Skip to main content
NCBI home page

This is a preprint.

It has not yet been peer reviewed by a journal.

The National Library of Medicine is running a pilot to include preprints that result from research funded by NIH in PMC and PubMed.

bioRxiv logoLink to bioRxiv
[Preprint]. 2026 Feb 9:2026.02.07.704597. [Version 1] doi: 10.64898/2026.02.07.704597

Cell-specific roles for the conserved Galpha chaperone RIC-8 in cilia biology

Christina Campagna 1, Abigail E Descoteaux 1, Abigail Pool 1, Eric Peet 1, Nawaphat Malaiwong 2, Michael P O’Donnell 2, Inna Nechipurenko 1
PMCID: PMC12919077  PMID: 41727026

Abstract

Primary cilia exhibit conserved organization and contain structural and functional domains of unique molecular composition. The inversin compartment (InvC), which is found in the proximal ciliary segment of a subset of vertebrate and invertebrate cell types, concentrates different classes of signaling molecules. Mutations in genes encoding resident proteins of the InvC manifest in ciliopathies, highlighting the importance of the InvC in cilia biology. We previously showed that a chaperone of Gα proteins RIC-8 localizes to the InvC of C. elegans channel cilia; however, the mechanisms that regulate RIC-8 targeting to this ciliary sub-domain or RIC-8 function in the InvC remain unknown. Here, we build on our prior work to demonstrate that RIC-8 becomes restricted to the InvC during larval development and show that, while the RVxP motif and intact transition zone are required for its proper intraciliary distribution, RIC-8 localization to the cilium depends on intraflagellar transport. Using the ASH neuron as a model, we establish that RIC-8 functions in channel cilia to modulate chemosensory responses. Finally, we demonstrate that human RIC8A and RIC8B proteins are required for ciliogenesis in RPE-1 cells. Collectively, our results define ciliary trafficking mechanisms and novel cell-specific functions for a highly conserved signaling protein.

INTRODUCTION

Primary cilia are signaling organelles that extend from the surface of most mammalian cells and invertebrate sensory neurons (Anvarian et al., 2019; Derderian et al., 2023). The signaling capacity of primary cilia depends on compartmentalized localization of signaling proteins to distinct sub-ciliary domains. For example, the inversin compartment (InvC), defined by localization of INVS/NPHP-2, is found in the proximal primary cilium of many cell types (e.g. (Bennett et al., 2020; Nakajima et al., 2018; Shiba et al., 2009; Warburton-Pitt et al., 2014; Watanabe et al., 2003)) and concentrates cyclic nucleotide-gated channels (Nechipurenko and Sengupta, 2025; Wojtyniak et al., 2013), the small GTPase ARL-13 (Cevik et al., 2013), and the Gα protein chaperone RIC-8 (Campagna et al., 2023). Likewise, TRPV channel and CDKL5 kinase are sequestered in the proximal regions of mechanosensory cilia in Drosophila (Xiang et al., 2022) and Chlamydomonas flagella (Tam et al., 2013), respectively. In addition to the InvC, cilia tip concentrates select signaling proteins such as Hedgehog pathway components in mammalian cells (Haycraft et al., 2005; Wen et al., 2010) and receptor guanylate cyclase GCY-22 in the C. elegans ASER neuron (van der Burght et al., 2020).

Although the mechanisms that target specific signaling proteins to discrete ciliary sub-domains are not well understood, intraflagellar transport (IFT) – a conserved active transport system that carries many transmembrane and soluble proteins in and out of the cilium – has been reported to participate in localizing Gli proteins (Haycraft et al., 2005; Qin et al., 2011), GCY-22 (van der Burght et al., 2020), and ARL-13 (Cevik et al., 2013) to their respective sub-ciliary domains. IFT is organized into IFT-A and IFT-B multi-protein complexes that function as adapters between motors and ciliary protein cargoes. Kinesin-2 and dynein-2 motors drive IFT along ciliary microtubules in the anterograde (from cilia base to tip) and retrograde (from cilia tip to base) directions, respectively. In C. elegans, two kinesin-2 family motors (kinesin-II and OSM-3) work together to build cilia and mediate anterograde transport (Snow et al., 2004).

In C. elegans, cilia extend from the distal dendrites of a subset of sensory neurons and display distinct morphologies and molecular composition (Inglis et al., 2007; Nechipurenko and Sengupta, 2025). Most chemosensory neurons of the amphid and phasmid sensory organs found in the worm head and tail, respectively, possess rod-like ‘channel’ cilia, while three types of amphid olfactory neurons (AWA, AWB, and AWC) have ‘wing’ cilia of elaborate morphologies (Doroquez et al., 2014; Perkins et al., 1986; Ward et al., 1975). Although core ciliogenic mechanisms are conserved, cell-specific functions for cilia proteins are being increasingly observed in worms and mammals (e.g. (Campagna et al., 2023; Ditirro et al., 2019; Lewis et al., 2019; Rachel et al., 2012; Roayaie et al., 1998; Salama et al., 2025).

We previously reported that RIC-8, a cytoplasmic guanine nucleotide exchange factor and chaperone for Gα proteins, shapes wing-cilia morphology (Campagna et al., 2023). Although RIC-8 is largely dispensable for the assembly of channel cilia, it localizes to the InvC of this cilia type (Campagna et al., 2023). Here, we extend our earlier findings to show that RIC-8 modulates sensory responses mediated by ASH channel cilia and define molecular mechanisms that regulate its localization to this cilia type. Finally, we show that human RIC8A and RIC8B contribute to ciliogenesis in RPE-1 cells. Overall, our findings uncover cell-specific cilia roles for an evolutionarily conserved signaling protein.

RESULTS AND DISCUSSION

RIC-8 becomes restricted to the InvC during larval development independently of NPHP-2

When expressed from a multicopy transgene, RIC-8 localizes to the InvC of channel cilia in adult hermaphrodites (Campagna et al., 2023). We confirmed this localization pattern by tagging the endogenous ric-8 locus with a split-Scarlet reporter (split-Sc) (Goudeau et al., 2021). Specifically, we inserted the 11th β strand of codon-optimized Scarlet (Scarlet11) before the stop codon of ric-8 and expressed the remaining Scarlet1–10 fragment under the bbs-8 promoter to reconstitute fluorescence and thus visualize localization of RIC-8::split-Sc in all ciliated neurons. Consistent with our earlier findings, RIC-8::split-Sc was distributed throughout phasmid neurons and exhibited enrichment in proximal ciliary segments (Figure 1A) (Campagna et al., 2023).

Figure 1.

Figure 1.

