Skip to main content
Nucleic Acids Research logoLink to Nucleic Acids Research
. 2026 Feb 17;54(4):gkag139. doi: 10.1093/nar/gkag139

Transposable elements as drivers of genome evolution in Drosophila virilis

Alexander P Rezvykh 1, Dina A Kulikova 2, Elena S Zelentsova 3, Liudmila Protsenko 4, Alina V Bespalova 5, Iuliia O Guseva 6, Justin P Blumenstiel 7, Mikhail B Evgen’ev 8,9, Sergei Y Funikov 10,
PMCID: PMC12910113  PMID: 41700089

Abstract

Transposable elements (TEs) drive genomic innovation, but their dynamics in non-model species remain unclear. Here, we integrated multi-omics data to explore TE dynamics in Drosophila virilis, an important model for repetitive DNA research. By combining computational predictions with manual curation, we identified 100 TE families and delineated three temporal waves of TE mobilization: recent activity, speciation-associated, and ancient invasions. TEs in D. virilis dynamically colonise both euchromatin and heterochromatin, suggesting heterochromatin is not solely a repository for degenerate repeats. While most TEs are widespread across strains, some exhibit strain-specific expansions, indicating varied activity and silencing. We found substantial evidence for horizontal transfer of TEs among close relatives, demonstrating that the D. virilis species group functions effectively as a TE “ecosystem”, allowing for recurrent invasion, loss, and re-invasion of TE lineages across the group. Epigenetic profiling revealed that H3K9me3 spreading from TEs represses adjacent genes in a distance-dependent manner, influenced by insertion length and genomic context, affecting developmental and metabolic genes. We also discovered the first spontaneous polymorphic inversion in D. virilis linked to retrotransposons. Our findings illuminate TEs as drivers of genomic innovation, influencing gene regulation and evolutionary trajectories, providing a framework for studying TE dynamics across animal species.

Graphical Abstract

Graphical Abstract.

Graphical Abstract

Introduction

Transposable elements (TEs) are mobile DNA sequences that can replicate and change their genomic position, allowing them to constitute a major fraction of eukaryotic genomes [14]. Once considered “junk DNA”, these elements are now recognized as crucial drivers of genome plasticity, evolution, and regulation in eukaryotes [57].

The fundamental classification of eukaryotic TEs distinguishes two major classes based on their transposition intermediate: class I—retrotransposons, and class II—DNA transposons [8, 9]. Retrotransposons differ by the presence or absence of long terminal repeats (LTRs). LTR retrotransposons typically encode gag and pol polyproteins, with pol including reverse transcriptase (RT), integrase (IN), protease, and RNase H domains [3, 4]. Certain LTR retroelements may additionally encode a retroviral envelope protein env. This particular class of LTR retrotransposons is currently more widely recognized as endogenous retroviruses (ERVs) [9]. Non-LTR retroelements, such as long interspersed nuclear elements (LINEs), possess a more elementary structural configuration but encode polyproteins that exhibit endonuclease (EN) and RT activities, the latter of which is a prerequisite for target-primed reverse transcription [10]. Penelope-like elements (PLEs) form a distinct monophyletic clade possessing a pseudo-LTR and a GIY-YIG EN domain which is not shared with any other retroelement subclasses [1113]. Class II TEs includes three major groups: transposase-coding elements (e.g. Tc1-Mariner, Cryptons), rolling-circle elements (RC, Helitrons), and self-synthesizing Mavericks [14, 15]. Most class II elements have terminal inverted repeats (TIRs) recognized by transposase, with the exception of Helitrons and Cryptons. TEs can be further divided into superfamilies and families, that are more accurately characterized in terms of phylogenetic relationships and DNA sequence conservation [9].

To control TE activity, hosts employ small RNA-based silencing strategies. In metazoan germline, a distinct class of small RNAs called Piwi-interacting RNAs (piRNAs) plays a crucial role in the silencing of TEs [16, 17]. Regulation of TEs in the germline is of paramount importance, as only TE insertions present in gametes can contribute to the spread of TEs in natural populations. In Drosophila, piRNA silencing relies on three Argonaute proteins: Piwi, Aubergine (Aub), and Argonaute-3 (Ago3), that are loaded with TE-derived piRNAs to mediate co-transcriptional (Piwi) and post-transcriptional repression (Aub/Ago3) [18]. The majority of piRNAs are produced by piRNA clusters, usually located in the pericentromeric and subtelomeric regions of chromosomes and composed of diverged copies of TEs [19, 20]. In both germ cells and the surrounding somatic cells of the Drosophila ovary, piRNA-Piwi complexes silence TEs by inducing changes in chromatin state, including the deposition of the heterochromatic histone mark H3K9me3 [21, 22]. H3K9me3 plays a dual role: it not only reinforces TE silencing but also facilitates the transcription of piRNA precursors, effectively transforming targeted TE insertions into piRNA clusters [2325].

TE-host interactions represent a balance between genomic instability and innovation. TE insertions can disrupt genes or regulatory regions, and their epigenetic silencing can have unintended consequences [26]. Specifically, the repressive histone mark H3K9me3 can “spread” from silenced TEs into adjacent genes, potentially repressing their expression [2731]. While this often leads to purifying selection against such insertions [26, 32], it can also be a source of genetic diversity and adaptation [3336].

Even with robust repressive mechanisms in place, forcing TEs to exist in a transposition-selection balance, TEs persist as one of the most dynamic and rapidly evolving components of eukaryotic genomes. TE content can differ drastically even between closely related species [3739] and contribute to intraspecific variation [29, 4042]. In comparison to the animal and plant genomes [43, 44], insects, particularly Drosophila, exhibit remarkable TE diversity and are excellent models for studying TE dynamics [4547].

The Drosophila virilis species group has emerged as a valuable model for comparative genomics and evolution, offering a robust framework for the study of repetitive DNA due to abundant diversity of interspersed and tandem repeats [4853]. The virilis species group of Drosophila includes 12 species and is divided into three subgroups, or phylads, virilis, littoralis, and montana diverged ∼9 million years ago (mya) [5456]. Within the virilis phylad, D. virilis is the earliest diverging lineage, having split from the ancestor of D. lummei and D. americana/D. novamexicana about 5 mya [54, 55]. Drosophila lummei subsequently diverged about 3 mya, with D. americana and D. novamexicana only diverging from each other about 1 mya [55, 56]. Drosophila virilis harbours a diverse array of TEs, including the Penelope retroelement, which exhibits active transposition implicated in hybrid dysgenesis, a syndrome of hybrid sterility and germline damage [57, 58]. Furthermore, studies in D. virilis have revealed lineage-specific TE expansions, thereby providing evolutionary context for TE diversification and TE silencing mechanisms [20, 59, 60]. Classical cytogenetic studies of the virilis species group demonstrated that D. virilis karyotype is the most primitive and probably ancestral among the virilis phylad based on chromosomal phylogenies [54, 61].

In this study, we employed a multi-omics approach across several D. virilis strains to investigate TE dynamics. We generated a refined, curated TE library and used it to delineate three temporal waves of TE mobilization. We show that TEs dynamically colonize both euchromatin and heterochromatin, exhibit strain-specific expansions, and are regulated by a dynamic piRNA response. Furthermore, we demonstrate that TE insertions can suppress nearby gene expression via H3K9me3 spreading in a distance- and context-dependent manner. Finally, we report the first polymorphic inversion in D. virilis, likely linked to retrotransposon activity.

Materials and methods

Fly stocks and husbandry

Five D. virilis strains were analysed in this study, including three wild-type strains 9 (Batumi, Georgia), 101 (Japan, neutral substrain according to the classification used in hybrid dysgenesis studies) [62], 15010-1051.47 (Hangchow, China), and two laboratory strains with recessive markers, 140 (eb va) and 160 (b; tb gp; cd; pe; gl). Fly stocks of strains 9, 140, and 101 were obtained from the Stock Centre of Koltzov Institute of Developmental Biology RAS (Moscow, Russia). Strain 160 is a long-established strain maintained in our laboratory and has the capacity to induce hybrid dysgenesis [58]. Strain 15010-1051.47 was obtained from the National Drosophila Species Stock Centre at Cornell University (USA). Flies were reared on a standard medium at 25°C until sexual maturity (10–15 days).

DNA extraction, library preparation, ONT sequencing, and genome assembly

The large size of the D. virilis genome (∼390 Mb) is primarily due to the expansion of pericentromeric/centromeric 7 bp satellite DNA [63]. To enrich for euchromatic sequences, we isolated genomic DNA from ovarian tissue, where centromeric satellite DNA is under-replicated due to polytenization [64]. Genomic DNA was isolated from thirty pairs of ovaries from 10–15-day-old females. Ovaries from strains 160, 101, and 1051.47 were collected for DNA extraction. Libraries were prepared with the ONT SQK-LSK109 kit and sequenced on FLO-MIN-106D flow cells. Basecalling was performed with Guppy 6.4.6, followed by quality filtering [65] and adapter removal [66].

Genomes were assembled using Flye v2.9 [67]. Quality was evaluated using QUAST 5.1 [68], and BUSCO (Diptera lineage) [69]. The D. virilis r.1.06 genome [70] was used for reference-based QUAST assessment, and annotation transfer using Liftoff [71].

Genome assemblies for strains 101 and 1051.47 are available from the NCBI BioProject database under accession number PRJNA1279437. The genomes of the 160, 9, and 140 strains, which had been previously sequenced and assembled [7274], were retrieved from NCBI (GCA_007989325.2 – strain 160; GCA_016920725.1 – strain 9; GCA_050656195.1 – strain 140).

To compare PacBio and ONT sequencing errors, we aligned sequenced genomes to a reference (strain 9) using GSAlign [75]. SNPs were identified and annotated within gene loci using R packages VariantAnnotation and GenomicFeatures [76, 77].

To compare homozygosity and heterozygosity levels, reads were aligned to the D. virilis (strain 101) genome using BWA-MEM [78]. Alignments were processed with SAMtools [79]. Variant calling was performed using FreeBayes [80].

This study used ONT reads from strain 160 (for which a PacBio chromosomal assembly is available [73]) for de novo TE insertion analysis and SNP calling using FreeBayes.

De novo annotation of TEs and creation of a curated TE library

We performed de novo annotation of TEs in the D. virilis genomes using RepeatModeler2 [81] with the “-LTRstruct” parameter. The output was filtered to remove non-TE sequences (e.g. ribosomal RNA, numts) and short sequences [82], though LTR elements were exempt from length-based filtering to preserve structural accuracy. “Unknown” sequences from RepeatClassifier were discarded.

Further curation involved aligning the filtered output to existing TE libraries [83, 84] using blastn [85]. Shorter, redundant sequences were removed. Remaining sequences were manually curated and extended using established guidelines [86, 87] and scripts from Storer et al. [88]. A final manual curation involved multiple sequence alignment of full-length copies and annotation of protein domains using the Conserved Domain Database [89]. The resulting library consists of 100 TEs: 14 DNA, 5 RC, 30 LINE, and 50 LTR elements, and 1 PLE (Supplementary File 1). To avoid confusion, the names of the TEs described in this study and their corresponding homologous families in RepBase and Erwin et al. [84] are provided in Supplementary File 2.

TE analysis

To screen genomes for TE insertions, we used RepeatMasker (v 4.1.0) [90] in RMBlast mode. The output was filtered using two criteria: (i) >90% identity over >50 bp, and (ii) <50% overlap with low-complexity regions; only insertions >50 nt were retained. We used the script “one_code_to_find_them_all.pl” [91] with the parameter “–insert 11”.

Divergence times were estimated by calculating Kimura distance from RepeatMasker alignments using a modified “calcDivergenceFromAlign.pl” script. The resulting distance matrix was Z-transformed and clustered via k-means, with the optimal cluster number determined using the factoextra R package [92].

The potential for transposition was assessed by identifying open reading frames (ORFs) [93]. TE sequences were analysed using ORFik [94] and Biostrings [95]; ORFs starting with ATG were translated. Proteins were clustered with CD-HIT (90% similarity). Insertions encoding a protein ≥ 90% of the length of the canonical sequence were considered full-length.

Pericentric heterochromatin was annotated in Integrative Genomic Viewer (IGV) [96] using ChIP-seq data for the heterochromatic mark H3K9me3 from ovarian tissue [97].

For phylogenetic analysis, transposase (DNA transposons) or RT (retroelements) encoding ORFs were aligned using MAFFT [98], trimmed with trimAl [99], and analysed with ProtTest 3 [100]. Phylogenetic trees were inferred using the maximum likelihood method in MEGA 11 [101]. Visualization was performed using iTOL v6 [102].

The ggplot2 package [103] was used to visualize the distribution of TEs across the genome. The custom scripts used in this study are available on https://github.com/aprezvykh/drosophila_virilis_TE_scripts.

Identification of horizontal transfer of TEs

To identify horizontal transfer (HT) of TEs in D. virilis, we searched for near-identical TEs in divergent relatives [104, 105]. We used D. virilis TE sequences as queries in a blastn search against the eight D. virilis group genomes assembled to date. Hits were filtered for ≥ 99.5% sequence identity and ≥ 90% query coverage of the canonical TE length.

To distinguish HT from vertical inheritance, we compared the synonymous substitution rate (dS) of TEs with that of 50 single-copy orthologues from BUSCO [69]. Alignments were generated using MAFFT [98] and dS was calculated using MSA2dist [106]. The dS distributions of genes and TEs were compared with a Mann–Whitney U test (False Discovery Rate (FDR) corrected).

Identification of nonreference TE insertion

Using TELR [107], we identified nonreference TE insertions in D. virilis strains by mapping ONT reads from strains 9, 101, 140, and 1051.47 to the strain 160 reference genome. To identify nonreference TE insertions in strain 160, we used TELR with ONT reads from 160 as a query and the 1051.47 assembly as a reference.

To identify unique TE insertions for each strain, we compared the coordinates of insertions obtained from TELR using the “bedtools intersect” function [108]. Genomic feature distribution was analysed with ChIPSeeker’s “annotatePeak” function [109].

RNA-seq experiments and TE expression analysis

Total RNA was extracted from 10–15-day-old D. virilis ovaries using Extract RNA reagent (Evrogen, Russia). RNA quality (RNA Integrity Number, (RIN) ≥ 8) was confirmed using an Agilent BioAnalyzer 2100. Libraries were prepared from poly(A)-selected RNA using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB, USA) and sequenced on an Illumina NextSeq 2000 (2 × 50 bp; two biological replicates per strain).

Reads were trimmed with TrimGalore and aligned to the genome using STAR 2.7.1a [110]. TE expression analysis was conducted using TEtranscripts [111] with the TE annotation file generated by RepeatMasker. The counts were then normalized to RPKM (Reads Per Kilobase per Million mapped reads). Differential expression of protein-coding genes was analysed with edgeR [112].

Small RNA-seq experiment and TE-targeting piRNA analysis

The ovarian small RNA fraction for cloning was separated from total RNA (∼15 μg) of flies aged 10–15 days using 15% polyacrylamide gel electrophoresis containing 8M urea. Subsequently, gel fragments corresponding to the small RNA fraction were excised using chemically synthesized RNA oligonucleotides corresponding to 21 and 29 nucleotides as size markers. Small RNA libraries were then prepared using the Illumina TruSeq Small RNA Library Prep Kit (Illumina, USA) according to the manufacturer’s protocol.

Following adapter trimming, reads matching ribosomal RNA, tRNA, small nucleolar RNA (snRNA), and microRNA were removed. The remaining reads were mapped to D. virilis TEs and genome using Bowtie [113], with a requirement for a perfect match (0 mismatches). We considered small RNAs 23–29 nt in length as piRNAs, consistent with known piRNA characteristics (1U bias, ping-pong signature) [19, 20]. Analysis of piRNAs, including sorting of sense and antisense piRNAs and calculation of ping-pong signatures, was carried out by well-described techniques [114] and custom scripts written in Python.

ChIP-seq experiments and enrichment analysis of methylated H3K9

ChIP-seq for H3K9me3 and H3K9me2 was performed as described [115] using antibodies ab8898 and ab1220 (Abcam). Libraries were prepared using the NEBNext Ultra II Kit (NEB, USA). Paired-end sequencing (50 + 50 bp) was conducted on an Illumina NextSeq 2000 platform. For analysis of H3K9me3 enrichment in strains 160 and 9, we used data (single-end sequencing) published previously [97].

Reads were aligned to the genome using Bowtie2 [116], processed with SAMtools [117] to filter multimapped reads and remove duplicates, and converted to normalized BigWig files using deepTools2 [118]. Enrichment was calculated by subtracting input signals and generating matrices centred on TE insertions.

To assess the epigenetic impact of unique TE insertions, the H3K9me2/me3 signal in a strain with an insertion (experimental, TE present) was compared to the mean signal from four strains without it (control, TE absent). Enrichment in the 1-2 kb regions flanking the TE was tested for statistical significance using the Mann–Whitney U test (FDR < 0.05). The association between heterochromatin spreading and gene downregulation was assessed using a chi-squared test. Significant loci were manually curated in IGV.

