Skip to main content
NCBI home page
BMC Pharmacology & Toxicology logoLink to BMC Pharmacology & Toxicology
. 2026 Jan 23;27:34. doi: 10.1186/s40360-026-01089-0

Canadine protects against doxorubicin-induced cardiac and brain injury by inhibiting Oxidative stress

Xianghui Zeng 1,#, Qingfeng Zeng 1,#, Qi Luo 2,#, Jianping Luo 1,✉
PMCID: PMC12911019  PMID: 41578365

Abstract

Background

Patients receiving doxorubicin (DOX) chemotherapy are susceptible to cardiac and brain tissue damage, with oxidative stress (OS) as the primary mechanism of injury. The purpose of this research is to identify effective agents to reduce the level of DOX-induced OS in the heart and brain through bioinformatics and in vitro.

Methods

Cardiac transcriptome data (GSE59672) and hippocampal transcriptome data (GSE178812) were downloaded from the Gene Expression Omnibus database. Meanwhile, OS-related genes were retrieved in the GeneCards database. The intersection of differentially expressed genes (DEGs) and OS-related genes in cardiac and brain tissues was identified to screen for differentially expressed OS-related genes (DEOGs). Subsequently, we performed Kyoto Gene and Genome Encyclopedia enrichment, Gene Ontology annotation, and protein-protein interaction network analysis. Using the Connectivity Map (Cmap) database, we predicted the potential drug to reduce the expression of DOX-induced OS in cardiac and brain injury by key genes and validated the therapeutic effect of the drug in vitro.

Results

A total of 20 DEOGs were identified. The network’s most important modules and central genes (Col1a1, Lox, Col1a2, Ogn, Myoc, Jph2, Casp1, Aldh1a2, Cfh) were screened by the MCODE plugin of Cytoscape software. Using the Cmap database, Canadine was predicted by key genes to reduce DOX-induced OS levels in cardiac and brain tissues. Canadine elevated superoxide dismutase 1 and catalase and reduced Malondialdehyde and reactive oxygen species levels in DOX-treated H9C2 and PC12 cells.

Conclusions

Our results show that Canadine ameliorates DOX-induced cardiac and brain tissue damage by inhibiting OS.

Keywords: Doxorubicin, Brain injury, Cardiac injury, Oxidative stress, Canadine

Introduction

Doxorubicin (DOX) is a drug commonly used in the treatment of breast cancer, lung cancer, and leukemia [1]. However, the substantial adverse effects of this drug outside of anti-tumor have limited its clinical use. Many studies have shown that DOX can induce systemic multi-organ toxic injuries, such as heart failure, chemo brain, gastrointestinal reactions, and drug-related hepatitis [2–4]. Among them, cardiac and brain toxicity injuries are the focus of clinical attention, for the serious threat to the survival and prognosis of patients. Myocardial injury caused by short-term adriamycin intervention is mainly manifested as arrhythmia, while a long time of adriamycin intervention will lead to the accumulation of adriamycin, which will lead to dilated cardiomyopathy and congestive heart failure [5]. In recent years, accumulated evidence has suggested that DOX may cause cognitive decline [6, 7].

Patients’ quality of life and survival are significantly affected by DOX-induced cardiotoxicity and neurotoxicity, but no effective medications to prevent or treat these side effects have been found. A amount of evidence has demonstrated the significant role of oxidative stress (OS) played in cardiac and brain damage induced by DOX [8]. After DOX treatment, cardiac and brain tissues showed elevated levels of OS, such as superoxide dismutase (SOD)1, glutathione peroxidase (GPx), and catalase (CAT) expression [9–11]. These findings underscore that targeting the OS pathway-specifically by enhancing the activity of endogenous antioxidant enzymes or supplementing with exogenous antioxidant agents-offers a promising therapeutic direction for preventing or alleviating DOX-induced cardiac and brain toxicity.

OS arises from the imbalance of reactive oxygen species (ROS) and antioxidants. Many researches revealed that DOX-induced OS in cardiac and brain tissues can be decreased by molecules with antioxidant properties [12]. Canadine is an alkaloid that inhibits cholinesterase activity [13] and has various pharmacological activities such as muscle relaxation, antioxidants, and antitumor [14–16]. Jakub Chlebek et al. also identified Canadine as a potential drug for the treatment of Alzheimer’s disease [17], and anti-OS is presumed to be an important mechanism for its efficacy. However, the role of Canadine on cardiac and brain damage induced by DOX remains to be investigated.

In this study, we first identified differentially expressed genes in GSE178812 (mouse hippocampal sample) and GSE59672 (mouse heart sample) after DOX intervention from the Gene Expression Omnibus (GEO) database and then intersected them with OS-related genes to reveal Canadine as a potential molecule to reverse DOX-induced elevated OS in cardiac and brain by the Connectivity Map (Cmap) database. Finally, we verified that Canadine was an effective agent to reduce the level of OS treated with DOX in H9C2 and PC12 cells.

Materials and methods

Data collection

The cardiac transcriptome data GSE59672 and the hippocampal transcriptome data GSE178812 were obtained from the GEO database. The GSE59672 dataset contains 3 DOX-treated heart samples and 3 normal heart samples. The GSE178812 dataset contains 3 DOX-treated hippocampi samples and 3 normal hippocampi samples. We performed log2 transformation for gene expression profiling. To identify OS-related genes for screening, 8286 OS protein structural domains were obtained from the GeneCards database, and 2459 OS-related genes (relevance scores ≥3) were used for subsequent analysis.

Data quality control and normalization

The expression matrices of the GSE59672 and GSE178812 datasets were normalized; box line plots were used to examine the trends of the dataset distribution; correlations between samples in the same dataset were visualized using correlation heat maps, and correlation heat maps and box plots were plotted using R software.

Differentially expressed OS-related genes (DEOGs)

Differentially expressed genes between the DOX-treated group and the control group in hippocampi/heart tissue were analyzed using the limma package in R [18]. The threshold values were p value < 0.05 and |log2 Fold change (FC) | > 0.4. Defined as OS-related genes, the intersection of GSE59672 and GSE178812 datasets differentially expressed genes were differential genes related to OS in heart and hippocampi tissues. Venn diagram and heat map were plotted using R software.

Gene ontology (GO) and kyoto gene and genome encyclopedia (KEGG) enrichment analysis

R 4.2.0 was installed with the “colorspace,” “stringi,” and “ggplot2” packages, “DOSE,” “clusterProfiler,” and “enrichplot” bioconductor packages were used for the study of GO and KEGG enrichment.

Construction of protein-protein interaction (PPI) network and screening of key genes

The PPI information of DEOGs was achieved in the STRING database (https://string-db.org/). The construction of PPI networks was established with the interaction database by Cytoscape 3.9.1 software [19]. The virtual modules and key genes were selected from the PPI network with Molecular Complex Detection (MCODE) node count > 7, p < 0.05 [20].