Open in a new tab

RIC-8 becomes restricted to the InvC during larval development. (A) Top: diagram of phasmid neurons in the worm tail. Cilia of phasmid neurons are magnified in the inset on the right. PCMC: periciliary membrane compartment; TZ: transition zone; InvC: inversin compartment. Bottom: RIC-8::split-Sc in phasmids. d: dendrite; cil.: cilia. (B – C) Localization of RIC-8::TagRFP (B) and co-localization of RIC-8::TagRFP with NPHP-2::GFP (C) in phasmids of WT L1 larvae. (D – E) Quantification of the absolute RIC-8::TagRFP signal length (D) and RIC-8::TagRFP signal length relative to phasmid cilia length (E) at the indicated stages. *** Different from L1 at p<0.001 (Mann-Whitney test). (F – H) Images (F) and quantification of relative RIC-8::TagRFP fluorescence (G) and RIC-8::TagRFP signal length (H) in the indicated genotypes. ns: not significant (Welch’s t test) (G), (Mann-Whitney test) (H). Arrowheads: TZ; arrows: cilia tip. Scale: 10 μm in (A) and (B); 5 μm in (C) and (F).

The InvC in phasmid cilia is established before the first-larval (L1) stage of development (Warburton-Pitt et al., 2014); however, at least one InvC resident protein (ARL-13) does not become restricted to the proximal cilium until L3 larval stage (Cevik et al., 2013). In contrast, Drosophila TRPV subunit Iav localizes directly to the proximal zone during cilia assembly and remains restricted there during extension of distal cilia segments (Xiang et al., 2022). To determine the timing of RIC-8 localization to the InvC, we analyzed a published transgenic strain that expresses RIC-8::TagRFP in all ciliated neurons (Campagna et al., 2023) due to rapid bleaching of RIC-8::split-Sc. Unlike in adults, RIC-8::TagRFP signal in L1 larvae extended outside the InvC, visualized with NPHP-2::GFP, into distal cilia segments (Figure 1, B – E), indicating that RIC-8 becomes restricted to the InvC during larval development similarly to ARL-13. Relative ciliary levels and intra-ciliary distribution of RIC-8::TagRFP were also comparable in wild type (WT) and nphp-2 mutants (Figure 1, F – H), suggesting that NPHP-2/INVS does not regulate RIC-8 localization to the InvC. It will be of interest to investigate the impact of dynamic changes in RIC-8 sub-ciliary localization on sensory neuron function and determine whether intraciliary distribution of additional InvC signaling proteins changes during development.

The transition zone regulates intraciliary distribution of RIC-8 in channel cilia

The transition zone (TZ) functions as a selective barrier at the cilia base, and defects in TZ integrity are associated with altered localization of ciliary proteins including InvC components (Barbelanne et al., 2024; Cevik et al., 2013; Jensen et al., 2015; Li et al., 2016). To determine whether the TZ contributes to RIC-8 ciliary import or its restriction to the InvC once inside the cilium, we examined localization of RIC-8::TagRFP in phasmid cilia of mks-5(tm3100) mutants with severely compromised TZ architecture (Li et al., 2016; Schouteden et al., 2015). Although still detected inside phasmid cilia, RIC-8::TagRFP levels inside the cilium relative to the distal dendrite were significantly reduced in mks-5 mutants compared to WT (Figure 2, A and B), suggesting the TZ may contribute to RIC-8 retention inside the cilium. Indeed, other studies reported ectopic accumulation of cilia signaling proteins in the distal dendrite of TZ mutants, proposing that the TZ prevents proteins from ‘leaking’ out of the cilium (Brear et al., 2014; Cevik et al., 2013; Jensen et al., 2015; Li et al., 2016).

Figure 2.

Figure 2.

Open in a new tab

RIC-8 cilia localization depends on an intact transition zone. (A and B) Images (A) and quantification (B) of RIC-8::TagRFP localization in WT and mks-5(tm3100) adult phasmids. Arrowheads: TZ; d: dendrite. Scale: 5 μm. *** Different from wild type at p<0.001 (Welch’s t test). (C) Line scans of RIC-8::TagRFP intensity in cilia of the indicated genotypes. Zero corresponds to the cilium base. Error bars: SEM. n=19 and 36 neurons for WT and mks-5(tm3100), respectively.

In addition to changes in the relative levels of RIC-8, we noted altered sub-ciliary distribution of RIC-8::TagRFP in mks-5 mutants. In WT, RIC-8::TagRFP signal peaks around 1 μm distal to the TZ (Figure 2, A and C) (Campagna et al., 2023), while in mks-5 mutants it is more uniformly distributed throughout the proximal cilium (Figure 2, A and C). Our results suggest that TZ integrity is important for cilia retention and proper sub-ciliary distribution of RIC-8. The defects in RIC-8::TagRFP distribution in mks-5 mutant are likely due to mislocalization of cilia proteins that restrict RIC-8 to the InvC.

The RVxP motif helps restrict RIC-8 to the InvC

The RVxP motif plays a role in targeting select proteins to cilia (Deretic et al., 2005; Geng et al., 2006; Higginbotham et al., 2012; Jenkins et al., 2006; Mariani et al., 2016; Zuo et al., 2019). For example, mutations in the RVxP motif of the mammalian Arl13b exclude mutant protein from cilia (Higginbotham et al., 2012), while C. elegans ARL-13 with deleted RVxP exhibits expanded localization to distal cilia (Cevik et al., 2013). RIC-8 contains the RVIP motif in the carboxyl terminus (Supplemental Figure S1A), so we wanted to test whether this motif is necessary for either targeting RIC-8 to the cilium or restricting it in the InvC. Unlike WT RIC-8, RIC-8ΔRVIP extended into more distal ciliary segments (Supplemental Figure S1, B and C), pointing to a role for RVIP in sequestering RIC-8 in the InvC, similarly to the RVxP motif in ARL-13 (Cevik et al., 2013).

RIC-8 ciliary localization is dependent on IFT

Next, we tested whether IFT plays a role in RIC-8 ciliary localization. In C. elegans channel cilia, the anterograde heterotrimeric kinesin-II motor moves IFT trains across the TZ (Mitra et al., 2024; Prevo et al., 2015; Snow et al., 2004). We examined RIC-8::TagRFP localization in kap-1 and klp-11 kinesin-II subunit mutants and noted significant reduction in RIC-8::TagRFP levels inside phasmid channel cilia relative to the periciliary membrane compartment (PCMC) in the distal dendrite (Figure 3, A and B), suggesting that the kinesin-II motor is required for localizing RIC-8 to the cilium. To determine whether the dynein-2 motor, which powers retrograde IFT trains, is important for trafficking RIC-8 out of the cilium, we investigated mutants of che-3 and xbx-1 that encode dynein heavy and light intermediate chains, respectively. Both mutants exhibited an increase in relative intraciliary RIC-8::TagRFP levels compared to WT (Figure 3, A and B). Together, these findings suggest that RIC-8 localization to the cilium depends on kinesin-II and dynein-2 motors.

Figure 3.

Figure 3.

