sRNA196 promotes Pseudomonas aeruginosa virulence by regulating target genes PA4398, ZapE and PhoB

Abstract

Bacterial sRNAs is important mechanisms regulating bacterial pathogenesis. In this study, We screened a novel sRNA located at PA5007 closely associated with Pseudomonas aeruginosa infection by transcriptome sequencing196. And using transcriptome sequencing as well as public databases, the sequence was found to be TCCGGGGCACGGCGCAGCATCGGCTCCAGGTCCTTGACCTGGTCGCGGCGGGCCGAACCA. We constructed sRNA196 gene-deficient and overexpression strains in PAO1 and demonstrated its presence by Northern blotting. The results showed that sRNA196 positively regulated pyocyanin synthesis, biofilm formation, and motility in P. aeruginosa. In addition, sRNA196 was able to promote P. aeruginosa adhesion and invasion ability in A549 cells as well as enhance P. aeruginosa survival in RAW264.7 cells. Furthermore, we demonstrated that sRNA196 can positively regulate several target genes including PA4398, ZapE, PhoB by fluorescense reporting system, and further verified the effects of these target genes on the relevant phenotypes. In summary, this study identified a new small RNA, sRNA196, that positively regulates virulence, which helps us to have a more comprehensive and clearer understanding of the role played by sRNAs in the regulation of virulence in P. aeruginosa.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12934-025-02920-9.

Introduction

P. aeruginosa is a Gram-negative pathogen widely distributed in the natural environmen. As an opportunistic pathogen, P. aeruginosa frequently causes various infections in immunocompromised patients, such as lung, bloodstream, skin, and urinary tract infections [23, 36]. The therapeutic landscape for P. aeruginosa infections remains critically constrained, and the misuse of antibiotics has exacerbated the management of P. aeruginosa infections in clinical settings. The complex and diverse virulence factors of P. aeruginosa play a key role in its infection of the host. A number of studies have demonstrated that P. aeruginosa usually invades the host through a variety of virulence factors, such as pyocyanin, biofilm, flagellate and pili [18, 25]. Pyocyanin, is a virulence factor unique to P. aeruginosa and stimulates the host immune response, leading to cellular damage and death [7]. Bacterial biofilm consists of an extracellular polymeric matrix that forms forms in three key stages: adhesion, maturation, and dispersion. Biofilms promote persistent infection and long-term colonization of P. aeruginosa within the host, playing a crucial role in antibiotic resistance [33]. Bacterial motility is closely linked to its pathogenesis, with flagella facilitating bacterial spread, colonization, and infection in the host environment [8]. The presence of the aforementioned virulence factors not only enables the bacteria to invade the host and evade the immune response, but also contributes to tissue damage and pathological changes by triggering local or systemic inflammatory responses.

Bacterial small RNAs (sRNAs) are non-coding RNAs commonly found in prokaryotes, typically ranging from 50 to 500 bp, and do not encode proteins [6]. sRNAs primarily function in regulatory roles in two key ways. First, they influence the stability and translation efficiency of mRNAs through base-pairing interactions. Second, sRNAs can alter their functions by binding to specific proteins. In recent years, bacterial sRNAs have been recognized as important regulators of bacterial virulence, particularly in processes such as quorum sensing, motility, and energy metabolism [9]. Quanming Xu et al. found that sRNA23 in Streptococcus suis affects its adhesion and biofilm formation by acting on FBA/rplB, which in turn affects its pathogenicity [31]. Pengbo Cao et al. demonstrated that the sRNA sicX in P. aeruginosa regulates the transition from chronic to acute infection [5]. Although several studies have highlighted the critical role of sRNAs in some other bacteria, research on their role in P. aeruginosa remains limited. Therefore, studying novel sRNAs and exploring their functions and regulatory networks in P. aeruginosa is crucial for understanding pathogenic mechanisms and developing new therapeutic strategies.

In this study, we screen sRNAs that are modulated during P. aeruginosa infection by constructing two models: a mouse intraperitoneal infection model and a PAO1 in vitro culture model. By transcriptome sequencing analysis, among these differentially expressed sRNAs, we screened and identified a novel sRNA and named it sRNA196. Using combined predictions from the IntaRNA and RNAPredator software, we found that sRNA196 targets multiple virulence-related genes, which are crucial for bacterial pathogenicity, particularly in biofilm morphogenesis. Based on these findings, we investigated the role of sRNA196 in P. aeruginosa biofilm formation and other related phenotypes. In a series of phenotyping experiments, we determined that sRNA196 plays a key role in biofilm formation and positively regulates pyocyanin production, swimming motility, and swarming motility in P. aeruginosa. Further experimental validation revealed that sRNA196 modulates the expression of several target genes, including PA4398, ZapE, PhoB, and others. By regulating these key genes, sRNA196 enhances the expression of virulence factors such as biofilm formation and motility in P. aeruginosa, and may also contribute to immune evasion and environmental adaptation. These results provide important insights into the function of sRNA196 in P. aeruginosa infection and offer new directions for studying the regulatory mechanisms of bacterial virulence factors and potential therapeutic targets.

Materials and methods

Bacterial strains and culture conditions

The bacterial strains and plasmids used in this study are listed in Table S1. Bacterial strains were cultured by isolating single colonies on LB agar plates(hopebiol, HB0128), followed by inoculation into LB broth (hopebiol, HB0129) for overnight incubation at 37 °C with shaking at 220 rpm. This served as the primary enrichment. The primary culture was then diluted 1:100 into fresh LB broth for secondary growth and incubated for 6 h, reaching the mid-exponential phase to generate the secondary bacterial culture.