Drug sensitivity analysis

Predicting effective agents for reducing DOX-induced OS levels in heart and hippocampi tissues by key genes using the Cmap database. Using the SPIEDw web tool (http://www.spied.org.uk/) [21], the Cmap database (http://portals.broadinstitute.org/cmap/) was interrogated with 9 key genes.

Molecular docking analysis

The PDB database (https://www.rcsb.org) was used to obtain the target proteins’ 3D structures. Using AutoDockTools-1.5.6 (updated 2014–09-17), the target proteins were modified by deleting the ligand and water motifs and adding hydrogen (Trott and Olson, 2010). Protein ligands and receptors were converted to PDBQT. The lowest free energy model was chosen following molecular docking using AutoDock Vina software, and PyMOL was applied to visualize and analyze the model. Individual dockings were conducted to determine docking scores (lower scores indicated successful docking results). Scores of less than −6 for docking are acceptable.

H9C2 and PC12 cells culture and processing

H9C2 and PC12 cells were purchased from the National Certified Cell Culture Collection (Shanghai, China) and cultured in DMEM (Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS, Thermo Fisher Scientific). After incubation for two days, the medium was replaced. Experiments were performed using approximately 70–80% confluent cells. Cells were treated with DOX (Myerol, Shanghai, China) at various concentrations as indicated for 24 hours. Cells had a 24-hour pretreatment with Canadine (0–2 μM) (EFEBIO, Shanghai, China) before being added to a medium containing 1 μM DOX and incubated for an additional 24-hour period in the experimental group.

Cell viability

The CCK-8 test was used to assess how DOX/Canadine/(Canadine+DOX) affected the activity of H9C2 and PC12 cells. In brief, 96-well plates with growth medium were injected with 3 × 103 H9C2/PC12 cells. After the cells were treated as described above, 10 μL of CCK-8 (BBI Life Sciences, Shanghai, China) were added to the 96-well plate and incubated for an hour. Each well’s absorbance value at 450 nm was determined spectrophotometrically using an enzyme marker (Bio-Tek, USA). Six repetitions were run through each experiment.

ROS activity measurement

After being washed with phosphate-buffered saline (PBS), the cells were incubated with 2.5 mM dihydroethidium (DHE, green) at 37 °C for 30 minutes, followed by staining with Hoechst 33342 (blue) for the same duration.A laser-scanning confocal microscope was then used to view the cells, and Image J software was used to analyze the images (version 6.0). Then the average fluorescence intensity of each cell and the average fluorescence intensity emitted by each field of cells were calculated to analyze the data.

Lipid peroxidation malondialdehyde (MDA) assay

The Lipid Peroxidation MDA Assay Kit (JC410852, Nanjing Jian cheng Institute of Biological Engineering) was used to determine the MDA content in H9C2/PC12 cells. Absorbance measurements were performed at 532 nm.

Q-PCR

Trizol (Invitrogen, USA) was used to extract total RNA, and cDNA was created using the reverse transcription reagent PrimeScript™ RT Master Mix (Takara, Japan) per the manufacturer’s instructions. Real-time quantitative PCR (RT-PCR) with gene-specific primers was performed using a TB green premix ex Taq Kit (Takara, Japan). As an internal reference, the polymerase chain reaction data of β-actin were employed. The primers for the PCR of genes were listed in Table 1.

Table 1.

List of RT-PCR primers

Gene ForwardPrimer（5´-3´） ReversePrimer（5´-3´）
Cat TTGCCTTGTTTGTCTTTCGCCATTG GTGCTTGTGCCGTCTTGTATGTTG
Sod1 CACAGTGCAGTAGCCATCCATTCC CCCTCCCTACCCATCTTCCCTAAC
Col1a1 TGACTGGAAGAGCGGAGAGT GATAGCGACATCGGCAGGAT
Lox ATGGCACCGGTTACTTCCAG GATAGCGACATCGGCAGGAT
Col1a2 TGTCGATGGCTGCTCCAAAA CCGATGTCCAGAGGTGCAAT
Ogn CGTGCCTCTGACACAGCAAA GGCATGTGGGCATTTCATCATTT
Myoc AGAGGGAGACAAAGGATGTGG CCAACCGTGTCAATCCTCCA
Jph2 CAAGAGCAACAAGGTTCGCC CTGATACTCCGGACCTGGCT
Casp1 GGAGCTTCAGTCAGGTCCAT CTTGAGGGAACCACTCGGTC
Aldh1a2 ACAGGGCAACTCTTGCAACTA CTCCGATGGGCTCATGTCTC
Cfh CAGGCAACCTACAAATGCCG CCCACATGGCCTTTTCCGA
Open in a new tab

Statistical analysis

We used GraphPad Prism 8.0.2 and version 4.2.0 of R software for statistical analysis. All data were provided as the mean ± SEM. Two-tailed unpaired t-tests were used to compare two groups, while one-way or two-way (if there were two-factor levels) ANOVA (analysis of variance) was used to compare multiple groups, followed by Bonferroni correction for post hoc multiple comparisons. p < 0.05 were regarded as statistically significant.

Results

Identification of differential genes in heart and hippocampi tissues

The expression matrices of the GSE59672 and GSE178812 datasets were normalized, and box plots showed good normalization with comparable distributions across all samples (Fig. 1A–B). Pearson’s correlation test revealed a substantial association between the samples (Fig. 1C–D). The GSE59672 and GSE178812 datasets identified 2213 and 724 differential genes (Fig. 1E–F).

Fig. 1.

Fig. 1

Open in a new tab

Identification of differential genes in heart and hippocampi tissues. Box plots (A-B), correlation heatmap (C-D) and volcano-plot (E-F) of the GSE178812 and GSE59672 datasets

Identification and GO/KEGG analysis of differentially expressed DEOGs

The differential genes in the GSE59672 and GSE178812 datasets had a total of 20 intersecting genes with OS-related genes (Fig. 2A). Figures 2B and 2C show the expression of DEOGs in heart (GSE59672) and hippocampi (GSE178812) tissues, respectively. The activities of the acquired DEOGs were annotated to further investigate their role in the pathogenesis of DOX-induced OS damage in heart and hippocampi tissues. In the KEGG enrichment analysis, differentially expressed DEOGs were primarily enriched in protein digestion and absorption, and platelet activation (Figs 2D).

Fig. 2.

Fig. 2

Open in a new tab

Identification and GO/KEGG analysis of the DEOGs. (A) venn diagram depicting the DEOGs. (B-C) heatmap of DEOGs genes in the GSE59672 and GSE178812 datasets. (D) histograms and circle plots of GO enrichment for DEOGs. (E) histograms and circle plots of KEGG for DEOGs

The most notable GO enrichment word was wound healing and ossification (Biological Processes); collagen−containing extracellular matrix (ECM) and secretory granule (Cellular Component); ECM structural constituent and phosphatidylinositol phosphate binding (Molecular Function) (Figs 2E).