Open in a new tab

RIC-8 localization to channel cilia depends on IFT. (A and B) Images (A) and quantification (B) of RIC-8::TagRFP localization in phasmids of the indicated genotypes. Corresponding mammalian homologs are listed on the x-axis in (B). (C and D) Images (C) and quantification (D) of RIC-8::TagRFP localization in WT and dyf-5(ok1177) phasmids. Arrowheads: TZ; arrows: distal boundary of TagRFP signal. Scale: 5 μm. *, **, and *** Different from WT at p<0.05, 0.01, and 0.001, respectively (Kruskal-Wallis with Dunn’s multiple comparisons test) (B) and Fisher’s exact test (D).

The IFT-B complex comprised of the IFT-B1 and IFT-B2 sub-complexes mediates ciliary import and/or anterograde transport of several soluble proteins (Ahmed et al., 2008; Bhogaraju et al., 2013; Dai et al., 2018; Hou and Witman, 2017; Hunter et al., 2018; Ishikawa et al., 2014; Lacey and Pigino, 2024; Nakamura et al., 2020; Taschner et al., 2017; Zhao et al., 2020). On the other hand, IFT-A, which similarly consists of two sub-complexes (IFT-A1 and IFT-A2) plays a major role in retrograde transport (Blacque et al., 2006; Engel et al., 2012; Iomini et al., 2009; Piperno et al., 1998). To determine if RIC-8 trafficking in and out of the cilium depends on IFT-B and/or IFT-A, respectively, we quantified relative RIC-8::TagRFP levels in cilia of a subset of IFT-A/B gene mutants. Mutations in genes encoding IFT-A1 (dyf-2, che-11, and daf-10) and IFT-A2 (ifta-1) proteins increased accumulation of RIC-8::TagRFP inside the cilium relative to the PCMC, similarly to our observations in che-3 and xbx-1 dynein-2 mutants (Figure 3, A and B). These findings are consistent with the hypothesis that retrograde IFT contributes to RIC-8 transport out of the cilium. On the other hand, mutations in the IFT-B2 complex genes ift-20 and che-2 significantly reduced the cilium/PCMC ratio of RIC-8::TagRFP (Figure 3, A and B). dyf-11 mutants showed a similar, although not statistically significant, decrease in relative RIC-8::TagRFP levels inside their cilia (Figure 3, A and B). These results suggest that ciliary localization of RIC-8 depends on at least a subset of IFT-B2 proteins. Furthermore, since all examined mutations in the IFT-B2, IFT-A, osm-3, and dynein-2 genes truncate cilia yet exert distinct effects on relative RIC-8 levels (Figure 3A), the observed changes in RIC-8 localization are unlikely to be simply a consequence of shorter cilia length.

Interestingly, mutations in the IFT-B1 genes dyf-1 and dyf-13 significantly increased ciliary RIC-8::TagRFP levels relative to the PCMC, while those in dyf-6 and ift-74 had no significant impact (Figure 3, A and B). Previous studies in C. elegans proposed that DYF-1 and possibly DYF-13 are required for activation of the homodimeric kinesin-2 motor OSM-3 and/or its loading onto the IFT-B module in channel cilia (Ou et al., 2005; Ou et al., 2007). This model was based on the observation that dyf-1 mutants had no detectable OSM-3 transport inside the cilia; however, other IFT-A and IFT-B1/B2 components exhibited normal motility presumably as a result of being transported by heterotrimeric kinesin-II (Ou et al., 2005; Ou et al., 2007). Consistently, we find that osm-3 mutants exhibited increased RIC-8::TagRFP fluorescence in cilia relative to the PCMC similarly to dyf-1 and dyf-13 mutant animals (Figure 3, A and B). These results suggest that OSM-3 and IFT-B1 components DYF-1 and DYF-13 may participate in ciliary trafficking of RIC-8.

A recent study in Chlamydomonas demonstrated that anterograde IFT trains undergo extensive remodeling at the cilia tip into retrograde trains of distinct conformation (Lacey and Pigino, 2024). The rearrangement of IFT-A/B components during this remodeling event generates unique cargo-binding interfaces in anterograde vs retrograde trains. Notably, IFT70/DYF-1 was proposed to form a potential cargo-binding surface on retrograde IFT trains. Thus, it would be interesting to determine whether RIC-8 is carried on retrograde trains via binding to DYF-1, DYF-13, or OSM-3, which is also moved by retrograde IFT from the cilia tip to the middle segment.

DYF-5 restricts RIC-8 to the InvC

The MAK/ICK kinase DYF-5 regulates cilia length and IFT protein localization in C. elegans sensory neurons (Burghoorn et al., 2007; Maurya et al., 2019; Mul et al., 2025; Yi et al., 2018). dyf-5 mutants exhibit long cilia and ectopic accumulation of IFT machinery (e.g. kinesin-2 motors, IFT-A, and IFT-B components) in distal cilia segments. Furthermore, retrograde IFT appears to be markedly reduced in the absence of dyf-5 (Mul et al., 2025). We reasoned that if RIC-8 ciliary trafficking depends on IFT, dyf-5(ok1177) mutants may exhibit defective RIC-8 localization. Indeed, RIC-8::TagRFP was detected throughout phasmid cilia, rather than being restricted to the InvC, in 75% of dyf-5 mutants (Figure 3, C and D). In contrast, only 28% of WT phasmid cilia had any detectable RIC-8::TagRFP in the distal segment (Figure 3, C and D), suggesting that DYF-5 function is important for restricting RIC-8 to the InvC. Notably, dyf-5 was similarly shown to restrict kinesin-II to the proximal cilium likely by contributing to its undocking from IFT trains (Burghoorn et al., 2007) and to promote unloading of tubulin from IFT complexes at the cilia tip (Jiang et al., 2022). Thus, it would be of interest to test whether DYF-5 also facilitates RIC-8 unloading from IFT trains in the InvC.

ric-8 mutants are defective in glycerol responses mediated by ASH neurons

We previously reported that RIC-8 functions as a Gα ODR-3 chaperone in AWC sensory neurons (Campagna et al., 2023). RIC-8 and ODR-3 are also present in the channel cilia of ASH neurons; however, both proteins are largely dispensable for ASH cilia assembly (Roayaie et al., 1998; Salama et al., 2025). Therefore, we next wanted to identify the function of RIC-8 in channel cilia using ASH as a model. First, we tested whether RIC-8 regulates Gα ODR-3 levels in ASH neurons similarly to AWC. To visualize endogenous ODR-3 in ASH cilia, we expressed wrmScarlet1–10 fragment under the control of the sra-6 promoter in animals that carried odr-3 endogenously tagged with wrmScarlet11 (ODR-3::split-Sc) (Goudeau et al., 2021; Salama et al., 2025). Consistent with prior work, ODR-3::split-Sc was enriched in WT ASH cilia (Roayaie et al., 1998; Salama et al., 2025) (Figure 4A). Although still detectable inside ASH cilia, ODR-3::split-Sc levels were markedly reduced in ric-8(md1909) mutants compared to WT (Figure 4, A and B), suggesting RIC-8 functions as an ODR-3 chaperone in ASH.

Figure 4.

Figure 4.