Establishment of animal infection models

C57BL/6J mice were purchased from Guangdong Yaokang. In this study, abdominal infection models were established using male C57BL/6 mice aged 4–6 weeks. First, the PAO1 suspension in the log phase of growth was centrifuged, and the bacterial pellet was re-suspended in sterile PBS buffer (Vivacell, C3580-0500) to the desired concentration. The bacterial suspension was then injected into the mouse abdomen via a single intraperitoneal injection, ensuring equal volume was administered to each mouse. Mice were divided into two experimental groups based on different infection time points, with each group consisting of 5 mice. Peritoneal fluid samples were collected at 2 and 6 h post-infection. At the end of the designated infection period, the mice were euthanized, and their peritoneal fluid samples were harvested for bacterial RNA extraction and subsequent transcriptome sequencing analysis.

Establishment of in vitro culture models

In the in vitro culture model, the PAO1 bacterial suspension in the log phase of growth was first centrifuged, and the bacterial pellet was re-suspended in sterile PBS buffer to the desired concentration. The resuspended bacteria were then inoculated into fresh LB broth medium at a specific inoculation ratio and cultured on a constant-temperature shaker at 37 °C until the predetermined time points were reached. To examine the transcriptomic characteristics of the bacteria at different time intervals, bacterial samples were collected at 2 and 6 h. RNA was extracted from these samples, followed by transcriptome sequencing analysis.

Validation of bloodstream infections

The PAO1 strain was co-cultured with healthy human blood to simulate bloodstream infection, as previously described [35]. First, 300 µL of whole blood was added to 2.7 mL of LB broth, diluting it to a 10% concentration. The PAO1 bacterial suspension in the logarithmic growth phase was then centrifuged and resuspended in sterile PBS to the appropriate concentration. The bacteria were incubated with 10% whole blood at a specific ratio for 2 and 6 h to simulate infection. After the infection period, the supernatant was removed by centrifugation, and the bacteria were washed five times with PBS. The supernatant was discarded, and Trizol reagent (Thermo, 15596026CN) was added for RNA extraction. RT-qPCR was performed using rpoD as the internal reference gene to measure the expression of sRNA196 during infection (2X Q3 SYRB qPCR Master Mix(AG11733) was purchased from ACCURATE BIOTECHNOLOGY (HUNAN)CO.,LTD, ChangSha, China).

Validation of cell infection models

In the cell infection model, the PAO1 bacterial suspension in the log phase of growth was first centrifuged, and the bacterial pellet was resuspended in sterile PBS to the appropriate concentration. The suspended bacteria were then co-cultured with A549 and RAW264.7 cells at a specific ratio until the predetermined time point was reached. After the infection period, the co-cultured supernatant was collected, and TRIzol reagent was added for RNA extraction. RT-qPCR was performed using rpoD as the internal reference gene to measure the expression of sRNA196 during infection.

Construction of the gene deficient and overexpression strains

To construct the sRNA196 gene-deficient strain, we employed homologous recombination [21]. First, the upstream and downstream fragments of sRNA196 (each 1000 bp, referred to as fragments A and B) were amplified using high-fidelity PCR enzymes (TOLOBIO, 20809-01). Fragments A and B were then ligated together through fusion PCR to obtain the target fragment. Additionally, the suicide plasmid PGSM was double-digested with SacI (NEB, R3156) and XbaI(NEB, R0145L), and the purified product was recovered. Next, seamless cloning technology was used to insert the target fragment into the linearized vector, followed by transformation. The PAO1 strain and PGSM plasmid containing the target fragment were then co-cultured on a filter membrane at a 1:3 ratio. Single colonies were selected and transferred to a 10% sucrose plate for reverse screening. Positive clones were identified and further verified by PCR. Finally, RT-qPCR was performed to quantify gene expression using rpoD as the internal reference gene, and the samples were sent for sequencing to confirm the successful knockout of sRNA196.

For the construction of overexpressed strains, PCR amplification was performed using primers that included homologous arms of the vector. The amplified products were then ligated into the EcoRI-digested pROp200 vector, which was subsequently transformed into E. coli DH5ɑ. Positive clones were selected, and the recombinant pROp200 plasmid containing the target gene was extracted. This plasmid was then transformed into the PAO1 strain. Overexpression was verified by PCR and RT-qPCR, and the plasmid was sequenced to confirm successful overexpression.

Northern blot

Total RNA was extracted from PAO1 and ∆sRNA196 strains and evaluated by Northern Blot to verify the size and expression level of sRNA196. The Biotin Northern Blot (for Small RNA) Kit (Beyotime, R0220) was used according to the manufacturer’s instructions. First, bacterial RNA was extracted using the Trizol method. The RNA samples were then mixed with an equal volume of 2x RNA loading buffer and heated at 65 °C for 15 minutes, followed by rapid cooling on ice. Next, the samples were resolved by electrophoresis on a 10% Urea-PAGE gel. After electrophoresis, RNA was transferred to a nylon membrane at 120 V for 30 minutes. The membrane was incubated in a preheated hybridization solution at 37 °C for 2 hours for pre-hybridization, followed by incubation with a hybridization solution containing the probe. The sequence of the sRNA196 probe was 5’ AGGACCTGGAGCCGATGCTGCGCCGTG 3’, and using 5 s rRNA as an internal reference [17], the 5S rRNA probe sequence was 5’ GUUUCACUUCUGAGUUCGGCAUGGGGAUCAGGUGGG 3’. Both probes were synthesized by DIA-UP BIOECH (Beijing, China). Hybridization was carried out overnight at 37 °C. After hybridization, the membrane was washed, blocked, and treated with rinsing and equilibration solution, followed by the addition of chemiluminescence working solution for development and result observation.

RNA extraction with qRT-PCR

Total RNA was extracted using Trizol reagent (Invitrogen, USA). Complementary DNA (cDNA) was synthesized using Evo MMLV RT Master Mix (AG, China). quantification of RNA expression was performed using SYBR^® Green Pro Taq HS Premix (AG, China) on a LightCycler^® 480 II (Roche, Applied Science). Data were normalized to GAPDH RNA expression and expression was calculated using the formula 2^^−ΔΔct. The primers are shown in Supplementary Table 2.