PPI regulatory network and module analysis, key gene Identification and analysis

The DEOGs PPI regulatory network was established (Fig. 3A). The PPI regulatory network contained 35 nodes and 135 interaction pairs. Then, the network’s most important modules and central genes were screened by the MCODE plugin of Cytoscape software (Fig. 3B). 9 key genes include Col1a1, Lox, Col1a2, Ogn, Myoc, Jph2, Casp1, Aldh1a2, and Cfh. Among these genes, Col1a1 and Col1a2 are core subunits of type I collagen, participating in the synthesis and assembly of ECM. DOX-induced upregulation of these two genes promotes ECM deposition, thereby exacerbating OS-mediated damage [22, 23]; Lox catalyzes collagen cross-linking and synergizes with the former two to exacerbate ECM disruption [24]; Ogn and Myoc maintain tissue elasticity by regulating collagen arrangement [25]. Jph2 preserves calcium homeostasis in cardiomyocytes, and its dysregulation can induce mitochondrial dysfunction and ROS production [26]; Casp1 mediates OS-dependent cell death [27]; Aldh1a2 is involved in antioxidant metabolism [28]; Cfh negatively regulates the complement system, and its abnormality amplifies OS-related inflammation [5, 29].

Fig. 3.

Fig. 3

Open in a new tab

PPI regulatory network of the DEOGs and GO/KEGG analysis of the key genes. (A) PPI regulatory networks of the DEOGs. (B) PPI regulatory networks of the key genes. (C) histograms and circle plots of GO enrichment for key genes. (D) histograms and circle plots of KEGG for the key genes

We adopted R software to perform GO and KEGG enrichment analysis to investigate the probable biological roles of these key genes. In the KEGG enrichment analysis, DEOGs were mainly involved in ECM−receptor interaction, AGE−RAGE signaling pathway, protein digestion and absorption, and platelet activation in diabetic complications (Fig. 3C). The results showed that the most significant GO-enriched words were bone development and ossification (Biological Processes); collagen−containing ECM and collagen trimer (Cellular Component); ECM structural constituent and platelet−derived growth factor binding (Molecular Function) (Fig. 3D).

Canadine was a candidate for reducing the level of DOX-induced oxidative stress in the heart and hippocampi tissues

To identify drug candidates for reducing the level of DOX-induced OS in the heart and hippocampi, 9 key genes were used to interrogate the Cmap database (https:/http://portals.broadinstitute.org/cmap/) [30]using the SPIEDw web tool (http://www.spied.org.uk/). Figure 4A-B showed the top 20 compounds we identified (10 positively correlated and 10 negatively with key genes) and the correlation of these compounds with key genes. Among those compounds, Sulfamonomethoxine, Adiphenine, and Canadine were highly negatively correlated with DOX-induced levels of OS in the heart and hippocampi, suggesting that these compounds may have potential therapeutic effects. Sulfamonomethoxine is a sulfonamide spectrum antibiotic widely used in veterinary medicine [31]. However, long-term administration of Sulfamonomethoxine may lead to neurological damage

Fig. 4.

Fig. 4

Open in a new tab

Cmap analyse. Histogram of the top 10 drugs with positive correlations and the top 10 drugs with negative correlations. Heat map of drug (A) and gene correlations (B)

[32, 33]. Adiphenine is a local anesthetic [34]. Canadine is an alkaloid, and Canadine has also been previously reported to have anti-OS effects [15]. Therefore, we selected Canadine as a potent candidate for the treatment of tissue damage induced by DOX.

Molecular docking results

To further explore the structural basis of Canadine’s multi-target regulation, we performed molecular docking between Canadine and the 9 key genes identified in our study. We noted that the docking scores of COL1A1, LOX, OGN, JPH2, ALDH1A2, and CFH, ranged from −8.5 to −5.5, and all key proteins exhibited good binding affinity with Canadine (Fig. 5A–F).

Fig. 5.

Fig. 5

Open in a new tab

Structural interactions between Canadine and key target receptors. (A-F) structural interactions of Canadine and key target receptors (CHF, ALDH1A2, LOX, COL1A1, JPH2 and OGN)

Viability of H9C2 and PC12 cells after Canadine and DOX treatment

DOX decreased the viability of H9C2 and PC12 cells in a concentration-dependent manner after 24 hours of incubation. The viability of H9C2 and PC12 cells at 1 μM DOX concentration of 1 μM was 69.8% and 65.1%, respectively (Fig. 6A–B). There was no effect on the viability of H9C2 and PC12 cells in the concentration range of Canadine 0–2 μM (Fig. 6C–D). Notably, co-treatment with Canadine at 0.5 μM and 1 μM exerted a robust protective effect: H9C2 cell viability was restored to 88.46% and 88.80% of the control, while PC12 cell viability recovered to 89.54% and 93.49%(Fig. 6E–F).

Fig. 6.

Fig. 6

Open in a new tab

Viability of H9C2 and PC12 cells after Canadine and DOX treatment. (A-B) viability of H9C2 and PC12 cells treatment with 0–10 μM DOX after 24 hours. (C–D) viability of H9C2 and PC12 cells after 48 h of treatment with 0–2 μM Canadine after 48 hours. n = 6, *p < 0.05, **p < 0.01, ****p < 0.001 compared with the control. (E-F) viability of H9C2 and PC12 cells treated with 0–2 μM Canadine and 1 μM DOX, and Canadine were pretreated for 24 hours before co-culturing with DOX for the following 24 hours. n = 6, *p < 0.05, ****p < 0.001 compared with the DOX group. Statistical analysis was performed using one-way ANOVA with Bonferroni’s post-hoc test. All dataare presented as mean±SEM

Canadine ameliorates oxidative stress levels in H9C2 and PC12 cells after DOX treatment

Previous studies have revealed that OS was one of the main mechanisms of tissue damage caused by DOX [35, 36]. Compared to untreated cells, exposure to DOX alone increased ROS levels in H9C2 and PC12 cells by a factor of 4.0 and 2.9, respectively (Fig. 7Aand B, Fig. 7E and G). Relative to the DOX-only group, ROS levels were reduced by 43 and 38% in H9C2 cells, and 52 and 55% in PC12 cells treated with Canadine (0.5 μM or 1 μM) + 1 μM DOX, respectively(p < 0.001) (Fig. 7A and B, Fig. 7E and G). We also examined the changes in mRNA expression of OS genes (Cat, Sod1) and MDA content. The results showed that Cat and Sod1 mRNA expression decreased significantly and MDA content increased significantly in the DOX group, while Canadine co-culture could partially reverse this change in H9C2 and PC12 cells (Fig. 7C–F, Fig. 7H–J).

Fig. 7.