Open in a new tab

RIC-8 regulates Gα ODR-3 levels and glycerol responses in ASH neurons. (A and B) Images (A) and quantifications (B) of ODR-3::split-Sc in WT and ric-8(md1909) ASH neurons. Arrowheads: TZ; arrows: autofluorescence in the pharynx. Scale: 5 μm. *** Different from WT at p<0.001 (Mann-Whitney test). (C) Heatmaps of relative changes in fluorescence intensity (ΔF/F0) of GCaMP6 expressed in ASH of the indicated genotypes in response to 1M glycerol. Horizontal bar: glycerol stimulus. Each row in the heatmaps: responses from a single ASH neuron. n=3 days with at least 12 animals/day. (D) Average changes in GCaMP6 fluorescence in ASH for data shown in (C). Shaded regions along the curves: SEM. (E) Quantification of maximum fluorescence intensity change upon glycerol onset in the indicated genotypes. Each dot: the response from a single neuron. *** Different from WT at p<0.001 (Welch’s test).

Gα ODR-3 is a primary transducer of chemosensory signaling in ASH neurons, which mediate avoidance responses to nociceptive chemicals including hyperosmotic solutions such as glycerol (Hilliard et al., 2005; Kato et al., 2014; Yoshida et al., 2012). To test if RIC-8 function is required for cilia-mediated neuronal responses, we examined stimulus-evoked intracellular calcium dynamics in ASH neurons expressing GCaMP6. ASH responses to 1M glycerol were significantly dampened in ric-8(md1909) mutants compared to WT (Figure 4, C – E). These responses are similar to those previously reported for odr-3 mutants (Kato et al., 2014; Yoshida et al., 2012). Thus, our data suggest that RIC-8 functions in channel cilia to modulate sensory responses likely by controlling ODR-3/Gα levels. Notably, conditional knockout of murine Ric8b in olfactory neurons decreased Gα levels and altered olfactory behavior (Machado et al., 2017) akin to our findings in ASH. Although the impact of Ric8b deletion on olfactory cilia morphology has not been examined, these findings suggest that RIC-8 function in sensory biology may be evolutionarily conserved.

Human RIC8A and RIC8B contribute to ciliogenesis in RPE-1 cells

Cilia on most mammalian cells exhibit simple morphology like C. elegans channel cilia. To establish whether mammalian RIC-8 homologs (RIC8A and RIC8B) play a role in cilia biology, we used small interfering RNAs (siRNAs) to knock down (KD) RIC8A or RIC8B in human RPE-1 cells that ciliate robustly upon serum starvation. Staining cells for ARL13B or acetylated tubulin showed reduced ciliation upon RIC8A and RIC8B KD compared to controls (Figure 5, A and B; Supplemental Figure 2, A and B). We confirmed RIC8A and RIC8B KD efficiency by qPCR (Figure 5C; Supplemental Figure 2C). Furthermore, cells treated with the second set of siRNAs (siRNAs #2) that target RIC8A and RIC8B coding sequences distinct from those targeted by the first siRNA set (siRNAs #1) resulted in comparable KD efficiency and ciliogenesis defects (Supplemental Figure 2, B and C) suggesting the observed phenotypes are likely caused by reduction of RIC8A and RIC8B function. Overall, our results define trafficking mechanisms that localize C. elegans RIC-8 to the InvC, describe a new function for RIC-8 in mediating ASH sensory responses, and demonstrate that human RIC-8 homologs contribute to ciliogenesis in RPE-1 cells, thus highlighting functional versatility of this conserved protein in cilia biology.

Figure 5.

Figure 5.

Open in a new tab

Human RIC8A and RIC8B regulate ciliogenesis in RPE-1 cells. (A) Fixed RPE-1 cells transfected with the indicated siRNAs and stained with the listed antibodies and DAPI. siCTRL: non-targeting siRNA. Scale: 20 μm. (B and C) Quantification of ciliation (B) and relative RIC8A and RIC8B mRNA levels (C) in RPE-1 cells transfected with the indicated siRNAs. Each data point: one KD experiment; biological replicates are shown in different shades of the corresponding color (B). Summary data in (C) represent 3 biological replicates per condition with 3 technical replicates each. ** and *** Different from siCTRL at p < 0.01 and 0.001, respectively (Fisher’s exact test) (B). * and ** Different between bracketed conditions at p < 0.05 and 0.01, respectively (Welch’s t test) (C).

MATERIALS AND METHODS

C. elegans genetics

C. elegans strains were cultured at 20°C on standard nematode growth medium (NGM) seeded with the OP50 strain of Escherichia coli. Standard genetic approaches were used to cross in transgenes into mutant backgrounds. All mutant genotypes were confirmed by PCR and/or Sanger sequencing (Azenta). Transgenic C. elegans were generated by standard microinjection of DNA and/or ribonucleoprotein complexes into syncytium of hermaphrodite gonad. The unc-122Δp::gfp or unc-122Δp::dsRed plasmids were used as co-injection markers at 30 and 40 ng/μL, respectively. The same transgenic array was examined in WT and corresponding mutant backgrounds that were directly compared in phenotypic assays.

CRISPR-Cas9-mediated genome editing

All reagents (crRNA, tracrRNA, single-stranded donor oligonucleotides, and Cas9 protein) were purchased from Integrated DNA Technologies (IDT). CRISPR-Cas9 genome editing to generate the split-wrmScarlet (wrmScarlet11) allele of ric-8 was carried out as described in (Dokshin et al., 2018). Briefly, the donor oligonucleotide (25 ng/μL), crRNA (56 ng/μL), tracrRNA (100 ng/μL), and Cas9 protein (250 ng/μL) were co-injected with unc-122Δp::dsred co-injection marker into N2 (variety Bristol) WT strain. Transgenic F1 adults were genotyped by PCR and Sanger sequencing (Azenta); F2 individuals homozygous for the transgene were isolated from heterozygous F1 parents to establish transgenic lines. Transgenic strains were outcrossed twice prior to phenotypic analysis.

ric-8(nch016) crRNA: 5’ – TCAGAATCCGAATTCTCGGC – 3’

donor oligonucleotide: 5’ – GCCATGTGTTGGAGCTCCTGAAGAATGCTCCAGAACCAGCGCCGGCCGAAAACTCGGATTCTGATGAAGAAGGAGGAGGATCCTACACCGTCGTCGAGCAATACGAGAAGTCCGTCGCCCGTCACTGCACCGGAGGAATGGATGAGTTATACAAGTAATTATTTTTGATTTTTCCATTTTAACATTTTGAAAAAAATTCT – 3’

Molecular biology

Plasmids

The coding sequence corresponding to the RVIP motif of RIC-8 was deleted from the bbs-8p::ric-8WT::tagrfp plasmid (Campagna et al., 2023) by site-directed mutagenesis using QuikChange Lightning kit (Agilent Technologies). The mutagenized construct was verified by full-plasmid sequencing (Plasmidsaurus).