Virulence related experiments

Pyocyanin synthesis

The synthesis of bacterial pyocyanin was determined according to established protocols [29]. After overnight culturing, the strains were subcultured twice and adjusted to an OD600 = 0.03. A 70 µL bacterial suspension was added to a 12-well plate containing 7 mL of LB medium and incubated at 37 °C for 24 h in a constant-temperature incubator. Following incubation, the supernatant was aspirated into a 15 mL centrifuge tube, which was then inverted and mixed thoroughly. Next, 200 µL of the bacterial suspension was transferred to a 96-well plate for OD600 measurement. The remaining bacterial suspension was centrifuged at 12,000 rpm for 10 min. The supernatant (5 mL) was collected and transferred to a new 15 mL centrifuge tube, followed by the addition of 3 mL of chloroform. After vigorous shaking, the mixture was centrifuged at 12,000 rpm for 5 min. The chloroform layer was carefully transferred to a new 15 mL centrifuge tube, and 1 mL of 0.2 N HCl was added. After vigorous shaking, the mixture was centrifuged again at 12,000 rpm for 5 min. A 200 µL sample of the pink upper layer was transferred to a 96-well plate, and the OD520 was measured. Pyocyanin yield was calculated using the following formula: Pyocyanin yield per milliliter of culture solution = 17.072 × (OD520/OD600).

Biofilm formation

The determination of bacterial biofilm formation was performed according to literature protocols [20]. The strains were incubated overnight, followed by secondary enrichment and adjustment to an OD600 = 0.03. A 20 µL bacterial suspension was added to a 12-well plate containing 2 mL of LB medium, and the plate was incubated for 24 h at 37 °C in a constant-temperature incubator. After incubation, the bacterial suspension was gently aspirated using a disposable syringe. The wells were allowed to dry, and 1 mL of methanol was added for fixation for 15 min. After aspirating the methanol, the wells were left to dry. Next, 1 mL of crystal violet solution was added for staining and incubated for 15 min at room temperature. The crystal violet (Solarbio, G1063) solution was aspirated, and the wells were rinsed five times with PBS buffer. After drying, 1 mL of 95% ethanol was added for decolorization. A 200 µL sample of the solution was transferred to a 96-well plate, and the OD600 was measured.

Motility assays

As mentioned earlier, swimming motility of bacteria was detected using a 0.3% semi-solid agar plate, and swarming motility was detected using a 0.5% semi-solid agar plate [24]. After overnight culturing, the strains were subcultured twice and adjusted to an OD600 = 0.03. A 5 µL drop of the bacterial suspension was added to the center of the plate, which was then incubated at 37 °C for 14–16 h to observe the results.

Cell experiments

Adhesion and invasion assays

To evaluate the ability of bacteria to adhere to and invade A549 cells, assays were conducted following established methods [4]. Twe groups were used: the experimental group (bacteria co-cultured with A549 cells at a 10:1 infection index), and the antibiotic control group (bacteria co-cultured with A549 cells along with polymyxin B). Polymyxin B (MCE, HY-A0248) was purchased Beijing Solarbio Science&Technology Co.,Ltd. A549 cells were purchased from Hunan FengHui Biotechnology Co.

Adhesion procedure: After a 1-hour incubation, the supernatant was discarded, and the cells were washed five times with PBS buffer to remove unbound bacteria. The cells were then lysed by adding 1 mL of sterile water, and 5 µL of the lysate was plated onto blood agar plates. The plates were incubated at 37 °C for bacterial colony growth, and the results were recorded.

Invasion procedure: Following the initial 1-hour incubation, the supernatant was discarded, and the cells were washed five times with PBS. DMEM medium containing 100 µg/mL polymyxin B was added to prevent bacterial growth outside the cells, and incubation continued for an additional 2 h. After the second incubation, the supernatant was discarded, and the cells were washed five more times with PBS. Finally, 1 mL of sterile water was added to lyse the cells, and 5 µL of the lysate was plated on blood agar plates. The plates were incubated at 37 °C, and bacterial survival was assessed by colony formation.

RAW264.7 intracellular survival assays

The ability of bacteria to survive in RAW264.7 cells was assessed using a method adapted from previous studies [4]. RAW264.7 cells were purchased from Hunan FengHui Biotechnology Co. The bacteria were co-cultured with RAW264.7 cells and the experimental procedure was the same as the invasion assay.

Cell proliferation assay

The detection of cell proliferation ability was mainly referred to CCK-8 assay kitt (Life-ilab, AC11L054). Firstly, A549 cells were inoculated in 96-well plates and cultured to a suitable density. The bacterial strain was first cultured overnight to achieve adequate growth, followed by a secondary enrichment. The bacteria were then introduced to the A549 cells at an infection index of 10:1, and the co-culture was maintained for a specified period. After the co-incubation, the culture supernatant was discarded, And add 100ul of CCK8 working solution diluted 10-fold by DMEM medium to each well. The plates were then incubated for 2 h at 37℃ to allow for the reduction of WST-8, a component of the CCK-8 reagent, by metabolically active cells. The optical density (OD) value was subsequently measured at a wavelength of 450 nm using a microplate reader. The cell survival rate was calculated based on the following formula: cell survival rate = [(As-A_b)/(Ac-A_b)] x 100%. Where As refers to wells where cells and bacteria were co-cultured, A_b refers to wells without cells and bacteria, and Ac refers to wells with cells and no bacteria.

Cytokine assays

The bacterial strains were cultured overnight and then subcultured with A549 cells at a 10:1 infection ratio. After co-culturing for a specified period, the cells were washed five times with PBS buffer. Subsequently, 500 µL of Trizol reagent was added to lyse the cells and extract RNA. GAPDH was used as the internal reference gene to quantitatively assess the expression levels of IL-1, IL-6, and TNF-α. The primer sequences used are provided in Table S2.