Chromosomal inversion analysis

Chromosomal inversion analysis was performed using pairwise genome-wide alignment with Minimap2 (asm5 preset) [119], visualized with dotPlotly (https://github.com/tpoorten/dotPlotly), and refined with blastn for breakpoint accuracy.

Polytene chromosomes from F1 hybrids (1051.47 × 9 strains) were prepared and stained as described [120].

Polymerase chain reaction (PCR) validation of the inversion breakpoints was performed using primers: P1 – GCGTTTGTTCGCCAAAGCG; P2 – GTCCTGCCAGTTGTTTCAGTTTG; P3 – CATTATAATCTTGCAGCTGCC; P4 – CCGTTAAACTGAATTATGCGCCATG.

The custom scripts used in this study are available in https://github.com/aprezvykh/drosophila_virilis_TE_scripts.

Detailed experimental procedures are provided in the Supplementary Materials.

Results

Whole-genome sequencing and assembly of D. virilis strains of geographic and laboratory origin

To study the diversity of TEs, we utilized genomic assemblies of three D. virilis strains that had been published previously [7274]. In addition, we applied long-read sequencing to generate whole-genome assemblies of two D. virilis strains. All five D. virilis strains examined originated from diverse sources spanning geographic populations and laboratory lineages: three wild-type strains from the Republic of Georgia (strain 9), Japan (strain 101), and China (1051.47), and two laboratory strains, 140 and 160.

Although genome assemblies differed in contig length and number, the N50 was high across all five genomes, ranging from 16.9 Mb in strain 9 to 31 Mb in strain 160 (Table 1). The total length of the genome assemblies ranged from 165.5 Mb in strain 101 to 182.3 Mb in strain 9. The BUSCO percentage of complete orthologues of dipteran genes was similar across the assemblies (99.5%–99.6%) (Table 1). Thus, the analysed genomes are comparable in terms of contiguity, total length, and completeness.

Table 1.

Genome assembly statistics for the five D. virilis genomes studied in this work

Genome Assembly length (Mb) Number of contigs Contigs N50 (Mb) GC (%) BUSCO complete (%) BUSCO single (%) BUSCO duplicated (%)
160 169.7 45 31 40.4 99.6 99.1 0.5
9 182.3 567 16.9 40.5 99.5 99.1 0.4
101 165.5 155 28.9 40.4 99.5 99.2 0.3
140 168.2 219 27.3 40.3 99.6 99.3 0.3
1051.47 174.9 225 27.5 40.4 99.6 99.3 0.3

Genomes of strains 160 and 9 were assembled previously and deposited in GenBank under the numbers GCA_007989325.2 and GCA_016920725.1, respectively. The genomes of strains 101, 140, and 1051.47 were sequenced and assembled in the current study.

We have also performed SNP analysis to determine the levels of heterozygous and homozygous mutations in the studied strains. The analysis indicated that strain 160 has a higher level of heterozygous SNPs than the other strains analysed (Supplementary Fig. S1A).

Expansion and refinement of TEs in D. virilis and creation of a curated library of canonical TE sequences

To establish a comprehensive and high-quality TE library for D. virilis, we integrated computational predictions from RepeatModeler2 [81] with existing databases and extensive manual curation (see the ‘Materials and methods’ section for details). This consolidated library comprises 100 distinct TE families, including 14 DNA transposons, 5 RC/Helitrons, 30 LINEs, 50 LTR retrotransposons, and 1 PLE (Fig. 1). Given the structural features inherent to TEs across diverse subclasses, the reconstruction of full intact canonical TE sequences was successful for 44 elements, including 4 DNA transposons, 2 RC elements, 1 PLE element, 17 LINE retrotransposons, and 20 LTR retrotransposons (marked with green circles in Fig. 1).

Figure 1.

Figure 1.

A guide to the TEs of D. virilis. The left panel lists all annotated TE families in D. virilis in terms of their taxonomy based on phylogenetic analysis and core protein homology with major TE superfamilies and subclasses. The right panel depicts genetic structures of representative elements from each TE family. Outlined boxes are ORFs, coloured regions are protein domains, triangles are repeated sequences (TIRs and LTRs). Element lengths are not to scale. The use of green and red circles is intended to denote intact and severely truncated (remnants) canonical copies of the elements, respectively. Blue circles indicate retroelements with partial reconstruction of their canonical copies. Abbreviations: TIR – Terminal Inverted Repeat-containing transposons; CR – Cryptons; Pol – Mavericks/Polintons; RC – rolling circle replication elements (Helitrons); PLE – Penelope-like elements; LINE – Long Interspersed Nuclear Elements; LTR – Long Terminal Repeat-containing retrotransposons; UN – The TE superfamily has not been identified/domain with unknown function; ORF – open reading frame; TP – transposase; IN – integrase; Rho – transcription termination factor Rho; Hel – helitron helicase-like domain; RecD – helicase subunit RecD; RT – reverse transcriptase; EN – endonuclease; GIY-YIG EN – GIY-YIG endonuclease; ZnF – Zn finger; UMSBP – universal minicircle sequence binding protein; SSL4 – superantigen-like protein SSL4; UL36 – large tegument protein UL36; GAG – retrotransposon gag protein; Gypsy – Gypsy protein; RING – ring finger domain; RP – retropepsin; RH – ribonuclease H domain; Pep Pao – Pao retrotransposon peptidase; PI – GAG-pre-integrase domain.

Following the reconstruction of the consensus TE copies, the phylogenetic analysis was performed using TE sequences of invertebrates from RepBase v27.01 [83] (Supplementary Figs S2S5). This approach enabled us to determine that the four described intact transposase-coding DNA elements belong to the Tc1-Mariner superfamily (Fig. 1 and Supplementary Fig. S2). The analysis of the 17 intact LINE elements demonstrated that 12 belong to the Jockey superfamily, three to the R1 superfamily, and one each to the I and CR1 superfamilies (Fig. 1 and Supplementary Fig. S3). Of the three superfamilies of LTR retrotransposons typically present in Drosophila genomes [3], 14 intact elements belong to the Gypsy superfamily, five to the Bel/Pao superfamily, and one represents the Copia superfamily (Fig. 1 and Supplementary Fig. S4). Finally, the other two intact DNA transposons belong to the Helitron group (Fig. 1 and Supplementary Fig. S5).

The remaining TE families are represented in an incomplete form, exhibiting varying degrees of truncation. For instance, LINE retroelements and LTR retrotransposons frequently exhibit a 5′ or 3′ truncation, likely resulting from deletion or recombination [14, 15]. As a result, essential domains like IN or RT are frequently missing, compromising the element’s basic structure. Retrotransposons Amaarhus, Kelso, Rocinante, Neiman, I-1, Levante, Harmatan, Mistral, Meltemi, Sirocco, Pampero, Khamsin, Ninlil, Chinook, etc., represent just such cases (marked with blue circles in Fig. 1). Despite our efforts, we were unable to reconstruct a complete consensus sequence for these TE families. Thus, these elements were designated as “partial” for further analysis.

As TEs are long-term residents of eukaryotic genomes, particularly in Drosophila, it is often only possible to identify traces of protein domains that were once present. An even more challenging scenario arises when only partial homology with a known TE allows for the tentative classification of a TE into a specific superfamily. For instance, DNA transposons belonging to Polinton and Crypton, as well as LTR retrotransposon families such as Pulsar-1-9 and Cepheid-1-5, represent this group of TEs in the D. virilis genome. We designated such elements as “remnants” (marked with red circles in Fig. 1).

In this study, we re-annotated all TEs in D. virilis, resulting in a refined library of 100 TE sequences. While only 44 intact TEs were fully reconstructed, the remaining elements, classified as partial (26 elements) and remnants (30 elements), provide valuable insights into the evolutionary dynamics of TEs in D. virilis species.

Divergence landscape analysis reveals temporal patterns of TE mobilization in D. virilis

To investigate the evolutionary history of TE activity, we generated divergence landscapes based on Kimura distance for TE copies in the genome of the D. virilis strain 160, which was assembled at the chromosomal level. The estimated Kimura distances were converted into a data matrix, followed by k-means clustering (see the ‘Materials and methods’ section for details). This approach enabled the identification of three discrete TE clusters that reflected the divergence times of the TE families occupying the D. virilis genome.

The first cluster predominantly includes copies of LTR, LINE, PLE, and DNA transposons with low or no divergence from the consensus sequences (K-value ≤ 1). These TE copies occupy 3.6% of the genome (Fig. 2A). Assuming a molecular clock for nucleotide substitutions within TE copies, these elements represent amplification of TE copies that bear a high degree of similarity to their progenitor copy, consistent with recent transposition of an active element. A broader distribution is observed around K values of 0-5 in the second cluster, which likely reflects TE transpositions during the divergence of the D. virilis species group (Fig. 2A). TE copies in this cluster occupy 4.5% of the genome (Fig. 2A). Finally, the third cluster, comprising ancient historical TE transpositions, has K values ranging from 5 to 30 (Fig. 2A). Two waves of TE invasion can be distinguished in this pattern, occurring at K values of around 11 and 25. Comprising the largest portion of the genome (6.6%), the third cluster is dominated by Helitrons and LTR retrotransposons belonging predominantly to partial and remnant families (Fig. 2A).

Figure 2.

Figure 2.

Divergence and occupancy of TEs in the D. virilis. (A) TE divergence landscape. The X-axes show the level of divergence (Kimura substitution level) between each identified TE copy and the consensus sequence for that TE family. The Y-axis shows the part of the genome occupied by each bar (in millions of bases covered). The number of TE clusters was determined by the silhouette method, followed by k-means clustering. Colours represent TE subclasses. (B) The number of TE copies in each cluster, as defined in panel (A), is categorized according to their length relative to the canonical copy. Colours show TE superfamilies. Partial elements according to the structure of their canonical copies were considered only as truncated copies. Remnant elements were considered only as half-truncated (<50% of the canonical copy length). (C) The relationship between the number of TE copies and the number of covered bases in the genome is given for each TE family. Colours show TE superfamilies. Intact, partial, and remnant TEs according to their canonical copies are indicated by circles, rhombuses, and squares, respectively. Data were analysed on the chromosome assembly of strain 160.

We next assessed the structural integrity of TEs within these clusters. A substantial number of TEs accumulated in the genome of D. virilis in a truncated form with low nucleotide substitution from the consensus (Supplementary Fig. S6). Given this, we categorized TEs from intact families as “full-length” if they were ≥90 percent of the consensus length. Shorter copies were considered “truncated”. Given that, a complete canonical copy was recovered only for 44 TE families, the above criterion was applied here and below exclusively to these intact TE families. The remaining partial and remnant TE families were examined only as truncated copies. The distribution of full-length and truncated TE copies differed significantly between clusters (Fig. 2B). As Kimura distance increased, the number of full-length insertions decreased, while the number of truncated copies increased. Cluster 1 was dominated by ∼600 full-length copies, cluster 2 contained ∼250, and cluster 3 contained very few. Conversely, the number of truncated copies was minimal in cluster 1 (>4000), rose sharply in cluster 2 (>6000), and increased dramatically in cluster 3 (over 22 000) (Fig. 2B).

Regarding TE families, more than half of the intact TE families (24 out of 44) were assigned to the first cluster, along with several partial and remnant elements. This suggests that these elements are the youngest and most transpositionally active residents of the D. virilis genome (Fig. 2C). These active families include members of the Gypsy (e.g. Ulysses, Galatea), Jockey (e.g. Demodocus, Snarf), and R1 (e.g. R1, Phemius) superfamilies, as well as Tc1-Mariner DNA transposons (e.g. Paris, Polyphemus) and Penelope (Fig. 2C). A second cluster also contained many intact TEs [15], but included more partial [12] and remnant [8] elements, suggesting lower transpositional activity (Fig. 2C). While LTR retroelements dominate these clusters, the CR1 superfamily (e.g. Rachael) is exceptionally abundant, with over 1600 copies in the genome (Fig. 2B and C). The third cluster consists mainly of partial and remnant TEs (∼89% of the elements in the cluster), representing traces of ancient invasions (Fig. 2C). In contrast to the first two clusters of predominantly intact elements, this cluster still contains some intact Helitrons, LTRs, and LINEs. Notably, Helitron-1 and Helitron-2 represent over half of the ancient TEs, but only a few full-length copies remain (Fig. 2C).

To control for sequencing technology bias (PacBio for strain 160 and ONT for other strains), we confirmed that the Kimura distance distributions and three-cluster structure were consistent across all strains (Supplementary Fig. S7).

In summary, the divergence landscape analysis of TEs in D. virilis revealed distinct evolutionary waves of TE activity, categorized into three clusters based on Kimura distance and copy integrity: recent, speciation-associated, and ancient.

TE dynamics across chromatin domains provide evidence of heterochromatic and euchromatic colonization in D. virilis

Transposon occupancy varied accordingly with the total length of the genome assembly and ranges from 11.8% in strain 101 (the shortest assembly, 165.5 Mb) to 18.8% in strain 9 (the longest assembly, 182.3 Mb; Table 1 and Supplementary Table S1). In the chromosomal assembly of strain 160, TEs occupied just over 14% of the D. virilis genome (Fig. 2A and Supplementary Table S1). Notably, the TE load was estimated for the entire genomes assembled so far, encompassing both euchromatin and heterochromatin regions, that are known to differ significantly in TE density [121].

To separate the TE content in euchromatin from that in pericentromeric heterochromatin, we analysed the TE load in the chromosome assembly of strain 160. The percentage of euchromatin regions of each chromosome comprised by TEs ranged from 3.09% (in chromosome 3, Muller D) to 4.65% (in chromosome 2, Muller E; Supplementary Table S1). The average TE density was 0.74 for DNA transposons, 1.18 for LINE elements, 2.37 for Penelope, 1.61 for LTR elements, and 13.87 for RC elements per million bases (Mb) across all chromosomes (Supplementary Table S2). The density of RC elements was higher than that of other TE subclasses, indicating that RC elements are the most prolific residents of the D. virilis genome.

The key distinction in TE distribution lies not in their sheer abundance, but in their structure and genomic location. Although all TE superfamilies were detected in pericentromeric heterochromatin (Fig. 3A) and the total count of truncated copies showed minimal discrepancy between the two chromatin types (∼14 000 copies in euchromatin versus ∼18 000 in heterochromatin; Fig. 3B), their genomic impact differed significantly. Euchromatin was preferentially enriched for full-length TE copies, while heterochromatin is predominantly occupied by truncated copies (χ2 test, P-value <.001) (Fig. 3C).

Figure 3.

Figure 3.

TE landscape in the genome of D. virilis. (A) Distribution of TEs along chromosomes. Long vertical dashes indicate full-length TE copies (≥90% of the canonical copy length), short vertical dashes indicate truncated TE copies (<90% of the canonical copy length). Dotted vertical lines indicate the boundary between euchromatin and pericentromeric heterochromatin. (B) The bar plots show the number of full-length and truncated TE copies located on different sides of the euchromatin-heterochromatin boundary. For full-length TE copies, the most contrasting TE families are indicated on the right according to their predominant presence either in euchromatin or in pericentromeric heterochromatin. (C) The bar plots show the occupancy of TE copies in both chromatin types. (D) Association between Kimura divergence clusters and chromatin states (euchromatin versus heterochromatin). See also Supplementary Tables S1 and S2. Data were analysed on the chromosome assembly of strain 160.

However, a higher proportion of full-length TE copies from several TE families was observed in heterochromatin compared to euchromatin, and a few TE families were located exclusively in heterochromatin. For instance, the number of full-length copies of the LINE element Rachael, as well as the LTR elements Tv1 and Drogypsy, was 1.5–4 times greater in heterochromatin than in euchromatin (Fig. 3B). Furthermore, the Laodamas and R1 retroelements, as well as the Ino DNA transposon, were represented in the D. virilis genome as full-length copies exclusively in pericentromeric heterochromatin (Fig. 3B). It should be noted, however, that satellite arrays are under-represented due to sequencing DNA from ovaries where centromeric regions is under-replicated due to polytenization.

Analysis of full-length TE copies revealed a distinct distribution pattern based on Kimura divergence clustering. Recent TEs (cluster 1) preferentially occupied euchromatin (χ2 test, P-value <.001), while both speciation-associated (cluster 2) and ancient (cluster 3) TEs were highly associated with heterochromatin (χ2 test, P-value <.01) (Fig. 3D).

In summary, TEs in D. virilis actively colonize both euchromatic and heterochromatic regions. While euchromatin was enriched for young, full-length copies, heterochromatin also hosted a significant number of intact elements, demonstrating that it is not merely a passive repository for degenerate repeats.

TE diversity and intraspecific variation in D. virilis

We next analysed TE abundance across the five D. virilis strains to characterize common features and interstrain variation. As anticipated from the divergence landscape, the most prevalent TE families in the D. virilis genome are represented by the RC elements Helitron-1 and Helitron-2, that had accumulated >4000 copies in each of the genomes studied (Fig. 4A and Supplementary Table S2). Along with Helitrons, DNA transposon PaleoMar-1, LINE elements TART and Rachael, as well as LTR retrotransposons of the Boreas and Khamsin families, were represented by more than a thousand copies in D. virilis genomes (Fig. 4A, Supplementary Fig. S8A, and Supplementary Table S2). However, according to their consensus sequences, only Helitrons, TART, and Rachael had intact full-length copies in the studied genomes (Fig. 4A). The other three TE families were represented only by truncated copies. Furthermore, despite a large number of copies of Helitrons and TART, their full-length representatives were found in only a few copies in the genomes of D. virilis (Fig. 4A and Supplementary Table S2).

