Skip to main content
NCBI home page
Molecular Biology of the Cell logoLink to Molecular Biology of the Cell
. 2026 Jul 27;37(8):br26. doi: 10.1091/mbc.E25-12-0598

Functions and trafficking mechanisms of RIC-8 in C. elegans and mammalian cilia

Christina M Campagna a, Abigail E Descoteaux a, Abigail Poole a, Eric Peet a, Nawaphat Malaiwong b, Michael P O'Donnell b, Inna Nechipurenko a,*
Editor: Gregory Pazourc
PMCID: PMC13428341  PMID: 42307979

Abstract

Primary cilia exhibit conserved organization and contain structural and functional domains of unique molecular composition. The inversin compartment (InvC), which is found in the proximal ciliary segment of a subset of vertebrate and invertebrate cell types, concentrates different classes of signaling molecules. Mutations in genes encoding resident proteins of the InvC manifest in ciliopathies, highlighting the importance of the InvC in cilia biology. We previously showed that a chaperone of Gα proteins, RIC-8, localizes to the InvC of C. elegans channel cilia; however, the mechanisms that regulate RIC-8 targeting to this ciliary subdomain or RIC-8 function in the InvC remain unknown. Here, we build on our previous work to demonstrate that RIC-8 becomes restricted to the InvC during larval development and show that, while the RVxP motif and intact transition zone are required for its proper intraciliary distribution, RIC-8 localization to the cilium depends on intraflagellar transport. Using the ASH neuron as a model, we establish that RIC-8 modulates chemosensory responses mediated by channel cilia. Finally, we show that human RIC8A and RIC8B proteins are required for ciliogenesis in RPE-1 cells. Collectively, our results define ciliary trafficking mechanisms and novel functions for a highly conserved signaling protein.

  • Compartmentalized localization of signaling proteins inside primary cilia is essential for the proper function of these organelles. The mechanisms that target signaling proteins to specific ciliary subdomains, such as the inversin compartment, are not well understood.

  • RIC-8 localizes to the inversin compartment of C. elegans chemosensory cilia via intraflagellar transport and the transition zone-dependent mechanisms. Furthermore, RIC-8 modulates chemosensory signaling in ASH neurons, and human RIC-8 homologs (RIC8A and RIC8B) regulate ciliogenesis in RPE-1 cells.

  • These findings expand the repertoire of RIC-8 cellular functions and pave the way for mechanistic investigations into the roles of mammalian RIC-8 homologs in cilia biology.

INTRODUCTION

Primary cilia are signaling organelles that extend from the surface of most mammalian cells and invertebrate sensory neurons (Anvarian et al., 2019; Derderian et al., 2023). The signaling capacity of primary cilia depends on compartmentalized localization of signaling proteins to distinct subciliary domains. For example, the inversin compartment (InvC), defined by localization of INVS/NPHP-2, is found in the proximal primary cilium of many cell types (e.g., Watanabe et al., 2003; Shiba et al., 2009; Warburton-Pitt et al., 2014; Nakajima et al., 2018; Bennett et al., 2020) and concentrates cyclic nucleotide-gated channels (Wojtyniak et al., 2013; Nechipurenko and Sengupta, 2025), the small GTPase ARL-13 (Cevik et al., 2013), and the Gα protein chaperone RIC-8 (Campagna et al., 2023). Likewise, the TRPV channel and CDKL5 kinase are sequestered in the proximal regions of mechanosensory cilia in Drosophila (Xiang et al., 2022) and Chlamydomonas flagella (Tam et al., 2013), respectively. In addition to the InvC, the cilia tip concentrates select signaling proteins such as Hedgehog pathway components in mammalian cells (Haycraft et al., 2005; Wen et al., 2010) and receptor guanylate cyclase GCY-22 in the C. elegans ASER neuron (van der Burght et al., 2020).

Although the mechanisms that target specific signaling proteins to discrete ciliary subdomains are not well understood, intraflagellar transport (IFT)—a conserved active transport system that carries many transmembrane and soluble proteins in and out of the cilium—has been reported to participate in localizing Gli proteins (Haycraft et al., 2005; Qin et al., 2011), GCY-22 (van der Burght et al., 2020), and ARL-13 (Cevik et al., 2013) to their respective subciliary domains. IFT is organized into IFT-A and IFT-B multi-protein complexes that function as adapters between motors and ciliary protein cargoes. Kinesin-2 and dynein-2 motors drive IFT along ciliary microtubules in the anterograde (from cilia base to tip) and retrograde (from cilia tip to base) directions, respectively. In C. elegans, two kinesin-2 family motors (kinesin-II and OSM-3) work together to build cilia and mediate anterograde transport (Snow et al., 2004).

In C. elegans, cilia extend from the distal dendrites of a subset of sensory neurons and display distinct morphologies and molecular composition (Inglis et al., 2007; Nechipurenko and Sengupta, 2025). Most chemosensory neurons of the amphid and phasmid sensory organs in the worm head and tail, respectively, possess rod-like “channel” cilia, while three types of amphid olfactory neurons (AWA, AWB, and AWC) have elaborate “wing” cilia (Ward et al., 1975; Perkins et al., 1986; Doroquez et al., 2014). Although core ciliogenic mechanisms are conserved, cell-specific functions for cilia proteins are being increasingly observed in worms and mammals (e.g., Roayaie et al., 1998; Rachel et al., 2012; Ditirro et al., 2019; Lewis et al., 2019; Campagna et al., 2023; Salama et al., 2025).

We previously reported that RIC-8, a cytoplasmic guanine nucleotide exchange factor and chaperone for heterotrimeric Gα protein subunits, shapes wing-cilia morphology by regulating levels of Gα ODR-3 (Campagna et al., 2023). Although RIC-8 is largely dispensable for the assembly of channel cilia, it localizes to the InvC of this cilia type (Campagna et al., 2023). Here, we demonstrate that RIC-8 modulates sensory responses mediated by ASH channel cilia, define molecular mechanisms that regulate its localization to this cilia type, and show that human RIC8A and RIC8B contribute to ciliogenesis in RPE-1 cells. Overall, our findings uncover new cilia roles for an evolutionarily conserved signaling protein.

RESULTS AND DISCUSSION

RIC-8 becomes restricted to the InvC during larval development independently of NPHP-2

When expressed from a multicopy transgene, RIC-8 localizes to the InvC of channel cilia in adult hermaphrodites (Campagna et al., 2023). We confirmed this localization pattern by tagging the endogenous ric-8 locus with a split-Scarlet reporter (split-Sc; Goudeau et al., 2021). Specifically, we inserted the 11th β strand of codon-optimized Scarlet (Scarlet11) before the stop codon of ric-8 and expressed the remaining Scarlet1-10 fragment under the bbs-8 promoter to reconstitute fluorescence and thus visualize localization of RIC-8::split-Sc in all ciliated neurons. Consistent with our earlier findings, RIC-8::split-Sc was distributed throughout phasmid neurons and exhibited enrichment in proximal cilia segments (Figure 1A; Campagna et al., 2023).

