Check RNA integrity by gel electrophoresis or automated electrophoresis system (e.g., Agilent TapeStation, Fragment Analyzer, etc.). If the quality of the total RNA is low, consider using other total RNA isolation methods.
-
•
Increase the amount of total RNA for enrichment. We have successfully used up to 250 μg of total RNA with NucleoSpin RNA silica columns (theoretical binding capacity 200 μg).
-
•
Perform the first column purification multiple times (steps 1–6), then pool the tRNA-containing flowthrough and proceed with second column purification (steps 8–14).
-
•
Presence of lipids in the total RNA. Isolate total RNA using protocol for lipid rich samples suitable for used research subject(s).
-
•
Check for precipitates in the buffers and prepare fresh buffers, if necessary. Ensure that the EGDA solution did not change color.
Problem 2
Probe labeling is inefficient or absent.
Potential solution
-
•
Biotin-16-dCTP was freeze-thawed. Use new aliquot or purchase new compound.
-
•
For some probes, only one biotin-16-dCTP is added. This is normal and does not affect probe functionality.
-
•
TdT enzyme was added to the concentrated reaction buffer during master mix preparation.
Problem 3
Too high background for Northern blots.
Potential solution
-
•
Include more stringent washes (e.g., higher buffer temperature or decrease SSC concentration) after step 57.
-
•
Prepare fresh blocking solution.
-
•
Perform longer blocking step with more blocking solution.
-
•
Try a new probe design. A low signal intensity will lead to stronger background depending on the exposure time. When designing a new probe, consider moving the probe’s binding site to different regions of the tRNA. If this is not possible, extending the probe length by a few nucleotides might improve binding efficiency and thus signal intensity. During the design, also consider the presence of modifications and their impact on probe binding. For example, methylations (m22G, m1G, m3G, m1A), isopentenyl group (i6A), t6A and acp3U are known to interfere with Watson-Crick base-pairing and may lead to decreased probe binding.8,9,14
Problem 4
No chemiluminescent signal.
Potential solution
-
•
Check biotinylation efficiency of the DNA probe. The probe might have lost the terminal biotin during storage. Analyze the stored probe on a native PAA gel as described in steps 19–24 or perform a dot blot with the probe only. Spot a few probe dilutions onto the membrane and perform detection (steps 55–71). When using commercially labeled (single biotin) probe, try increasing amount of used probe to improve signal intensity.
-
•
Verify the functionality of all buffers by performing a dot blot using a previously validated probe (as described above).
-
•
Verify that transfer was successful by staining the gel post-transfer with SyBr Gold (Figure 1F, middle panel). In case of APM gel transfers, supplementing 0.5× TBE with 10 mM DTT is utilized to improve transfer efficiency.13
-
•
Decrease the hybridization temperature.
-
•
Load more tRNA and/or total RNA onto the gel. This applies for the detection of molecules with low abundance (steps 27–32).
-
•
Try a new probe design for same target RNA. Follow the guidance provided in problem 3.
-
•
Make sure the chemiluminescent substrate is not degraded.
-
•
Use a more sensitive chemiluminescent substrate, such as SuperSignal West Pico PLUS, Thermo Scientific, 34580).
Resource availability
Lead contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, L. Peter Sarin (peter.sarin@helsinki.fi).
Technical contact
Technical questions on executing this protocol should be directed to and will be answered by the technical contact, Pavlina Gregorova (pavlina.gregorova@helsinki.fi).
Materials availability
This study did not generate new unique reagents.
Data and code availability
This study did not generate new datasets or code.
Acknowledgments
The authors thank Salla Kalaniemi for technical support and all members of the RNAcious laboratory for further testing of this protocol. This work was supported by the Research Council of Finland (grant no. 354906 to L.P.S.) and the Sigrid Jusélius Foundation (grant no. 230182 to L.P.S.). Open access funded by Helsinki University Library. P.G. is a fellow of the Doctoral Programme in Integrative Life Sciences. The graphical abstract was created with BioRender.com.
Author contributions
Conceptualization, P.G.; methodology, P.G., M.-M.K.H., and M.M.L.; visualization, P.G. and M.-M.K.H.; writing – original draft, P.G., M.-M.K.H., and L.P.S.; writing – review and editing, P.G., M.-M.K.H., M.M.L., and L.P.S.; supervision and resources, L.P.S.
Declaration of interests
The authors declare no competing interests.