Mouse lung tissue H&E staining

Mice were infected with Pseudomonas aeruginosa PAO1, sRNA196, Vector, and ∆sRNA196 strains. After a specified period of infection, the animals were euthanized, and the lung tissues were carefully excised for further analysis. Lung tissue was fixed in formalin and subsequently paraffin embedded and sectioned. Sections were first dewaxed in xylene and then dehydrated through a gradient of different concentrations of alcohol. After dehydration, the sections were immersed in staining solution for staining. After staining was completed, the sections were dehydrated again through an alcohol gradient and finally treated with transparency in xylene. Finally, the sections were sealed with sealer and covered with coverslips to complete the preparation of tissue sections.

Fluorescent reporter assays

The plasmids used in this experiment are listed in Table S1, and PCR amplification was performed using primers provided in Table S2. First, amplification products for sRNA196 and the PA4398, ZapE, and PhoB genes were obtained by PCR, using primers designed to include the homology arms of the vectors. The purified PCR products were recovered via agarose gel electrophoresis. Next, plasmids pSTV28 and pUCP30T-gfp were double-enzymatically cleaved with BamHI, HindIII, EcoRI, and NcoI, respectively. The purified linearized vectors were recovered by agarose gel electrophoresis. Using the Ready-to-Use Seamless Cloning Kit (B632219-0040, Abbkine), the target fragments were ligated with the linearized vectors at a 3:1 ratio and then transferred into E. coli DH5ɑ. Monoclonal colonies were selected for PCR verification, and positive strains were sequenced. Subsequently, the pUCP30T plasmid containing the target genes (PA4398, ZapE, and PhoB) was extracted and transformed into receptive cells containing pSTV28 and pSTV28-sRNA196. Fluorescence intensity was measured after culture. OD595 and fluorescence intensity (F485/535) were determined using a BioTek Cytation™ instrument, and fluorescence intensity was calculated using the formula: F485/F535/OD595. Additionally, confocal microscopy was employed to observe the fluorescence distribution and intensity of the bacterial suspension under the same parameters.

Add Trizol reagent to the above bacteria to lysed and extract the total bacterial RNA.Total RNA was used for mRNA library preparation and sequencing. Library construction was accomplished using the Illumina TruSeq Targeted mRNA Library Preparation Kit (Illumina, San Diego, CA, USA). The library construction process included mRNA enrichment, reverse transcription and PCR amplification. The final library fragment sizes ranged from 200 to 500 bp, and library concentrations were determined by Qubit (Invitrogen, Carlsbad, California, USA) and diluted to 10 nM.All libraries were sequenced in bipartite (2 × 150 bp) mode on the Illumina NovaSeq 6000 platform, with a sequencing throughput of 300 million reads per sample.

RNA sequencing and library construction

1. Pseudomonas aeruginosa was incubated in lb medium at 37 degrees Celsius and 220 rpm on a constant temperature shaker for 2 h/6 h respectively;

2. Pseudomonas aeruginosa was injected intraperitoneally into C57 mice and bacteria were collected from the peritoneal fluid after 2 h/6 h.

Statistical analysis

In this study, at least three independent experiments were conducted for each set of measurements. The GraphPad Prism 5.0 software was used to analyze experimental data, and the independent sample T-test was used to compare the two samples. * represented the difference with a value of 0.01 < P < 0.05, ** represented the difference with a value of P < 0.01, and *** represented the difference with a value of P < 0.001.

Results

Screening and validation of sRNA196

In this study, to investigate the pathogenicity of P. aeruginosa, we utilized both in vitro culture and animal infection models to screen for infection-associated sRNA (Fig. 1A). An in vitro culture model was established by reaching the mid-exponential phase PAO1 strain in culture for 2 h and 6 h, and bacterial RNA was collected for transcriptome sequencing. For the animal infection model, PAO1 was injected intraperitoneally into C57BL/6 mice, and peritoneal fluid RNA was collected at 2 h and 6 h post-infection for transcriptome sequencing. By analysing the sequencing results, we identified sRNA196, which has not been reported and was differentially expressed within the infection process. In the in vitro culture model, sRNA196 expression increased significantly with culture time, showing a time-dependent pattern. This suggests that sRNA196 may play a critical role in regulating the normal biological behavior of P. aeruginosaand may be related to the bacterial adaptive mechanism. However, in mice with normal immune function, sRNA196 expression was higher early in the infection and gradually down-regulated as the infection progressed, showing a different trend from the in vitro model. This suggests that sRNA196 may be involved in the host immune response, and plays an important role in regulating bacterial pathogenicity and immune escape mechanisms. Interestingly, at 2 h post-infection, the expression of sRNA196 in immunocompetent mice was significantly higher than in the in vitro culture model, but it decreased more rapidly as the infection continued. This indicates that sRNA196 expression may be involved in the adaptive response of P. aeruginosa or the regulation of the host immune response. By observing the expression changes of sRNA196 under different experimental conditions, we tentatively speculate that sRNA196 may play an important role in the pathogenic process of P. aeruginosa as well as the immune response of the host (Fig. 1B).

Fig. 1.