qPCR

Total RNA was extracted from RPE-1 cells transfected with siControl, siRIC8A, or siRIC8B using the RNeasy kit (Qiagen) per manufacturer’s instructions. RNA samples were reverse-transcribed using the ZymoScript One-Step RT-qPCR Kit (ZymoResearch), and expression levels of RIC8A and RIC8B were quantified by real-time PCR (Applied Biosystems QuantStudio 6 Pro) relative to RPL11 control using the 2−ΔΔCt method. Primer sequences are listed below:

RPL11: 5’ GTTGGGGAGAGTGGAGACAG 3’ / 5’ TGCCAAAGGATCTGACAGTG 3’ 
RIC8A: 5’ TGATCGCTACTGCTGGAGA 3’ / 5’ TCCAGGGTGAGGAGAACAT 3’ 
RIC8B: 5’ TAGACAGTTGGAAGGTGCATAAA 3’ / 5’ GTCTTCAGTTGGACCTACGATTAG 3’

Calcium imaging

Young adult worms were transferred to M9 buffer supplemented with poloxamer (1μL/50mL). A single worm was loaded into a microtube using a 3-mL syringe and connected to the olfactory microfluidic chip (Chronis et al., 2007). The inlet channels of the chip were supplied with S-basal buffer and 1M glycerol in S-basal buffer, each connected to computer-controlled rotary valves (Advanced Microfluidics). Recordings were acquired at 10 frames s−1, synchronized with the valve switching program. The flow sequence consisted of 30 s of S-basal buffer, followed by 30 s of 1M glycerol, and then 30 s of S-basal buffer for recovery. To correct for photobleaching, an exponential decay was fit to fluorescence intensity values for the first 30 s and the last 20 s of imaging (prior and post stimulus). The resulting curve was subtracted from original intensity values. Amplitude was calculated as maximum change in fluorescence (F-F0) in the 10 s following glycerol addition; F0 was set to the average ΔF/F0 value for 5 s before glycerol onset. Figure panels summarizing calcium imaging data were generated using RStudio.

RPE-1 cell culture and transfection

Human telomerase-immortalized retinal pigment epithelial cells (hTERT RPE-1) were cultured in DMEM/F12 (1:1) complete growth medium supplemented with 10% fetal bovine serum and 1X antibiotic-antimycotic (Gibco) at 37°C with 5% CO2. One day prior to transfection, cells were plated in antibiotic-free media at 30,000 cells per well on 12-mm glass pre-treated coverslips (Neuvitro) in a 24-well plate (for immunofluorescence analysis) or at 60,000 cells per well without coverslips in a 12-well plate (for qPCR analysis). Synthetic small interfering RNA oligonucleotides (siRNAs) targeting RIC8A or RIC8B or non-targeting control siRNA were transfected as previously described (Nechipurenko et al., 2016). The target sequences for siRNAs used in this study are shown below:

siRIC8A siRNA#1 (J-016121–09-0002, Dharmacon): GGGGAGAUGCUGCGGAACA 
siRIC8A siRNA#2 (J-016121–11-0002, Dharmacon): CAGGAUGCCAUGUGCGAGA 
siRIC8B siRNA#1 (J-021081–09-0002, Dharmacon): UCUCAUCAGUUCCGUGUAA siRIC8B siRNA#2 (J-021081–12-0002, Dharmacon): ACAGUUGGAAGGUGCAUAA 
siControl (D-001810–01-05, Dharmacon): UGGUUUACAUGUCGACUAA

Immunostaining

RPE-1 cells were fixed in 4% paraformaldehyde for 12 minutes at room temperature (RT) or in ice-cold ethanol or methanol for 10 minutes at −20°C. Fixed cells were blocked in 5% bovine serum albumin (BSA) in phosphate buffered saline with 0.2% Triton X-100 (PBS-T) for one hour at RT or at 4°C overnight and subsequently incubated in primary antibodies diluted in the blocking solution for 1.5 hours at RT or at 4°C overnight. The following primary antibodies were used in this study: anti-ARL13B (1:10, catalog/clone # N295B/66, Developmental Studies Hybridoma Bank), anti-γ-tubulin (1:500, catalog # orb499656, clone # 8D11, biorbyt), anti-acetylated α-tubulin (1:500, catalog # T7451, clone # 6–11B-1, MilliporeSigma). Alpaca anti-mouse Alexa 594 (catalog # 615–584-214, Jackson ImmunoResearch Labs) secondary antibody was diluted in blocking solution and applied for 1.5 hours at RT or at 4°C overnight. DAPI (1:1000, ThermoFisher) was used to stain DNA.

Microscopy

C. elegans

L1 larvae or one-day-old adult hermaphrodites were anesthetized in 10 mM tetramisole hydrochloride (MP Biomedicals) and mounted on 10% agarose pads on top of glass microscope slides. The animals were imaged on an upright THUNDER Imager 3D Tissue (Leica) using 63X NA 1.4–0.60 oil immersion objective and K5 sCMOS camera (Leica) in Leica Application Suite X software. Images of RIC-8::split-Scarlet in Figure 1A and ODR-3::split-Scarlet in Figure 4A were acquired on an inverted Nikon Ti-E microscope with Yokogawa CSU-X1 spinning disk confocal head using 60X NA 1.40 oil immersion objective and ORCA-fusion BT camera (Hamamatsu) in MetaMorph 7 (Molecular Devices). Images for all phenotypic analyses were collected on at least two independent days, and identical acquisition settings were used for imaging all genotypes that were compared directly. In all figures, images are oriented with anterior of the animal to the left.

RPE-1 cells

Coverslips with fixed and stained RPE-1 cells were mounted on microscope slides with ProLong Diamond anti-fade mountant (Invitrogen) and imaged on an inverted Nikon Ti-E microscope with a Yokogawa CSU-X1 spinning disk confocal head. Complete z-stacks were acquired at 0.25-μm intervals in MetaMorph 7 software (Molecular Devices) using a 60X NA 1.40 oil immersion objective and an ORCA-Fusion BT Digital CMOS camera (Hamamatsu).

Image analysis

Image analyses were carried out in Fiji/Image J (National Institute of Health) and are detailed below.

RIC-8::TagRFP fluorescence intensity:

Fluorescence intensity was quantified by drawing a line from cilia base to the distal tip of the ciliary RIC-8::TagRFP signal and measuring the mean intensity along the line. Similarly, a line was drawn across the PCMC, and the mean intensity along the line was recorded. The relative RIC-8::TagRFP fluorescence for each neuron was reported as the ratio of the mean ciliary intensity over the mean PCMC fluorescence intensity.

Line scans:

A straight line was drawn from cilia base to the distal boundary of RIC-8::TagRFP signal inside a cilium and measuring fluorescence intensities along the line using the plot profile tool. TagRFP intensity within each cilium was normalized to the maximum intensity value for that cilium and expressed as percent of the maximum intensity.

ODR-3::split-Scarlet fluorescence intensity:

The z-slices that encompassed ASH cilia in their entirety were rendered into maximum-intensity projections. Fluorescence intensity of ODR-3::split-Scarlet inside a cilium was quantified by drawing a segmented line from cilium base to tip and measuring the mean intensity along the line after subtracting the average background fluorescence.