Fig. 7

Open in a new tab

Oxidative stress levels in H9C2 cardiomyocytes and PC12 neuronal cells after Canadine and DOX treatment. The Canadine was pretreated for 24 hours before co-culturing with DOX for the following 24 hours. (A and B) DHE staining of H9C2. (C and D) Sod1 and Cat mRNA expression of H9C2 cells. (E) MDA content of H9C2 cells. (F and G) DHE staining of PC12. (H and I) Sod1 and Cat mRNA expression of PC12 cells. (J) MDA content of PC12 cells. n = 6, **** p < 0.001 compared with the control, #### p < 0.001, compared with the DOX group. Statistical analysis was performed using one-way ANOVA with Bonferroni’s post-hoc test. All dataare presented as mean±SEM

Relationship between Canadine and 9 key genes in H9C2 and PC12 cells

We investigated the effect of Canadine on key genes in H9C2 and PC12 cells. In H9C2 cells, compared with the control group, doxorubicin (DOX) treatment significantly upregulated the mRNA expression of 9 key genes and simultaneously downregulated Aldh1a2 transcription. Canadine could inhibit the mRNA expression of 6 genes (Col1a1, Col1a2, Lox, Myoc, Casp1, and Cfh) and reverse the downregulation of Aldh1a2 (Fig. 8A-I).

Fig. 8.

Fig. 8

Fig. 8

Open in a new tab

Relationship between Canadine and 6 key genes in H9C2 and PC12 cells. The Canadine was pretreated for 24 hours before co-culturing with DOX for the following 24 hours. (A-F) Col1a1, Lox, Col1a2, Ogn, Myoc, Jph2, Casp1, Aldh1a2, and Cfh mRNA expression of H9C2. (G-M) Col1a1, Lox, Col1a2, Ogn, Myoc, Jph2, Casp1, Aldh1a2, and Cfh mRNA expression of PC12. n = 6, *p < 0.05, ****p < 0.001 compared with the DOX group，#### p < 0.001, compared with the DOX group statistical analysis was performed using one-way ANOVA with Bonferroni’s post-hoc test

In PC12 cells, DOX treatment upregulated 6 genes (Col1a1, Col1a2, Lox, Casp1, Jph2, and Cfh) and similarly downregulated Aldh1a2 mRNA expression. Furthermore, Canadine could specifically downregulate the aberrant transcriptional activation of Col1a1, Col1a2, Lox, Casp1, Jph2, and Cfh, while restoring the normal mRNA expression level of Aldh1a2 (Fig. 8J-R).

Discussion

In this study, we first revealed that Canadine is a potential drug to reverse DOX-induced OS gene differentiation in cardiac and brain tissues by analyzing GSE178812 (mouse hippocampi samples), GSE59672 (mouse heart samples), and OS-related genes through the Cmap. We further confirmed that Canadine reduced DOX-induced OS in vitro.

DOX, an anthracycline antitumor agent, interferes with DNA transcription and mRNA synthesis in tumor cells by embedding in the nucleic acid double strand and inhibiting topoisomerases, thereby inhibiting the proliferation of tumor cells in different growth cycles [37]. DOX damages healthy tissues through apoptosis, ferroptosis, autophagy, and OS, among which OS was confirmed to be a key mechanism of tissue damage [7, 38, 39]. After DOX treatment, lipid peroxidation, increased ROS production, and reduced ATP synthesis in heart and brain cells cause tissue damage [8, 40].

First, we identified 20 differentially expressed OS-related genes (DEOGs) in DOX-treated cardiac and hippocampal tissues, including Kcnq1, Chat, and Trim63 with established links to DOX toxicity. For instance, Lercanidipine has been reported to alleviate DOX-induced neuroinflammation via activating CHAT [41]. Inhibiting Trim63 has been shown to alleviate fatty acid oxidation deficiency and mitochondrial dysfunction, while also restoring podocyte injury and renal fibrosis in models of acute renal failure and diabetic nephropathy [42, 43]. Additionally, KCNP1 serves as a biomarker for DOX-induced dilated cardiomyopathy in breast cancer patients [44]. Notably, KEGG enrichment analysis revealed shared pathways and biological processes between the two tissues, including “protein digestion and absorption,” “platelet activation,” and “ECM-receptor interaction”-all closely linked to OS amplification. Consistent with prior reports [45, 46], the “protein digestion and absorption” pathway regulates ECM protein metabolism (e.g., collagen degradation via collagenases), and its disruption exacerbates ECM deposition, activates integrin-mediated stress signaling, and promotes ROS generation [47, 48]. The “platelet activation” pathway contributes to OS via releasing inflammatory factors that activate NF-κB signaling and induce ROS production, while platelet-derived thromboxane A2 impairs vascular endothelial function and tissue oxygen supply [49, 50]. Furthermore, the KEGG enrichment analysis identified ECM-receptor interaction as a core pathway dysregulated in DOX-induced cardiac and brain injury-a finding highly consistent with the known pathophysiology of DOX toxicity. DOX has been reported to disrupt ECM homeostasis by upregulating pro-fibrotic genes, leading to excessive ECM deposition, tissue stiffness, and impaired cellular communication [22, 24]. The ECM-receptor interaction pathway mediates the crosstalk between ECM components and cell surface integrins, activating downstream signaling cascades that amplify OS and programmed cell death [51].

The study also found that DOX-treated OS-related genes in the heart and hippocampi after DOX treated showed the same signaling pathways and GO terms, such as protein digestion and absorption signaling pathway, ossification GO terms, which are closely related to OS [45, 46]. The integrated analysis of transcriptomes from different tissues is an effective analytical strategy to investigate the genetic characteristics present in different diseases. For example, Menghui Yao et al. revealed nicotinic acid-related molecular functions and pharmacological targets for the treatment of rectal cancer/COVID-19 by analyzing the gene expression profiles of rectal cancer and COVID-19 patients [52]. In another study, a transcriptomic analysis of systemic lupus erythematosus and pulmonary hypertension identified a high interferon response in patients with systemic lupus erythematosus as a possible key susceptibility factor for pulmonary hypertension [53].

To translate these transcriptomic findings into potential interventions, we screened 10 optimal candidate compounds for the DEOG feature using Cmap, including Sulfamonomethoxine, Adiphenine, Canadine, and Naringenin. Naringenin has already been reported to attenuate DOX-induced cardiac OS levels by promoting the expression of ECHS1 [54], while Sulfamonomethoxine (a veterinary antibiotic) and Adiphenine (a local anesthetic) were excluded due to neurotoxic risks and limited relevance to OS regulation [31–34].

Canadine is an alkaloid extracted from corydalis cavernosa and it is widely found in nature and has good biological activity and development value [55]. Many studies show that alcaloid played pharmacological role by reducing OS [56, 57] and previous researches report also showed that Canadine have anti-OS function [15]. Canadine has also been reported to inhibit cholinesterase and prolyl oligopeptidase activity and may alleviate cognitive impairment in Alzheimer’s disease [17, 58].