Screening and validation of infection immunity related sRNA196. A Infection model of the subject. B Sequencing results showing the changes of sRNA196 expression during the infection process. C The RAW264.7 and A549 cells infection model simulated the down-regulation of sRNA expression over time during the infection process. D Bloodstream infection model simulation verified that the expression of sRNA196 was up-regulated at 2 h of infection in vivo and down-regulated at 6 h of infection compared with in vitro culture. E Secondary structure of sRNA196. F The expression of sRNA196 sRNA196 gene-deficient and overexpression strains was verified by RT-qPCR. G Northern blot validation of sRNA196. Data are shown as mean ± SD of at least three independent experiments, *, P < 0.05; **, P < 0.01; ***, P < 0.001; ns, not significant

Next, we validated the sequencing results by simulating the bloodstream infection model and the cellular infection model, aiming to assess the reliability of the sequencing data under different experimental conditions. First, we co-cultured PAO1 with RAW264.7 macrophages or A549 lung epithelial cells to simulate an in vitro infection environment. The results showed that the expression of sRNA196 decreased with increasing infection time in the co-culture model (Fig. 1C). Given that P. aeruginosa often causes bacteremia and sepsis in clinical settings, we then established bloodstream infection model to more closely mimic in vivo infection. The results showed that at the early stage of infection, sRNA196 expression in vivo was significantly higher than in the in vitro culture model. This suggests that sRNA196 may serve a biological function early in the infection, potentially related to bacterial adaptation or the initial regulation of the host immune response. However, as the infection progressed, sRNA196 expression in vivo began to decline after 6 h. (Fig. 1D). This decline may reflect regulation of sRNA196 by P. aeruginosa under immune pressure from the host. These findings suggest that sRNA196 plays a key role in regulating bacterial pathogenicity and mediating host immune interactions, providing important insights into its function during P. aeruginosa infection. It is well known that the stability and formation of RNA are significantly influenced by its secondary structure, which, in turn, affects its interactions with target genes, proteins, and other RNA molecules. To investigate this, we predicted the secondary structure of sRNA196 using RNAfold. The results revealed that sRNA196 exhibits a highly stable secondary structure with a minimum free energy of −25.30 kcal/mol (Fig. 1E). This low free energy indicates a tight and stable folding pattern, allowing sRNA196 to maintain its structure and resist unfolding in the intracellular environment. During bacterial infection, immune evasion, or gene regulation, the stable secondary structure of sRNA 196 may play an important role in facilitating its interaction with target molecules and thus regulating the biological behavior of bacteria. To further investigate the role of sRNA196, we constructed both an overexpression strain (sRNA196) and a knockout strain (∆sRNA196) of sRNA196 in PAO1 and confirmed the expression levels via RT-qPCR (Fig. 1F). In addition, we further verified whether sRNA196 was sRNA by northern blotting (Fig. 1G).

Regulation of virulence of P. aeruginosa by sRNA196

Using bioinformatics tools, we identified that sRNA196 targets multiple genes involved in biofilm formation. To assess its role, we first quantified the impact of sRNA196 on biofilm formation. Biofilm quantification revealed that the ∆sRNA196 strain exhibited a significant reduction in biofilm formation compared to PAO1. In contrast, overexpressing sRNA196 resulted in a significant upregulation of biofilm formation (Fig. 2A). Next, we examined biofilm morphology using light microscopy after incubation. The deletion of sRNA196 led to reduced aggregation of biofilm cells, decreased biofilm thickness, and a more dispersed distribution. Conversely, overexpressing sRNA196 resulted in a more compact and thicker biofilm structure (Fig. 2B). It indicating that sRNA196 is essential for biofilm formation. Additionally, pyocyanin, a virulence factor in P. aeruginosa, stabilizes biofilms by releasing extracellular DNA (eDNA) [21]. We investigated the effect of sRNA196 on pyocyanin production and found that the sRNA196 knockout strain had reduced pyocyanin levels, while overexpression of sRNA196 slightly increased pyocyanin production (Fig. 2C). Swarming and Swimming motility is one of the major motions of bacterial and plays an important role in bacterial colonization of hosts [30]. Through Swarming and Swimming motility experiments, we discovered that the sRNA196 knockout strain exhibited significantly inhibited Swarming motility, while overexpression of sRNA196 promoted Swarming motility (Fig. 2D, E). Overall, our results suggest that sRNA196 plays multiple regulatory roles in biofilm formation, pyocyanin synthesis, and bacterial motility. By modulating these processes, sRNA196 can improve survival adaptation of P. aeruginosa.

Fig. 2.

sRNA196 affected P. aeruginosa pyocyanin, biofilm, swimming motility and swarming motility. A ∆sRNA196 significantly inhibited the synthesis of P. aeruginosa biofilm, while overexpression of sRNA196 significantly promoted the synthesis of P. aeruginosa biofilm. B Observation of the effect of sRNA196 on the morphological structure of biofilm under light microscope(Scale 100 μm). C ∆sRNA196 inhibited the formation of pyocyanin, while overexpression of sRNA196 slightly promoted the formation of P. aeruginosa pyocyanin. D ∆sRNA196 can lead to dimished swimming motility in P. aeruginosa. E ∆sRNA196 can lead to dimished swarming motility, while overexpression of sRNA196 can promote swarming motility in P. aeruginosa. Data are shown as mean ± SD of at least three independent experiments, *, P < 0.05; **, P < 0.01; ***, P < 0.001; ns, not significant

Effects of sRNA196 on hosts and host cells

On one hand, sRNAs play a critical role in regulating bacterial virulence; on the other hand, bacteria affect normal biological functions of host cells. To explore the effects of sRNA196 on host cells, we evaluated its adhesion and invasion abilities in A549 cells and its survival within macrophage cells. In co-culture with A549 cells, the ∆sRNA196 strain displayed a significant reduction in both adhesion and invasion compared to the PAO1 strain. Conversely, overexpressing sRNA196 significantly enhanced both adhesion (Fig. 3A) and invasion (Fig. 3B) compared to the vector control. In co-culture with RAW264.7 cells, the ∆sRNA196 strain showed reduced survival, while overexpression of sRNA196 significantly increased bacterial survival (Fig. 3C).