Figure 4.

Figure 4.

Comparative analysis of TE abundance, TE expression, and TE-targeting by piRNAs in D. virilis strains. (A) Heatmap depicting the number (log2 values) of full-length (≥90% of the canonical copy length) and truncated (<90% of the canonical copy length) TE copies in the genomes of strains studied. The ratio of full-length to truncated TE copies is given as bars on the right. Only intact TE families according to their canonical copies are shown. (B) Heatmap demonstrating the expression level (RPKM, log2) of intact TE families in ovaries of the studied strains. (C) Heatmaps showing the abundance of piRNAs (left) (RPM, log2) and ping-pong Z-scores (right) for each intact TE family in five strains. (D) Pearson’s correlation coefficient between copy number (full-length only and all (full-length + truncated) copies), TE expression, and piRNA abundance is shown as a heatmap. Pairwise correlations were calculated between all categories for each strain studied and presented as average values. Asterisks indicate P-value (*<.05, **P <.01). (E) Number of full-length copies of intact TE families, divided according to the presence of complete or disrupted ORFs. An ORF was considered complete if it had at least 90% of the ORF length with preservation of the domain structure of the canonical element. Otherwise, an ORF was considered disrupted. Colours represent TE superfamilies. (F) The most abundant intact TE copies with complete ORFs in all genomes examined. The number of TE-copies on the right shows the sum of TE-copies in all strains.

Most potentially active TE family lineages consisted of fewer than 500 copies in the genomes, including both full-length and truncated forms (Supplementary Table S2). While many of these families were present in all five strains, we observed significant quantitative variation in the abundance of full-length copies for several elements, indicating differences in recent transpositional activity. For instance, the Penelope element and DNA transposon Polyphemus were present in a significantly larger number of full-length copies in the genomes of three of the five studied strains (160, 140, and 1051.47) (Fig. 4A and Supplementary Table S2). Full-length copies of the LINE retroelement Slicemaster were found only in the genomes of strains 160, 101, and 1051.47. Another LINE element, Jockey-5, was present only in the genomes of strains 160, 9, and 140 as a full-length copy (Fig. 4A and Supplementary Table S2). Certain TE families exhibited higher representation in only one strain in comparison to others. For example, full-length copies of the LINE element Demodocus predominated in strain 101, while strain 1051.47 demonstrated a predominance of the Bishop element of the R1 superfamily as well as the Barguzin LTR retroelement (Fig. 4A, Supplementary Fig. S9, and Supplementary Table S2).

In D. virilis, the HeT-A elements are divided into three subfamilies (HeT-A, HeT-A2, HeT-A3), and their composition differed across strains. Full-length copies of HeT-A3 predominated in all studied strains except 1051.47, ranging from 5 copies in the genome of strain 101 to 16 copies in the genome of strain 160 (Fig. 4A and Supplementary Table S2). The genome of strain 1051.47 did not contain full-length copies of HeT-A3, but comprised five copies each of HeT-A and HeT-A2, that are absent in the genomes of strains 101 and 140 (Fig. 4A and Supplementary Table S2).

Strain 160 was particularly distinctive, containing full-length copies of all known TE families and showing marked expansions of specific elements like the Paris DNA transposon, the Helena and TART LINE retroelements, and the Calchas LTR retrotransposon (Fig. 4A, Supplementary Fig. S9, and Supplementary Table S2). Importantly, the aforementioned interstrain variations are predominantly formed by intact TE families, whereas partial and remnant TE families exhibited a comparable number of copies across the D. virilis genomes studied (Supplementary Fig. S8A and Supplementary Table S2).

Profiling of TE expression in all studied strains using poly(A)-selected RNA-seq and analysis of TE-targeting piRNAs with perfect match (0 mismatches allowed) in ovarian tissue largely confirmed the identified common features and interstrain variations in the genomic abundance of intact TE families. Among the most expressed TEs in all strains in terms of TE expression and piRNA targeting, the following TE families can be distinguished: TART, Helitron-1, Helitron-2, Galatea, Rachael, Tiresias, HeT-A3, Snarf, R1, Ulysses, Drogypsy, Telemac, and Andromache (Fig. 4B and C). Strain-specific TE families (e.g. Penelope, Helena) also demonstrated higher levels of expression in the strains where they were most prevalent (Fig. 4B and C). Furthermore, the majority of identified intact TE families were targeted by piRNAs that exhibit a ping-pong signature, the hallmark of bona fide piRNA biogenesis (Fig. 4C).

We found a significant correlation between the number of TE copies (full-length + truncated) for intact TE families and TE expression (average Pearson’s R = 0.6, <.01; Fig. 4D). The correlation was weaker when considering only full-length copies (R = 0.35, P <.05), suggesting that truncated copies also contribute to the transcript pool. Interestingly, while piRNA abundance correlated with the number of full-length copies (R = 0.5, P <.01), there was no significant correlation between TE expression and piRNA abundance, indicating a complex and nonlinear relationship between piRNA targeting and transcriptional output.

Conversely, despite the absence of substantial differences in the number of copies, partial and remnant TEs showed significant variation in expression and piRNA targeting between strains (Supplementary Fig. S8B and C). The correlation between TE copy number and expression also varied, with Pearson’s correlation coefficients of 0.4 in some strains and 0.6 in others (P <.05) (Supplementary Fig. S8D). As with intact TEs, their expression did not correlate significantly with piRNA targeting (Supplementary Fig. S8D).

This analysis revealed intraspecific variation in TE composition across D. virilis strains, with each exhibiting unique abundances of specific elements. These distinct TE profiles, supported by expression and piRNA data, indicate strain-specific potentials for TE mobilization that likely contribute to genomic diversity.

The disruption of coding regions limits the functional capabilities of full-length TE insertions

Internal TE mutations can impede the translation of functional TE proteins, thereby limiting transposition even when the element is transcribed [94, 122, 123]. To assess functional potential, we analysed ORF integrity in full-length insertions, defining a ‘complete ORF’ as one covering ≥90% of the consensus sequence with preserved domain structure (see the ‘Materials and methods’ section for details).

The analysis demonstrated that approximately half of the full-length TE copies exhibited incomplete ORFs in four of the five genomes examined, due to mutations that disrupted their integrity (Fig. 4E and Supplementary Table S2). However, an exception to this generalization was observed in the genome of strain 160, where the percentage of disrupted ORFs was lower (∼30%) (Fig. 4E and Supplementary Table S2). Among the TEs with the most copies containing complete ORFs, retrotransposon superfamilies were particularly predominant, including Galatea, Hecuba, Andromache, Snarf, Ziggy, Telemac, Rachael, Penelope, Demodocus, Tiresias, R1, Ulysses, and Drogypsy (Fig. 4F). Overall, ∼0.7% (in strains 101 and 9) to 1.5% (in strain 160) of all individual TE copies (full-length and truncated) were considered capable of transposition. It is noteworthy that the majority of these TEs were enriched in the first cluster, as determined by Kimura distance analysis (Fig. 2). In contrast, only Rachael and Drogypsy were enriched in cluster 2, and despite their age, both appeared to remain active in the genome (Fig. 2).

The number of complete and disrupted ORFs in strain 160 is likely genuine, as SNP analysis showed only minor differences in mutation counts between PacBio and ONT sequencing technologies (Supplementary Fig. S1B).

Our findings reveal that a significant proportion of full-length insertions were functionally inert. Consequently, a comprehensive assessment of TE activity must take into account ORF integrity analysis to accurately distinguish between potentially active elements and nonfunctional genomic relics, thereby refining our understanding of TE-driven genome evolution.

Dynamic regulation of TEs by piRNA pathway in D. virilis

The expression of TEs is tightly regulated by the piRNA pathway, which targets active TEs through sequence complementarity, preventing deleterious mutations and insertions in the germline and somatic cells [17, 18]. The proportion of intact, partial, and remnant TEs in the TE transcript pool closely mirrored the distribution of piRNAs targeting these elements. Intact TE families accounted for >70% of the TE transcript pool in ovaries and are the primary target of piRNA regulation in all strains of D. virilis (Fig. 5A). The remaining piRNAs were distributed among partial and remnant TEs, with variation observed between the strains studied (Fig. 5B).

Figure 5.

Figure 5.

Dynamic regulation of TEs by piRNA pathway in D. virilis. (A, B) The ratio of intact, partial, and remnant TEs in terms of their expression and piRNA targeting in ovaries of the five D. virilis strains studied. Percentage of TEs according to the completeness of their canonical copies constituting the TEs expression pool (RNA-seq) and TE targeting piRNA population (small RNA-seq) in ovarian tissue, respectively. The 1U nucleotide bias, as well as the ratio of sense and antisense piRNAs (percentage), are shown. (C) Relationship between the expression level of TEs and the number of TE-targeting antisense piRNAs. The X-axes show the expression level of TEs determined by RNA-seq. The Y-axis demonstrates the expression level of antisense piRNAs. Expression values for RNA-seq and small RNA-seq were normalized to the number of reads per kilobase per million mapped reads (RPKM) and reads per million mapped (RPM), respectively. (D) The Venn diagram shows strain-specific and common TE families in the studied strains. Only the most expressed TEs, according to TE expression analysis and piRNA targeting, were considered. (E) Examples of mapping of RNA-seq and piRNA reads on the LINE retroelement of CR1 superfamily, Rachael, DNA transposon of Tc1-Mariner superfamily, Paris, and Helitron-2. Data from strains 1051.47, 160, and 9 were used to plot RNA-seq and piRNA reads for Rachael, Paris, and Helitron-2, respectively. Nucleotide biases, including 1U and 10A (percentage), are shown for both sense and antisense piRNA mappers (23–29 nt). The 154 bp tandem repeat region corresponding to the 237–1087 nt region of Helitron-2 is shown.

As revealed by correlation analysis, a clear association between TE expression and piRNA abundance was not always observable (Fig. 4D). We sought to analyse this relationship more thoroughly in every studied strain. We categorized the intact TE families into four distinct groups based on their expression levels and the abundance of TE-targeting piRNAs. The first group comprised TEs that demonstrated both TE expression (log2 RPKM > 0) and antisense piRNAs targeting these elements (log10 RPM ≥ 2) (Fig. 5C). This group likely represents the active TE families in D. virilis strains, as supported by genome-wide analysis of full-length TE copy number. The second group consisted of TEs that exhibited low levels of TE expression (log2 RPKM < 0) but high levels of antisense piRNAs (log10 RPM > 2; Fig. 5C). The discordance in TE expression and their piRNA targeting between the aforementioned groups likely explains the observed lack of significant correlation described previously (Fig. 4D). Importantly, according to Kimura distance, the first group of TEs, with the exception of Rachael and Drogypsy, consisted of young families (cluster 1; Fig. 2C). In contrast, the second group was primarily composed of older families (cluster 2; Fig. 2C), indicating that these TE families have been effectively suppressed by the piRNA pathway throughout their extended presence in the genome. The third group comprised TEs that are expressed in ovarian tissue (log2 RPKM > 0) but demonstrated low targeting by antisense piRNAs (log10 RPM < 2; Fig. 5C). TEs in this group were highly strain-specific, indicating that the same TE families may be active in one strain while represented only by inactive relics of past invasions in others. Consequently, these strains lacked piRNAs that perfectly matched (0 mismatches) and targeted these elements. Finally, the fourth group represented TEs that exhibited a negligible level of both TE expression (log2 < 0) and antisense piRNAs (log10 < 2) in the particular strain (Fig. 5C). Collectively, these findings demonstrate that the piRNA pathway dynamically suppresses TE expression to maintain a balance between genome plasticity and stability.

Among the actively expressed TEs (group 1), we identified both universal and strain-specific families (Fig. 5D). Rachael, Galatea, HeT-A3, Helitron-1, and Helitron-2 were highly expressed across all strains. In contrast, Penelope and Polyphemus expression was elevated in strains 160, 140, and 1051.47, while Paris and Helena were distinctive markers of strain 160.

In summary, our analysis revealed a dynamic and nuanced interplay between TEs and the piRNA pathway in D. virilis. The piRNA system does not uniformly silence all TEs but rather establishes distinct regulatory relationships, categorizing TE families into groups based on their expression and piRNA targeting. This results in effective suppression of older elements, active engagement with recent invaders, and strain-specific patterns that reflect the unique TE history and piRNA repertoire of each population, thereby maintaining a crucial balance between genomic stability and plasticity.

Expression profiling of TEs suggests piRNA biogenesis from TE-derived tandem repeats in D. virilis

Despite extensive methodological developments for measuring TE expression using RNA-seq data, the efficacy of these approaches is constrained by the inherent characteristics of TEs [124]. Since TEs are highly repetitive and evolutionarily related TE families often coexist in the same genome, short sequencing reads derived from TEs frequently map equally well to multiple genomic locations.

With this in mind, we analysed the coverage of RNA-seq and piRNA reads across the sequences of intact 44 TE families (Fig. 1). Examples of the most common TE families, Rachael and Helitron-2, as well as Paris, that illustrate interstrain variations, are shown in Fig. 5E. The coverage profile for Paris showed a relatively uniform distribution of RNA-seq reads, while for Rachael, the mapping profile was shifted towards the 3′-end of the TE sequence (Fig. 5E). This is typical for LINE retroelements, that are frequently represented by 5′-truncated copies (Fig. 5E) [125, 126]. An intriguing coverage pattern was observed for Helitron-2, which demonstrated a marked preference for RNA-seq mapping to the 5′ end of its sequence. Previously, we showed that 154 bp tandem repeats represent one of the most abundant families of medium-sized repeats in the D. virilis genome [127]. This repeat demonstrates a high degree of homology to the region between positions 237 and 1087 in Helitron-2, suggesting that the 154 bp tandem repeats originated from this transposon. The analysis performed in this study demonstrated that the 237–1087 Helitron-2 region exhibited elevated levels of expression for both RNA-seq reads and TE-targeting piRNAs (Fig. 5E). This finding indicates that the 154 nt tandem repeat is transcribed and functions as a source for piRNA production. Importantly, the expression of the full-length copy of Helitron-2 was also determined by northern blot hybridization [127]. Similarly, the coverage profile for Helitron-1 also demonstrated a high prevalence of RNA-seq reads mapping to the 5′-end of the TE sequence (Supplementary Fig. S10). Given that the D. virilis genome contains even more copies of Helitron-1 than Helitron-2, but retains only a few full-length copies (Supplementary Table S2), one may suggest that another medium-sized tandem repeat may be derived from Helitron-1, but this has yet to be described.

Evidence for HT events in D. virilis species group

In Drosophila melanogaster, studies have shown that close relatives frequently share recently mobilized TE lineages through HT [128, 129].

We thus sought to determine the degree to which elements active in the D. virilis genome were also active in relatives. If such TE families showed residence within relatives of D. virilis and also exhibited near identity at the sequence level, this would suggest broad sharing via HT among species within the virilis group. We evaluated this using blastn to identify, among the described 100 TE families, those also present in available genome sequences of eight species within the virilis, littoralis, and montana phylads. Among these TEs, we considered families with identity >99.5% in another species (all species have >4 million years of divergence from D. virilis) to be most likely appeared by HT. This approach revealed 13 families with at least 99.5% identity in at least one another species (Fig. 6A). Eleven of these 13 families were found in another species with 100% identity. Of these 13, three were DNA transposons and ten were retrotransposons. Most sharing of identical TE lineages was among the D. virilis phylad (D. virilis, Drosophila novamexicana, Drosophila americana, Drosophila americana texana), but five TE families had 100% identical copies in at least one species of the montana phylad, which diverged from D. virilis about 9 million years ago (Fig. 6A). In fact, one DNA transposon (Ino) was present in all studied species of the montana phylad, but was found only in D. virilis among the species of the virilis phylad (Fig. 6A). We also calculated the synonymous substitution rate (dS) for the top 50 orthologous genes between D. virilis and other species in the group. We confirmed that for each of the 13 families proposed to have been horizontally transferred, the TE sequence identity was significantly higher (P <.001) than the background dS value (which had median values ranging from 12 to 20), as shown in Fig. 6B.

Figure 6.

Figure 6.

HT of TEs among the D. virilis species group. (А) The results demonstrate the presence of D. virilis TEs in related species, with a minimum completeness of 90% and sequence identity of at least 99.5% compared to the consensus D. virilis TE copies. The cluster’s numbers are given according to the Kimura distance analysis. The species phylogenetic tree used in this analysis was sourced from Yusuf et al. [56]. (B) The synonymous substitution rate (dS) for single-copy orthologous genes and TE ORFs between D. virilis and other species in the group was determined. A conserved set of 50 single-copy orthologs (genes) and 13 potentially horizontally transferred TEs was used. Statistical support was determined by the Mann–Whitney U-test, followed by FDR correction. **P <.01; ***P <.001.