Molecular docking further provided structural evidence for Canadine’s multi-target activity, showing favorable binding affinity (docking scores: −5.5 to −8.5 kcal/mol) with six core DEOGs: CHF, ALDH1A2, LOX, COL1A1, JPH2 and OGN. These proteins play distinct but complementary roles in OS regulation: ALDH1A2 (lipid peroxide scavenger) and CFH (complement system inhibitor) directly modulate OS [28, 59], while COL1A1, LOX, OGN, and JPH2 are critical nodes in OS-amplifying pathways (ECM remodeling, calcium homeostasis, mitochondrial function) [60–63]. Hypothetically, Canadine exerts protective effects via dual mechanisms: 1) directly enhancing the activity of OS regulators; and 2) interfering with pro-OS functions of ECM/calcium-related proteins. These structural predictions align with our in vitro data-Canadine reduced ROS levels and modulated DEOG transcription-reinforcing a multi-level OS-targeting mechanism. However, the docking results are preliminary: direct binding affinity and functional modulation require validation via biochemical assays, and the specific link between Canadine binding and OS reduction for indirect targets warrants further investigation.

In vitro experiments using H9C2 and PC12 cells clarified Canadine’s tissue-specific regulatory effects on DEOG transcription. In H9C2 cells, DOX significantly upregulated Col1a1, Col1a2, Lox, Myoc, Casp1, and Cfh, while downregulating Aldh1a2. Canadine concentration-dependently reversed these transcriptional abnormalities, targeting ECM homeostasis, inflammatory apoptosis, and antioxidant networks to block cardiomyocyte injury. In PC12 cells, DOX upregulated Col1a1, Col1a2, Lox, Casp1, Jph2, and Cfh and downregulated Aldh1a2, with no significant change in Myoc-reflecting tissue specificity, as Myoc is a muscle-enriched factor with low neuronal expression [64]. In neuronal cells, COL1A1/Col1a2-mediated fibrosis [65, 66], Lox-induced ROS production [67], Casp1-dependent pyroptosis [68], and Cfh-amplified neuroinflammation [69] contribute to OS injury. Notably, Aldh1a2 downregulation was a shared mechanism across both cell types, indicating antioxidant metabolic deficiency as a conserved driver of DOX-induced cardiac and cerebral toxicity [28, 70]. Canadine’s reversal of Aldh1a2 mRNA expression further confirms its targeting specificity.

Beyond OS scavenging, Canadine exerted robust cytoprotective effects, restoring the viability of DOX-injured H9C2 and PC12 cells to near-normal levels at 0.5 μM and 1 μM. This protection likely stems from synergistic regulation of third interconnected pathways: 1) reducing OS via scavenging ROS, upregulating antioxidant enzymes, and reversing Aldh1a2 inhibition to mitigate damage to mitochondria and DNA [28]; 2) inhibiting OS-dependent programmed cell death (apoptosis/pyroptosis) via downregulating Casp1 [27]; and 3), Canadine may inhibit excessive ECM deposition and block integrin-mediated pro-injury signaling, synergizing with its antioxidant activity to alleviate DOX-induced tissue damage [71, 72].

There are some limitations in this study. Firstly, DOX-treated heart samples and hippocampi samples were obtained from mice with different DOX doses and treatment times, which may lead to errors in gene expression. Secondly, we only validated Canadine is a potential treatment for DOX-induced OS levels in H9C2/PC12 cells, but not in animal or human clinical trials. Thirdly, while we detected changes in key gene mRNA expression via qPCR, we did not validate their protein expression levels or post-translational modifications in vitro-leaving the functional consequences of transcriptional regulation incompletely verified. Fourthly, the molecular docking results provide preliminary structural evidence for the interaction between Canadine and key target proteins, but lack in vitro biochemical validation of binding affinity and specific regulatory mechanisms. Fifth, we validated the expression of differentially expressed OS-related genes (DEOGs) in mouse samples but did not fully explore their intrinsic mechanisms in mediating DOX-induced injury in H9C2/PC12 cells or animal models. Finally, this study is based solely on the analysis of two transcriptome datasets, which may affect the universality and robustness of the conclusions.

Conclusion

In conclusion, our study indicates that OS is a key mechanism of cardiac and cerebral injury caused by DOX, and Canadine protects cardiomyocytes and brain cells against OS. It also has potential antitummor effects, so Canadine is one of the potential candidates against cardiotoxic and neurotoxicity injury induced by DOX, which deserves further clinical study to verify.

Acknowledgements

We would like to appreciate the public databases including GEO and HAGR for their contributions to human medicine.

Author contributions

The authors’ responsibilities were as follows—Mr. X, Z. had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. Concept and design: X, Z.; Acquisition, analysis, or interpretation of data: All authors. Drafting of the manuscript: Q, Z., X,Z.; Critical revision of the manuscript for important intellectual content: J,L., Q,L.; Statistical analysis: Q, Z., X,Z.; Administrative, technical, or material support: J,L.,; Supervision: J,L., Q, Z.

Funding

Science and Technology Plan of Jiangxi Provincial Administration of Traditional Chinese Medicine (2025022956).

Data availability

The data are public and can be downloaded from the GEO database and Human Ageing Genomic Resources.

Decleartion

Ethics declaration

not applicable.

Competing of interest

The authors declare no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Xianghui Zeng, Qingfeng Zeng, Qi Luo Contributed equally.