Fig. 3.

sRNA196 can enhance the damage to host cells and promote the expression of inflammatory factors. A ∆sRNA196 significantly inhibited the adhesion of PA to A549 cells, while overexpression of sRNA196 significantly promoted this phenomenon. B ∆sRNA196 significantly inhibited the invasion of P. aeruginosa to A549 cells, while overexpression of sRNA196 significantly promoted this phenomenon. C sRNA196 significantly decreased the viability of P. aeruginosa in RAW264.7 cells, while overexpression of sRNA196 significantly increased the viability of P. aeruginosa. D The damage of A549 cells induced by sRNA196 after a certain period of infection under ordinary microscope(Scale 100 μm). E sRNA196 reduced cell survival rate in A549 cells. F sRNA196 exacerbates the inflammatory response and immune response in the host (Scale 100 μm). G sRNA196 can promote the expression of inflammatory cytokines in A549 cells, especially IL-6. H sRNA196 can promote the expression of inflammatory cytokines in RAW264.7 cells, especiallyIL-1 and IL-6. Data are shown as mean ± SD of at least three independent experiments, *, P < 0.05; **, P < 0.01; ***, P < 0.001; ns, not significant

Next, we observed the damage to host cells under co-culture of sRNA196 with host cells by ordinary light microscopy. It was found that the sRNA196 overexpression strain accelerated P. aeruginosa damage to A549 cells compared to Vector, as evidenced by altered cell morphology, whereas the damage to host cells was attenuated after knockdown of sRNA196 (Figure. 3D). Given this situation, we examined the effect of sRNA196 on cell proliferation by CCK assay. The results showed that overexpression of sRNA196 significantly reduced cell survival of A549 cells, while deletion of sRNA196 increased cell survival (Fig. 3E). The above illustrates that the presence of sRNA196 exacerbates host cell damage. To assess the effect of sRNA196 on the host. We used Hematoxylin and eosin (H&E stains) staining of lung tissue sections from sRNA196-infected mice in order to understand the role of inflammatory response in the lung tissues of infected C57 mice. The results show that damage to alveolar structure was seen in the lung tissues of mice infected with the PAO1 strain, and neutrophil infiltration was observed In contrast, damage to alveolar structure was attenuated and neutrophil infiltration was significantly reduced in lung tissues of ∆sRNA196-infected mice. In contrast, in the lung tissues of mice overexpressing sRNA196, the alveolar structure was severely damaged, with a large number of neutrophils infiltrating and an increased inflammatory response (Fig. 3F). This result suggests that sRNA196 may play a facilitating role in the inflammatory response triggered by P. aeruginosa infection, further exacerbating the host’s lung inflammatory response.

Bacterial invasion of lung epithelial cells and survival within macrophages often triggers an inflammatory response in the host, marked by the release of pro-inflammatory cytokines. Therefore, we examined the effect of sRNA196 on inflammatory factor levels in host cells. The results show that in A549 cells, deletion of sRNA196 significantly inhibited the expression of IL-1 and TNF-α, while overexpression of sRNA196 upregulated IL-6 and TNF-α by 2-fold (Fig. 3G). In RAW264.7 cells, sRNA196 promoted the expression of TNF-α and significantly increased IL-1 and IL-6 levels (Fig. 3H).

sRNA196 directly targets PA4398, ZapE and PhoB

The precise mechanism through which sRNA196 regulates virulence in Pseudomonas aeruginosa remains unclear. To explore this, we predicted the potential targets of sRNA196 using the IntaRNA and RNAPredator tools. Interestingly, we identified that sRNA196 has potential binding sites with multiple genes. Based on this prediction, We screened the genes PA4398, ZapE, PA0913, PA1242 and Phob based on their binding energy values. According to IntaRNA predictions, the binding energy values for these genes with sRNA196 all exceed − 10 kcal/mol. respectively, for experimental validation using the luciferase reporter system (Fig. 4A). To begin the experimental validation, we constructed two types of plasmids. The sRNA196 sequence was inserted into the pSTV28 overexpression plasmid to generate the pSTV28-sRNA196 recombinant plasmid. The sequences of PA4398, ZapE, PA0913, PA1242 and PhoB were inserted into the pUCP30T-gfp vector, which encodes GFP, to create the recombinant plasmids pUCP30T-PA4398-gfp, pUCP30T-ZapE-gfp, pUCP30T-PA0913-gfp, pUCP30T-PA1242-gfp and pUCP30T-PhoB-gfp, respectively (Fig. 4B). These recombinant plasmids were introduced into E. coli DH5α cells, and GFP-mRNA plasmids were extracted and transferred into pSTV28-sRNA196. Fluorescence intensity was measured using a live-cell imager and an orthogonal fluorescence microscope.Results indicate that when co-expressed with pUCP30T-PA4398-gfp, pUCP30T-ZapE-gfp, and pUCP30T-PhoB-gfp, pSTV28-sRNA196 exhibits a 2- to 3-fold increase in fluorescence intensity compared to the control plasmid pSTV28. However, no significant change in fluorescence intensity was observed when pSTV28-sRNA196 was co-expressed with pUCP30T-PA0913-gfp or pUCP30T-1242-gfp (Fig. 4C, D; Supplementary Fig. 1A, B). To further validate these findings, RT-qPCR was performed to quantify the mRNA expression levels of PA4398, ZapE, and PhoB in sRNA196-deficient and overexpression strains. Results indicate that compared to the vector control group, mRNA levels of PA4398, ZapE, and PhoB were significantly elevated in the sRNA196-overexpressing strain. Furthermore, expression of these genes was markedly reduced in the ∆sRNA196 strain. Conversely, neither PA0913 nor PA1242 exhibited altered expression patterns following sRNA196 knockout or overexpression (Fig. 4E, Supplementary Fig. 1C). Overall, sRNA196 positively regulates the mRNA expression of PA4398, ZapE, and PhoB.