This indicates that HT is frequent among even quite divergent species of the virilis group.

Distinct TE insertional landscapes drive genomic variations in D. virilis

To understand how TE landscapes differ across D. virilis strains, we applied TELR [107]. The application of TELR revealed hundreds of nonreference TE insertions, ranging from 584 in strain 1051.47 to 323 in strain 9 (Supplementary Fig. S11A). The differences in the number of identified nonreference TE insertions are not likely attributable to variation in coverage and read length between the strains, as evidenced by an analysis of read length and coverage-normalized datasets (Supplementary Fig. S11B). However, a slight underestimation of insertions may have occurred in strain 160 due to the limited amount of sequencing data available (genome coverage ∼30×).

Further to estimate the number of TE insertions that comprise the unique landscape of TE invasions, we removed those nonreference TE insertions that overlap between genomes 5 kb upstream and downstream from the TE insertion coordinates defined for each strain. Applying this approach, we identified a total of 425 unique nonreference TE insertions in strain 1051.47, 303 in strain 160, 286 in strain 140, 244 in strain 101, and 230 in strain 9 (Fig. 7A). On the average, 70% of the identified nonreference TE insertions were unique to a single genome (Supplementary Fig. S11A). Analysis of TE age (Kimura distance) showed that 80% of these unique insertions were young, while <1% were ancient (Supplementary Fig. S11C). In contrast, nonunique insertions had a more balanced age distribution. Elements from the intermediate-age Rachael family made up about 20% of both unique and nonunique groups (Supplementary Fig. S11C).

Figure 7.

Figure 7.

Abundance, allele frequency, and genome-wide distribution of unique TE insertions in D. virilis strains. (A) Number of unique TE insertions for D. virilis strains 160, 9, 101, 140, and 1051.47 partitioned by TE superfamilies. (B) Genome-wide TE allele frequency (TAF) distribution for studied strains. (C) Length of unique TE insertions. The length is given as a percentage relative to the length of the canonical TE sequence. The percentage of full-length and truncated/partial TE insertions is indicated next to the boxes. TE insertions that are at least 90% of the length of the canonical element are considered full-length TE insertions. (D) Genome-wide distribution of unique full-length TE insertions across chromosomes is indicated for each strain. Dotted vertical lines indicate pericentromeric regions. (E) The heatmap shows the number of unique TE insertions in each genome, divided by TE family.

Most unique insertions were homozygous (TE allele frequency, TAF ∼1) and full-length (∼70%; Fig. 7B and C), indicating their recent fixation. However, a notable exception was observed in strain 1051.47, where a group of insertions from various TE families, including Rachael, Bishop, Hecuba, and Polyphemus, were found to be heterozygous (TAF < 0.7; Fig. 7B). While predominantly euchromatic, some full-length insertions from Gypsy, CR1, and Tc1-Mariner superfamilies were located in heterochromatin (Fig. 7D).

We identified 29 TE families contributing to this strain-specific variation, 26 of which were intact (Figs 7E and 1). This analysis confirmed the uneven distribution of specific families, such as the exclusive activity of the Paris DNA transposon in strain 160 and the unique Bishop insertions in strain 1051.47. Transpositions of Penelope and Polyphemus occurred in strains 160, 140, and 1051.47 but not in 101 or 9. Four families were particularly prolific, with over 100 insertions across all genomes: the LINE elements Rachael, Snarf, Demodocus, and the LTR element Galatea. Notably, Rachael underwent a major expansion in strain 1051.47, with more than twice as many insertions as in other strains studied (Fig. 7E).

Our analysis revealed distinct TE landscapes across D. virilis strains. This variation was not random. Different strains exhibited unique “signature” expansions of specific TE families, such as Paris in strain 160 and Rachael in strain 1051.47. Collectively, the identification of hundreds of strain-specific, unique TE insertions, predominantly from young, intact families, demonstrates that recent and ongoing TE activity has actively shaped the genomes of different populations of D. virilis.

TE insertions modify gene expression in a distance- and location-dependent manner

Transposon insertions can significantly influence gene expression through various genetic and epigenetic mechanisms, ranging from direct disruption of coding sequences (CDS) to epigenetic silencing and long-range chromatin effects [1, 32].

To investigate the influence of TEs on the expression of adjacent genes, we categorise protein-coding genes based on their distance to the unique TE insertions identified previously (0–1 kb, 1–2 kb, etc.). From this point onwards, the “TE present” category denotes the strain containing a unique TE insertion, whereas the “TE absent” category refers to the control group comprizing all other strains lacking that specific insertion (see the ‘Materials and methods’ section for details). We analysed ovarian mRNA expression for each of the five strains individually, and then combined the results to provide a general overview. We found that TEs affected the expression of genes located up to 2 kb from their insertions (0–1 kb, P <.001; 1–2 kb, P <.05; Mann–Whitney U test followed by FDR correction; Fig. 8A). No significant changes in gene expression were observed in the region >2 kb from the TEs (Fig. 8A). Both correlation and principal component analyses demonstrated a high level of similarity between the biological replicates for each sample (Supplementary Fig. S12).

Figure 8.

Figure 8.

Effects of TE insertions on host gene expression. (A) The pattern of gene expression changes according to the distance to the TE insertion. (B) The distribution of unique TE insertions across genomic features is given for strains 160, 9, 101, 140, and 1051.47. A region up to 1 kb upstream of the transcription start site of genes is considered the promoter region. (C) The pattern of gene expression changes depending on the genomic features. Statistical significance in was assessed by the Mann–Whitney U test followed by FDR correction. * indicates P <.05, ** indicates <.01 and *** denotes P <.001.

Approximately 45% of all unique TE insertions were located within gene introns (Fig. 8B). A substantial proportion of TEs, reaching about 40%, were located within intergenic regions. Only 5%–8% of TE insertions were found in gene promoters, and ∼5% were located in gene exons (Fig. 8B). This distribution was only slightly different between full-length and truncated TE insertions (Supplementary Fig. S13A).

A general decrease in gene expression was observed when TE insertions were located in promoters and introns (Fig. 8C). However, for intronic insertions, this decrease was only observed if the TE was positioned within 1 kb of the nearest exon (P <.01, Mann–Whitney U test, FDR-corrected) (Fig. 8C). As expected, a marked decline in gene expression was evident due to TE insertions within gene exons (Fig. 8C). A statistically significant decrease in gene expression was also detected for TE insertions in the 5′ untranslated region (5′ UTR) and CDS, but not in the 3′ untranslated region (3′ UTR; Fig. 8C).

The location of TE insertions relative to genes had a significant impact on gene expression. Overall, 187 of 521 genes (35.8%) with nearby TE insertions showed significant differential expression (p-adj < 0.05) (Supplementary Table S3). Of these, 127 genes were downregulated (log2FC range: −0.16 to −8.7) and 60 were upregulated (log2FC range: 0.34–2.27). A breakdown by TE location showed that intronic insertions had the broadest effect, significantly altering expression for 138 of 400 genes. Promoter and exonic insertions affected 19 of 49, and 17 of 29, respectively (Supplementary Table S3).

Herein, we systematically assessed how TE insertions may influence nearby gene expression using a comparative genomics approach, integrating high-confidence TE insertion calls with gene expression data. Our analysis demonstrated that TE insertions can act as local modulators of gene expression in the D. virilis genome and are primarily associated with gene repression. The magnitude of this repression is determined by a dual dependency: distance from a gene (maximal within 0–1 kb, detectable up to 2 kb) and genomic location (most severe in promoters, exons, and introns located close to exons).

Heterochromatin spreading from TE insertion sites contributes to a reduced expression of adjacent genes

To provide a mechanistic interpretation of the observed overall reduction in gene expression near TE insertions, we examined the epigenetic effects of TE silencing by profiling the repressive histone mark H3K9me3 in the ovaries of all five strains studied. Specifically, we performed ChIP-seq for strains 101 and 1051.47 as well as re-analysed ChIP-seq data for strains 160, 9, and 140 that had been published previously [72, 97]. We then quantified H3K9me3 enrichment near unique TE insertions by comparing strains where a specific TE was present to strains where it was absent (see the ‘Materials and methods’ section for details). This analysis was performed separately for full-length and truncated TE insertions.

As indicated by the H3K9me3 profiles, heterochromatin spreading was observed at distances of up to 4 kb from full-length TE insertions (Fig. 9A and B). Moreover, H3K9me3 spreading of up to 4 kb was only evident in two of the five analysed strains, specifically in strains 160 and 101. In the remaining three strains (9, 140, and 1051.47), a statistically significant enrichment of H3K9me3 was observed in the region extending up to 3 kb from TE insertions (Fig. 9A and B). The level of the H3K9me3 mark also appeared to be higher in the downstream region compared to the upstream region of TE insertions across all strains examined (Fig. 9A and B). Importantly, only a minority of unique TE insertions (23%–48%) demonstrated H3K9me3 spreading across all D. virilis strains examined (Fig. 9A and B).

Figure 9.

Figure 9.

Epigenetic effects of TE insertions on host gene expression. (A) The genome-wide H3K9me3 occupancy around full-length TE insertions in the studied genomes. The shaded areas indicate the 95% confidence interval. The pie chart in the corner on the right shows the percentage of TE insertions with or without determined H3K9me3 spread. (B) The enrichment analysis of H3K9me3 occupancy in 0–1 kb windows flanking TE insertions. The colours for the experimental group (TE present) and the control group (TE absent) correspond to those shown in panel (D). (C) The percentage of TE insertions with and without H3K9me3 spread according to the genomic features. The numbers on the bars indicate the number of TE insertions with and without H3K9me3 spreading in each category. ** and *** denote P-values <.01 and <.001, respectively, determined by chi-squared test. (D) The proportion of TE insertions with epigenetic effects for each TE family. All unique TE insertions observed for all five strains were used. The value (n) indicates the number of unique TE insertions for a given TE family. (E) Examples of H3K9me3 spreading affecting gene expression at the pyd, Maltase, and Pdk gene loci. Gene names are given according to the names of their orthologues in D. melanogaster. Statistical significance in (B), (C), and (E) was assessed by the Mann–Whitney U test followed by FDR correction. * indicates P <.05, ** indicates <.01 and *** denotes P <.001.

The enrichment of H3K9me3 in the regions flanking TE insertions was significantly more pronounced for full-length insertions compared to truncated ones (Supplementary Fig. S13B). In contrast to full-length TE insertions (Fig. 9A and B), we observed the spread of H3K9me3 exclusively in strain 101, and only up to 1 kb downstream of truncated TE insertions (Supplementary Fig. S13C and D).

In Drosophila, both di- and trimethylation of H3K9 have been demonstrated to function as repressive post-translational histone modifications [130, 131]. To investigate their roles, we performed ChIP-seq on strain 140 ovaries and found no statistically significant difference in H3K9me2 and H3K9me3 enrichment around TE insertions, indicating that the epigenetic effects of TE silencing involve both examined H3K9 modifications in similar proportions (Supplementary Fig. S14).

Crucially, the functional impact of this spreading was highly dependent on genomic context. Association analysis revealed that H3K9me3 spreading strongly correlated with gene repression when TEs were located in promoters or exons (χ² test, P <.01; Fig. 9C). In contrast, for intronic insertions located >1 kb from an exon, reduced gene expression was typically not associated with H3K9me3 spreading (χ2 test, P >.05). Furthermore, for TE insertions located >1 kb from the nearest exon, a reduction in gene expression was less likely to be associated with H3K9me3 spreading (χ2 test, P <.01; Fig. 9C).

The propensity to induce heterochromatin also varied among TE families. For instance, insertions of the LTR retrotransposon Drogypsy showed the strongest H3K9me3 enrichment and the highest proportion of insertions with epigenetic effects (100%), though they were rare (Fig. 9D and Supplementary Fig. S15). In contrast, more abundant families like Rachael and Galatea exhibited moderate enrichment, with only about half of their insertions causing detectable spreading (Fig. 9D and Supplementary Fig. S15).

As a case in point, consider the insertions of the LINE retroelements Demodocus, R1, and Bishop in the genomes of 160, 101, and 1051.47, respectively (Fig. 9E). In all cases, the TE insertions induced spreading of the heterochromatin mark H3K9me3. The insertion of Demodocus was associated with a substantial decrease in the expression of the pyd (polychaetoid) gene (log2FC = −2.6, p-adj < 0.05) in strain 160 (Fig. 9E). Similarly, the insertion of R1 into the maltase A gene cluster led to a drastic decrease in Mal-A5 gene expression (log2FC = −2.2, p-adj < 0.05) in the genome of strain 101 (Fig. 9E) [132]. Interestingly, Mal-A5 is the only gene from the maltase A cluster that is expressed in the ovaries of D. melanogaster according to modENCODE [133]. Given the conservation of the maltase gene clusters in Drosophila species, it can be assumed that oogenesis in strain 101 is accompanied by glucose deficiency. Finally, the insertion of Bishop in the genome of 1051.47 is of particular interest, as it is a potential factor for the concurrent downregulation of the expression of two genes concurrently. This TE insertion occurred in the exon encoding the 3′UTR of the DUBAI (Deubiquitinating apoptotic inhibitor) gene and was associated with H3K9me3 spreading both upstream and downstream. This was associated with the downregulation of both the DUBAI (log2FC = −1, p-adj < 0.05) and Pdk (Pyruvate dehydrogenase kinase) (log2FC = −2.8, p-adj < 0.05) genes strain 1051.47 (Fig. 9E).

Our findings demonstrate that heterochromatin spreading from TE insertion sites is a significant mechanism contributing to the reduced expression of adjacent genes in D. virilis. This epigenetic effect is most pronounced for full-length TE insertions, with the repressive H3K9me3 mark extending up to 4 kb and exhibiting a directional bias, primarily downstream. Crucially, the functional impact of this spreading is highly dependent on genomic context: it is strongly associated with gene repression when TEs are located in promoters or exons, but has a negligible effect for intronic insertions distant from exons. This suggests that the epigenetic consequences of TE silencing are not uniform, but are modulated by both the structural integrity of the TE and its precise location within the genome.

Retrotransposon insertions are associated with a polymorphic inversion in D. virilis

It is widely established that TEs are frequently linked to chromosomal rearrangements across various species, including Drosophila, with inversions being a predominant occurrence [3, 134].

In the course of our study, we identified a spontaneous inversion of ∼4.5 Mb in length located in the medial part of the fourth chromosome (Muller B) in D. virilis strain 1051.47 (Fig. 10A). Precise mapping of the breakpoints demonstrated that the proximal inversion breakpoint was located in a region downstream of the CG9259 gene locus in strain 1051.47 (contig_36:12834530-12839314) (Fig. 10B). The distal inversion breakpoint was located in the region between the CG14397 and CG10801 gene loci in the genome of strain 1051.47 (contig_36:17426774-17427313) (Fig. 10B).

Figure 10.

Figure 10.

Polymorphic chromosomal inversion in D. virilis. (A) The dot plots illustrate the inversion in the genome of strain 1051.47 in comparison to the chromosomal assembly of the genome of strain 160 and other D. virilis strains that have been analysed. Up to 10% divergence was allowed for sequence alignment. (B) Schematic representation of the inversion region in the genomes of strains 1051.47 and 160. Light and dark grey indicate regions of homology beyond and within the inversion breakpoints, respectively. The names of genes are given according to the names of their orthologues in D. melanogaster, if the gene ortholog exists. (C) Polytene chromosomes of the salivary glands of the F1 hybrid from the cross between the strains 1051.47 and 9. The dotted white line indicates the inversion region at cytogenetic loci 44B–44E of chromosome 4 (Muller B). (D) PCR validation of the inversion breakpoints. The alignment of the P1–P4 primer regions is shown in (B). L is a ladder. Strain 1051.47 is referred as 1051.

The use of the blastn algorithm for pairwise alignment of the corresponding genomic regions encompassing the proximal inversion breakpoint revealed a 4784 nt gap in the genome of strain 1051.47. Further analysis indicated a full-length Rachael TE insertion located just between the aligned homologous regions at the proximal breakpoint (Fig. 10B). Furthermore, the genomic region downstream of the Rachael insertion also showed a loss of homology between the compared genomes. This loss can be attributed to an imbalance in the number of insertions of another TE, the LTR retrotransposon Hecuba. Specifically, a single Hecuba insertion was identified in strain 160, while double Hecuba insertions were detected in genome 1051.47 (Fig. 10B).

The DAIBAM Miniature Inverted-repeat Transposable Elements (MITE) is implicated in at least 20% of both intraspecific and interspecific chromosomal inversions observed in the virilis subgroup [135]. Furthermore, DAIBAM is implicated in 80% of inversions in Drosophila americana [136]. Following this, we checked for the presence of DAIBAM at both inversion breakpoints in the 1051.47 genome. We did not find DAIBAM sequences at or near the identified breakpoints, indicating that DAIBAM is not associated with the inversion breakpoint in this case.

To confirm the detected chromosomal inversion, strain 1051.47 was crossed with strain 9. In the salivary gland chromosomes of the F1 hybrid, the inversion appeared as a loop at cytological loci 44B–44E (Fig. 10C). The breakpoints were validated by PCR (Fig. 10D).