Statistical analyses

Prism 10 software (GraphPad) was used to carry out statistical analyses and generate graphs. In scatter plots, horizontal and vertical bars represent mean ± SD, unless noted otherwise in figure legends. In bar graphs, number of analyzed animals is listed inside corresponding bars. Statistical tests are noted in the corresponding figure legends.

Supplementary Material

Supplement 1
media-1.pdf (850KB, pdf)

ACKNOWLEDGEMENTS

We are grateful to members of the Nechipurenko lab for critical comments on the manuscript and to Ryan Breitenbach and Thomas L. Morrione for technical assistance and maintenance of strains. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). This work was supported by the NIH (R15 HD109706 – I.N.; R35 GM155316 – I.N.).

REFERENCES

  1. Ahmed N.T., Gao C., Lucker B.F., Cole D.G., and Mitchell D.R.. 2008. ODA16 aids axonemal outer row dynein assembly through an interaction with the intraflagellar transport machinery. Journal of Cell Biology. 183:313–322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Anvarian Z., Mykytyn K., Mukhopadhyay S., Pedersen L.B., and Christensen S.T.. 2019. Cellular signalling by primary cilia in development, organ function and disease. Nature Reviews Nephrology. 15:199–219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Barbelanne M., Lu Y., Kumar K., Zhang X., Li C., Park K., Warner A., Xu X.Z.S., Shaham S., and Leroux M.R.. 2024. C. elegans PPEF-type phosphatase (Retinal degeneration C ortholog) functions in diverse classes of cilia to regulate nematode behaviors. Sci Rep. 14:28347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bennett H.W., Gustavsson A.-K., Bayas C.A., Petrov P.N., Mooney N., Moerner W.E., and Jackson P.K.. 2020. Novel fibrillar structure in the inversin compartment of primary cilia revealed by 3D single-molecule super-resolution microscopy. Molecular Biology of the Cell:mbc.E19-09–0499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bhogaraju S., Cajanek L., Fort C., Blisnick T., Weber K., Taschner M., Mizuno N., Lamla S., Bastin P., Nigg E.A., and Lorentzen E.. 2013. Molecular basis of tubulin transport within the cilium by IFT74 and IFT81. Science. 341:1009–1012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Blacque O.E., Li C., Inglis P.N., Esmail M.A., Ou G., Mah A.K., Baillie D.L., Scholey J.M., and Leroux M.R.. 2006. The WD Repeat-containing Protein IFTA-1 Is Required for Retrograde Intraflagellar Transport. Molecular Biology of the Cell. 17:5053–5062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Brear A.G., Yoon J., Wojtyniak M., and Sengupta P.. 2014. Diverse Cell Type-Specific Mechanisms Localize G Protein-Coupled Receptors to Caenorhabditis elegans Sensory Cilia. Genetics. 197:667–684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Burghoorn J., Dekkers M.P., Rademakers S., de Jong T., Willemsen R., and Jansen G.. 2007. Mutation of the MAP kinase DYF-5 affects docking and undocking of kinesin-2 motors and reduces their speed in the cilia of Caenorhabditis elegans. Proc Natl Acad Sci U S A. 104:7157–7162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Campagna C.M., McMahon H., and Nechipurenko I.. 2023. The G protein alpha chaperone and guanine-nucleotide exchange factor RIC-8 regulates cilia morphogenesis in Caenorhabditis elegans sensory neurons. PLOS Genetics. 19:e1011015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cevik S., Sanders A.A., Van Wijk E., Boldt K., Clarke L., van Reeuwijk J., Hori Y., Horn N., Hetterschijt L., Wdowicz A., Mullins A., Kida K., Kaplan O.I., van Beersum S.E., Man Wu K., Letteboer S.J., Mans D.A., Katada T., Kontani K., Ueffing M., Roepman R., Kremer H., and Blacque O.E.. 2013. Active transport and diffusion barriers restrict Joubert Syndrome-associated ARL13B/ARL-13 to an Inv-like ciliary membrane subdomain. PLoS Genet. 9:e1003977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chronis N., Zimmer M., and Bargmann C.I.. 2007. Microfluidics for in vivo imaging of neuronal and behavioral activity in Caenorhabditis elegans. Nat Methods. 4:727–731. [DOI] [PubMed] [Google Scholar]
  12. Dai J., Barbieri F., Mitchell D.R., and Lechtreck K.F.. 2018. In vivo analysis of outer arm dynein transport reveals cargo-specific intraflagellar transport properties. Mol Biol Cell. 29:2553–2565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Derderian C., Canales G.I., and Reiter J.F.. 2023. Seriously cilia: A tiny organelle illuminates evolution, disease, and intercellular communication. Dev Cell. 58:1333–1349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Deretic D., Williams A.H., Ransom N., Morel V., Hargrave P.A., and Arendt A.. 2005. Rhodopsin C terminus, the site of mutations causing retinal disease, regulates trafficking by binding to ADP-ribosylation factor 4 (ARF4). Proc Natl Acad Sci U S A. 102:3301–3306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Ditirro D., Philbrook A., Rubino K., and Sengupta P.. 2019. The Caenorhabditis elegans Tubby homolog dynamically modulates olfactory cilia membrane morphogenesis and phospholipid composition. eLife. 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Dokshin G.A., Ghanta K.S., Piscopo K.M., and Mello C.C.. 2018. Robust Genome Editing with Short Single-Stranded and Long, Partially Single-Stranded DNA Donors in Caenorhabditis elegans. Genetics. 210:781–787. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Doroquez D.B., Berciu C., Anderson J.R., Sengupta P., and Nicastro D.. 2014. A high-resolution morphological and ultrastructural map of anterior sensory cilia and glia in Caenorhabditis elegans. eLife. 3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Engel B.D., Ishikawa H., Wemmer K.A., Geimer S., Wakabayashi K., Hirono M., Craige B., Pazour G.J., Witman G.B., Kamiya R., and Marshall W.F.. 2012. The role of retrograde intraflagellar transport in flagellar assembly, maintenance, and function. J Cell Biol. 199:151–167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Geng L., Okuhara D., Yu Z., Tian X., Cai Y., Shibazaki S., and Somlo S.. 2006. Polycystin-2 traffics to cilia independently of polycystin-1 by using an N-terminal RVxP motif. J Cell Sci. 119:1383–1395. [DOI] [PubMed] [Google Scholar]
  20. Goudeau J., Sharp C.S., Paw J., Savy L., Leonetti M.D., York A.G., Updike D.L., Kenyon C., and Ingaramo M.. 2021. Split-wrmScarlet and split-sfGFP: tools for faster, easier fluorescent labeling of endogenous proteins in Caenorhabditis elegans. Genetics. 217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Haycraft C.J., Banizs B., Aydin-Son Y., Zhang Q., Michaud E.J., and Yoder B.K.. 2005. Gli2 and Gli3 localize to cilia and require the intraflagellar transport protein polaris for processing and function. PLoS Genet. 1:e53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Higginbotham H., Eom T.-Y., Laura A. Bachleda, J. Hirt, V. Gukassyan, C.L. Cusack, C. Lai, T. Caspary, and E.S. Anton. 2012. Arl13b in Primary Cilia Regulates the Migration and Placement of Interneurons in the Developing Cerebral Cortex. Developmental Cell. 23:925–938. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hilliard M.A., Apicella A.J., Kerr R., Suzuki H., Bazzicalupo P., and Schafer W.R.. 2005. In vivo imaging of C. elegans ASH neurons: cellular response and adaptation to chemical repellents. EMBO J. 24:63–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Hou Y., and Witman G.B.. 2017. The N-terminus of IFT46 mediates intraflagellar transport of outer arm dynein and its cargo-adaptor ODA16. Mol Biol Cell. 28:2420–2433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Hunter E.L., Lechtreck K., Fu G., Hwang J., Lin H., Gokhale A., Alford L.M., Lewis B., Yamamoto R., Kamiya R., Yang F., Nicastro D., Dutcher S.K., Wirschell M., and Sale W.S.. 2018. The IDA3 adapter, required for intraflagellar transport of I1 dynein, is regulated by ciliary length. Mol Biol Cell. 29:886–896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Inglis P.N., Ou G., Leroux M.R., and Scholey J.M.. 2007. The sensory cilia of Caenorhabditis elegans. WormBook:1–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Iomini C., Li L., Esparza J.M., and Dutcher S.K.. 2009. Retrograde intraflagellar transport mutants identify complex A proteins with multiple genetic interactions in Chlamydomonas reinhardtii. Genetics. 183:885–896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Ishikawa H., Ide T., Yagi T., Jiang X., Hirono M., Sasaki H., Yanagisawa H., Wemmer K.A., Stainier D.Y., Qin H., Kamiya R., and Marshall W.F.. 2014. TTC26/DYF13 is an intraflagellar transport protein required for transport of motility-related proteins into flagella. Elife. 3:e01566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Jenkins P.M., Hurd T.W., Zhang L., McEwen D.P., Brown R.L., Margolis B., Verhey K.J., and Martens J.R.. 2006. Ciliary targeting of olfactory CNG channels requires the CNGB1b subunit and the kinesin-2 motor protein, KIF17. Curr Biol. 16:1211–1216. [DOI] [PubMed] [Google Scholar]
  30. Jensen V.L., Li C., Bowie R.V., Clarke L., Mohan S., Blacque O.E., and Leroux M.R.. 2015. Formation of the transition zone by Mks5/Rpgrip1L establishes a ciliary zone of exclusion (CIZE) that compartmentalises ciliary signalling proteins and controls PIP2 ciliary abundance. The EMBO Journal. 34:2537–2556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Jiang X., Shao W., Chai Y., Huang J., Mohamed M.A.A., Okten Z., Li W., Zhu Z., and Ou G.. 2022. DYF-5/MAK-dependent phosphorylation promotes ciliary tubulin unloading. Proc Natl Acad Sci U S A. 119:e2207134119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Kato S., Xu Y., Cho C.E., Abbott L.F., and Bargmann C.I.. 2014. Temporal responses of C. elegans chemosensory neurons are preserved in behavioral dynamics. Neuron. 81:616–628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Lacey S.E., and Pigino G.. 2024. The intraflagellar transport cycle. Nature Reviews Molecular Cell Biology. [DOI] [PubMed] [Google Scholar]
  34. Lewis W.R., Bales K.L., Revell D.Z., Croyle M.J., Engle S.E., Song C.J., Malarkey E.B., Uytingco C.R., Shan D., Antonellis P.J., Nagy T.R., Kesterson R.A., Mrug M.M., Martens J.R., Berbari N.F., Gross A.K., and Yoder B.K.. 2019. Mks6 mutations reveal tissue- and cell type-specific roles for the cilia transition zone. FASEB J. 33:1440–1455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Li C., Jensen V.L., Park K., Kennedy J., Garcia-Gonzalo F.R., Romani M., De Mori R., Bruel A.L., Gaillard D., Doray B., Lopez E., Riviere J.B., Faivre L., Thauvin-Robinet C., Reiter J.F., Blacque O.E., Valente E.M., and Leroux M.R.. 2016. MKS5 and CEP290 Dependent Assembly Pathway of the Ciliary Transition Zone. PLoS Biol. 14:e1002416. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Machado C.F., Nagai M.H., Lyra C.S., Reis-Silva T.M., Xavier A.M., Glezer I., Felicio L.F., and Malnic B.. 2017. Conditional Deletion of Ric-8b in Olfactory Sensory Neurons Leads to Olfactory Impairment. J Neurosci. 37:12202–12213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Mariani L.E., Bijlsma M.F., Ivanova A.A., Suciu S.K., Kahn R.A., and Caspary T.. 2016. Arl13b regulates Shh signaling from both inside and outside the cilium. Mol Biol Cell. 27:3780–3790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Maurya A.K., Rogers T., and Sengupta P.. 2019. A CCRK and a MAK Kinase Modulate Cilia Branching and Length via Regulation of Axonemal Microtubule Dynamics in Caenorhabditis elegans. Current Biology. 29:1286–1300.e1284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Mitra A., Loseva E., and Peterman E.J.G.. 2024. IFT cargo and motors associate sequentially with IFT trains to enter cilia of C. elegans. Nature Communications. 15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Mul W., Mitra A., Prevo B., and Peterman E.J.G.. 2025. DYF-5 regulates intraflagellar transport by affecting train turnaround. Mol Biol Cell. 36:ar53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Nakajima Y., Kiyonari H., Mukumoto Y., and Yokoyama T.. 2018. The Inv compartment of renal cilia is an intraciliary signal-activating center to phosphorylate ANKS6. Kidney Int. 93:1108–1117. [DOI] [PubMed] [Google Scholar]
  42. Nakamura K., Noguchi T., Takahara M., Omori Y., Furukawa T., Katoh Y., and Nakayama K.. 2020. Anterograde trafficking of ciliary MAP kinase–like ICK/CILK1 by the intraflagellar transport machinery is required for intraciliary retrograde protein trafficking. Journal of Biological Chemistry. 295:13363–13376. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Nechipurenko I., and Sengupta P.. 2025. C. elegans: An elegant experimental system for the study of cilia biology. Semin Cell Dev Biol. 174:103636. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Nechipurenko I.V., Olivier-Mason A., Kazatskaya A., Kennedy J., McLachlan I.G., Heiman M.G., Blacque O.E., and Sengupta P.. 2016. A Conserved Role for Girdin in Basal Body Positioning and Ciliogenesis. Dev Cell. 38:493–506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Ou G., Blacque O. E., Snow J.J., Leroux M.R., and Scholey J.M.. 2005. Functional coordination of intraflagellar transport motors. Nature. 436:583–587. [DOI] [PubMed] [Google Scholar]
  46. Ou G., Koga M., Blacque O.E., Murayama T., Ohshima Y., Schafer J.C., Li C., Yoder B.K., Leroux M.R., and Scholey J.M.. 2007. Sensory ciliogenesis in Caenorhabditis elegans: assignment of IFT components into distinct modules based on transport and phenotypic profiles. Mol Biol Cell. 18:1554–1569. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Perkins L.A., Hedgecock E.M., Thomson J.N., and Culotti J.G.. 1986. Mutant sensory cilia in the nematode Caenorhabditis elegans. Dev Biol. 117:456–487. [DOI] [PubMed] [Google Scholar]
  48. Piperno G., Siuda E., Henderson S., Segil M., Vaananen H., and Sassaroli M.. 1998. Distinct mutants of retrograde intraflagellar transport (IFT) share similar morphological and molecular defects. J Cell Biol. 143:1591–1601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Prevo B., Mangeol P., Oswald F., Scholey J.M., and Peterman E.J.G.. 2015. Functional differentiation of cooperating kinesin-2 motors orchestrates cargo import and transport in C. elegans cilia. Nature Cell Biology. 17:1536–1545. [DOI] [PubMed] [Google Scholar]
  50. Qin J., Lin Y., Norman R.X., Ko H.W., and Eggenschwiler J.T.. 2011. Intraflagellar transport protein 122 antagonizes Sonic Hedgehog signaling and controls ciliary localization of pathway components. Proc Natl Acad Sci U S A. 108:1456–1461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Rachel R.A., Li T., and Swaroop A.. 2012. Photoreceptor sensory cilia and ciliopathies: focus on CEP290, RPGR and their interacting proteins. Cilia. 1:22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Roayaie K., Crump J.G., Sagasti A., and Bargmann C.I.. 1998. The Gα Protein ODR-3 Mediates Olfactory and Nociceptive Function and Controls Cilium Morphogenesis in C. elegans Olfactory Neurons. Neuron. 20:55–67. [DOI] [PubMed] [Google Scholar]
  53. Salama R., Peet E., Morrione L., Durant S., Seager M., Rennie M., Scarlata S., and Nechipurenko I.. 2025. Functional classification of GNAI1 disorder variants in C. elegans uncovers conserved and cell-specific mechanisms of dysfunction. Genetics. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Schouteden C., Serwas D., Palfy M., and Dammermann A.. 2015. The ciliary transition zone functions in cell adhesion but is dispensable for axoneme assembly in C. elegans. J Cell Biol. 210:35–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Shiba D., Yamaoka Y., Hagiwara H., Takamatsu T., Hamada H., and Yokoyama T.. 2009. Localization of Inv in a distinctive intraciliary compartment requires the C-terminal ninein-homolog-containing region. Journal of Cell Science. 122:44–54. [DOI] [PubMed] [Google Scholar]
  56. Snow J.J., Ou G., Gunnarson A.L., Walker M.R., Zhou H.M., Brust-Mascher I., and Scholey J.M.. 2004. Two anterograde intraflagellar transport motors cooperate to build sensory cilia on C. elegans neurons. Nat Cell Biol. 6:1109–1113. [DOI] [PubMed] [Google Scholar]
  57. Tam L.W., Ranum P.T., and Lefebvre P.A.. 2013. CDKL5 regulates flagellar length and localizes to the base of the flagella in Chlamydomonas. Mol Biol Cell. 24:588–600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Taschner M., Mourao A., Awasthi M., Basquin J., and Lorentzen E.. 2017. Structural basis of outer dynein arm intraflagellar transport by the transport adaptor protein ODA16 and the intraflagellar transport protein IFT46. J Biol Chem. 292:7462–7473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. van der Burght S.N., Rademakers S., Johnson J.L., Li C., Kremers G.J., Houtsmuller A.B., Leroux M.R., and Jansen G.. 2020. Ciliary Tip Signaling Compartment Is Formed and Maintained by Intraflagellar Transport. Curr Biol. 30:4299–4306 e4295. [DOI] [PubMed] [Google Scholar]
  60. Warburton-Pitt S.R.F., Silva M., Nguyen K.C.Q., Hall D.H., and Barr M.M.. 2014. The nphp-2 and arl-13 Genetic Modules Interact to Regulate Ciliogenesis and Ciliary Microtubule Patterning in C. elegans. PLoS Genetics. 10:e1004866. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Ward S., Thomson N., White J.G., and Brenner S.. 1975. Electron microscopical reconstruction of the anterior sensory anatomy of the nematode Caenorhabditis elegans. J Comp Neurol. 160:313–337. [DOI] [PubMed] [Google Scholar]
  62. Watanabe D., Saijoh Y., Nonaka S., Sasaki G., Ikawa Y., Yokoyama T., and Hamada H.. 2003. The left-right determinant Inversin is a component of node monocilia and other 9+0 cilia. Development. 130:1725–1734. [DOI] [PubMed] [Google Scholar]
  63. Wen X., Lai C.K., Evangelista M., Hongo J.A., de Sauvage F.J., and Scales S.J.. 2010. Kinetics of hedgehog-dependent full-length Gli3 accumulation in primary cilia and subsequent degradation. Mol Cell Biol. 30:1910–1922. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Wojtyniak M., Brear A.G., O’Halloran D.M., and Sengupta P.. 2013. Cell- and subunit-specific mechanisms of CNG channel ciliary trafficking and localization in C. elegans. Journal of Cell Science. 126:4381–4395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Xiang W., Zur Lage P., Newton F.G., Qiu G., and Jarman A.P.. 2022. The dynamics of protein localisation to restricted zones within Drosophila mechanosensory cilia. Sci Rep. 12:13338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Yi P., Xie C., and Ou G.. 2018. The kinases male germ cell-associated kinase and cell cycle-related kinase regulate kinesin-2 motility in Caenorhabditis elegans neuronal cilia. Traffic. 19:522–535. [DOI] [PubMed] [Google Scholar]
  67. Yoshida K., Hirotsu T., Tagawa T., Oda S., Wakabayashi T., Iino Y., and Ishihara T.. 2012. Odour concentration-dependent olfactory preference change in C. elegans. Nat Commun. 3:739. [DOI] [PubMed] [Google Scholar]
  68. Zhao Q., Li S., Shao S., Wang Z., and Pan J.. 2020. FLS2 is a CDK-like kinase that directly binds IFT70 and is required for proper ciliary disassembly in Chlamydomonas. PLoS Genet. 16:e1008561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Zuo X., Lobo G., Fulmer D., Guo L., Dang Y., Su Y., Ilatovskaya D.V., Nihalani D., Rohrer B., Body S.C., Norris R.A., and Lipschutz J.H.. 2019. The exocyst acting through the primary cilium is necessary for renal ciliogenesis, cystogenesis, and tubulogenesis. J Biol Chem. 294:6710–6718. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplement 1
media-1.pdf (850KB, pdf)

Articles from bioRxiv are provided here courtesy of Cold Spring Harbor Laboratory Preprints

RESOURCES