Fig. 4.

sRNA196 directly targets PA4398, zapE, and PhoB. A By IntaRNA prediction, sRNA196 was found to have binding sequences to the CDS region of PA4398, zapE and PhoB. B Model diagram of fluorescence reporting system construction. C Under fluorescence microscopy, the fluorescence intensity of pUCP30T-PA4398-gfp, pUCP30T-ZapE-gfp and pUCP30T-PhoB-gfp of pSTV28-sRNA196 was enhanced compared with pSTV28(Scale 20 μm). D By measuring the fluorescence intensity, pSTV28-sRNA196 was able to promote the translation level of PA4398, zapE and phoB compared to pSTV28. E The effect of mRNA expression level of PA4398, zapE and phoB in sRNA196. Data are shown as mean ± SD of at least three independent experiments, *, P < 0.05; **, P < 0.01; ***, P < 0.001; ns, not significant

sRNA196 mediates virulence of P. aeruginosa through PA4398, ZapE and PhoB

The above results suggest that sRNA196 targets PA4398, ZapE, and PhoB. To investigate the roles of these target genes in regulating P. aeruginosa virulence, we constructed overexpression strains for PA4398, ZapE, and PhoB and assessed their phenotypic effects. As anticipated, overexpression of PA4398, ZapE, and PhoB slightly increased the synthesis of P. aeruginosa pyocyanin compared to the vector control (Fig. 5A). In biofilm formation assays, PA4398 and ZapE modestly promoted biofilm formation, while PhoB significantly enhanced biofilm formation (Fig. 5B). This suggests that PhoB may be a key target gene in the sRNA196-mediated regulation of biofilm formation. Although PA4398 and ZapE also facilitated biofilm formation, their effects were less pronounced than PhoB. Additionally, motility assays revealed that PA4398 promoted both swimming and swarming motility in P. aeruginosa. PhoB significantly enhanced swarming motility but had little impact on swimming motility, while ZapE showed no significant effect on either swimming or swarming motility (Fig. 5C, D).

Fig. 5.

sRNA196 mediates P. aeruginosa virulence by targeting PA4398, ZapE and pPhoB. A PA4398, ZapE and PhoB can slightly promote thesynthesis of P. aeruginosa pyocyanin. B PA4398, ZapE and PhoB can significantly promote the formation of P. aeruginosa biofilm. C PA4398 could slightly promote the swimming motility of bacteria, while ZapE and PhoB had no significant effect. D PA4398 and PhoB were able to significantly promote bacterial swarming motility, the while the effect of ZapE was not significant. E PA4398, ZapE and PhoB were able to promote the adhesion ability of P. aeruginosa to A549 cells. F PA4398, ZapE and PhoB promoted the invasive ability of P. aeruginosa to A549 cells. G PA4398 and phoB were able to significantly increase the survival ability of P. aeruginosa in RAW264.7 cells. H PA4398, ZapE, and PhoB promote the expression of inflammatory factors in A549 cells. I PA4398, ZapE, and PhoB promote the expression of inflammatory factors in RAW264.7 cells. Data are shown as mean ± SD of at least three independent experiments, *, P < 0.05; **, P < 0.01; ***, P < 0.001; ns, not significant

Next, we similarly examined the effects of PA4398, ZapE and PhoB on the host cells. The results revealed that all three genes enhanced the adhesion (Fig. 5E) and invasion (Fig. 5F) capabilities of P. aeruginosa to A549 cells. Additionally, PA4398 and PhoB significantly improved the survival of P. aeruginosa in RAW264.7 cells, while ZapE showed no significant effect (Fig. 5G). By further testing, we found that the effects of these genes on inflammatory factor release were also distinct. In A549 cells, PA4398 slightly increased IL-1 and TNF-α release, while significantly boosting IL-6 levels. ZapE notably increased IL-1, IL-6, and TNF-α secretion, whereas PhoB slightly promoted IL-1 and IL-6 release and significantly raised TNF-α levels (Fig. 5H). In RAW264.7 cells, PA4398 and ZapE modestly enhanced IL-1 and IL-6 secretion with minimal impact on TNF-α, while PhoB slightly increased TNF-α release and significantly augmented IL-1 and IL-6 levels (Fig. 5I). These findings suggest that PA4398, ZapE, and PhoB not only regulate the adhesion, invasion, and survival of P. aeruginosa but also modulate the host immune response by influencing inflammatory factor release. In conclusion, PA4398, ZapE, and PhoB are important target genes of sRNA196 in regulating the virulence of P. aeruginosa, potentially enhancing its pathogenicity through their effects on biofilm formation, motility, host cell adhesion, invasion, and inflammatory responses.

Discussion

In this study, we characterized and identified a novel small RNA, sRNA196, and demonstrated that it is strongly associated with changes in P. aeruginosa virulence. Through comprehensive analysis, we demonstrated that sRNA196 plays a pivotal role in enhancing bacterial biofilm formation and various virulence factors by regulating genes such as PA4398, ZapE, and phoB. Additionally, sRNA196 significantly increases the pathogenicity of P. aeruginosa by modulating host cell biological processes, including adhesion, invasion, and immune response. These findings offer new insights into the virulence mechanisms of P. aeruginosa and suggest potential strategies for the development of novel antimicrobial therapies.