Discussion

A high-quality curated library revealed historical waves of TE colonization in the D. virilis genome

High-quality TE annotation is fundamental for understanding genome function, evolution, and stability, as well as TE-host interactions [87, 88]. Historically, only a limited number of TEs have been annotated and curated for D. virilis. This TE annotation relied mostly on direct analysis of TE insertions that were identified as the causal factor for phenotypic mutations during the study of hybrid dysgenesis [58, 137143, 144].

By integrating computational predictions from RepeatModeler2 with existing databases and rigorous manual curation, we have established a refined library of 100 TE families for D. virilis. This resource, which includes 44 intact, 26 partial, and 30 remnant elements, provides a robust foundation for the current and future studies, correcting and expanding upon previous TE annotations.

A notable feature of many DNA transposons is the generation of short yet transpositionally active elements known as MITEs (miniature inverted-repeat TEs) [145]. Typically, MITEs lack coding capacity but possess conserved TIRs and frequently attain high copy numbers in genomes. The D. virilis genome has been shown to harbour abundant MITEs, with several families already documented [74, 135, 136, 146]. However, this study did not include MITEs, warranting their careful examination and curation in future research.

In genetic research, TE landscapes are used to quantify the sequence divergence between individual TE copies and a family consensus sequence. Histograms of the resulting Kimura distances [147] offer insights into TE activity over evolutionary timescales, serving as a proxy for divergence time [87, 148150]. Our divergence landscape analysis delineates three temporal waves of TE mobilization, reflecting the dynamic history of the D. virilis genome. The first cluster comprises young, recently active families with low Kimura divergence, many of which are intact and enriched in euchromatin. The second cluster, with intermediate divergence, likely corresponds to mobilization events during the diversification of the virilis species group [5456]. A similar pattern of TE distribution was observed in the genomic assemblies of closely related species of D. americana and D. novamexicana, and even the diverged subgroup of D. montana [49, 151]. Finally, the third, ancient cluster is dominated by degenerate copies of Helitrons and LTR retrotransposons, occupying the largest genomic territory and residing primarily in heterochromatin. This pattern of ancient TE invasions is pervasive among species of the genus Drosophila, as observed in D. melanogaster and other species groups, providing a retrospective view of the history of genome colonization by TEs [151154].

Heterochromatin as a dynamic reservoir for TEs

Pericentromeric heterochromatin, with its low meiotic recombination, is enriched with repetitive TEs and is considered a genomic repository for superfluous DNA [155, 156]. Euchromatic TE insertions, however, are less tolerated as they are likely subject to negative selection [157, 158].

The landscape of TE insertions is far from random. It is shaped by both sequence-level preferences, such as specific nucleotide motifs or structural features, and chromatin context, including accessibility, histone modifications, and nuclear architecture [159161]. While some TEs prefer open chromatin, others target heterochromatin via host factor tethering [162166]. The data presented in the current study also suggest that the repressive environment of heterochromatin is not a substantial constraint for the transposition of intact elements. Indeed, dozens of essential genes were identified in the pericentromeric heterochromatin of Drosophila [167]. The accumulation of full-length TEs in heterochromatin may be explained by epigenetic heterogeneity, where euchromatin-like islands lack the H3K9me3 mark, providing a platform for transcription factors [168, 169].

Pericentromeric heterochromatin forms 3D domains with euchromatin via liquid–liquid phase separation [169]. TEs, which recruit repressive marks like H3K9me2/3, may facilitate this spatial organization. The accumulation of TEs in heterochromatin suggests that these interactions are dynamic and could influence fitness, though whether this is due to insertion or retention bias remains unclear.

Certain TEs exhibit a preference for insertion into heterochromatin. A notable example is the I-element in D. melanogaster, which shows a strong tendency to integrate into pericentromeric regions under hybrid dysgenesis conditions [170]. To this end, in Drosophila, representatives of the R1 superfamily of TEs, R1 and R2, exhibit a preference for inserting into the ribosomal DNA cluster located in the pericentromeric regions of X and Y chromosomes [171].

In summary, the accumulated data challenge the paradigm that heterochromatin solely harbours degenerate repeats and suggest that TEs actively colonize these regions, potentially exploiting their unique chromatin environment.

TE-derived tandem repeats as a source for piRNA production

Once dismissed as “junk” DNA, along with TEs, tandem repeats like satellite DNA are now known to be vital for chromosome structure, heterochromatin assembly, and development [172, 173]. Both TEs and satellite DNAs may produce piRNAs, linking them to genome defence. In D. melanogaster, complex satellite DNAs are transcribed into lncRNAs and processed into piRNAs via the Rhino-Deadlock-Cutoff complex [174]. The Helitron-2-derived 154-nt repeats demonstrate similar properties, being transcribed and processed into piRNAs. Given that the D. virilis genome is especially rich in repeats, including tandem repeats of various sizes [50, 51, 175], it raises key questions: what signals trigger the transcriptional activation of these repeats, and how does the piRNA machinery recognize different repeat classes? The rhinoG31D mutation causes Rhino to redistribute from piRNA clusters to satellite repeats, altering the piRNA profile [176], highlighting the need to investigate differences in piRNA production from TE-derived versus satellite repeats.

Strain-specific TE landscapes reveal dynamic regulation and a potential for genomic conflict

Our findings show that the D. virilis genome contains diverse TE families, with RC elements (Helitron-1 and Helitron-2) being the most abundant, consistent with prior reports of their high copy number in Drosophila [3]. The presence of intact full-length copies of certain TE families (e.g. Demodocus, Snarf, Agelaus, Galatea, Hecuba, Ziggy, Anticlea, Telemac, Andromache, etc.) targeted by piRNAs in all strains suggests recent invasions. The conservation of these elements across the studied strains contrasts with the variable presence of other families like Penelope and Polyphemus, that show strain-specific patterns probably reflecting different evolutionary histories or selective pressures in these strains. The predominance of truncated copies demonstrated for most TE families is consistent with the high rate of DNA loss documented in other Drosophila genomes [177, 178].

The dominance of LINE elements Demodocus and Rachael in strains 101 and 1051.47 contrasts with the prevalence of LTR retrotransposons in strains 9, 140, and 160. This biased TE family representation mirrors patterns in Drosophila simulans, where LTR retrotransposons have proliferated in specific lineages through episodic bursts [179]. While these bursts may arise spontaneously, they are frequently linked to stressful conditions, including extreme temperatures, irradiation, chemical exposure, or viral infection [180184]. Since some TEs, such as Copia, have been found to contain sequences homologous to the promoters of heat shock protein genes [185], it will be important to investigate TE expression and potential mobilization in D. virilis after heat shock, to identify responsive TEs and adaptive insertions that may contribute to stress adaptation.

Based on its unique TE composition, strain 160 is an established “inducer” of D. virilis hybrid dysgenesis [58, 142]. The uneven distribution of active TEs like Paris and Helena between strains explains the paternal transmission of TEs to naïve maternal genomes, causing germline mobilization and sterility in certain crosses [62, 84]. Our finding of higher TE expression in strains where they are more prevalent supports their direct role in this syndrome.

The interstrain variations in TE composition have important evolutionary implications. Although hybrid dysgenesis may be rare in nature, the underlying “genomic shock” comprising TE activation, novel insertions, and the resulting epigenetic and transcriptional changes can occur on a more localized scale. Low-level genomic turmoil, driven by differential TE activity, provides a continuous source of genetic variation that can contribute to population differentiation and adaptation. Strain-specific TE patterns may even contribute to reproductive isolation through genomic incompatibilities [186, 187]. Future work should explore how these TE differences translate into phenotypic variation and population divergence in D. virilis.

The observed significant correlation between total TE copy number (full-length + truncated) and expression levels suggests that both types of copies contribute to the TE transcript pool, possibly through the transcription from cryptic promoters, flanking gene promoters or the presence of internal promoters in truncated elements [188, 189]. It is also important to note that truncated TEs can be “hidden” within chimeric gene–TE transcripts. Because they are controlled by the gene’s own promoter, their expression level is not a true measure of the TE’s activity [190, 191]. An alternative explanation is that the correlation arises from genomic co-occurrence. While both full-length and truncated copies are linked to TE expression, this may be a coincidence of their shared location rather than evidence that truncated copies are directly involved in transcription.

HT and functional decay: modes of TE persistence

Evidence from D. melanogaster demonstrates that lineages of recently mobilized TEs are frequently shared among close relatives through HT [128, 129]. Consequently, a TE’s ecosystem can be viewed as encompassing the genomes of close relatives, suggesting adaptation to a broader host group rather than a single species.

The most well-described TE in D. melanogaster is the P-element. It invaded D. melanogaster from D. willistoni via HT and can cause hybrid dysgenesis [104, 192]. Since this discovery, it has become increasingly clear that HT is an important source of newly invading TEs [105, 193]. Two factors facilitating transfer are ecological proximity, as with the P-element’s spread during New World colonization, and phylogenetic relatedness, where TEs pre-adapted to one host can readily function in a related host within a similar cellular environment [194].

We found substantial evidence of HT of 13 TE families among species of the virilis group, including between phylads that diverged ∼9 million years ago. More broadly, these results support the hypothesis that a single species is not the entire ecosystem for TE lineages. Rather, groups of related species are, with recurrent invasion, loss, and re-invasion. This pattern of sharing among related species is consistent with a recent study that identified phylogenetic relatedness as an important factor in TE HT rates [195].

Conversely, within a genome, TEs are subject to mutational decay. Crucially, our ORF integrity analysis revealed that a significant proportion (∼30%–50%) of full-length TE insertions contain disruptive mutations, rendering them nonfunctional. This highlights that the mere presence of a full-length sequence is an insufficient proxy for transposition competence; a comprehensive assessment must integrate structural and coding potential to distinguish active TEs from genomic relics.

The predominance of retrotransposon families (Galatea, Hecuba, Andromache, Rachael, etc.) among TEs with complete ORFs is particularly noteworthy. This pattern may reflect several biological phenomena. While HT imposes purifying selection on all TEs, the selective pressures during within-host evolution differ dramatically between TE classes. Retrotransposons predominantly evolve under purifying selection within host genomes, a pattern consistent with the cis-preference of their replication mechanism, which directly links a copy’s transposition to the functionality of its own proteins [193]. In contrast, DNA transposons evolve neutrally within hosts due to trans-complementation, which decouples a copy’s replication from its own coding capacity [193]. This fundamental difference in selection regimes explains why the long-term persistence of DNA transposons relies more heavily on HT than that of retrotransposons. Across a broad phylogenetic scale of animals, the accumulation of TEs in genera is not consistently linked to effective population size [196]. This suggests that long-term genome size evolution is not predominantly driven by genetic drift, but rather depends on lineage-specific factors such as host silencing mechanisms and deletion biases [196].

A TE-induced inversion breaks karyotypic stasis in D. virilis

Inversions, which are widespread in Diptera species including D. melanogaster populations, are often caused by TEs [3, 134]. While most TE-induced inversions are deleterious, some become fixed due to selective advantages [197]. Inversions were also shown to play a significant role in the evolution and speciation of the virilis species group [48, 49]. However, D. virilis is an exception within the virilis group, showing a highly stable karyotype.

Our study identifies the first spontaneous chromosomal inversion in D. virilis (strain 1051.47), a ∼4.5 Mb event linked to Rachael and Hecuba retrotransposon insertions at its proximal breakpoint, connecting retrotransposon activity to macro-evolutionary change. The distal breakpoint lacked such evidence, possibly due to transposon loss. Alternatively, the inversion may have arisen from misrepair of a transposon-induced double-strand break via nonhomologous end joining, a mechanism prevalent in the D. melanogaster group [198]. While spontaneous inversions were not reported in D. virilis, numerous inversions and other aberrations with TE-associated breakpoints have been found in this species in the progeny of dysgenic crosses [48].

Inversions may influence speciation by maintaining co-adapted gene complexes via suppressed recombination in heterozygotes [199, 200]. For instance, inversions at the X chromosome were shown to reduce gene flow between Drosophila flavomontana and D. montana, supporting their role in reinforcing species boundaries [201]. Future studies could investigate how inversion polymorphisms contribute to local adaptation in D. virilis.

TEs as drivers of gene regulation

Numerous studies have demonstrated how TE insertions may influence nearby gene expression, with a few even providing adaptive advantages [31, 202206]. In this study, we show that the spread of H3K9me3 from TEs is predominantly associated with reduced gene expression, but only when the TE is inserted in a promoter or exon. H3K9me3 spreading extends up to 4 kb from full-length TE insertions, consistent with D. melanogaster studies showing that heterochromatin spreading is distance-limited [29]. In contrast, in the Drosophila nasuta species group, H3K9me3 enrichment is detected near TE insertion sites, both upstream and downstream, but rapidly diminishes within 100 bp [39]. Variation in H3K9me3 spreading patterns across Drosophila species likely reflects differences in species-specific genomic and epigenetic regulation. Similar distribution patterns observed in D. virilis and D. melanogaster suggest the utilization of shared chromatin remodellers such as Heterochromatin proteins 1 (HP1) and Su(var) proteins or RNA interference pathways that reinforce H3K9me3 over larger distances [19, 20]. In contrast, the narrow H3K9me3 spreading boundaries demonstrated in D. nasuta species group probably imply stronger barriers to spreading, including insulator elements that may block the spreading, competing euchromatin histone marks (e.g. H3K4me3). The demonstrated difference in the spreading between Drosophila species may also be due to the expansion of species-specific Drosophila interspersed elements observed in the D. nasuta species group that may lack strong heterochromatin nucleation signals (e.g. piRNA targeting) [39].

In contrast to D. virilis, in D. melanogaster, more than half of the analysed euchromatic TEs are associated with the spread of repressive epigenetic marks by at least 1 kb and do not show differences in spreading distance, even between species of D. melanogaster subgroup [29, 37]. However, a recent genome-wide, multitissue analysis [31] reveals this broad-stroke view obscures critical nuances. The epigenetic effects of TEs are not monolithic but are profoundly dependent on genomic context and tissue type. For instance, the repressive effect was strongest in the ovary but significantly weaker in the head, linked to the expression of chromatin regulators [31]. Therefore, the variation in spreading potential observed in D. virilis is unlikely to reflect long-term evolutionary adaptive strategies. Rather, it arises from the complex interplay between chromatin architecture and the balance of TE suppression with gene expression fidelity, driven by the expansion of the most active TE families.

Beyond influencing gene expression via insertion and epigenetic spreading, DNA transposons can generate structural variation through imprecise excision [207]. Our analysis confirmed characteristic target site duplication (TSD) motifs (e.g. TA for Paris and Polyphemus, AT for Alcinous) at insertion sites. However, a genome-wide assessment did not reveal a strong correlation between these TE families and small, disruptive indels in CDS (data not shown).

In summary, while piRNA-mediated silencing initiates heterochromatin formation, the extent of spreading depends on the length of TE insertions, genomic context, and probably specific properties of TE families. These epigenetic modifications influence developmental and metabolic genes, providing potential fitness trade-offs in species evolution. However, it is important to note that our evaluation of TE-driven epigenetic changes and their functional effects on gene expression probably falls short of the real effects in natural populations. The study used long-established laboratory fly strains, where small population sizes and reduced selective pressure may alter TE-gene dynamics. Furthermore, our analysis was limited to homozygous insertions in ovarian tissue, unlike the heterozygous insertions found across various tissues and developmental stages in wild populations.

Conclusion

Since the discovery of its extensive satellite DNA content by Joe Gall and colleagues in the 1970s [51], D. virilis has been an important model for understanding the evolution and function of repetitive DNA. Our study provides a comprehensive description of TE dynamics in D. virilis, integrating genomic, epigenomic, and transcriptomic analyses across several strains to uncover the evolutionary and regulatory impact of TEs. By creating a refined TE library, we demonstrate that, despite the potential to disrupt genome stability, TEs persist as active contributors to genetic diversity, with their activity patterns reflecting both recent and ancient invasions. The interplay between TE mobilization and host silencing mechanisms, such as piRNA-mediated repression, demonstrates a delicate balance that shapes genome evolution. The study elucidates TE distribution across chromatin domains, their strain-specific variations, and their epigenetic effects on neighbouring genes. The observed heterogeneity in TE activity and silencing across strains suggests that TEs may contribute to population differentiation and adaptation. We also show recurrent HT of TEs within the virilis species group, supporting earlier observations of ongoing TE influx [208] and suggesting that closely related species act as a common ecosystem for TE lineages. Furthermore, the discovery of a chromosomal inversion linked to TE activity in D. virilis underscores the broader implications of TEs in genomic rearrangements and speciation. Our work establishes TEs as key drivers of genomic diversity and regulation. Future research should explore the functional consequences of TE-mediated regulation and expand comparative analyses across the virilis group including populations recently collected in the wild.