References

  • 1.Rivankar S. An overview of doxorubicin formulations in cancer therapy. J Cancer Res Ther. 2014;10:853–58. 10.4103/0973-1482.139267. [DOI] [PubMed] [Google Scholar]
  • 2.Zhao L, Zhang B. Doxorubicin induces cardiotoxicity through upregulation of death receptors mediated apoptosis in cardiomyocytes. Sci Rep. 2017;7:44735. 10.1038/srep44735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Koleini N, Kardami E. Autophagy and mitophagy in the context of doxorubicin-induced cardiotoxicity. Oncotarget. 2017;8:46663–80. 10.18632/oncotarget.16944. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Volkova M, Russell R. Anthracycline cardiotoxicity: prevalence, pathogenesis and treatment. Curr Cardiol Rev. 2011;7:214–20. 10.2174/157340311799960645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Krilis M, Qi M, Qi J, Wong JWH, Guymer R, Liew G, et al. Dual roles of different redox forms of complement factor H in protecting against age related macular degeneration. Free Radic Biol Med. 2018;129:237–46. 10.1016/j.freeradbiomed.2018.09.034. [DOI] [PubMed] [Google Scholar]
  • 6.El-Agamy SE, Abdel-Aziz AK, Esmat A, Azab SS. Chemotherapy and cognition: comprehensive review on doxorubicin-induced chemobrain. Cancer Chemother Pharmacol. 2019;84:1–14. 10.1007/s00280-019-03827-0. [DOI] [PubMed] [Google Scholar]
  • 7.Ongnok B, Chattipakorn N, Chattipakorn SC. Doxorubicin and cisplatin induced cognitive impairment: the possible mechanisms and interventions. Exp Neurol. 2020;324:113118. 10.1016/j.expneurol.2019.113118. [DOI] [PubMed] [Google Scholar]
  • 8.Songbo M, Lang H, Xinyong C, Bin X, Ping Z, Liang S. Oxidative stress injury in doxorubicin-induced cardiotoxicity. Toxicol Lett. 2019;307:41–48. 10.1016/j.toxlet.2019.02.013. [DOI] [PubMed] [Google Scholar]
  • 9.Shaker FH, El-Derany MO, Wahdan SA, El-Demerdash E, El-Mesallamy HO. Berberine ameliorates doxorubicin-induced cognitive impairment (chemobrain) in rats. Life Sci. 2021;269:119078. 10.1016/j.lfs.2021.119078. [DOI] [PubMed] [Google Scholar]
  • 10.Gaman AM, Uzoni A, Popa-Wagner A, Andrei A, Petcu E-B. The role of Oxidative stress in etiopathogenesis of Chemotherapy induced cognitive impairment (CICI)-“chemobrain”. Aging Dis. 2016;7:307–17. 10.14336/AD.2015.1022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Moruno-Manchon JF, Uzor N-E, Kesler SR, Wefel JS, Townley DM, Nagaraja AS, et al. Peroxisomes contribute to oxidative stress in neurons during doxorubicin-based chemotherapy. Mol Cell Neurosci. 2018;86:65–71. 10.1016/j.mcn.2017.11.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Prša P, Karademir B, Biçim G, Mahmoud H, Dahan I, Yalçın AS, et al. The potential use of natural products to negate hepatic, renal and neuronal toxicity induced by cancer therapeutics. Biochem Pharmacol. 2020;173:113551. 10.1016/j.bcp.2019.06.007. [DOI] [PubMed] [Google Scholar]
  • 13.Chlebek J, Korábečný J, Doležal R, Štěpánková Š, Pérez DI, Hošťálková A, et al. In vitro and in silico acetylcholinesterase Inhibitory activity of Thalictricavine and Canadine and their predicted penetration across the blood-brain barrier. Molecules. 2019;24:1340. 10.3390/molecules24071340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Abdel-Haq H, Cometa MF, Palmery M, Leone MG, Silvestrini B, Saso L. Relaxant effects of hydrastis canadensis L. and its major alkaloids on Guinea pig isolated trachea. Pharmacol Toxicol. 2000;87:218–22. 10.1034/j.1600-0773.2000.d01-77.x. [DOI] [PubMed] [Google Scholar]
  • 15.Correché ER, Andujar SA, Kurdelas RR, Gómez Lechón MJ, Freile ML, Enriz RD. Antioxidant and cytotoxic activities of canadine: biological effects and structural aspects. Bioorg Med Chem. 2008;16:3641–51. 10.1016/j.bmc.2008.02.015. [DOI] [PubMed] [Google Scholar]
  • 16.Kumarasamy VM, Shin Y-J, White J, Sun D. Selective repression of RET proto-oncogene in medullary thyroid carcinoma by a natural alkaloid berberine. BMC Cancer. 2015;15:599. 10.1186/s12885-015-1610-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Chlebek J, De Simone A, Hošťálková A, Opletal L, Pérez C, Pérez DI, et al. Application of BACE1 immobilized enzyme reactor for the characterization of multifunctional alkaloids from corydalis cava (fumariaceae) as Alzheimer’s disease targets. Fitoterapia. 2016;109:241–47. 10.1016/j.fitote.2016.01.008. [DOI] [PubMed] [Google Scholar]
  • 18.Diboun I, Wernisch L, Orengo CA, Koltzenburg M. Microarray analysis after RNA amplification can detect pronounced differences in gene expression using limma. BMC Genomics. 2006;7:252. 10.1186/1471-2164-7-252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, et al. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res. 2003;13:2498–504. 10.1101/gr.1239303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Bader GD, Hogue CWV. An automated method for finding molecular complexes in large protein interaction networks. BMC Bioinf. 2003;4:2. 10.1186/1471-2105-4-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Williams G. SPIEDw: a searchable platform-independent expression database web tool. BMC Genomics. 2013;14:765. 10.1186/1471-2164-14-765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Levick SP, Soto-Pantoja DR, Bi J, Hundley WG, Widiapradja A, Manteufel EJ, et al. Doxorubicin-induced Myocardial fibrosis involves the Neurokinin-1 receptor and direct effects on cardiac fibroblasts. Heart Lung Circ. 2019;28:1598–605. 10.1016/j.hlc.2018.08.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Nagoor Meeran MF, Arunachalam S, Azimullah S, Saraswathiamma D, Albawardi A, Almarzooqi S, et al. α-bisabolol, a Dietary sesquiterpene, attenuates doxorubicin-induced acute cardiotoxicity in rats by inhibiting Cellular signaling pathways, Nrf2/Keap-1/HO-1, Akt/mTOR/GSK-3β, NF-κB/p38/MAPK, and NLRP3 inflammasomes regulating Oxidative stress and inflammatory cascades. Int J Mol Sci. 2023;24:14013. 10.3390/ijms241814013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Zhang J-Y, Zhu W-W, Wang M-Y, Zhai R-D, Wang Q, Shen W-L, et al. Cancer-associated fibroblasts promote oral squamous cell carcinoma progression through LOX-mediated matrix stiffness. J Transl Med. 2021;19:513. 10.1186/s12967-021-03181-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Costa RA, Martins RST, Capilla E, Anjos L, Power DM. Vertebrate SLRP family evolution and the subfunctionalization of osteoglycin gene duplicates in teleost fish. BMC Evol Biol. 2018;18:191. 10.1186/s12862-018-1310-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Luo T, Yan N, Xu M, Dong F, Liang Q, Xing Y, et al. Junctophilin-2 allosterically interacts with ryanodine receptor type 2 to regulate calcium release units in mouse cardiomyocytes. Gen Physiol Biophys. 2022;41:133–40. 10.4149/gpb_2022007. [DOI] [PubMed] [Google Scholar]