Firstly, through a combination of cellular infection models and bloodstream infection models, we systematically validated the expression changes of sRNA196 under different infection environments. Our experimental results showed that the expression of sRNA196 was closely correlated with time during P. aeruginosa infection, suggesting a possible important role in the infection process. Specifically, the expression of sRNA196 was significantly up-regulated during the early stages of infection, a phenomenon that may indicate that sRNA196 is involved in the initial establishment of P. aeruginosa infection, helping the bacteria to adapt to the host environment and successfully invade host cells. With the prolongation of the infection time, the expression of sRNA196 was gradually down-regulated, a change suggesting that sRNA196 may play a role in immune escape in the late stage of bacterial infection, helping P. aeruginosa to evade the host’s immune surveillance and maintain the infection status. Next, virulence phenotyping experiments revealed that the absence of sRNA196 resulted in a significant reduction of key virulence factors in P. aeruginosa, including pyocyanin synthesis, motility, and, notably, biofilm formation. Biofilm formation is critical for bacterial pathogenicity as it serves as a physical barrier that resists immune attacks, enhances bacterial tolerance to antibiotics, and significantly increases infectivity and survival [26, 32]. Pyocyanin, a major phenazine compound, induces apoptosis in neutrophils, macrophages, and other immune cells, impairing host immune defenses [19]. Additionally, P. aeruginosa swimming motility is mediated by unipolar flagella, while swarming motility depends on type IV pili, promoting bacterial aggregation and contributing to the early stages of biofilm formation [27]. These findings suggest that sRNA196 plays a critical role in bacterial-host adaptation and pathogenesis, potentially enhancing infectivity by regulating multiple virulence factors. Some studies have observed an inverse relationship between biofilm formation and motility in P. aeruginosa, attributed to c-di-GMP production during biofilm formation, which is believed to inhibit motility[13]. However, our results align with those of Abbas, Abdelhamid et al. [1], He, Li et al. [10], and Kar, Amiya et al. [12], who reported a positive correlation between biofilm formation and motility. This may be due to biofilm formation relying on bacterial swarming motility, which facilitates bacterial aggregation and biofilm development. The relationship between biofilm formation and collective motility is likely influenced by factors such as the growth phase of P. aeruginosa, environmental conditions, and the activation of quorum sensing. We further validated the importance of sRNA196 in bacterial-host cell interactions through cell-based experiments. The results showed that during adhesion and invasion, sRNA196 not only facilitates rapid bacterial proliferation in localized infections but also supports its spread to surrounding tissues. Additionally, our results demonstrate that sRNA196 enhances P. aeruginosa survival in macrophages, highlighting its role in immune evasion and chronic infection development. This suggests that sRNA196 may be involved in the adaptation of bacteria to the intracellular environment of macrophages and in the modulation of certain antiphagocytic mechanisms thereby enhancing their survival within macrophages. In addition, by corroborating in vivo mouse experiments and in vitro CCK-8 experiments, we further confirmed the facilitating effect of sRNA196 on P. aeruginosa virulence as well as its key role in host cell damage and inflammatory responses. IL-1, IL-6, and TNF-ɑ are central mediators of the inflammatory response. IL-1 induces a local inflammatory reaction by binding to its receptors on lung epithelial cells [2]. IL-6 enhances local immune responses and aids in bacterial clearance [14], while TNF-ɑ promotes the recruitment of inflammatory cells to the infection site, further aiding bacterial clearance [15]. sRNA196 plays an important role in host infection and immunity by promoting the expression of these inflammatory factors. Thus, the role of sRNA196 extends beyond the regulation of virulence factor synthesis and may include multiple aspects of bacterial-host cell interactions.

Bioinformatics analysis revealed that sRNA196 may regulate the virulence of P. aeruginosa by binding to multiple biofilm-associated target genes. Using luciferase reporter assays and RT-PCR analyses, we confirmed the interactions between sRNA196 and the PA4398, ZapE, and PhoB genes, finding that their expression was positively regulated by sRNA196. These results suggest that sRNA196 regulates post-transcriptional expression by interacting with predicted binding sites on these target genes. sRNA196 binding may facilitate the assembly of translation initiation complexes by opening the hairpin structure, thereby exposing the translation initiation region and enhancing fluorescent signals. Existing studies suggest that PA4398 is a sensor kinase closely related to bacterial swimming motility and plays a role in promoting bacterial swarming movement [28, 34]. ZapE, a cell division factor with ATPase activity, is critical for cell division and biofilm synthesis. ZapE modulates P. aeruginosa biofilm formation through the pqs signaling pathway, promoting colonization and spread in host tissues, which is essential for bacterial persistence in the host [16]. PhoB, a transcriptional response regulator, promotes pyocyanin formation and swarming motility of P. aeruginosa by upregulating RhlR [3, 11]. Based on these findings, we conducted functional experiments to verify the role of these genes in sRNA196-mediated regulation of P. aeruginosa virulence. The results demonstrated that PA4398, ZapE, and PhoB contribute to P. aeruginosa pyocyanin synthesis and biofilm formation. Among these, PA4398 significantly enhanced both swimming and swarming motility, while PhoB primarily promoted swarming motility. ZapE had no significant effect on motility. Moreover, PA4398, ZapE, and PhoB significantly enhanced P. aeruginosa adhesion to and invasion of A549 cells. PA4398 and PhoB also significantly improved bacterial survival in RAW264.7 cells, whereas ZapE had no significant effect. In conclusion, PA4398, ZapE, and PhoB are essential for the regulation of P. aeruginosa virulence.

Overall, this study demonstrates that sRNA196 is differentially expressed during infection and enhances biofilm formation and pathogenicity of P. aeruginosa by positively regulating several key genes. Its involvement in bacterial-host interactions, immune evasion, and inflammatory responses provides new insights into the mechanisms underlying P. aeruginosa pathogenicity. Therefore, as a key factor in the virulence regulation of P. aeruginosa, sRNA196 may be an important target for the treatment of bacterial infections in the future.

Author contributions

F.W., P.M., and P.Z. performed the experiments; Q.L., Y.L.,L.Z, described and discussed the results of the study; J.H., W.Y., were involved in data analysis and organization as well as preparation of the draft manuscript. All authors read, revised, and approved the manuscript for submission.

Funding

This work was supported by Guangdong Provincial Medical Science and Technology Research Fund Project(B2023443), Guangzhou Science and Technology Plan Project ༈2025A03J0631༉,Infection immunization topic (202301-408) from the Affiliated Qingyuan Hospital (Qingyuan People’s Hospital) Guangzhou Medical University.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

This study was approved by the Animal Ethics Committee of the affiliated Qingyuan hospital of Guangzhou Medical University (id: LAEC-202312-011).

Consent for publication

All authors approved the final manuscript and the submission to this journal.

Competing interests

The authors declare no competing interests.