Supplementary Material

gkag139_Supplemental_Files

Acknowledgements

We thank David Ray from Texas Tech University for his assistance in the manual curation of D. virilis TE library. The authors are grateful for information obtained from the library of the virtual museum of the Institute of Developmental Biology, Russian Academy of Sciences, supported by the State Budget Project 0088-2024-0011 of the Institute of Developmental Biology, 2024. Sequencing was performed using the equipment of the Engelhardt Institute of Molecular Biology RAS “Genome” centre (http://www.eimb.ru/rus/ckp/ccu_genome_c.php).

Author contributions: Alexander P. Rezvykh (Data curation [lead], Formal analysis [lead], Investigation [lead], Methodology [equal], Software [lead], Visualization [equal], Writing – review & editing [equal]), Dina Kulikova (Formal analysis [equal], Investigation [equal], Methodology [supporting], Validation [equal], Writing – review & editing [supporting]), Elena Zelentsova (Investigation [equal], Methodology [equal], Validation [equal], Writing – review & editing [supporting]), Liudmila A. Protsenko (Formal analysis [equal], Investigation [equal], Validation [equal], Writing – review & editing [equal]), Alina V. Bespalova (Formal analysis [supporting], Validation [supporting], Writing – review & editing [supporting]), Iuliia O. Guseva (Formal analysis [supporting], Validation [supporting], Writing – review & editing [supporting]), Justin P. Blumenstiel (Formal analysis [equal], Investigation [equal], Validation [equal], Writing – review & editing [equal]), Mikhail B. Evgen’ev (Methodology [equal], Project administration [equal], Supervision [equal], Writing – review & editing [equal]), Sergei Yu. Funikov (Conceptualization [lead], Formal analysis [equal], Investigation [equal], Methodology [equal], Project administration [lead], Resources [lead], Supervision [lead], Validation [equal], Visualization [equal], Writing – original draft [lead], Writing – review & editing [equal])

Notes

Present address: Institute of Molecular Biotechnology of the Austrian Academy of Sciences (IMBA), Vienna BioCenter (VBC), Dr. Bohr-Gasse 3, 1030 Vienna, Austria

Contributor Information

Alexander P Rezvykh, Engelhardt Institute of Molecular Biology of Russian Academy of Sciences, Moscow 119991, Russia.

Dina A Kulikova, Koltzov Institute of Developmental Biology, Russian Academy of Sciences, 119334 Moscow, Russia.

Elena S Zelentsova, Engelhardt Institute of Molecular Biology of Russian Academy of Sciences, Moscow 119991, Russia.

Liudmila Protsenko, Engelhardt Institute of Molecular Biology of Russian Academy of Sciences, Moscow 119991, Russia.

Alina V Bespalova, Engelhardt Institute of Molecular Biology of Russian Academy of Sciences, Moscow 119991, Russia.

Iuliia O Guseva, Moscow Center for Advanced Studies, Kulakova Str. 20, 123592 Moscow, Russia.

Justin P Blumenstiel, Department of Ecology and Evolutionary Biology, University of Kansas, Lawrence, Kansas 66049, United States.

Mikhail B Evgen’ev, Engelhardt Institute of Molecular Biology of Russian Academy of Sciences, Moscow 119991, Russia; Institute of Evolution, University of Haifa, Haifa 3498838, Israel.

Sergei Y Funikov, Engelhardt Institute of Molecular Biology of Russian Academy of Sciences, Moscow 119991, Russia.

Supplementary data

Supplementary data is available at NAR online.

Conflict of interest

None declared.

Funding

This project was supported by the Russian Science Foundation grant 22-74-10050-P.

Data availability

High-throughput sequencing data performed in this study includes RNA-seq for strains 160, 101, and 1051.47; small RNA-seq for strains 160, 9, 101, 140, 1051.47; ChIP-seq (H3K9me3) for strains 101, 1051.47; ChIP-seq (H3K9me2) for strain 140; raw ONT reads for strains 160, 9, 101, and 1051.47 were deposited in NCBI GEO under the number GSE307819. The accession number for ChIP-seq (H3K9me3) for strains 160 and 9 in NCBI GEO is GSE59965. ChIP-seq, RNA-seq for strain 140, as well as RNA-seq for strain 9, can be downloaded from NCBI GEO using the number GSE292339. Raw ONT reads for strain 140 were deposited in the NCBI SRA (SRX28458524).