  • 27.Zhang H, Ding X, Qiu Y, Xie M, Wang H, Li T, et al. Preventive effect of imperatorin against doxorubicin-induced cardiotoxicity through suppression of NLRP3 inflammasome activation. J Nat Med. 2025;79:95–106. 10.1007/s11418-024-01850-x. [DOI] [PubMed] [Google Scholar]
  • 28.Zhang C, Amanda S, Wang C, King Tan T, Zulfaqar Ali M, Zhong Leong W, et al. Oncorequisite role of an aldehyde dehydrogenase in the pathogenesis of T-cell acute lymphoblastic leukemia. Haematologica. 2021;106:1545–58. 10.3324/haematol.2019.245639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Kiss MG, Papac-Miličević N, Porsch F, Tsiantoulas D, Hendrikx T, Takaoka M, et al. Cell-autonomous regulation of complement C3 by factor H limits macrophage efferocytosis and exacerbates atherosclerosis. Immunity. 2023;56:1809–24.e10. 10.1016/j.immuni.2023.06.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Lamb J, Crawford ED, Peck D, Modell JW, Blat IC, Wrobel MJ, et al. The Connectivity map: using gene-expression signatures to connect small molecules, genes, and disease. Science. 2006;313:1929–35. 10.1126/science.1132939. [DOI] [PubMed] [Google Scholar]
  • 31.Zhang Q-Q, Ying G-G, Pan C-G, Liu Y-S, Zhao J-L. Comprehensive evaluation of antibiotics emission and fate in the river basins of China: source analysis, multimedia modeling, and linkage to bacterial resistance. Environ Sci Technol. 2015;49:6772–82. 10.1021/acs.est.5b00729. [DOI] [PubMed] [Google Scholar]
  • 32.Lee K-Y, Huang C-H, Tang H-J, Yang C-J, Ko W-C, Chen Y-H, et al. Acute psychosis related to use of trimethoprim/sulfamethoxazole in the treatment of HIV-infected patients with pneumocystis jirovecii pneumonia: a multicentre, retrospective study. J Antimicrob Chemother. 2012;67:2749–54. 10.1093/jac/dks283. [DOI] [PubMed] [Google Scholar]
  • 33.Saidinejad M, Ewald MB, Shannon MW. Transient psychosis in an immune-competent patient after oral trimethoprim-sulfamethoxazole administration. Pediatrics. 2005;115:e739–741. 10.1542/peds.2004-1352. [DOI] [PubMed] [Google Scholar]
  • 34.Spitzmaul G, Gumilar F, Dilger JP, Bouzat C. The local anaesthetics proadifen and adiphenine inhibit nicotinic receptors by different molecular mechanisms. Br J Pharmacol. 2009;157:804–17. 10.1111/j.1476-5381.2009.00214.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Sirangelo I, Sapio L, Ragone A, Naviglio S, Iannuzzi C, Barone D, et al. Vanillin prevents doxorubicin-induced apoptosis and Oxidative stress in rat H9c2 cardiomyocytes. Nutrients. 2020;12:2317. 10.3390/nu12082317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Mojarrab M, Mehrabi M, Ahmadi F, Hosseinzadeh L. Protective effects of fractions from artemisia biennis hydro-ethanolic extract against doxorubicin-induced oxidative stress and apoptosis in PC12 cells. Iran J Basic Med Sci. 2016;19:503–10. [PMC free article] [PubMed] [Google Scholar]
  • 37.Cummings J, Anderson L, Willmott N, Smyth JF. The molecular pharmacology of doxorubicin in vivo. Eur J Cancer. 1991;27:532–35. 10.1016/0277-5379(91)90209-v. [DOI] [PubMed] [Google Scholar]
  • 38.Octavia Y, Tocchetti CG, Gabrielson KL, Janssens S, Crijns HJ, Moens AL. Doxorubicin-induced cardiomyopathy: from molecular mechanisms to therapeutic strategies. J Mol Cell Cardiol. 2012;52:1213–25. 10.1016/j.yjmcc.2012.03.006. [DOI] [PubMed] [Google Scholar]
  • 39.Chunchai T, Arinno A, Ongnok B, Pantiya P, Khuanjing T, Prathumsap N, et al. Ranolazine alleviated cardiac/brain dysfunction in doxorubicin-treated rats. Exp Mol Pathol. 2022;127:104818. 10.1016/j.yexmp.2022.104818. [DOI] [PubMed] [Google Scholar]
  • 40.Cauli O. Oxidative stress and cognitive alterations induced by cancer Chemotherapy Drugs: a scoping review. Antioxid (Basel). 2021;10:1116. 10.3390/antiox10071116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Dogan Unlu M, Asci S, Asci H, Agirca Tasan S, Ozmen O, Taner R, et al. Lercanidipine ameliorated doxorubicin-induced neuroinflammation and maintained the expressions of choline acetyltransferase via enhancing the levels of PI3K/AKT/HIF1-α expressions. Mol Biol Rep. 2024;51:300. 10.1007/s11033-023-09024-w. [DOI] [PubMed] [Google Scholar]
  • 42.Liu J, Chen Y, Han D, Huang M. Inhibition of the expression of TRIM63 alleviates ventilator-induced diaphragmatic dysfunction by modulating the PPARα/PGC-1α pathway. Mitochondrion. 2025;83:102025. 10.1016/j.mito.2025.102025. [DOI] [PubMed] [Google Scholar]
  • 43.Chen Q, Xie C, Tang K, Luo M, Zhang Z, Jin Y, et al. The E3 ligase Trim63 promotes podocyte injury and proteinuria by targeting PPARα to inhibit fatty acid oxidation. Free Radic Biol Med. 2023;209 Pt 1):40–54. 10.1016/j.freeradbiomed.2023.09.039. [DOI] [PubMed] [Google Scholar]
  • 44.Serie DJ, Crook JE, Necela BM, Axenfeld BC, Dockter TJ, Colon-Otero G, et al. Breast cancer clinical trial of Chemotherapy and Trastuzumab: potential tool to identify cardiac modifying variants of dilated cardiomyopathy. J Cardiovasc Dev Dis. 2017;4:6. 10.3390/jcdd4020006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Martins B, Vieira M, Delerue-Matos C, Grosso C, Soares C. Biological potential, gastrointestinal digestion, absorption, and bioavailability of algae-derived compounds with Neuroprotective activity: a comprehensive review. Mar Drugs. 2022;20:362. 10.3390/md20060362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Anastassopoulou J, Kyriakidou M, Kyriazis S, Mavrogenis AF, Mamareli V, Mamarelis I, et al. Oxidative stress in ageing and disease development studied by FT-IR spectroscopy. Mech Ageing Dev. 2018;172:107–14. 10.1016/j.mad.2017.11.009. [DOI] [PubMed] [Google Scholar]
  • 47.Liang L, Zhu J-H, Chen G, Qin X-G, Chen J-Q. Prognostic values for the mRNA expression of the ADAMTS family of genes in gastric cancer. J Oncol. 2020, 2020;9431560. 10.1155/2020/9431560. [DOI] [PMC free article] [PubMed]
  • 48.Xing R, Yu H, Yu J, Zeng R, Xiang Z, Ma H, et al. Identification of key genes affecting ventilator-induced diaphragmatic dysfunction in diabetic mice. Front Genet. 2024;15:1387688. 10.3389/fgene.2024.1387688. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Zhang L, Wuri J, An L, Liu X, Wu Y, Hu H, et al. Metoprolol attenuates intracerebral hemorrhage-induced cardiac damage by suppression of sympathetic overactivity in mice. Auton Neurosci. 2021;234:102832. 10.1016/j.autneu.2021.102832. [DOI] [PubMed] [Google Scholar]
  • 50.Lucotti S, Cerutti C, Soyer M, Gil-Bernabé AM, Gomes AL, Allen PD, et al. Aspirin blocks formation of metastatic intravascular niches by inhibiting platelet-derived COX-1/thromboxane A2. J Clin Invest. 2019;129:1845–62. 10.1172/JCI121985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Druso JE, MacPherson MB, Chia SB, Elko E, Aboushousha R, Seward DJ, et al. Endoplasmic reticulum Oxidative stress promotes glutathione-dependent oxidation of collagen-1A1 and promotes Lung fibroblast activation. Am J Respir Cell Mol Biol. 2024;71:589–602. 10.1165/rcmb.2023-0379OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Li R, Li Y, Liang X, Yang L, Su M, Lai KP. Network pharmacology and bioinformatics analyses identify intersection genes of niacin and COVID-19 as potential therapeutic targets. Brief Bioinform. 2021;22:1279–90. 10.1093/bib/bbaa300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Yao M, Zhang C, Gao C, Wang Q, Dai M, Yue R, et al. Exploration of the shared gene signatures and molecular mechanisms between systemic lupus erythematosus and pulmonary arterial hypertension: evidence from transcriptome data. Front Immunol. 2021;12:658341. 10.3389/fimmu.2021.658341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Zhao Z, Yang S, Deng Y, Wang L, Zhang Y, Feng Z, et al. Naringin interferes doxorubicin-induced Myocardial injury by promoting the expression of ECHS1. Front Pharmacol. 2022;13:859755. 10.3389/fphar.2022.859755. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Pingali S, Donahue JP, Payton-Stewart F. Tetrahydroberberine, a pharmacologically active naturally occurring alkaloid. Acta Crystallogr C Struct Chem. 2015;71 Pt, 4):262–65. 10.1107/S2053229615004076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Sun K, Yang P, Zhao R, Bai Y, Guo Z. Matrine attenuates D-Galactose-induced Aging-related behavior in mice via Inhibition of Cellular senescence and Oxidative stress. Oxid Med Cell Longev. 2018, 2018;7108604. 10.1155/2018/7108604. [DOI] [PMC free article] [PubMed]
  • 57.Nigdelioglu Dolanbay S, Kocanci FG, Aslim B. Neuroprotective effects of allocryptopine-rich alkaloid extracts against oxidative stress-induced neuronal damage. Biomed Pharmacother. 2021;140:111690. 10.1016/j.biopha.2021.111690. [DOI] [PubMed] [Google Scholar]
  • 58.Siatka T, Adamcová M, Opletal L, Cahlíková L, Jun D, Hrabinová M, et al. Cholinesterase and prolyl oligopeptidase Inhibitory activities of alkaloids from argemone platyceras (papaveraceae). Molecules. 2017;22:1181. 10.3390/molecules22071181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Velazquez-Soto H, Groman-Lupa S, Cruz-Aguilar M, Salazar AL, Zenteno JC, Jimenez-Martinez MC. Exogenous CFH modulates levels of pro-inflammatory mediators to prevent Oxidative damage of retinal pigment epithelial cells with the At-risk CFH Y402H variant. Antioxid (Basel). 2023;12:1540. 10.3390/antiox12081540. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Li M, Wang J, Wang C, Xia L, Xu J, Xie X, et al. Microenvironment remodeled by tumor and stromal cells elevates fibroblast-derived COL1A1 and facilitates ovarian cancer metastasis. Exp Cell Res. 2020;394:112153. 10.1016/j.yexcr.2020.112153. [DOI] [PubMed] [Google Scholar]
  • 61.Zhang Y-P, Wang H-X, Gao Z-C, Xu L-Z, Fu Y. COL12A1 promotes osteosarcoma progression via the FAK/PI3K/AKT/mTOR pathway. Curr Mol Med. 2025;25:902–15. 10.2174/0115665240322280240903111159. [DOI] [PubMed] [Google Scholar]
  • 62.Tan J, Lin G, Zhang R, Wen Y, Luo C, Wang R, et al. Bufotalin induces Oxidative stress-mediated apoptosis by blocking the ITGB4/FAK/ERK pathway in glioblastoma. Antioxid (Basel). 2024;13:1179. 10.3390/antiox13101179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Kumari S, Panda TK, Pradhan T. Lysyl oxidase: its diversity in health and diseases. Indian J Clin Biochem. 2017;32:134–41. 10.1007/s12291-016-0576-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Zhang Y, Li S, Wen X, Tong H, Li S, Yan Y. MYOC promotes the differentiation of C2C12 cells by regulation of the TGF-β signaling pathways via CAV1. Biol (Basel). 2021;10:686. 10.3390/biology10070686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.De Luca F, Besio R, Lugli E, Pelloni E, Casali C, Pérez Franco, et al. Osteogenesis Imperfecta: a look into the cerebellum of the brtl murine Model. Mol Neurobiol. 2025;62:15609–27. 10.1007/s12035-025-05205-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Feng L, Zhang X, Li W, Wang J, Wang Q, Wang Q, et al. Proteomics reveals that Di Dang decoction can regulate the Jak2/Stat5 signaling pathway and inhibit apoptosis by reducing the oxidative stress response in rats with acute intracerebral hemorrhagic stroke. J Ethnopharmacol. 2023;301:115816. 10.1016/j.jep.2022.115816. [DOI] [PubMed] [Google Scholar]
  • 67.Lo Castro A, Murdocca M, Pucci S, Zaratti A, Greggi C, Sangiuolo F, et al. Early hippocampal i-LTP and LOX-1 overexpression induced by Anoxia: a potential role in neurodegeneration in NPC mouse Model. Int J Mol Sci. 2017;18:1442. 10.3390/ijms18071442. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Jiang Q, Tang G, Zhong X-M, Ding D-R, Wang H, Li J-N. Role of Stat3 in NLRP3/caspase-1-mediated hippocampal neuronal pyroptosis in epileptic mice. Synapse. 2021;75:e22221. 10.1002/syn.22221. [DOI] [PubMed] [Google Scholar]
  • 69.Fields JA, Swinton M, Sundermann EE, Scrivens N, Vallee K-A, Moore DJ. Complement component 3 and complement factor H protein levels are altered in brain tissues from people with human immunodeficiency virus: a pilot study. Front Aging Neurosci. 2022;14:981937. 10.3389/fnagi.2022.981937. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Liang H, Zhou X, Zhang J, Xu W, Liu Y, Wang X, et al. The therapeutic potential of Apigenin in amyotrophic lateral sclerosis through ALDH1A2/Nrf2/ARE signaling. Mol Med. 2024;30:206. 10.1186/s10020-024-00977-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Fidale TM, Antunes HKM, Alex Dos Santos L, Rodrigues de Souza F, Deconte SR, Borges Rosa de Moura F, et al. Increased Dietary leucine reduces doxorubicin-associated cardiac dysfunction in rats. Front Physiol. 2017;8:1042. 10.3389/fphys.2017.01042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Ma Y, Yang Q-Q, Gu D-M, Yuan X, Wang Y-H, Guo L-C. Canadine inhibits epithelial mesenchymal transformation of HPV-negative cervical cancer. Tissue Barriers. 2024;12:2256641. 10.1080/21688370.2023.2256641. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data are public and can be downloaded from the GEO database and Human Ageing Genomic Resources.

Articles from BMC Pharmacology & Toxicology are provided here courtesy of BMC

RESOURCES