Contributor Information
Pavlina Gregorova, Email: pavlina.gregorova@helsinki.fi.
L. Peter Sarin, Email: peter.sarin@helsinki.fi.
References
- 1.Cappannini A., Ray A., Purta E., Mukherjee S., Boccaletto P., Moafinejad S.N., Lechner A., Barchet C., Klaholz B.P., Stefaniak F., Bujnicki J.M. MODOMICS: a database of RNA modifications and related information. 2023 update. Nucleic Acids Res. 2024;52:D239–D244. doi: 10.1093/nar/gkad1083. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Lampi M., Gregorova P., Qasim M.S., Ahlblad N.C.V., Sarin L.P. Bacteriophage Infection of the Marine Bacterium Shewanella glacialimarina Induces Dynamic Changes in tRNA Modifications. Microorganisms. 2023;11 doi: 10.3390/microorganisms11020355. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Hwang S.P., Barondeau K., Denicourt C. Protocol to detect m(2)(2)G modification on single tRNA iso-decoders by immuno-northern blotting. STAR Protoc. 2025;6 doi: 10.1016/j.xpro.2025.103924. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Alings F., Sarin L.P., Fufezan C., Drexler H.C.A., Leidel S.A. An evolutionary approach uncovers a diverse response of tRNA 2-thiolation to elevated temperatures in yeast. RNA. 2015;21:202–212. doi: 10.1261/rna.048199.114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.McKenney K.M., Connacher R.P., Dunshee E.B., Goldstrohm A.C. Chemi-Northern: a versatile chemiluminescent northern blot method for analysis and quantitation of RNA molecules. RNA. 2024;30:448–462. doi: 10.1261/rna.079880.123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Hwang S.P., Barondeau K., Denicourt C. Protocol to analyze tRNA and rRNA processing using biotin-labeled probes. STAR Protoc. 2025;6 doi: 10.1016/j.xpro.2025.103866. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Kim S.W., Li Z., Moore P.S., Monaghan A.P., Chang Y., Nichols M., John B. A sensitive non-radioactive northern blot method to detect small RNAs. Nucleic Acids Res. 2010;38 doi: 10.1093/nar/gkp1235. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Khalique A., Mattijssen S., Maraia R.J. A versatile tRNA modification-sensitive northern blot method with enhanced performance. RNA. 2022;28:418–432. doi: 10.1261/rna.078929.121. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Hiley S.L., Jackman J., Babak T., Trochesset M., Morris Q.D., Phizicky E., Hughes T.R. Detection and discovery of RNA modifications using microarrays. Nucleic Acids Res. 2005;33 doi: 10.1093/nar/gni002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Dabrowski P., Rasmus M., Jundzill A., Drewa T., Pokrywczynska M. A comparison of five methods to maximize RNA and DNA isolation yield from adipose tissue. PeerJ. 2024;12 doi: 10.7717/peerj.17071. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Gunaratne L., Moore H., Albaum N., Casius A., Henderson J., Kessler A., Hegedűsová E., Kulkarni S., Arthur H., Ross R.L., et al. Key RNA-binding domains in the La protein establish tRNA modification levels in Trypanosoma brucei. Nucleic Acids Res. 2025;53 doi: 10.1093/nar/gkaf594. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Collart M.A., Oliviero S. Preparation of yeast RNA. Curr. Protoc. Mol. Biol. 2001;Chapter 13 doi: 10.1002/0471142727.mb1312s23. Unit13 12. [DOI] [PubMed] [Google Scholar]
- 13.Sokolowski M., Kwasna D., Ravichandran K.E., Eggers C., Krutyholowa R., Kaczmarczyk M., Skupien-Rabian B., Jaciuk M., Walczak M., Dahate P., et al. Molecular basis for thiocarboxylation and release of Urm1 by its E1-activating enzyme Uba4. Nucleic Acids Res. 2024;52:13980–13995. doi: 10.1093/nar/gkae1111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Hwang S.P., Liao H., Barondeau K., Han X., Herbert C., McConie H., Shekar A., Pestov D.G., Limbach P.A., Chang J.T., Denicourt C. TRMT1L-catalyzed m(2)(2)G27 on tyrosine tRNA is required for efficient mRNA translation and cell survival under oxidative stress. Cell Rep. 2025;44 doi: 10.1016/j.celrep.2024.115167. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
This study did not generate new datasets or code.

Timing: 1 h to 5 days (depending on DNA synthesis service supplier)