References

  • 1. Gebrie  A. Transposable elements as essential elements in the control of gene expression. Mobile DNA. 2023;14:9. 10.1186/s13100-023-00297-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Hassan  AH, Mokhtar  MM, El Allali  A. Transposable elements: multifunctional players in the plant genome. Front Plant Sci. 2023;14:1330127. 10.3389/fpls.2023.1330127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Mérel  V, Boulesteix  M, Fablet  M  et al.  Transposable elements in Drosophila. Mobile DNA. 2020;11:23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Wells  JN, Feschotte  C. A field guide to eukaryotic transposable elements. Annu Rev Genet. 2020;54:539–61. 10.1146/annurev-genet-040620-022145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Bourque  G, Burns  KH, Gehring  M  et al.  Ten things you should know about transposable elements. Genome Biol. 2018;19:199. 10.1186/s13059-018-1577-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Carotti  E, Carducci  F, Barucca  M  et al.  Transposable elements: epigenetic silencing mechanisms or modulating tools for vertebrate adaptations? Two sides of the same coin. Int J Mol Sci. 2023;24:11591. 10.3390/ijms241411591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Fueyo  R, Judd  J, Feschotte  C  et al.  Roles of transposable elements in the regulation of mammalian transcription. Nat Rev Mol Cell Biol. 2022;23:481–97. 10.1038/s41580-022-00457-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Finnegan  D.J. Eukaryotic transposable elements and genome evolution. Trends Genet. 1989;5:103–7. 10.1016/0168-9525(89)90039-5. [DOI] [PubMed] [Google Scholar]
  • 9. Wicker  T, Sabot  F, Hua-Van  A  et al.  A unified classification system for eukaryotic transposable elements. Nat Rev Genet. 2007;8:973–82. 10.1038/nrg2165. [DOI] [PubMed] [Google Scholar]
  • 10. Arkhipova  IR, Yushenova  I.A. To Be mobile or not: the variety of reverse transcriptases and their recruitment by host genomes. Biochemistry Biokhimiia. 2023;88:1754–62. 10.1134/S000629792311007X. [DOI] [PubMed] [Google Scholar]
  • 11. Arkhipova  IR, Pyatkov  KI, Meselson  M  et al.  Retroelements containing introns in diverse invertebrate taxa. Nat Genet. 2003;33:123–4. 10.1038/ng1074. [DOI] [PubMed] [Google Scholar]
  • 12. Craig  RJ, Yushenova  IA, Rodriguez  F  et al.  An ancient clade of penelope-like retroelements with permuted domains is present in the green lineage and protists, and dominates many invertebrate genomes. Mol Biol Evol. 2021;38:5005–20. 10.1093/molbev/msab225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Lyozin  GT, Makarova  KS, Velikodvorskaja  V.V  et al.  The structure and evolution of Penelope in the virilis species group of Drosophila: an ancient lineage of retroelements. J Mol Evol. 2001;52:445–56. 10.1007/s002390010174. [DOI] [PubMed] [Google Scholar]
  • 14. Arkhipova  I.R. Using bioinformatic and phylogenetic approaches to classify transposable elements and understand their complex evolutionary histories. Mobile DNA. 2017;8:19. 10.1186/s13100-017-0103-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Piégu  B, Bire  S, Arensburger  P  et al.  A survey of transposable element classification systems–a call for a fundamental update to meet the challenge of their diversity and complexity. Mol Phylogenet Evol. 2015;86:90–109. [DOI] [PubMed] [Google Scholar]
  • 16. Haase  A.D. An introduction to PIWI-interacting RNAs (piRNAs) in the context of metazoan small RNA silencing pathways. RNA Biol. 2022;19:1094–102. 10.1080/15476286.2022.2132359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Wang  X, Ramat  A, Simonelig  M  et al.  Emerging roles and functional mechanisms of PIWI-interacting RNAs. Nat Rev Mol Cell Biol. 2023;24:123–41. 10.1038/s41580-022-00528-0. [DOI] [PubMed] [Google Scholar]
  • 18. Czech  B, Munafò  M, Ciabrelli  F  et al.  piRNA-guided genome defense: from biogenesis to silencing. Annu Rev Genet. 2018;52:131–57. 10.1146/annurev-genet-120417-031441. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Brennecke  J, Aravin  AA, Stark  A  et al.  Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell. 2007;128:1089–103. 10.1016/j.cell.2007.01.043. [DOI] [PubMed] [Google Scholar]
  • 20. Rozhkov  NV, Aravin  AA, Zelentsova  E.S  et al.  Small RNA-based silencing strategies for transposons in the process of invading Drosophila species. RNA (New York, NY). 2010;16:1634–45. 10.1261/rna.2217810. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Sienski  G, Dönertas  D, Brennecke  J. Transcriptional silencing of transposons by Piwi and maelstrom and its impact on chromatin state and gene expression. Cell. 2012;151:964–80. 10.1016/j.cell.2012.10.040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Wang  SH, Elgin  S.C. Drosophila Piwi functions downstream of piRNA production mediating a chromatin-based transposon silencing mechanism in female germ line. Proc Nat Acad Sci USA. 2011;108:21164–9. 10.1073/pnas.1107892109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Andersen  PR, Tirian  L, Vunjak  M  et al.  A heterochromatin-dependent transcription machinery drives piRNA expression. Nature. 2017;549:54–9. 10.1038/nature23482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Klattenhoff  C, Xi  H, Li  C  et al.  The Drosophila HP1 homolog Rhino is required for transposon silencing and piRNA production by dual-strand clusters. Cell. 2009;138:1137–49. 10.1016/j.cell.2009.07.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Le Thomas  A, Stuwe  E, Li  S  et al.  Transgenerationally inherited piRNAs trigger piRNA biogenesis by changing the chromatin of piRNA clusters and inducing precursor processing. Genes Dev. 2014;28:1667–80. 10.1101/gad.245514.114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Choi  JY, Lee  Y.C.G. Double-edged sword: the evolutionary consequences of the epigenetic silencing of transposable elements. PLos Genet. 2020;16:e1008872. 10.1371/journal.pgen.1008872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Rebollo  R, Miceli-Royer  K, Zhang  Y  et al.  Epigenetic interplay between mouse endogenous retroviruses and host genes. Genome Biol. 2012;13:R89. 10.1186/gb-2012-13-10-r89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Pezic  D, Manakov  SA, Sachidanandam  R  et al.  piRNA pathway targets active LINE1 elements to establish the repressive H3K9me3 mark in germ cells. Genes Dev. 2014;28:1410–28. 10.1101/gad.240895.114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Lee  Y.C.G., Karpen  G.H. Pervasive epigenetic effects of Drosophila euchromatic transposable elements impact their evolution. eLife. 2017;6:e25762. 10.7554/eLife.25762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Choi  JY, Purugganan  M.D. Evolutionary epigenomics of retrotransposon-mediated methylation spreading in rice. Mol Biol Evol. 2018;35:365–82. 10.1093/molbev/msx284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Coronado-Zamora  M, González  J. The epigenetics effects of transposable elements are genomic context dependent and not restricted to gene silencing in Drosophila. Genome Biol. 2025;26:251. 10.1186/s13059-025-03705-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Hollister  JD, Gaut  B.S. Epigenetic silencing of transposable elements: a trade-off between reduced transposition and deleterious effects on neighboring gene expression. Genome Res. 2009;19:1419–28. 10.1101/gr.091678.109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Rech  GE, Radío  S, Guirao-Rico  S  et al.  Population-scale long-read sequencing uncovers transposable elements associated with gene expression variation and adaptive signatures in Drosophila. Nat Commun. 2022;13:1948. 10.1038/s41467-022-29518-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Schrader  L, Schmitz  J. The impact of transposable elements in adaptive evolution. Mol Ecol. 2019;28:1537–49. 10.1111/mec.14794. [DOI] [PubMed] [Google Scholar]
  • 35. Sotero-Caio  CG, Platt  RN  2nd, Suh  A  et al.  Evolution and diversity of transposable elements in vertebrate genomes. Genome Biol Evolut. 2017;9:161–77. 10.1093/gbe/evw264. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Ullastres  A, Merenciano  M, González  J. Regulatory regions in natural transposable element insertions drive interindividual differences in response to immune challenges in Drosophila. Genome Biol. 2021;22:265. 10.1186/s13059-021-02471-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Huang  Y, Shukla  H, Lee  Y.C.G. Species-specific chromatin landscape determines how transposable elements shape genome evolution. eLife. 2022;11:e81567. 10.7554/eLife.81567. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Prado-Martinez  J, Sudmant  PH, Kidd  J.M  et al.  Great ape genetic diversity and population history. Nature. 2013;499:471–5. 10.1038/nature12228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Wei  KH, Mai  D, Chatla  K  et al.  Dynamics and impacts of transposable element proliferation in the Drosophila nasuta Species group radiation. Mol Biol Evol. 2022;39:msac080. 10.1093/molbev/msac080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Beck  CR, Collier  P, Macfarlane  C  et al.  LINE-1 retrotransposition activity in human genomes. Cell. 2010;141:1159–70. 10.1016/j.cell.2010.05.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Coronado-Zamora  M, Salces-Ortiz  J, González  J. DrosOmics: a browser to explore -omics variation across high-quality reference genomes from natural populations of Drosophila melanogaster. Mol Biol Evol. 2023;40:msad075. 10.1093/molbev/msad075. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Rahman  R, Chirn  GW, Kanodia  A  et al.  Unique transposon landscapes are pervasive across Drosophila melanogaster genomes. Nucleic Acids Res. 2015;43:10655–72. 10.1093/nar/gkv1193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Neumann  P, Novák  P, Hoštáková  N  et al.  Systematic survey of plant LTR-retrotransposons elucidates phylogenetic relationships of their polyprotein domains and provides a reference for element classification. Mobile DNA. 2019;10:1. 10.1186/s13100-018-0144-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Richardson  SR, Doucet  AJ, Kopera  H.C  et al.  The influence of LINE-1 and SINE retrotransposons on mammalian genomes. Microbiol Spectr. 2015;3:Mdna3–0061-2014. 10.1128/microbiolspec.MDNA3-0061-2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Kaminker  JS, Bergman  CM, Kronmiller  B  et al.  The transposable elements of the Drosophila melanogaster euchromatin: a genomics perspective. Genome Biol. 2002;3:Research0084. 10.1186/gb-2002-3-12-research0084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Mérel  V, Gibert  P, Buch  I  et al.  The worldwide invasion of Drosophila suzukii is accompanied by a large increase of transposable element load and a small number of putatively adaptive insertions. Mol Biol Evol. 2021;38:4252–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Vargas-Chavez  C, Longo Pendy  NM, Nsango  S.E  et al.  Transposable element variants and their potential adaptive impact in urban populations of the malaria vector Anopheles coluzzii. Genome Res. 2022;32:189–202. 10.1101/gr.275761.121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Evgen’ev  MB, Zelentsova  H, Poluectova  H  et al.  Mobile elements and chromosomal evolution in the virilis group of Drosophila. Proc Nat Acad Sci USA. 2000;97:11337–42. 10.1073/pnas.210386297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Flynn  JM, Ahmed-Braimah  YH, Long  M  et al.  High-quality genome assemblies reveal evolutionary dynamics of repetitive DNA and structural rearrangements in the drosophila virilis subgroup. Genome Biol Evolut. 2024;16:evad238. 10.1093/gbe/evad238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Flynn  JM, Long  M, Wing  R.A  et al.  Evolutionary dynamics of abundant 7-bp satellites in the genome of Drosophila virilis. Mol Biol Evol. 2020;37:1362–75. 10.1093/molbev/msaa010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Gall  JG, Atherton  D.D. Satellite DNA sequences in Drosophila virilis. J Mol Biol. 1974;85:633–64. 10.1016/0022-2836(74)90321-0. [DOI] [PubMed] [Google Scholar]
  • 52. Orsini  L, Huttunen  S, Schlötterer  C. A multilocus microsatellite phylogeny of the Drosophila virilis group. Heredity (Edinb). 2004;93:161–5. 10.1038/sj.hdy.6800487. [DOI] [PubMed] [Google Scholar]
  • 53. Silva  BSML, Heringer  P, Dias  GB  et al.  De novo identification of satellite DNAs in the sequenced genomes of Drosophila virilis and D. americana using the RepeatExplorer and TAREAN pipelines. PLoS One. 2019;14:e0223466. 10.1371/journal.pone.0223466. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Patterson  JT, Stone  WS. Evolution in the Genus Drosophila. New York: Macmillan, 1952. [Google Scholar]
  • 55. Throckmorton  LH. Drosophila systematics and biochemical evolution. Annu Rev Ecol Syst. 1977;8:235–54. 10.1146/annurev.es.08.110177.001315. [DOI] [Google Scholar]
  • 56. Yusuf  LH, Tyukmaeva  V, Hoikkala  A  et al.  Divergence and introgression among the virilis group of Drosophila. Evol Lett. 2022;6:537–51. 10.1002/evl3.301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Evgen’ev  M.B. What happens when Penelope comes? An unusual retroelement invades a host species genome exploring different strategies. Mob Genet Elements. 2013;3:e24542. 10.4161/mge.24542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Lozovskaya  ER, Scheinker  VS, Evgen’ev  M.B. A hybrid dysgenesis syndrome in Drosophila virilis. Genetics. 1990;126:619–23. 10.1093/genetics/126.3.619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Rozhkov  NV, Schostak  NG, Zelentsova  E.S  et al.  Evolution and dynamics of small RNA response to a retroelement invasion in Drosophila. Mol Biol Evol. 2013;30:397–408. 10.1093/molbev/mss241. [DOI] [PubMed] [Google Scholar]
  • 60. Zelentsova  H, Poluectova  H, Mnjoian  L  et al.  Distribution and evolution of mobile elements in the virilis species group of Drosophila. Chromosoma. 1999;108:443–56. 10.1007/s004120050396. [DOI] [PubMed] [Google Scholar]
  • 61. Spicer  G.S. Reevaluation of the phylogeny of the Drosophila virilis species group (Diptera: drosophilidae). Ann Entomol Soc Am. 1992;85:11–25. 10.1093/aesa/85.1.11. [DOI] [Google Scholar]
  • 62. Funikov  SY, Kulikova  DA, Krasnov  G.S  et al.  Spontaneous gain of susceptibility suggests a novel mechanism of resistance to hybrid dysgenesis in Drosophila virilis. PLos Genet. 2018;14:e1007400. 10.1371/journal.pgen.1007400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Bosco  G, Campbell  P, Leiva-Neto  J.T  et al.  Analysis of Drosophila species genome size and satellite DNA content reveals significant differences among strains as well as between species. Genetics. 2007;177:1277–90. 10.1534/genetics.107.075069. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64. Belyaeva  ES, Zhimulev  IF, Volkova  E.I  et al.  Su(UR)ES: a gene suppressing DNA underreplication in intercalary and pericentric heterochromatin of Drosophila melanogaster polytene chromosomes. Proc Nat Acad Sci USA. 1998;95:7532–7. 10.1073/pnas.95.13.7532. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65. De Coster  W, D’Hert  S, Schultz  D.T  et al.  NanoPack: visualizing and processing long-read sequencing data. Bioinformatics. 2018;34:2666–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66. Bonenfant  Q, Noé  L, Touzet  H. Porechop_ABI: discovering unknown adapters in Oxford Nanopore Technology sequencing reads for downstream trimming. Bioinform Adv. 2023;3:vbac085. 10.1093/bioadv/vbac085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67. Kolmogorov  M, Yuan  J, Lin  Y  et al.  Assembly of long, error-prone reads using repeat graphs. Nat Biotechnol. 2019;37:540–6. 10.1038/s41587-019-0072-8. [DOI] [PubMed] [Google Scholar]
  • 68. Gurevich  A, Saveliev  V, Vyahhi  N  et al.  QUAST: quality assessment tool for genome assemblies. Bioinformatics. 2013;29:1072–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69. Simão  FA, Waterhouse  RM, Ioannidis  P  et al.  BUSCO: assessing genome assembly and annotation completeness with single-copy orthologs. Bioinformatics. 2015;31:3210–2. [DOI] [PubMed] [Google Scholar]
  • 70. Clark  AG, Eisen  MB, Smith  D.R  et al.  Evolution of genes and genomes on the Drosophila phylogeny. Nature. 2007;450:203–18. [DOI] [PubMed] [Google Scholar]
  • 71. Shumate  A, Salzberg  S.L. Liftoff: accurate mapping of gene annotations. Bioinformatics. 2021;37:1639–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72. Bespalova  AV, Kulikova  DA, Zelentsova  E.S  et al.  Paramutation-like behavior of genic piRNA-producing loci in Drosophila virilis. Int J Mol Sci. 2025;26:4243. 10.3390/ijms26094243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73. Hemmer  LW, Dias  GB, Smith  B  et al.  Hybrid dysgenesis in Drosophila virilis results in clusters of mitotic recombination and loss-of-heterozygosity but leaves meiotic recombination unaltered. Mobile DNA. 2020;11:10. 10.1186/s13100-020-0205-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74. Rezvykh  AP, Funikov  SY, Protsenko  L.A  et al.  Evolutionary dynamics of the pericentromeric heterochromatin in Drosophila virilis and related species. Genes. 2021;12:175. 10.3390/genes12020175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75. Lin  HN, Hsu  W.L. GSAlign: an efficient sequence alignment tool for intra-species genomes. BMC Genomics. 2020;21:182. 10.1186/s12864-020-6569-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76. Lawrence  M, Huber  W, Pagès  H  et al.  Software for computing and annotating genomic ranges. PLoS Comput Biol. 2013;9:e1003118. 10.1371/journal.pcbi.1003118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77. Obenchain  V, Lawrence  M, Carey  V  et al.  VariantAnnotation: a bioconductor package for exploration and annotation of genetic variants. Bioinformatics. 2014;30:2076–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78. Li  H, Durbin  R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 2009;25:1754–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79. Li  H, Handsaker  B, Wysoker  A  et al.  The sequence alignment/map format and SAMtools. Bioinformatics. 2009;25:2078–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80. Garrison  E, Marth  G. Haplotype-based variant detection from short-read sequencing. arXiv, 10.48550/arXiv.1207.3907, 17 July 2012, preprint; not peer reviewed. [DOI]
  • 81. Flynn  JM, Hubley  R, Goubert  C  et al.  RepeatModeler2 for automated genomic discovery of transposable element families. Proc Nat Acad Sci USA. 2020;117:9451–7. 10.1073/pnas.1921046117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82. Fu  L, Niu  B, Zhu  Z  et al.  CD-HIT: accelerated for clustering the next-generation sequencing data. Bioinformatics. 2012;28:3150–2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83. Bao  W, Kojima  KK, Kohany  O. Repbase Update, a database of repetitive elements in eukaryotic genomes. Mobile DNA. 2015;6:11. 10.1186/s13100-015-0041-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84. Erwin  AA, Galdos  MA, Wickersheim  M.L  et al.  piRNAs are associated with diverse transgenerational effects on gene and transposon expression in a Hybrid dysgenic syndrome of D. virilis. PLos Genet. 2015;11:e1005332. 10.1371/journal.pgen.1005332. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85. Camacho  C, Coulouris  G, Avagyan  V  et al.  BLAST+: architecture and applications. BMC Bioinformatics. 2009;10:421. 10.1186/1471-2105-10-421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86. Goubert  C, Craig  RJ, Bilat  A.F  et al.  A beginner’s guide to manual curation of transposable elements. Mobile DNA. 2022;13:7. 10.1186/s13100-021-00259-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87. Rodriguez  F, Arkhipova  I.R. An overview of best practices for transposable element identification, classification, and annotation in eukaryotic genomes. Methods Mol Biol. 2023;2607:1–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88. Storer  JM, Hubley  R, Rosen  J  et al.  Curation guidelines for de novo generated transposable element families. Curr Protoc. 2021;1:e154. 10.1002/cpz1.154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 89. Wang  J, Chitsaz  F, Derbyshire  M.K  et al.  The conserved domain database in 2023. Nucleic Acids Res. 2023;51:D384–d388. 10.1093/nar/gkac1096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90. Smit  A, Hubley  R, Green  P. RepeatMasker Open-4.0. (2013–2015). http://www.repeatmasker.org (February 2025, date last accessed).
  • 91. Bailly-Bechet  M, Haudry  A, Lerat  E. “One code to find them all”: a perl tool to conveniently parse RepeatMasker output files. Mobile DNA. 2014;5:13. 10.1186/1759-8753-5-13. [DOI] [Google Scholar]
  • 92. Kassambara  A, Mundt  F. Factoextra: extract and visualize the results of multivariate data analyses. R Package Version 1.0.7. 2020; [Google Scholar]
  • 93. Duvaud  S, Gabella  C, Lisacek  F  et al.  Expasy, the Swiss Bioinformatics Resource Portal, as designed by its users. Nucleic Acids Res. 2021;49:W216–w227. 10.1093/nar/gkab225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94. Tjeldnes  H, Labun  K, Torres Cleuren  Y  et al.  ORFik: a comprehensive R toolkit for the analysis of translation. BMC Bioinformatics. 2021;22:336. 10.1186/s12859-021-04254-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95. Pagès  H, A.P.  Gentleman R, DebRoy  S. Biostrings: Efficient manipulation of biological strings. 2025. 10.18129/B9.bioc.Biostrings, R package version 2.78.0. [DOI]
  • 96. Robinson  JT, Thorvaldsdóttir  H, Winckler  W  et al.  Integrative genomics viewer. Nat Biotechnol. 2011;29:24–6. 10.1038/nbt.1754. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 97. Le Thomas  A, Marinov  GK, Aravin  A.A. A transgenerational process defines piRNA biogenesis in Drosophila virilis. Cell Rep. 2014;8:1617–23. 10.1016/j.celrep.2014.08.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98. Katoh  K, Standley  D.M. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol. 2013;30:772–80. 10.1093/molbev/mst010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 99. Capella-Gutiérrez  S, Silla-Martínez  JM, Gabaldón  T. trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics. 2009;25:1972–3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100. Darriba  D, Taboada  GL, Doallo  R  et al.  ProtTest 3: fast selection of best-fit models of protein evolution. Bioinformatics. 2011;27:1164–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 101. Tamura  K, Stecher  G, Kumar  S. MEGA11: molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol. 2021;38:3022–7. 10.1093/molbev/msab120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 102. Letunic  I, Bork  P. Interactive Tree of Life (iTOL) v6: recent updates to the phylogenetic tree display and annotation tool. Nucleic Acids Res. 2024;52:W78–82. 10.1093/nar/gkae268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 103. Wickham  H. ggplot2: elegant graphics for data analysis. New York: Springer-Verlag, 2016. [Google Scholar]
  • 104. Daniels  SB, Peterson  KR, Strausbaugh  L.D  et al.  Evidence for horizontal transmission of the P transposable element between Drosophila species. Genetics. 1990;124:339–55. 10.1093/genetics/124.2.339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 105. Peccoud  J, Loiseau  V, Cordaux  R  et al.  Massive horizontal transfer of transposable elements in insects. Proc Nat Acad Sci USA. 2017;114:4721–6. 10.1073/pnas.1621178114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 106. K  Ullrich. MSA2dist: MSA2dist calculates pairwise distances between all sequences of a DNAStringSet or a AAStringSet using a custom score matrix and conducts codon based analysis. 2025. 10.18129/B9.bioc.MSA2dist, R package version 1.14.0. [DOI] [Google Scholar]