FIGURE 1:

FIGURE 1:

Open in a new tab

RIC-8 becomes restricted to the InvC during larval development. (A) Top: diagram of phasmid neurons in the worm tail. Phasmid cilia are magnified in the inset on the right. PCMC: periciliary membrane compartment; TZ: transition zone; InvC: inversin compartment. Bottom: RIC-8::split-Sc in phasmids. Boxed region is shown at higher magnification on the right. d: dendrite; cil.: cilia. (B and C) Localization of RIC-8::TagRFP (B) and co-localization of RIC-8::TagRFP with NPHP-2::GFP (C) in WT phasmids at the indicated stages. (D and E) Quantification of the absolute RIC-8::TagRFP signal length (D) and RIC-8::TagRFP signal length relative to phasmid cilia length (E) in L1 and adult WT animals. *** Different from L1 at p < 0.001 (Mann-Whitney test). (F–H) Images (F) and quantification of relative RIC-8::TagRFP fluorescence (G) and RIC-8::TagRFP signal length (H) in phasmid cilia of WT and nphp-2 mutants. ns: not significant (Welch's t test; G), (Mann-Whitney test; H). Arrowheads: TZ; arrows: distal boundary of RIC-8::TagRFP signal. Scale: 5 µm.

The InvC in phasmid cilia is established before the first larval (L1) stage (Warburton-Pitt et al., 2014); however, at least one InvC resident protein (ARL-13) does not become restricted to the proximal cilium until the L3 larval stage (Cevik et al., 2013). In contrast, Drosophila TRPV subunit Iav localizes directly to the proximal zone during cilia assembly and remains restricted there during extension of distal cilia segments (Xiang et al., 2022). To determine the timing of RIC-8 localization to the InvC, we analyzed a published transgenic strain that expresses RIC-8::TagRFP in all ciliated neurons (Campagna et al., 2023) due to rapid bleaching of RIC-8::split-Sc. Unlike in adults, RIC-8::TagRFP signal in L1 larvae extended outside the InvC, visualized with NPHP-2::GFP, into distal cilia segments (Figure 1, B–E), indicating that RIC-8 becomes restricted to the InvC during larval development, similarly to ARL-13. Relative ciliary levels and intraciliary distribution of RIC-8::TagRFP were comparable in wild-type (WT) and nphp-2 mutants (Figure 1, F–H), suggesting that NPHP-2 does not regulate RIC-8 localization to or within cilia.

The transition zone regulates levels and distribution of RIC-8 inside channel cilia

The transition zone (TZ) functions as a selective barrier at the cilia base, and defects in TZ integrity are associated with altered localization of ciliary proteins, including InvC components (Cevik et al., 2013; Jensen et al., 2015; Li et al., 2016; Barbelanne et al., 2024). To determine whether the TZ contributes to RIC-8 ciliary import or its restriction to the InvC, we examined the localization of RIC-8::TagRFP in phasmid cilia of mks-5(tm3100) mutants with severely compromised TZ (Schouteden et al., 2015; Li et al., 2016). RIC-8::TagRFP levels inside the cilium relative to the distal dendrite were significantly reduced in mks-5 mutants compared with WT (Figure 2, A and B), suggesting the TZ may contribute to RIC-8 retention inside the cilium. Indeed, other studies reported ectopic accumulation of cilia signaling proteins in the distal dendrite of TZ mutants, proposing that the TZ prevents proteins from “leaking” out of the cilium (Cevik et al., 2013; Brear et al., 2014; Jensen et al., 2015; Li et al., 2016).

FIGURE 2:

FIGURE 2:

Open in a new tab

RIC-8 cilia localization depends on an intact transition zone. (A and B) Images (A) and quantification (B) of RIC-8::TagRFP localization in WT and mks-5(tm3100) adult phasmids. Arrowheads: TZ; arrows: distal boundary of RIC-8::TagRFP signal; d: dendrite. Scale: 5 µm. *** Different from wild-type at p < 0.001 (Welch's t test). (C) Line scans of RIC-8::TagRFP intensity in phasmid cilia of the indicated genotypes. Zero corresponds to the cilium base. Error bars: SEM. n = 19 and 36 neurons for WT and mks-5(tm3100), respectively.

In addition to changes in the relative levels, we noted an altered distribution of RIC-8::TagRFP inside mks-5 mutant cilia. In WT, RIC-8::TagRFP signal peaks around 1 µm distal to the TZ (Figure 2, A and C) (Campagna et al., 2023), while in mks-5 mutants, it is more uniformly distributed throughout the proximal cilium (Figure 2, A and C). Our results suggest that TZ integrity is important for RIC-8 cilia retention and proper subciliary distribution. The defects in RIC-8::TagRFP distribution in mks-5 mutants are likely due to mislocalization of cilia proteins that restrict RIC-8 to the InvC.

The RVxP motif helps restrict RIC-8 to the InvC

The RVxP motif plays a role in targeting select proteins to cilia (Deretic et al., 2005; Geng et al., 2006; Jenkins et al., 2006; Higginbotham et al., 2012; Mariani et al., 2016; Zuo et al., 2019). For example, mutations in the RVxP motif of the mammalian Arl13b exclude mutant protein from cilia (Higginbotham et al., 2012), while C. elegans ARL-13 with deleted RVxP exhibits expanded localization to distal cilia (Cevik et al., 2013). RIC-8 contains the RVIP motif in the carboxyl terminus (Supplemental Figure S1A), so we wanted to test whether this motif is necessary for either targeting RIC-8 to the cilium or restricting it to the InvC. Unlike WT RIC-8, RIC-8ΔRVIP extended into distal ciliary segments (Supplemental Figure S1, B and C), pointing to a role for RVIP in sequestering RIC-8 in the InvC, similarly to the RVxP motif in ARL-13 (Cevik et al., 2013). It will be important to determine whether these changes in intraciliary RIC-8 distribution are accompanied by deficits in cilia function.

RIC-8 ciliary localization is dependent on IFT

Next, we tested whether IFT plays a role in RIC-8 ciliary localization. In C. elegans channel cilia, the heterotrimeric kinesin-II motor moves anterograde IFT trains across the TZ (Snow et al., 2004; Prevo et al., 2015; Mitra et al., 2024). We examined RIC-8::TagRFP localization in kap-1 and klp-11 kinesin-II subunit mutants and noted a significant reduction in RIC-8::TagRFP levels inside phasmid channel cilia relative to the periciliary membrane compartment (PCMC) in the distal dendrite (Figure 3, A and B), suggesting that the kinesin-II motor is required for localizing RIC-8 to the cilium. To determine whether the dynein-2 motor, which powers retrograde IFT trains, is important for trafficking RIC-8 out of the cilium, we investigated mutants of che-3 and xbx-1 that encode dynein heavy and light intermediate chains, respectively. Both mutants exhibited an increase in relative intraciliary RIC-8::TagRFP levels compared with WT (Figure 3, A and B). Together, these findings suggest that RIC-8 localization to the cilium depends on kinesin-II and dynein-2 motors.

FIGURE 3:

FIGURE 3:

Open in a new tab

RIC-8 localization to channel cilia depends on IFT. (A and B) Images (A) and quantification (B) of RIC-8::TagRFP localization in phasmids of the indicated genotypes. Corresponding mammalian homologues are listed on the x-axis in (B). (C and D) Images (C) and quantification (D) of RIC-8::TagRFP localization in WT and dyf-5(ok1177) phasmids. Arrowheads: TZ; arrows: distal boundary of RIC-8::TagRFP signal. Scale: 5 µm. *, **, and *** Different from WT at p < 0.05, 0.01, and 0.001, respectively (Kruskal-Wallis with Dunn's multiple comparisons test; B), (Fisher's exact test D).

The IFT-B complex comprised of the IFT-B1 and IFT-B2 subcomplexes mediates ciliary import and/or anterograde transport of several soluble proteins (Ahmed et al., 2008; Bhogaraju et al., 2013; Ishikawa et al., 2014; Hou and Witman, 2017; Taschner et al., 2017; Dai et al., 2018; Hunter et al., 2018; Nakamura et al., 2020; Zhao et al., 2020; Lacey and Pigino, 2024). On the other hand, IFT-A, which similarly consists of two subcomplexes (IFT-A1 and IFT-A2), plays a major role in retrograde transport (Piperno et al., 1998; Blacque et al., 2006; Iomini et al., 2009; Engel et al., 2012). To determine if RIC-8 trafficking in and out of the cilium depends on IFT-B and/or IFT-A, respectively, we quantified relative RIC-8::TagRFP levels in cilia of a subset of IFT-A/B gene mutants. Mutations in genes encoding IFT-A1 (dyf-2, che-11, and daf-10) and IFT-A2 (ifta-1) proteins increased accumulation of RIC-8::TagRFP inside the cilium relative to the PCMC, similarly to our observations in che-3 and xbx-1 dynein-2 mutants (Figure 3, A and B). These findings are consistent with the hypothesis that retrograde IFT contributes to RIC-8 transport out of the cilium. On the other hand, mutations in the IFT-B2 complex genes ift-20 and che-2 significantly reduced the cilium/PCMC ratio of RIC-8::TagRFP (Figure 3, A and B). dyf-11 mutants showed a similar, although not statistically significant, decrease in relative RIC-8::TagRFP levels inside their cilia (Figure 3, A and B). These results suggest that ciliary localization of RIC-8 depends on at least a subset of IFT-B2 proteins. Furthermore, since all examined mutations in the IFT-B2, IFT-A, osm-3, and dynein-2 genes truncate cilia yet exert distinct effects on relative RIC-8 levels (Figure 3A), the observed changes in RIC-8 localization are unlikely to be simply a consequence of shorter cilia length.

Interestingly, mutations in the IFT-B1 genes dyf-1 and dyf-13 significantly increased ciliary RIC-8::TagRFP levels relative to the PCMC, while those in dyf-6 and ift-74 had no significant impact (Figure 3, A and B). Previous studies in C. elegans proposed that DYF-1 and possibly DYF-13 are required for activation of the homodimeric kinesin-2 motor OSM-3 and/or its loading onto the IFT-B module in channel cilia (Ou et al., 2005; Ou et al., 2007). This model was based on the observation that dyf-1 mutants had no detectable OSM-3 transport inside the cilia; however, other IFT-A and IFT-B1/B2 components exhibited normal motility, presumably due to being transported by heterotrimeric kinesin-II (Ou et al., 2005; Ou et al., 2007). Consistently, we find that osm-3 mutants exhibited increased RIC-8::TagRFP fluorescence in cilia relative to the PCMC, similarly to dyf-1 and dyf-13 mutant animals (Figure 3, A and B). These results suggest that OSM-3 and IFT-B1 components DYF-1 and DYF-13 may participate in ciliary trafficking of RIC-8.

A recent study in Chlamydomonas demonstrated that anterograde IFT trains undergo extensive remodeling at the cilia tip into retrograde trains of distinct conformation (Lacey and Pigino, 2024). The rearrangement of IFT-A/B components during this remodeling event generates unique cargo-binding interfaces in anterograde versus retrograde trains. Notably, IFT70/DYF-1 was proposed to form a potential cargo-binding surface on retrograde IFT trains. Thus, it would be interesting to determine whether RIC-8 is carried on retrograde trains via binding to DYF-1, DYF-13, or OSM-3, which is also moved by retrograde IFT from the cilia tip to the middle segment.

DYF-5 restricts RIC-8 to the InvC

The MAK/ICK kinase DYF-5 regulates cilia length and IFT protein localization in C. elegans sensory neurons (Burghoorn et al., 2007; Yi et al., 2018; Maurya et al., 2019; Mul et al., 2025). dyf-5 mutants exhibit long cilia and ectopic accumulation of IFT machinery (e.g., kinesin-2 motors, IFT-A, and IFT-B components) in distal cilia segments. Furthermore, retrograde IFT appears to be markedly reduced in the absence of dyf-5 (Mul et al., 2025). We reasoned that if RIC-8 ciliary trafficking depends on IFT, dyf-5(ok1177) mutants may exhibit defective RIC-8 localization. Indeed, RIC-8::TagRFP was detected throughout phasmid cilia, rather than being restricted to the InvC, in 75% of dyf-5 mutants (Figure 3, C and D). In contrast, only 28% of WT phasmid cilia had any detectable RIC-8::TagRFP in the distal segment (Figure 3, C and D), suggesting that DYF-5 function is important for restricting RIC-8 to the InvC. Notably, dyf-5 was similarly shown to restrict kinesin-II to the proximal cilium, likely by contributing to its undocking from IFT trains (Burghoorn et al., 2007) and to promote unloading of tubulin from IFT complexes at the cilia tip (Jiang et al., 2022). Thus, it would be of interest to test whether DYF-5 also facilitates RIC-8 unloading from IFT trains in the InvC.

ric-8 mutants are defective in glycerol responses mediated by ASH neurons

We previously reported that RIC-8 functions as a Gα ODR-3 chaperone in AWC sensory neurons (Campagna et al., 2023). RIC-8 and ODR-3 are also present in the channel cilia of ASH neurons; however, both proteins are largely dispensable for ASH cilia assembly (Roayaie et al., 1998; Salama et al., 2025). Therefore, we next wanted to identify the function of RIC-8 in channel cilia using ASH as a model. First, we tested whether RIC-8 regulates Gα ODR-3 levels in ASH neurons similarly to AWC. To visualize endogenous ODR-3 in ASH cilia, we expressed wrmScarlet1-10 fragment under the control of the sra-6 promoter in animals that carried odr-3 endogenously tagged with wrmScarlet11 (ODR-3::split-Sc; Goudeau et al., 2021; Salama et al., 2025). Consistent with prior work, ODR-3::split-Sc was enriched in WT ASH cilia (Roayaie et al., 1998; Salama et al., 2025; Figure 4A). Although present inside ASH cilia, ODR-3::split-Sc levels were markedly reduced in the strong hypomorphic ric-8(md1909) allele compared with WT (Figure 4, A and B), suggesting RIC-8 functions as an ODR-3 chaperone in ASH.

FIGURE 4:

FIGURE 4:

Open in a new tab

RIC-8 regulates Gα ODR-3 levels and glycerol responses in ASH neurons. (A and B) Images (A) and quantifications (B) of ODR-3::split-Sc in WT and ric-8(md1909) ASH neurons. Arrowheads: TZ; arrows: autofluorescence in the pharynx. Scale: 5 µm. *** Different from WT at p < 0.001 (Mann-Whitney test). (C) Heatmaps of relative changes in fluorescence intensity (ΔF/F0) of GCaMP6 expressed in ASH of the indicated genotypes in response to 1M glycerol. Horizontal bar: glycerol stimulus. Each row in the heatmaps: responses from a single ASH neuron. n = 3 d with at least 12 animals/day. (D) Average changes in GCaMP6 fluorescence in ASH for data shown in (C). Shaded regions along the curves: SEM. (E) Quantification of maximum fluorescence intensity change upon glycerol onset in the indicated genotypes. Each dot: the response from a single neuron. *** Different from WT at p < 0.001 (Welch's test).

Gα ODR-3 is a primary transducer of chemosensory signaling in ASH neurons, which mediate avoidance responses to nociceptive chemicals, including hyperosmotic solutions such as glycerol (Hilliard et al., 2005; Yoshida et al., 2012; Kato et al., 2014). To test if RIC-8 function is required for cilia-mediated neuronal responses, we examined stimulus-evoked intracellular calcium dynamics in ASH neurons expressing GCaMP6. ASH responses to 1M glycerol were significantly dampened in ric-8(md1909) mutants compared with WT (Figure 4, C–E). These responses are similar to those previously reported for odr-3 mutants (Yoshida et al., 2012; Kato et al., 2014). Thus, our data suggest that RIC-8 functions in ASH to modulate sensory responses, likely by controlling ODR-3/Gα levels. Notably, conditional knockout of murine Ric8b in olfactory neurons decreased Gα levels and altered olfactory behavior (Machado et al., 2017), akin to our findings in ASH. Although the impact of Ric8b deletion on olfactory cilia morphology has not been examined, these findings suggest that RIC-8 function in sensory biology may be evolutionarily conserved.

Human RIC8A and RIC8B regulate ciliogenesis in RPE-1 cells

Mammalian RIC-8 homologues (RIC8A and RIC8B) have distinct Gα clients. RIC8A functions as a GEF and chaperone toward Gαi/o, q, and 12/13, while RIC8B regulates Gαs/olf proteins (Tall et al., 2003; Von Dannecker et al., 2005; Nagai et al., 2010; Chan et al., 2011). To determine if RIC8A and/or RIC8B participate in ciliogenesis, we used small interfering RNAs (siRNAs) to knock down (KD) RIC8A or RIC8B in human RPE-1 cells that ciliate robustly upon serum starvation. Staining cells for ARL13B or acetylated tubulin showed reduced ciliation upon RIC8A and RIC8B KD compared with controls (Figure 5, A and B; Supplemental Figure S2, A and B). We confirmed RIC8A and RIC8B KD efficiency by qPCR (Figure 5C). Importantly, RIC8A-targeting siRNAs did not non-specifically KD RIC8B and vice versa (Supplemental Figure S2C), and ciliation defects in RIC8B KD cells were rescued by co-expression of RIC8B cDNA refractory to RNAi using lentivirus (Supplemental Figure S2D). Finally, cells treated with the second set of siRNAs (siRNAs #2) that target RIC8A and RIC8B coding sequences distinct from those targeted by the first siRNA set (siRNAs #1) resulted in comparable KD efficiency and ciliogenesis defects (Supplemental Figure S2, A, B, and E). Collectively, these data indicate that the observed ciliation defects are caused by the reduction of RIC8A and RIC8B function.

FIGURE 5:

FIGURE 5:

Open in a new tab

Human RIC8A and RIC8B regulate ciliogenesis in RPE-1 cells. (A) Fixed RPE-1 cells transfected with the indicated siRNAs and stained with the listed antibodies and DAPI. siCTRL: nontargeting siRNA. Scale: 20 µm. (B and C) Quantification of ciliation (B) and relative RIC8A and RIC8B mRNA levels (C) in RPE-1 cells transfected with the indicated siRNAs. Each data point: one KD experiment; biological replicates are shown in different shades of the corresponding color (B). Summary data in (C) represent three biological replicates per condition with three technical replicates each. ** and *** Different from siCTRL at p < 0.01 and 0.001, respectively (Fisher's exact test; B). * and ** Different between bracketed conditions at p < 0.05 and 0.01, respectively (Welch's t test; C).

In summary, our results define trafficking mechanisms that localize C. elegans RIC-8 to the InvC, describe a new function for RIC-8 in mediating ASH sensory responses, and demonstrate that human RIC-8 homologues contribute to ciliogenesis in RPE-1 cells, thus highlighting the functional versatility of this conserved protein in cilia biology.

MATERIALS AND METHODS

C. elegans genetics

C. elegans strains were cultured at 20°C on standard nematode growth medium (NGM) seeded with the OP50 strain of Escherichia coli. Standard genetic approaches were used to cross in transgenes into mutant backgrounds. All mutant genotypes were confirmed by PCR and/or Sanger sequencing (Azenta). Transgenic C. elegans were generated by standard microinjection of DNA and/or ribonucleoprotein complexes into the syncytium of the hermaphrodite gonad. The unc-122Δp::gfp or unc-122Δp::dsRed plasmids were used as co-injection markers at 30 and 40 ng/µl, respectively. The same transgenic array was examined in WT and corresponding mutant backgrounds that were directly compared in phenotypic assays.

CRISPR-Cas9-mediated genome editing

All reagents (crRNA, tracrRNA, single-stranded donor oligonucleotides, and Cas9 protein) were purchased from Integrated DNA Technologies (IDT). CRISPR-Cas9 genome editing to generate the split-wrmScarlet (wrmScarlet11) allele of ric-8 was carried out as described in (Dokshin et al., 2018). Briefly, the donor oligonucleotide (25 ng/µl), crRNA (56 ng/µl), tracrRNA (100 ng/µl), and Cas9 protein (250 ng/µl) were co-injected with unc-122Δp::dsred co-injection marker into the N2 (variety Bristol) WT strain. Transgenic F1 adults were genotyped by PCR and Sanger sequencing (Azenta); F2 individuals homozygous for the transgene were isolated from heterozygous F1 parents to establish transgenic lines. Transgenic strains were outcrossed twice before phenotypic analysis.

ric-8(nch016) crRNA: 5′ – TCAGAATCCGAATTCTCGGC – 3′ donor oligonucleotide: 5′ – GCCATGTGTTGGAGCTCCTGAAGAATGCTCCAGAACCAGCGCCGGCCGAAAACTCGGATTCTGATGAAGAAGGAGGAGGATCCTACACCGTCGTCGAGCAATACGAGAAGTCCGTCGCCCGTCACTGCACCGGAGGAATGGATGAGTTATACAAGTAATTATTTTTGATTTTTCCATTTTAACATTTTGAAAAAAATTCT – 3′

Molecular biology

Plasmids

The coding sequence corresponding to the RVIP motif of RIC-8 was deleted from the bbs-8p::ric-8WT::tagrfp plasmid (Campagna et al., 2023) by site-directed mutagenesis using the QuikChange Lightning kit (Agilent Technologies). The mutagenized construct was verified by full-plasmid sequencing (Plasmidsaurus).

The RIC8B rescue plasmid was generated by GenScript. The RIC8B cDNA sequence containing five silent mutations in the region targeted by siRIC8B siRNA#1 was synthesized and subcloned into a lentiviral vector (GLV3-CMV-(ORF/RIC8B)-PGK-Puro-P2A-EGFP) for packaging into lentivirus (GenScript).

qPCR

Total RNA was extracted from RPE-1 cells transfected with siControl, siRIC8A (siRNA#1 and #2), or siRIC8B (siRNA#1 and #2) using the RNeasy kit (Qiagen) per manufacturer's instructions. RNA samples were reverse-transcribed using the ZymoScript One-Step RT-qPCR Kit (ZymoResearch), and expression levels of RIC8A and RIC8B were quantified by real-time PCR (Applied Biosystems QuantStudio 6 Pro) relative to RPL11 control using the 2-ΔΔCt method. Primer sequences are listed below:

  • RPL11: 5′ GTTGGGGAGAGTGGAGACAG 3′/5′ TGCCAAAGGATCTGACAGTG 3′

  • RIC8A: 5′ TGATCGCTACTGCTGGAGA 3′/5′ TCCAGGGTGAGGAGAACAT 3′

  • RIC8B: 5′ TAGACAGTTGGAAGGTGCATAAA 3′/5′ GTCTTCAGTTGGACCTACGATTAG 3′

Calcium imaging

Young adult worms were transferred to M9 buffer supplemented with poloxamer (1µL/50mL). A single worm was loaded into a microtube using a 3-ml syringe and connected to the olfactory microfluidic chip (Chronis et al., 2007). The inlet channels of the chip were supplied with S-basal buffer and 1M glycerol in S-basal buffer, each connected to computer-controlled rotary valves (Advanced Microfluidics). Recordings were acquired at 10 frames s−1, synchronized with the valve switching program. The flow sequence consisted of 30 s of S-basal buffer, followed by 30 s of 1M glycerol, and then 30 s of S-basal buffer for recovery. To correct for photobleaching, an exponential decay was fit to fluorescence intensity values for the first 30 s and the last 20 s of imaging (pre and post-stimulus). The resulting curve was subtracted from the original intensity values. Amplitude was calculated as the maximum change in fluorescence (F–F0) in the 10 s following glycerol addition; F0 was set to the average ΔF/F0 value for 5 s before glycerol onset. Figure panels summarizing calcium imaging data were generated using RStudio.

RPE-1 cell culture and transfection

Human telomerase-immortalized retinal pigment epithelial cells (hTERT RPE-1; Nechipurenko et al., 2016) were cultured in DMEM/F12 (1:1) supplemented with 10% fetal bovine serum and 1X antibiotic-antimycotic (Life Technologies) at 37°C with 5% CO2 and tested monthly for mycoplasma using the mycoplasma PCR detection kit (ABM). One day before transfection, cells were plated in antibiotic-free media at 30,000 cells per well on 12-mm glass pre-treated coverslips (Neuvitro) in a 24-well plate (for immunofluorescence analysis) or at 60,000 cells per well without coverslips in a 12-well plate (for qPCR analysis). Synthetic small interfering RNA oligonucleotides (siRNAs) targeting RIC8A or RIC8B or non-targeting control siRNA were transfected as previously described (Nechipurenko et al., 2016). For the rescue experiment, RPE-1 cells (untransduced and transduced with RIC8B-overexpressing lentivirus) were cultured, plated, and transfected with siRIC8B siRNA#1 as described above. The target sequences for siRNAs used in this study are shown below:

  • siRIC8A siRNA#1 (J-016121-09-0002, Dharmacon): GGGGAGAUGCUGCGGAACA

  • siRIC8A siRNA#2 (J-016121-11-0002, Dharmacon): CAGGAUGCCAUGUGCGAGA

  • siRIC8B siRNA#1 (J-021081-09-0002, Dharmacon): UCUCAUCAGUUCCGUGUAA

  • siRIC8B siRNA#2 (J-021081-12-0002, Dharmacon): ACAGUUGGAAGGUGCAUAA

  • siControl (D-001810-01-05, Dharmacon): UGGUUUACAUGUCGACUAA

Lentiviral transduction of RPE-1 cells

RPE-1 cells were seeded at 30,000 cells per well in a 24-well plate and transduced with RIC8B-overexpressing lentivirus at a final concentration of 1.8 × 106 units/ml (equivalent to an MOI of 30) for 24 h in antibiotic-free media containing 8 µg/ml polybrene (GenScript). At 24 h following transduction, successfully transduced cells were selected with 20 µg/ml puromycin (InvivoGen) for at least 72 h, or until all untransduced cells in the control well were dead. Expression of RIC8B from the lentiviral vector in the transduced cells was confirmed indirectly by the presence of EGFP co-expressed from the same vector as RIC8B on an inverted Mateo FL microscope (Leica). Following puromycin selection, RIC8B-overexpressing cells were expanded in 60-mm dishes in normal growth media before siRNA transfection and immunostaining experiments.

Immunostaining

RPE-1 cells were fixed in 4% paraformaldehyde for 12 min at room temperature (RT) or in ice-cold ethanol or methanol for 10 min at −20°C. Fixed cells were blocked in 5% bovine serum albumin (BSA) in phosphate-buffered saline with 0.2% Triton X-100 (PBS-T) for one hour at RT or at 4°C overnight and subsequently incubated in primary antibodies diluted in the blocking solution for 1.5 h at RT or at 4°C overnight. The following primary antibodies were used in this study: anti-ARL13B (1:10, catalogue/clone # N295B/66, Developmental Studies Hybridoma Bank), anti-γ-tubulin (1:500, catalogue # orb499656, clone # 8D11, biorbyt), anti-acetylated α-tubulin (1:500, catalogue # T7451, clone # 6-11B-1, MilliporeSigma). Alpaca anti-mouse Alexa 594 (catalogue # 615-584-214, Jackson ImmunoResearch Labs) secondary antibody was diluted in blocking solution and applied for 1.5 h at RT or at 4°C overnight. DAPI (1:1000, ThermoFisher) was used to stain DNA.

Microscopy

C. elegans

L1 larvae or one-day-old adult hermaphrodites were anesthetized in 10 mM tetramisole hydrochloride (MP Biomedicals) and mounted on 10% agarose pads on top of glass microscope slides. The animals were imaged on an upright THUNDER Imager 3D Tissue (Leica) using a 63X NA 1.4-0.60 oil immersion objective and K5 sCMOS camera (Leica) in Leica Application Suite X software. Images of RIC-8::split-Scarlet in Figure 1A and ODR-3::split-Scarlet in Figure 4A were acquired on an inverted Nikon Ti-E microscope with Yokogawa CSU-X1 spinning disk confocal head using 60X NA 1.40 oil immersion objective and ORCA-fusion BT camera (Hamamatsu) in MetaMorph 7 (Molecular Devices). Images for all phenotypic analyses were collected on at least two independent days, and identical acquisition settings were used for imaging all genotypes that were compared directly. In all figures, images are oriented with the anterior of the animal to the left.

RPE-1 cells

Coverslips with fixed and stained RPE-1 cells were mounted on microscope slides with ProLong Diamond anti-fade mountant (Invitrogen) and imaged on an inverted Nikon Ti-E microscope with a Yokogawa CSU-X1 spinning disk confocal head. Complete z-stacks were acquired at 0.25-µm intervals in MetaMorph 7 software (Molecular Devices) using a 60X NA 1.40 oil immersion objective and an ORCA-Fusion BT Digital CMOS camera (Hamamatsu).

Image analysis

Image analyses were carried out in Fiji/Image J (National Institute of Health) and are detailed below.

RIC-8::TagRFP fluorescence intensity. Fluorescence intensity was quantified by drawing a line from the cilia base to the distal tip of the ciliary RIC-8::TagRFP signal and measuring the mean intensity along the line. Similarly, a line was drawn across the PCMC, and the mean intensity along the line was recorded. The relative RIC-8::TagRFP fluorescence for each neuron was reported as the ratio of the mean ciliary intensity over the mean PCMC fluorescence intensity.

Line scans. A straight line was drawn from the cilia base to the distal boundary of RIC-8::TagRFP signal inside a cilium, and fluorescence intensities along the line were measured using the plot profile tool. TagRFP intensity at each point along the line was normalized to the maximum intensity value for that cilium and expressed as a percentage of the maximum intensity inside the cilium.

ODR-3::split-Scarlet fluorescence intensity. The z-slices that encompassed ASH cilia in their entirety were rendered into maximum-intensity projections. Fluorescence intensity of ODR-3::split-Scarlet inside a cilium was quantified by drawing a segmented line from the cilium base to tip and measuring the mean intensity along the line after subtracting the average background fluorescence.

Statistical analyses

Prism 10 software (GraphPad) was used to carry out statistical analyses and generate graphs. In scatter plots, horizontal and vertical bars represent mean ± SD, unless noted otherwise in figure legends. In bar graphs, the number of analyzed animals is listed inside the corresponding bars. The D'Agostino–Pearson test was used to determine whether the data were normally distributed. Statistical tests and p values are noted in the corresponding figure legends.

Supporting information

mbc-37-br26-s001.pdf (2.8MB, pdf)

ACKNOWLEDGMENTS

We are grateful to members of the Nechipurenko lab for critical comments on the manuscript and to Ryan Breitenbach and Thomas L. Morrione for technical assistance and maintenance of strains. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). This work was supported by the NIH (R15 HD109706 – I.N.; R35 GM155316 – I.N.) and Charles H. Hood Foundation (Child Health Research Award – I.N.).

Abbreviations used:

InvC
WT
TZ
IFT
PCMC
KD
RT
s

Footnotes

This article was published online ahead of print in MBoC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E25-12-0598) on Jun 17, 2026.

REFERENCES

  1. Ahmed NT, Gao C, Lucker BF, Cole DG, Mitchell DR (2008). ODA16 aids axonemal outer row dynein assembly through an interaction with the intraflagellar transport machinery. J Cell Biol 183, 313–322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Anvarian Z, Mykytyn K, Mukhopadhyay S, Pedersen LB, Christensen ST (2019). Cellular signalling by primary cilia in development, organ function and disease. Nat Rev Nephrol 15, 199–219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Barbelanne M, Lu Y, Kumar K, Zhang X, Li C, Park K, Warner A, Xu XZS, Shaham S, Leroux MR (2024). C. elegans PPEF-type phosphatase (Retinal degeneration C ortholog) functions in diverse classes of cilia to regulate nematode behaviors. Sci Rep 14, 28347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bennett HW, Gustavsson A-K, Bayas CA, Petrov PN, Mooney N, Moerner WE, Jackson PK (2020). Novel fibrillar structure in the inversin compartment of primary cilia revealed by 3D single-molecule super-resolution microscopy. Mol Biol Cell 31, 619–639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bhogaraju S, Cajanek L, Fort C, Blisnick T, Weber K, Taschner M, Mizuno N, Lamla S, Bastin P, Nigg EA, Lorentzen E (2013). Molecular basis of tubulin transport within the cilium by IFT74 and IFT81. Science 341, 1009–1012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Blacque OE, Li C, Inglis PN, Esmail MA, Ou G, Mah AK, Baillie DL, Scholey JM, Leroux MR (2006). The WD repeat-containing protein IFTA-1 is required for retrograde intraflagellar transport. Mol Biol Cell 17, 5053–5062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Brear AG, Yoon J, Wojtyniak M, Sengupta P (2014). Diverse cell type-specific mechanisms localize G protein-coupled receptors to Caenorhabditis elegans sensory cilia. Genetics 197, 667–684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Burghoorn J, Dekkers MP, Rademakers S, de Jong T, Willemsen R, Jansen G (2007). Mutation of the MAP kinase DYF-5 affects docking and undocking of kinesin-2 motors and reduces their speed in the cilia of Caenorhabditis elegans. Proc Natl Acad Sci USA 104, 7157–7162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Campagna CM, McMahon H, Nechipurenko I (2023). The G protein alpha chaperone and guanine-nucleotide exchange factor RIC-8 regulates cilia morphogenesis in Caenorhabditis elegans sensory neurons. PLoS Genet 19, e1011015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cevik S, Sanders AA, Van Wijk E, Boldt K, Clarke L, van Reeuwijk J, Hori Y, Horn N, Hetterschijt L, Wdowicz A, et al. (2013). Active transport and diffusion barriers restrict Joubert Syndrome-associated ARL13B/ARL-13 to an Inv-like ciliary membrane subdomain. PLoS Genet 9, e1003977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chan P, Gabay M, Wright FA, Tall GG (2011). Ric-8B is a GTP-dependent G protein as guanine nucleotide exchange factor. J Biol Chem 286, 19932–19942. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Chronis N, Zimmer M, Bargmann CI (2007). Microfluidics for in vivo imaging of neuronal and behavioral activity in Caenorhabditis elegans. Nat Methods 4, 727–731. [DOI] [PubMed] [Google Scholar]
  13. Dai J, Barbieri F, Mitchell DR, Lechtreck KF (2018). In vivo analysis of outer arm dynein transport reveals cargo-specific intraflagellar transport properties. Mol Biol Cell 29, 2553–2565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Derderian C, Canales GI, Reiter JF (2023). Seriously cilia: a tiny organelle illuminates evolution, disease, and intercellular communication. Dev Cell 58, 1333–1349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Deretic D, Williams AH, Ransom N, Morel V, Hargrave PA, Arendt A (2005). Rhodopsin C terminus, the site of mutations causing retinal disease, regulates trafficking by binding to ADP-ribosylation factor 4 (ARF4). Proc Natl Acad Sci USA 102, 3301–3306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Ditirro D, Philbrook A, Rubino K, Sengupta P (2019). The Caenorhabditis elegans Tubby homolog dynamically modulates olfactory cilia membrane morphogenesis and phospholipid composition. eLife 8, e48789. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Dokshin GA, Ghanta KS, Piscopo KM, Mello CC (2018). Robust genome editing with short single-stranded and long, partially single-stranded DNA donors in Caenorhabditis elegans. Genetics 210, 781–787. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Doroquez DB, Berciu C, Anderson JR, Sengupta P, Nicastro D (2014). A high-resolution morphological and ultrastructural map of anterior sensory cilia and glia in Caenorhabditis elegans. eLife 3, e01948. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Engel BD, Ishikawa H, Wemmer KA, Geimer S, Wakabayashi K, Hirono M, Craige B, Pazour GJ, Witman GB, Kamiya R, Marshall WF (2012). The role of retrograde intraflagellar transport in flagellar assembly, maintenance, and function. J Cell Biol 199, 151–167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Geng L, Okuhara D, Yu Z, Tian X, Cai Y, Shibazaki S, Somlo S (2006). Polycystin-2 traffics to cilia independently of polycystin-1 by using an N-terminal RVxP motif. J Cell Sci 119, 1383–1395. [DOI] [PubMed] [Google Scholar]
  21. Goudeau J, Sharp CS, Paw J, Savy L, Leonetti MD, York AG, Updike DL, Kenyon C, Ingaramo M (2021). Split-wrmScarlet and split-sfGFP: tools for faster, easier fluorescent labeling of endogenous proteins in Caenorhabditis elegans. Genetics 217, iyab014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Haycraft CJ, Banizs B, Aydin-Son Y, Zhang Q, Michaud EJ, Yoder BK (2005). Gli2 and Gli3 localize to cilia and require the intraflagellar transport protein polaris for processing and function. PLoS Genet 1, e53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Higginbotham H, Eom T-Y, Laura AB, Hirt J, Gukassyan V, Cusack CL, Lai C, Caspary T, Anton ES (2012). Arl13b in primary cilia regulates the migration and placement of interneurons in the developing cerebral cortex. Dev Cell 23, 925–938. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Hilliard MA, Apicella AJ, Kerr R, Suzuki H, Bazzicalupo P, Schafer WR (2005). In vivo imaging of C. elegans ASH neurons: cellular response and adaptation to chemical repellents. EMBO J 24, 63–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Hou Y, Witman GB (2017). The N-terminus of IFT46 mediates intraflagellar transport of outer arm dynein and its cargo-adaptor ODA16. Mol Biol Cell 28, 2420–2433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Hunter EL, Lechtreck K, Fu G, Hwang J, Lin H, Gokhale A, Alford LM, Lewis B, Yamamoto R, Kamiya R, et al. (2018). The IDA3 adapter, required for intraflagellar transport of I1 dynein, is regulated by ciliary length. Mol Biol Cell 29, 886–896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Inglis PN, Ou G, Leroux MR, Scholey JM (2007). The sensory cilia of Caenorhabditis elegans. WormBook:1–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Iomini C, Li L, Esparza JM, Dutcher SK (2009). Retrograde intraflagellar transport mutants identify complex A proteins with multiple genetic interactions in Chlamydomonas reinhardtii. Genetics 183, 885–896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Ishikawa H, Ide T, Yagi T, Jiang X, Hirono M, Sasaki H, Yanagisawa H, Wemmer KA, Stainier DY, Qin H, et al. (2014). TTC26/DYF13 is an intraflagellar transport protein required for transport of motility-related proteins into flagella. eLife 3, e01566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Jenkins PM, Hurd TW, Zhang L, McEwen DP, Brown RL, Margolis B, Verhey KJ, Martens JR (2006). Ciliary targeting of olfactory CNG channels requires the CNGB1b subunit and the kinesin-2 motor protein, KIF17. Curr Biol 16, 1211–1216. [DOI] [PubMed] [Google Scholar]
  31. Jensen VL, Li C, Bowie RV, Clarke L, Mohan S, Blacque OE, Leroux MR (2015). Formation of the transition zone by Mks5/Rpgrip1L establishes a ciliary zone of exclusion (CIZE) that compartmentalises ciliary signalling proteins and controls PIP2 ciliary abundance. EMBO J 34, 2537–2556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Jiang X, Shao W, Chai Y, Huang J, Mohamed MAA, Okten Z, Li W, Zhu Z, Ou G (2022). DYF-5/MAK-dependent phosphorylation promotes ciliary tubulin unloading. Proc Natl Acad Sci USA 119, e2207134119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Kato S, Xu Y, Cho CE, Abbott LF, Bargmann CI (2014). Temporal responses of C. elegans chemosensory neurons are preserved in behavioral dynamics. Neuron 81, 616–628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Lacey SE, Pigino G (2024). The intraflagellar transport cycle. Nat Rev Mol Cell Biol 26, 175–192 [DOI] [PubMed] [Google Scholar]
  35. Lewis WR, Bales KL, Revell DZ, Croyle MJ, Engle SE, Song CJ, Malarkey EB, Uytingco CR, Shan D, Antonellis PJ, et al. (2019). Mks6 mutations reveal tissue- and cell type-specific roles for the cilia transition zone. FASEB J 33, 1440–1455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Li C, Jensen VL, Park K, Kennedy J, Garcia-Gonzalo FR, Romani M, De Mori R, Bruel AL, Gaillard D, Doray B, et al. (2016). MKS5 and CEP290 dependent assembly pathway of the ciliary transition zone. PLoS Biol 14, e1002416. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Machado CF, Nagai MH, Lyra CS, Reis-Silva TM, Xavier AM, Glezer I, Felicio LF, Malnic B (2017). Conditional deletion of Ric-8b in olfactory sensory neurons leads to olfactory impairment. J Neurosci 37, 12202–12213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Mariani LE, Bijlsma MF, Ivanova AA, Suciu SK, Kahn RA, Caspary T (2016). Arl13b regulates Shh signaling from both inside and outside the cilium. Mol Biol Cell 27, 3780–3790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Maurya AK, Rogers T, Sengupta P (2019). A CCRK and a MAK kinase modulate cilia branching and length via regulation of axonemal microtubule dynamics in Caenorhabditis elegans. Curr Biol 29, 1286–1300.e1284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Mitra A, Loseva E, Peterman EJG (2024). IFT cargo and motors associate sequentially with IFT trains to enter cilia of C. elegans. Nat Commun 15, 3456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Mul W, Mitra A, Prevo B, Peterman EJG (2025). DYF-5 regulates intraflagellar transport by affecting train turnaround. Mol Biol Cell 36, ar53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Nagai Y, Nishimura A, Tago K, Mizuno N, Itoh H (2010). Ric-8B stabilizes the alpha subunit of stimulatory G protein by inhibiting its ubiquitination. J Biol Chem 285, 11114–11120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Nakajima Y, Kiyonari H, Mukumoto Y, Yokoyama T (2018). The Inv compartment of renal cilia is an intraciliary signal-activating center to phosphorylate ANKS6. Kidney Int 93, 1108–1117. [DOI] [PubMed] [Google Scholar]
  44. Nakamura K, Noguchi T, Takahara M, Omori Y, Furukawa T, Katoh Y, Nakayama K (2020). Anterograde trafficking of ciliary MAP kinase–like ICK/CILK1 by the intraflagellar transport machinery is required for intraciliary retrograde protein trafficking. J Biol Chem 295, 13363–13376. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Nechipurenko I, Sengupta P (2025). C. elegans: an elegant experimental system for the study of cilia biology. Semin Cell Dev Biol 174, 103636. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Nechipurenko IV, Olivier-Mason A, Kazatskaya A, Kennedy J, McLachlan IG, Heiman MG, Blacque OE, Sengupta P (2016). A conserved role for girdin in basal body positioning and ciliogenesis. Dev Cell 38, 493–506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Ou G, Blacque OE, Snow JJ, Leroux MR, Scholey JM (2005). Functional coordination of intraflagellar transport motors. Nature 436, 583–587. [DOI] [PubMed] [Google Scholar]
  48. Ou G, Koga M, Blacque OE, Murayama T, Ohshima Y, Schafer JC, Li C, Yoder BK, Leroux MR, Scholey JM (2007). Sensory ciliogenesis in Caenorhabditis elegans: assignment of IFT components into distinct modules based on transport and phenotypic profiles. Mol Biol Cell 18, 1554–1569. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Perkins LA, Hedgecock EM, Thomson JN, Culotti JG (1986). Mutant sensory cilia in the nematode Caenorhabditis elegans. Dev Biol 117, 456–487. [DOI] [PubMed] [Google Scholar]
  50. Piperno G, Siuda E, Henderson S, Segil M, Vaananen H, Sassaroli M (1998). Distinct mutants of retrograde intraflagellar transport (IFT) share similar morphological and molecular defects. J Cell Biol 143, 1591–1601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Prevo B, Mangeol P, Oswald F, Scholey JM, Peterman EJG (2015). Functional differentiation of cooperating kinesin-2 motors orchestrates cargo import and transport in C. elegans cilia. Nat Cell Biology 17, 1536–1545. [DOI] [PubMed] [Google Scholar]
  52. Qin J, Lin Y, Norman RX, Ko HW, Eggenschwiler JT (2011). Intraflagellar transport protein 122 antagonizes Sonic Hedgehog signaling and controls ciliary localization of pathway components. Proc Natl Acad Sci USA 108, 1456–1461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Rachel RA, Li T, Swaroop A (2012). Photoreceptor sensory cilia and ciliopathies: focus on CEP290, RPGR and their interacting proteins. Cilia 1, 22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Roayaie K, Crump JG, Sagasti A, Bargmann CI (1998). The Gα protein ODR-3 mediates olfactory and nociceptive function and controls cilium morphogenesis in C. elegans olfactory neurons. Neuron 20, 55–67. [DOI] [PubMed] [Google Scholar]
  55. Salama R, Peet E, Morrione L, Durant S, Seager M, Rennie M, Scarlata S, Nechipurenko I (2025). Functional classification of GNAI1 disorder variants in C. elegans uncovers conserved and cell-specific mechanisms of dysfunction. Genetics 231, iyaf216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Schouteden C, Serwas D, Palfy M, Dammermann A (2015). The ciliary transition zone functions in cell adhesion but is dispensable for axoneme assembly in C. elegans. J Cell Biol 210, 35–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Shiba D, Yamaoka Y, Hagiwara H, Takamatsu T, Hamada H, Yokoyama T (2009). Localization of Inv in a distinctive intraciliary compartment requires the C-terminal ninein-homolog-containing region. J Cell Sci 122, 44–54. [DOI] [PubMed] [Google Scholar]
  58. Snow JJ, Ou G, Gunnarson AL, Walker MR, Zhou HM, Brust-Mascher I, Scholey JM (2004). Two anterograde intraflagellar transport motors cooperate to build sensory cilia on C. elegans neurons. Nat Cell Biol 6, 1109–1113. [DOI] [PubMed] [Google Scholar]
  59. Tall GG, Krumins AM, Gilman AG (2003). Mammalian Ric-8A (Synembryn) is a heterotrimeric Gα protein guanine nucleotide exchange factor. J Biol Chem 278, 8356–8362. [DOI] [PubMed] [Google Scholar]
  60. Tam LW, Ranum PT, Lefebvre PA (2013). CDKL5 regulates flagellar length and localizes to the base of the flagella in Chlamydomonas. Mol Biol Cell 24, 588–600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Taschner M, Mourao A, Awasthi M, Basquin J, Lorentzen E (2017). Structural basis of outer dynein arm intraflagellar transport by the transport adaptor protein ODA16 and the intraflagellar transport protein IFT46. J Biol Chem 292, 7462–7473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. van der Burght SN, Rademakers S, Johnson JL, Li C, Kremers GJ, Houtsmuller AB, Leroux MR, Jansen G (2020). Ciliary tip signaling compartment is formed and maintained by intraflagellar transport. Curr Biol 30, 4299–4306 e4295. [DOI] [PubMed] [Google Scholar]
  63. Von Dannecker LEC, Mercadante AF, Malnic B (2005). Ric-8B, an olfactory putative GTP exchange factor, amplifies signal transduction through the olfactory-specific G-protein Gαolf. J Neurosci 25, 3793–3800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Warburton-Pitt SRF, Silva M, Nguyen KCQ, Hall DH, Barr MM (2014). The nphp-2 and arl-13 genetic modules interact to regulate ciliogenesis and ciliary microtubule patterning in C. elegans. PLoS Genet 10, e1004866. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Ward S, Thomson N, White JG, Brenner S (1975). Electron microscopical reconstruction of the anterior sensory anatomy of the nematode Caenorhabditis elegans. J Comp Neurol 160, 313–337. [DOI] [PubMed] [Google Scholar]
  66. Watanabe D, Saijoh Y, Nonaka S, Sasaki G, Ikawa Y, Yokoyama T, Hamada H (2003). The left-right determinant Inversin is a component of node monocilia and other 9+0 cilia. Development 130, 1725–1734. [DOI] [PubMed] [Google Scholar]
  67. Wen X, Lai CK, Evangelista M, Hongo JA, de Sauvage FJ, Scales SJ (2010). Kinetics of hedgehog-dependent full-length Gli3 accumulation in primary cilia and subsequent degradation. Mol Cell Biol 30, 1910–1922. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Wojtyniak M, Brear AG, O'Halloran DM, Sengupta P (2013). Cell- and subunit-specific mechanisms of CNG channel ciliary trafficking and localization in C. elegans. J Cell Sci 126, 4381–4395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Xiang W, Zur Lage P, Newton FG, Qiu G, Jarman AP (2022). The dynamics of protein localisation to restricted zones within Drosophila mechanosensory cilia. Sci Rep 12, 13338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Yi P, Xie C, Ou G (2018). The kinases male germ cell-associated kinase and cell cycle-related kinase regulate kinesin-2 motility in Caenorhabditis elegans neuronal cilia. Traffic 19, 522–535. [DOI] [PubMed] [Google Scholar]
  71. Yoshida K, Hirotsu T, Tagawa T, Oda S, Wakabayashi T, Iino Y, Ishihara T (2012). Odour concentration-dependent olfactory preference change in C. elegans. Nat Commun 3, 739. [DOI] [PubMed] [Google Scholar]
  72. Zhao Q, Li S, Shao S, Wang Z, Pan J (2020). FLS2 is a CDK-like kinase that directly binds IFT70 and is required for proper ciliary disassembly in Chlamydomonas. PLoS Genet 16, e1008561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Zuo X, Lobo G, Fulmer D, Guo L, Dang Y, Su Y, Ilatovskaya DV, Nihalani D, Rohrer B, Body SC, et al. (2019). The exocyst acting through the primary cilium is necessary for renal ciliogenesis, cystogenesis, and tubulogenesis. J Biol Chem 294, 6710–6718. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    mbc-37-br26-s001.pdf (2.8MB, pdf)
    mbc-37-br26-s001.pdf (2.8MB, pdf)

    Articles from Molecular Biology of the Cell are provided here courtesy of American Society for Cell Biology

    RESOURCES