  • 107. Han  S, Dias  GB, Basting  P.J  et al.  Local assembly of long reads enables phylogenomics of transposable elements in a polyploid cell line. Nucleic Acids Res. 2022;50:e124. 10.1093/nar/gkac794. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 108. Quinlan  AR, Hall  I.M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics. 2010;26:841–2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 109. Wang  Q, Li  M, Wu  T  et al.  Exploring epigenomic datasets by ChIPseeker. Curr Protoc. 2022;2:e585. 10.1002/cpz1.585. [DOI] [PubMed] [Google Scholar]
  • 110. Dobin  A, Davis  CA, Schlesinger  F  et al.  STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29:15–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 111. Jin  Y, Tam  OH, Paniagua  E  et al.  TEtranscripts: a package for including transposable elements in differential expression analysis of RNA-seq datasets. Bioinformatics. 2015;31:3593–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 112. Robinson  MD, McCarthy  DJ, Smyth  G.K. edgeR: a bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010;26:139–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 113. Langmead  B, Trapnell  C, Pop  M  et al.  Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009;10:R25. 10.1186/gb-2009-10-3-r25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 114. Nicholas  F, Parrish  YWI. piRNA. 1 edn., New York, NY: Humana, 2022. [Google Scholar]
  • 115. Akulenko  N, Ryazansky  S, Morgunova  V  et al.  Transcriptional and chromatin changes accompanying de novo formation of transgenic piRNA clusters. RNA (New York, NY). 2018;24:574–84. 10.1261/rna.062851.117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 116. Langmead  B, Salzberg  S.L. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9:357–9. 10.1038/nmeth.1923. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 117. Danecek  P, Bonfield  JK, Liddle  J  et al.  Twelve years of SAMtools and BCFtools. GigaScience. 2021;10. 10.1093/gigascience/giab008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 118. Ramírez  F, Ryan  DP, Grüning  B  et al.  deepTools2: a next generation web server for deep-sequencing data analysis. Nucleic Acids Res. 2016;44:W160–165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 119. Li  H. Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics. 2018;34:3094–100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 120. Henderson  D.S. Drosophila Cytogenetics Protocols. Totowa, NJ: Humana, 2004. [Google Scholar]
  • 121. Marsano  RM, Dimitri  P. Constitutive heterochromatin in eukaryotic genomes: a mine of transposable elements. Cells. 2022;11:761. 10.3390/cells11050761. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 122. Goodier  J.L. Restricting retrotransposons: a review. Mobile DNA. 2016;7:16. 10.1186/s13100-016-0070-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 123. Penzkofer  T, Jäger  M, Figlerowicz  M  et al.  L1Base 2: more retrotransposition-active LINE-1s, more mammalian genomes. Nucleic Acids Res. 2017;45:D68–d73. 10.1093/nar/gkw925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 124. Lanciano  S, Cristofari  G. Measuring and interpreting transposable element expression. Nat Rev Genet. 2020;21:721–36. 10.1038/s41576-020-0251-y. [DOI] [PubMed] [Google Scholar]
  • 125. Blumenstiel  J.P. Birth, school, work, death, and resurrection: the life stages and dynamics of transposable element proliferation. Genes. 2019;10:336. 10.3390/genes10050336. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 126. Kent  TV, Uzunović  J, Wright  S.I. Coevolution between transposable elements and recombination. Philos Trans R Soc Lond B Biol Sci. 2017;372:20160458. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 127. Abdurashitov  MA, Gonchar  DA, Chernukhin  V.A  et al.  Medium-sized tandem repeats represent an abundant component of the Drosophila virilis genome. BMC Genomics. 2013;14:771. 10.1186/1471-2164-14-771. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 128. Simmons  G.M. Horizontal transfer of hobo transposable elements within the Drosophila melanogaster species complex: evidence from DNA sequencing. Mol Biol Evol. 1992;9:1050–60. [DOI] [PubMed] [Google Scholar]
  • 129. Wierzbicki  F, Pianezza  R, Selvaraju  D  et al.  On the origin of the P-element invasion in Drosophila simulans. Mobile DNA. 2025;16:7. 10.1186/s13100-025-00345-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 130. Grewal  SI, Elgin  S.C. Transcription and RNA interference in the formation of heterochromatin. Nature. 2007;447:399–406. 10.1038/nature05914. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 131. Kouzarides  T. Chromatin modifications and their function. Cell. 2007;128:693–705. 10.1016/j.cell.2007.02.005. [DOI] [PubMed] [Google Scholar]
  • 132. Gabriško  M, Janeček  S. Characterization of maltase clusters in the genus Drosophila. J Mol Evol. 2011;72:104–18. [DOI] [PubMed] [Google Scholar]
  • 133. Chen  ZX, Sturgill  D, Qu  J  et al.  Comparative validation of the D. melanogaster modENCODE transcriptome annotation. Genome Res. 2014;24:1209–23. 10.1101/gr.159384.113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 134. Cáceres  M, Ranz  JM, Barbadilla  A  et al.  Generation of a widespread Drosophila inversion by a transposable element. Science. 1999;285:415–8. 10.1126/science.285.5426.415. [DOI] [PubMed] [Google Scholar]
  • 135. Fonseca  NA, Vieira  CP, Schlötterer  C  et al.  The DAIBAM MITE element is involved in the origin of one fixed and two polymorphic Drosophila virilis phylad inversions. Fly. 2012;6:71–4. 10.4161/fly.19423. [DOI] [PubMed] [Google Scholar]
  • 136. Reis  M, Vieira  CP, Lata  R  et al.  Origin and consequences of chromosomal inversions in the virilis group of Drosophila. Genome Biol Evolut. 2018;10:3152–66. 10.1093/gbe/evy239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 137. Andrianov  BV, Zakharyev  VM, Reznik  N.L  et al.  Gypsy group retrotransposon Tv1 from Drosophila virilis. Gene. 1999;239:193–9. 10.1016/S0378-1119(99)00338-8. [DOI] [PubMed] [Google Scholar]
  • 138. Blumenstiel  J.P. Whole genome sequencing in Drosophila virilis identifies Polyphemus, a recently activated Tc1-like transposon with a possible role in hybrid dysgenesis. Mobile DNA. 2014;5:6. 10.1186/1759-8753-5-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 139. Casacuberta  E, Pardue  M.L. Transposon telomeres are widely distributed in the Drosophila genus: TART elements in the virilis group. Proc Nat Acad Sci USA. 2003;100:3363–8. 10.1073/pnas.0230353100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 140. Evgen’ev  MB, Zelentsova  H, Shostak  N  et al.  Penelope, a new family of transposable elements and its possible role in hybrid dysgenesis in Drosophila virilis. Proc Nat Acad Sci USA. 1997;94:196–201. 10.1073/pnas.94.1.196. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 141. Mizrokhi  LJ, Mazo  A.M. Cloning and analysis of the mobile element gypsy from D. virilis. Nucleic Acids Res. 1991;19:913–6. 10.1093/nar/19.4.913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 142. Petrov  DA, Schutzman  JL, Hartl  D.L  et al.  Diverse transposable elements are mobilized in hybrid dysgenesis in Drosophila virilis. Proc Nat Acad Sci USA. 1995;92:8050–4. 10.1073/pnas.92.17.8050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 143. Scheinker  VS, Lozovskaya  ER, Bishop  J.G  et al.  A long terminal repeat-containing retrotransposon is mobilized during hybrid dysgenesis in Drosophila virilis. Proc Nat Acad Sci USA. 1990;87:9615–9. 10.1073/pnas.87.24.9615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 144. Vieira  J, Vieira  CP, Hartl  D.L  et al.  Factors contributing to the hybrid dysgenesis syndrome in Drosophila virilis. Genet Res. 1998;71:109–17. 10.1017/S001667239800322X. [DOI] [PubMed] [Google Scholar]
  • 145. Feschotte  C, Zhang  X, Wessler  S.R. Mobile genetic elements and genome evolution 2014. Mob DNA. 2007;5:1145–58. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 146. Dias  GB, Svartman  M, Delprat  A  et al.  Tetris is a foldback transposon that provided the building blocks for an emerging satellite DNA of Drosophila virilis. Genome Biol Evolut. 2014;6:1302–13. 10.1093/gbe/evu108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 147. Kimura  M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol. 1980;16:111–20. 10.1007/BF01731581. [DOI] [PubMed] [Google Scholar]
  • 148. Kapusta  A, Suh  A. Evolution of bird genomes-a transposon’s-eye view. Ann NY Acad Sci. 2017;1389:164–85. 10.1111/nyas.13295. [DOI] [PubMed] [Google Scholar]
  • 149. Nowell  RW, Wilson  CG, Almeida  P  et al.  Evolutionary dynamics of transposable elements in bdelloid rotifers. eLife. 2021;10:e63194. 10.7554/eLife.63194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 150. Shao  F, Han  M, Peng  Z. Evolution and diversity of transposable elements in fish genomes. Sci Rep. 2019;9:15399. 10.1038/s41598-019-51888-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 151. Tahami  MS, Vargas-Chavez  C, Poikela  N  et al.  Transposable elements in Drosophila montana from harsh cold environments. Mobile DNA. 2024;15:18. 10.1186/s13100-024-00328-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 152. Kofler  R, Nolte  V, Schlötterer  C. Tempo and mode of transposable element activity in Drosophila. PLoS Genet. 2015;11:e1005406. 10.1371/journal.pgen.1005406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 153. Obbard  DJ, Maclennan  J, Kim  K.W  et al.  Estimating divergence dates and substitution rates in the Drosophila phylogeny. Mol Biol Evol. 2012;29:3459–73. 10.1093/molbev/mss150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 154. Petersen  M, Armisén  D, Gibbs  R.A  et al.  Diversity and evolution of the transposable element repertoire in arthropods with particular reference to insects. BMC Evol Biol. 2019;19:11. 10.1186/s12862-018-1324-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 155. Janssen  A, Colmenares  SU, Karpen  G.H. Heterochromatin: guardian of the genome. Annu Rev Cell Dev Biol. 2018;34:265–88. 10.1146/annurev-cellbio-100617-062653. [DOI] [PubMed] [Google Scholar]
  • 156. Pazhayam  NM, Frazier  LK, Sekelsky  J. Centromere-proximal suppression of meiotic crossovers in Drosophila is robust to changes in centromere number, repetitive DNA content, and centromere-clustering. Genetics. 2024;226:iyad216. 10.1093/genetics/iyad216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 157. Charlesworth  B, Langley  CH, Stephan  W. The evolution of restricted recombination and the accumulation of repeated DNA sequences. Genetics. 1986;112:947–62. 10.1093/genetics/112.4.947. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 158. Montgomery  E, Charlesworth  B, Langley  C.H. A test for the role of natural selection in the stabilization of transposable element copy number in a population of Drosophila melanogaster. Genet Res. 2007;89:435–45. 10.1017/S0016672308009634. [DOI] [PubMed] [Google Scholar]
  • 159. Berry  C, Hannenhalli  S, Leipzig  J  et al.  Selection of target sites for mobile DNA integration in the human genome. PLoS Comput Biol. 2006;2:e157. 10.1371/journal.pcbi.0020157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 160. Linheiro  RS, Bergman  C.M. Testing the palindromic target site model for DNA transposon insertion using the Drosophila melanogaster P-element. Nucleic Acids Res. 2008;36:6199–208. 10.1093/nar/gkn563. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 161. Linheiro  RS, Bergman  C.M. Whole genome resequencing reveals natural target site preferences of transposable elements in Drosophila melanogaster. PLoS One. 2012;7:e30008. 10.1371/journal.pone.0030008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 162. Cuenca-Guardiola  J, Morena-Barrio  B, Navarro-Manzano  E  et al.  Detection and annotation of transposable element insertions and deletions on the human genome using nanopore sequencing. iScience. 2023;26:108214. 10.1016/j.isci.2023.108214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 163. Sackton  TB, Kulathinal  RJ, Bergman  C.M  et al.  Population genomic inferences from sparse high-throughput sequencing of two populations of Drosophila melanogaster. Genome Biol Evolut. 2009;1:449–65. 10.1093/gbe/evp048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 164. Sultana  T, Zamborlini  A, Cristofari  G  et al.  Integration site selection by retroviruses and transposable elements in eukaryotes. Nat Rev Genet. 2017;18:292–308. 10.1038/nrg.2017.7. [DOI] [PubMed] [Google Scholar]
  • 165. Vendrell-Mir  P, Leduque  B, Quadrana  L. Ultra-sensitive detection of transposon insertions across multiple families by transposable element display sequencing. Genome Biol. 2025;26:48. 10.1186/s13059-025-03512-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 166. Zhang  X, Zhao  M, McCarty  D.R  et al.  Transposable elements employ distinct integration strategies with respect to transcriptional landscapes in eukaryotic genomes. Nucleic Acids Res. 2020;48:6685–98. 10.1093/nar/gkaa370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 167. Marsano  RM, Giordano  E, Messina  G  et al.  A new portrait of constitutive heterochromatin: lessons from Drosophila melanogaster. Trends Genet. 2019;35:615–31. 10.1016/j.tig.2019.06.002. [DOI] [PubMed] [Google Scholar]
  • 168. Funikov  SY, Rezvykh  AP, Kulikova  D.A  et al.  Adaptation of gene loci to heterochromatin in the course of Drosophila evolution is associated with insulator proteins. Sci Rep. 2020;10:11893. 10.1038/s41598-020-68879-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 169. Lee  Y.C.G., Ogiyama  Y, Martins  N.M.C  et al.  Pericentromeric heterochromatin is hierarchically organized and spatially contacts H3K9me2 islands in euchromatin. PLos Genet. 2020;16:e1008673. 10.1371/journal.pgen.1008673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 170. Dimitri  P, Arcà  B, Berghella  L  et al.  High genetic instability of heterochromatin after transposition of the LINE-like I factor in Drosophila melanogaster. Proc Nat Acad Sci USA. 1997;94:8052–7. 10.1073/pnas.94.15.8052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 171. Jakubczak  JL, Zenni  MK, Woodruff  R.C  et al.  Turnover of R1 (type I) and R2 (type II) retrotransposable elements in the ribosomal DNA of Drosophila melanogaster. Genetics. 1992;131:129–42. 10.1093/genetics/131.1.129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 172. Lauria Sneideman  MP, Meller  V.H. Drosophila satellite repeats at the intersection of chromatin, gene regulation and evolution. Prog Mol Subcell Biol. 2021;60:1–26. [DOI] [PubMed] [Google Scholar]
  • 173. Shatskikh  AS, Kotov  AA, Adashev  V.E  et al.  Functional significance of satellite DNAs: insights from Drosophila. Front Cell Dev Biol. 2020;8:312. 10.3389/fcell.2020.00312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 174. Wei  X, Eickbush  DG, Speece  I  et al.  Heterochromatin-dependent transcription of satellite DNAs in the Drosophila melanogaster female germline. eLife. 2021;10:e62375. 10.7554/eLife.62375. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 175. de Lima  LG, Ruiz-Ruano  F.J. In-depth satellitome analyses of 37 drosophila species illuminate repetitive DNA evolution in the drosophila genus. Genome Biol Evolut. 2022;14:evac064. 10.1093/gbe/evac064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 176. Baumgartner  L, Ipsaro  JJ, Hohmann  U  et al.  Evolutionary adaptation of an HP1-protein chromodomain integrates chromatin and DNA sequence signals. eLife. 2024;13:RP93194. 10.7554/eLife.93194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 177. Petrov  DA, Hartl  D.L. High rate of DNA loss in the Drosophila melanogaster and Drosophila virilis species groups. Mol Biol Evol. 1998;15:293–302. 10.1093/oxfordjournals.molbev.a025926. [DOI] [PubMed] [Google Scholar]
  • 178. Petrov  DA, Lozovskaya  ER, Hartl  D.L. High intrinsic rate of DNA loss in Drosophila. Nature. 1996;384:346–9. 10.1038/384346a0. [DOI] [PubMed] [Google Scholar]
  • 179. Vieira  C, Biémont  C. Geographical variation in insertion site number of retrotransposon 412 in Drosophila simulans. J Mol Evol. 1996;42:443–51. 10.1007/BF02498638. [DOI] [PubMed] [Google Scholar]
  • 180. Biémont  C, Arnault  C, Heizmann  A. Massive changes in genomic locations of P elements in an inbred line of Drosophila melanogaster. Naturwissenschaften. 1990;77:485–8. [DOI] [PubMed] [Google Scholar]
  • 181. Funikov  SY, Ryazansky  SS, Zelentsova  E.S  et al.  The peculiarities of piRNA expression upon heat shock exposure in Drosophila melanogaster. Mob Genet Elements. 2015;5:72–80. 10.1080/2159256X.2015.1086502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 182. García Guerreiro  M.P. What makes transposable elements move in the Drosophila genome?. Heredity (Edinb). 2012;108:461–8. 10.1038/hdy.2011.89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 183. Vasilyeva  LA, Bubenshchikova  EV, Ratner  V.A. Heavy heat shock induced retrotransposon transposition in Drosophila. Genet Res. 1999;74:111–9. 10.1017/S0016672399003973. [DOI] [PubMed] [Google Scholar]
  • 184. Yang  HP, Hung  TL, You  T.L  et al.  Genomewide comparative analysis of the highly abundant transposable element DINE-1 suggests a recent transpositional burst in Drosophila yakuba. Genetics. 2006;173:189–96. 10.1534/genetics.105.051714. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 185. Strand  DJ, McDonald  J.F. Copia is transcriptionally responsive to environmental stress. Nucleic Acids Res. 1985;13:4401–10. 10.1093/nar/13.12.4401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 186. Castillo  DM, Barbash  D.A. Moving speciation genetics forward: modern techniques build on foundational studies in drosophila. Genetics. 2017;207:825–42. 10.1534/genetics.116.187120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 187. Castillo  DM, Moyle  L.C. Hybrid incompatibility between Drosophila virilis and D. lummei is stronger in the presence of transposable elements. J Evol Biol. 2022;35:1319–34. 10.1111/jeb.14079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 188. Maeng  JH, Jang  HJ, Du  A.Y  et al.  Using long-read CAGE sequencing to profile cryptic-promoter-derived transcripts and their contribution to the immunopeptidome. Genome Res. 2023;33:2143–55. 10.1101/gr.277061.122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 189. Prokopov  D, Tunbak  H, Leddy  E  et al.  Transposable elements as genome regulators in normal and malignant haematopoiesis. Blood Cancer J. 2025;15:87. 10.1038/s41408-025-01295-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 190. Coronado-Zamora  M, González  J. Transposons contribute to the functional diversification of the head, gut, and ovary transcriptomes across Drosophila natural strains. Genome Res. 2023;33:1541–53. 10.1101/gr.277565.122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 191. Oliveira  DS, Fablet  M, Larue  A  et al.  ChimeraTE: a pipeline to detect chimeric transcripts derived from genes and transposable elements. Nucleic Acids Res. 2023;51:9764–84. 10.1093/nar/gkad671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 192. Rubin  GM, Kidwell  MG, Bingham  P.M. The molecular basis of P-M hybrid dysgenesis: the nature of induced mutations. Cell. 1982;29:987–94. 10.1016/0092-8674(82)90462-7. [DOI] [PubMed] [Google Scholar]
  • 193. Zhang  HH, Peccoud  J, Xu  M.R  et al.  Horizontal transfer and evolution of transposable elements in vertebrates. Nat Commun. 2020;11:1362. 10.1038/s41467-020-15149-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 194. Gilbert  C, Feschotte  C. Horizontal acquisition of transposable elements and viral sequences: patterns and consequences. Curr Opin Genet Dev. 2018;49:15–24. 10.1016/j.gde.2018.02.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 195. Muller  H, Savisaar  R, Peccoud  J  et al.  Phylogenetic relatedness rather than aquatic habitat fosters horizontal transfer of transposable elements in animals. Genome Res. 2025;35:2011–22. 10.1101/gr.280432.125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 196. Marino  A, Debaecker  G, Fiston-Lavier  A.-S  et al.  Effective population size does not explain long-term variation in genome size and transposable element content in animals. eLife. 2025;13:RP100574. 10.7554/eLife.100574.3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 197. Klein  SJ, O’Neill  R.J. Transposable elements: genome innovation, chromosome diversity, and centromere conflict. Chromosome Res. 2018;26:5–23. 10.1007/s10577-017-9569-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 198. Ranz  JM, Maurin  D, Chan  Y.S  et al.  Principles of genome evolution in the Drosophila melanogaster species group. PLoS Biol. 2007;5:e152. 10.1371/journal.pbio.0050152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 199. Lohse  K, Clarke  M, Ritchie  M.G  et al.  Genome-wide tests for introgression between cactophilic Drosophila implicate a role of inversions during speciation. Evolution. 2015;69:1178–90. 10.1111/evo.12650. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 200. Stevison  LS, Hoehn  KB, Noor  M.A. Effects of inversions on within- and between-species recombination and divergence. Genome Biol Evolut. 2011;3:830–41. 10.1093/gbe/evr081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 201. Poikela  N, Laetsch  DR, Hoikkala  V  et al.  Chromosomal inversions and the demography of speciation in Drosophila montana and Drosophila flavomontana. Genome Biol Evolut. 2024;16:evae024. 10.1093/gbe/evae024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 202. Eichten  SR, Ellis  NA, Makarevitch  I  et al.  Spreading of heterochromatin is limited to specific families of maize retrotransposons. PLoS Genet. 2012;8:e1003127. 10.1371/journal.pgen.1003127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 203. Mateo  L, Ullastres  A, González  J. A transposable element insertion confers xenobiotic resistance in Drosophila. PLoS Genet. 2014;10:e1004560. 10.1371/journal.pgen.1004560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 204. Rebollo  R, Karimi  MM, Bilenky  M  et al.  Retrotransposon-induced heterochromatin spreading in the mouse revealed by insertional polymorphisms. PLoS Genet. 2011;7:e1002301. 10.1371/journal.pgen.1002301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 205. Stuart  T, Eichten  SR, Cahn  J  et al.  Population scale mapping of transposable element diversity reveals links to gene regulation and epigenomic variation. eLife. 2016;5:e20777. 10.7554/eLife.20777. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 206. Villanueva-Cañas  JL, Horvath  V, Aguilera  L  et al.  Diverse families of transposable elements affect the transcriptional regulation of stress-response genes in Drosophila melanogaster. Nucleic Acids Res. 2019;47:6842–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 207. Payer  LM, Burns  K.H. Transposable elements in human genetic disease. Nat Rev Genet. 2019;20:760–72. 10.1038/s41576-019-0165-8. [DOI] [PubMed] [Google Scholar]
  • 208. Evgen’ev  M, Zelentsova  H, Mnjoian  L  et al.  Invasion of Drosophila virilis by the Penelope transposable element. Chromosoma. 2000;109:350–7. 10.1007/s004120000086. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

gkag139_Supplemental_Files

Data Availability Statement

High-throughput sequencing data performed in this study includes RNA-seq for strains 160, 101, and 1051.47; small RNA-seq for strains 160, 9, 101, 140, 1051.47; ChIP-seq (H3K9me3) for strains 101, 1051.47; ChIP-seq (H3K9me2) for strain 140; raw ONT reads for strains 160, 9, 101, and 1051.47 were deposited in NCBI GEO under the number GSE307819. The accession number for ChIP-seq (H3K9me3) for strains 160 and 9 in NCBI GEO is GSE59965. ChIP-seq, RNA-seq for strain 140, as well as RNA-seq for strain 9, can be downloaded from NCBI GEO using the number GSE292339. Raw ONT reads for strain 140 were deposited in the NCBI SRA (SRX28458524).


Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES