Simple Summary
The Asian grasshopper (Oedaleus asiaticus) is a serious pest in dry and semi-dry grasslands of Inner Mongolia, China, where outbreaks destroy crops and pastures, harming farming, animal husbandry, and the environment. Current control depends mostly on chemical pesticides, but these cause insect resistance, pollution, and health risks. This study identified two genes, OaUAP1 and OaUAP2, that help produce chitin, the hard material forming the insect’s outer covering. The genes work in different body parts: OaUAP1 mainly in the epidermis and OaUAP2 in the fat body. Silencing either gene prevented proper molting, causing body shrinkage, cracked shells, and death. A natural molting hormone boosted their activity, while a substance that blocks chitin production reduced it. These results show that the genes have distinct but vital roles in insect growth and molting. The findings offer new knowledge for creating safe, targeted biological insecticides that avoid chemical harm, supporting sustainable pest control and the protection of grasslands and agriculture.
Keywords: 20-hydroxyecdysone, chitin biosynthesis, expression pattern, RNA interference, UDP-N-acetylglucosamine pyrophosphorylase, validamycin
Abstract
UDP-N-acetylglucosamine pyrophosphorylase (UAP) is an essential enzyme in the insect chitin biosynthesis pathway; however, little is known regarding its molecular functions in Oedaleus asiaticus Bey-Bienko (Orthoptera: Acrididae). Here, two UAP genes, OaUAP1 and OaUAP2, were identified and characterized in O. asiaticus. The effects of exogenous treatments, including the molting hormone 20-hydroxyecdysone (20E) and the chitin biosynthesis inhibitor validamycin (VA), were assessed on chitin synthesis. Sequence analyses have shown that the cDNA and deduced amino acid sequences of O. asiaticus share over 90% identity with UAPs in Locusta migratoria. OaUAP1 and OaUAP2 are widely expressed in many tissues and developmental stages but exhibit different expression patterns: OaUAP1 shows higher expression in the epidermis and fifth-instar nymphs, while OaUAP2 is primarily expressed in the fat body and in the fifth-instar nymphs and adults. The functional analysis of two OaUAPs revealed that OaUAP2 was crucial in molting; moreover, its implication also exists in other biosynthetic processes since nymphs maintained normal growth and development. Both OaUAP expressions were upregulated by 20E and downregulated by VA in the chitin biosynthesis pathway. Our findings provide a vital molecular insight into the chitin biosynthesis pathway of O. asiaticus and lay a solid foundation for developing environmentally safe biological insecticides.
1. Introduction
The second most abundant natural polymer in living organisms after cellulose, chitin is a cellulose-derived biopolymer and a linear homopolymer of N-acetylglucosamine (GlcNAc) linked by β-1,4 glycosidic bonds [1,2,3,4]. It is so widely distributed among diverse taxa including fungi, sponges, nematodes, mollusks, arthropods, fishes, amphibians, and some certain algae that it indicates an important general biological role [5,6,7,8]. The importance of chitin in insects includes the formation of exoskeletal structures such as those of the cuticle, linings of tracheae, and the peritrophic matrix of the midgut, whereas, physiologically, it supports important processes like growth, metamorphosis, and actual survival, serving thereby to maintain physical resilience for developmental success [2,9,10]. That might actually jeopardize the whole developmental and adult life of an insect, thus giving the chitin a place in the concept of pest management [11,12,13,14,15,16].
Chitin biosynthesis gives rise to a potent and pest-selective pest control methodology. Indeed, it is possible to cause impairment to the formation of exoskeleton structures and gut integrity in insects [5,6,13,14,15,17,18]. For example, insects fail to molt properly, or the peritrophic matrix in the midgut may weaken or thin, with all these leading to stunted growth or death, as demonstrated to occur in a few selective cases where the target was enzymes such as chitin synthase or UAP [9,19,20,21,22]. RNA interference-induced suppression of essential chitin metabolism enzymes has proven effective as a promising green method of insect growth and development control with little environmental toxicity for use either in the open or in any other recommended approach [23,24,25,26]. Insect growth, development, and molting depend on a delicate dynamic equilibrium between chitin synthesis and degradation, controlled by a coordinated activity of chitin-metabolizing enzymes [9,27,28,29]. From trehalose, chitin biosynthesis occurs via a chain of enzyme-catalyzed processes which include hexokinase, glucose-6-phosphate isomerase, glutamine-fructose-6-phosphate aminotransferase, glucosamine-6-phosphate N-acetyltransferase, phosphoglucosamine mutase, UDP-N-acetylglucosamine pyrophosphorylase (UAP), and chitin synthase, with UAP supplying the active precursor UDP-N-acetylglucosamine [30,31,32,33]. Although UAP is evolutionarily highly conserved, the structural divergence between prokaryotic and eukaryotic homologs shows a special functional adaptation of UAP in higher organisms [27,34,35]. UAP is essential for the epidermis and the peritrophic matrix (PM) of the larval midgut in insects. Disruption of UAP activity compromises chitin biosynthesis, thereby causing defective molting and reduced survival [9,19,22,36].
The rapid growth of genomic and transcriptomic resources in insects has allowed the identification and functional characterization of UAP orthologs in various taxa, thereby providing new avenues in the regulation of chitin metabolism [37,38,39].
Different species of insects show many variations in the number of UAP genes. Among the various species studied, UAP genes are identified only in Drosophila melanogaster Meigen, Aedes aegypti L., and Bombyx mori L. [14,35,40,41]. On the other hand, two separate UAP gene sequences have been identified in the species Tribolium castaneum Herbst, Locusta migratoria L., and Leptinotarsa decemlineata Say, suggesting the evolutionary diversification and possible functional specialization of UAPs among insects [5,15,42,43,44]. UAPs during insect development clearly play vital roles in mediating certain processes that are essential for the growth and morphogenesis of the organism. In D. melanogaster, mutations in DmUAP produce severe defects in cuticle formation, tracheal tube morphogenesis, and CNS fasciculation, underscoring the critical nature of this enzyme for overall developmental integrity [12,42,45]. In T. castaneum, the RNAi-induced silencing of both TcUAPl and TcUAP2 disrupts the sequence of all developmental transitions: larval–larval, larval–pupal, and pupal–adult eclosion, whereas the specific amendment of TcUAP2 declines the growth of larvae severely [46,47,48]. In L. decemlineata, LdUAP1 and LdUAP2 show spatially distinct functions associated with the roles in the cuticle layer synthesis and the deposition of midgut chitin, respectively [15,49]. Likewise, in L. migratoria, LmUAP1 is required for the biosynthesis of chitin, in both the epidermis and midgut, whereas LmUAP2 appears to be an unessential gene with respect to nymphal development, thus pointing out species-specific changes in the functionalities of genes within this family [42,50]. Locusts reproduce very quickly, are voracious in appetite, and can migrate over long distances; this is a combination that seriously jeopardizes agricultural and livestock production [42,51]. The adverse effects of locusts on direct damage to crops and pastures go far beyond such damage: they also have major ecological and socio-economic impacts, among which we find grassland degradation, desertification, and disruption of ecosystem services [52,53]. An annual invasion of up to 100,000 hectares by O. asiaticus in Inner Mongolia, which is prone to semi-arid types of grazing, can be very detrimental to agricultural production, animal husbandry, and local ecological balances [54,55,56,57]. Furthermore, O. asiaticus is also a bioindicator of grassland degradation and hence reflects the health of the ecosystem at the larger scale [54,58,59].
Despite ongoing efforts to diversify management strategies, control of O. asiaticus remains heavily reliant on chemical pesticides, with only limited integration of biological measures [60,61,62]. The long-term and extensive application of chemical pesticides has led to environmental residues, accelerated development of pest resistance, ultimately resulting in reduced control efficacy and threats to ecological safety [63,64,65,66]. Whereas chemical pesticides used for a long time have promoted resistance and environmental residues, genetic and molecular approaches to managing O. asiaticus remain largely unexplored, highlighting a critical gap in sustainable pest management strategies. Two UDP-N-acetylglucosamine pyrophosphorylase genes (OaUAP1 and OaUAP2) have been identified and characterized in the current study on O. asiaticus, thus giving molecular insights for sustainable locust control strategies.
2. Materials and Methods
2.1. Insect Rearing and Sample Collection
Oedaleus asiaticus eggs were collected from the wild grasslands of Siziwang Banner, Inner Mongolia, China (41°22′ N, 111°21′ E), and brought to Hohhot, where they were set up under controlled conditions for incubation. After hatching out, nymphs were fed with fresh wheat seedlings with added bran at 25 ± 1 °C, 40 ± 5% RH, and a photoperiod L/D 14:10 h. In order to keep the consistency of treatment across experiments, individual specimens were synchronized so that all individuals reached the same developmental stage and physiological age simultaneously. Samples were healthy, spreading over all developmental stages, including eggs, first- to fifth-instar nymphs, and adult males and females. For tissue specificity analysis, higher fourth-instar nymph organs were dissected and included fat body, Malpighian tubules, foregut, midgut, hindgut, salivary glands, trachea, and epidermis. All dissected tissues were snap-frozen in liquid nitrogen immediately and stored at −80 °C until the time of molecular analysis.
2.2. Transcriptome-Based Identification of UAP Genes
UAP genes in O. asiaticus were identified by exhaustively interrogating the published transcriptome database of the species. For this purpose, pooled mRNA samples from synchronized nymphal and adult stages were subjected to interrogation using specific keywords pertaining to UAP and UDP-N-acetylglucosamine pyrophosphorylase. By employing the Blastx algorithm for homology search, two distinct cDNAs, OaUAP1 and OaUAP2, were revealed corresponding to two divergent UDP-N-acetylglucosamine pyrophosphorylases. These findings provided a basis for downstream molecular cloning, expression profile studies, and functional characterization.
2.3. Molecular Cloning of UAP Genes
For the purpose of validating and obtaining full-length sequences of the predicted UAP genes, cDNA was synthesized from total RNA extracted from whole-body samples of fourth-instar nymphs using Eastep® Super Total RNA Extraction Kit (Promega, Madison, WI, USA) according to the manufacturer’s protocol. First-strand cDNA synthesis was conducted using GoScript® Reverse Transcription Mix (Promega, Madison, WI, USA) and Oligo(dT) kit (Promega). Gene-specific primers were designed with Premier 5.0 software (Table 1) and used in reverse transcription quantitative PCR (RT-qPCR) to amplify target cDNA sequences. The PCR products were then analyzed on 1% agarose gels, purified, and cloned into the pMD18-T vector for sequencing by Hooseen Biotechnology Co., Ltd. (Beijing, China). This study followed all standard procedures for molecular cloning to guarantee sequence accuracy.
Table 1.
Gene-specific primers used for cDNA cloning, RT-qPCR analysis, and dsRNA synthesis in Oedaleus asiaticus.
| Application | Gene Name | Primer Name | Primer Sequence (5′–3′) | Product Size (bp) |
|---|---|---|---|---|
| cDNA cloning | OaUAP1 | UAP1-F | TTCAGAATGCTGGACATCGG | 1455 |
| UAP1-R | AATTTAGCTTTGTTCACTAGGATGC | |||
| OaUAP2 | UAP2-F | ACCAATCACTATGCAGGATCTTA | 1482 | |
| UAP2-R | GAATGATTCATTTCAGCAATAATTA | |||
| RT-qPCR analysis | OaUAP1 | UAP1-qF | TGCTTGTGAACGAACAGGAG | 80 |
| UAP1-qR | CCTGAGTGGGGCACATAGTT | |||
| OaUAP2 | UAP2-qF | GAGTTGTTTGCCAGGTGGAT | 89 | |
| UAP2-qR | ACCATCAGCATTCCTCTGCT | |||
| β-actin | β-actin-F1 | CTACCACAGCCGAGCGAGAA | 353 | |
| β-actin-R1 | CCATCAGGCAGCTCGTAGGA | |||
| dsRNA synthesis | OaUAP1 | dsUAP1-F | taatacgactcactatagggCGGAGTATCGTATCCCAAAG | 545 |
| dsUAP1-R | taatacgactcactatagggTGCCATCCACCTGACAAA | |||
| OaUAP2 | dsUAP2-F | taatacgactcactatagggGAGTTGTTTGCCAGGTGGAT | 511 | |
| dsUAP2-R | taatacgactcactatagggTCGCCAGCATATGACAGAAG | |||
| GFP | dsGFP-F | taatacgactcactatagggAAGGGCGAGGAGCTGTTCACCG | 657 | |
| dsGFP-R | taatacgactcactatagggCAGCAGGACCATGTGATCGCGC |
cDNA, complementary DNA; dsRNA, double-stranded RNA; RT-qPCR, reverse transcription quantitative polymerase chain reaction; β-actin: internal reference gene; GFP, green fluorescent protein.
2.4. Bioinformatics and Phylogenetic Analysis
Both cDNA sequences of OaUAP1 and OaUAP2 were translated into amino acid sequences using the ExPASy server (http://cn.expasy.org, accessed on 16 September 2025). Key physicochemical properties such as molecular weight, theoretical isoelectric point, and open reading frames were computed via NCBI’s Blastp tool (http://www.ncbi.nlm.nih.gov, accessed on 17 September 2025). Amino acid sequences were compared with homologous UAPs from other insect species for sequence conservation. Pairwise alignments were created between the deduced amino acid sequences of OaUAP1 and OaUAP2 and their corresponding homologs LmUAP1 and LmUAP2 from L. migratoria using DNAMAN 6.0 (Lynnon Biosoft, San Ramon, CA, USA) to evaluate sequence homology [42]. Out of these 21 representative protein sequences retrieved from the NCBI database, they were later used to elicit evolutionary relationships among the insect UAPs. Their phylogenetic reconstruction employed the neighbor-joining (NJ) method with 1000 bootstrap replicates in MEGA 5, which gave really solid support for the obtained inferred evolutionary linkages [67,68]. Therefore, this phylogeny can provide a basis through which the divergence and conservation of OaUAP sequences with respect to other insect UAPs can be interpreted.
2.5. Expression Profiling of UAP Genes
OaUAP1 and OaUAP2 gene expressions were studied across developmental stages and in sampled tissues within fourth-instar nymphs such as the fat body, Malpighian tubules, foregut, midgut, hindgut, salivary glands, trachea, and epidermis. Quantitative PCR (qRT-PCR) was performed using GoTaq® qPCR Master Mix (Promega, Madison, WI, USA) in a 20 μL reaction volume, consisting of 1 μL template cDNA, 0.4 μL for each primer, 0.2 μL ROX reference dye, 10 μL 2× Master Mix, and nuclease-free water. The thermal cycling was started by an initial denaturation of 2 min at 95 °C followed by 40 cycles of 3 s at 95 °C and 30 s at 60 °C. Dissociation curve analysis was performed to further confirm the specificity of the amplification. Relative transcript abundance was normalized to that of β-actin, serving as an internal reference. Data were analyzed statistically by one-way nested ANOVA followed by Duncan’s multiple range test (IBM SPSS Statistics v25.0) to determine significant differences among developmental stages and tissues.
2.6. Functional Analysis of UAP Genes
Functional studies of OaUAP1 and OaUAP2 were performed through RNA interference (RNAi). A double-stranded RNA (dsRNA) specific for each gene was injected into the fourth-instar nymphs by microinjection 3 days post-molt (5 μL per individual, containing 5 μg dsRNA at a concentration of 1 μg/μL). Each treatment was independently replicated three times (20 nymphs per group). The locusts were then sampled after injection at 12, 24, 48, and 72 h post-treatment for evaluating the efficiency of gene silencing through RT-qPCR and checking the phenotypic effects under controlled rearing conditions. The RNAi was performed for knockdown of OaUAP1 and OaUAP2 to assess their individual contributions toward chitin synthesis and locust development.
2.7. Hormone and Inhibitor Treatments
In the regulatory effect studies on OaUAP expression, healthy fourth-instar nymphs were firstly injected with 20E or VA with different concentration programs at 3 days post-molting (20E from Sigma-Aldrich, St. Louis, MO, USA, dissolved in DMSO as solvent control: DMSO alone; VA from Huaxia Chemical Reagent, Chengdu, China, dissolved in ddH2O as solvent control: ddH2O alone). Gene expression was quantified at 12, 24, 48, and 72 h after 20E treatment and at 12, 24, and 48 h after VA treatment in nymphs subjected to RNAi-mediated gene knockdown. This allowed assessment of transcriptional regulation of OaUAP1 and OaUAP2 through both hormonal induction and chemical inhibition.
2.8. Statistical Analysis
All measurements were assessed by applying a one-way nested analysis of variance (ANOVA) followed by Tukey’s post hoc test (IBM SPSS Statistics v 25.0).
3. Results
3.1. Molecular Characterization and Phylogeny of UAP Genes
Annotational data identified two chitin biosynthesis pathway genes in O. asiaticus called OaUAP1 and OaUAP2, with nucleotide sizes of 2157 bp and 3646 bp, respectively (Figure 1). The open reading frames (ORFs) of OaUAP1 and OaUAP2 translate into proteins with lengths of 484 and 493 amino acids, respectively. Their calculated molecular weights were 55.08 kDa and 55.88 kDa, while the isoelectric points were 6.05 and 6.25. Functional domain analysis found that neither of the two proteins possess any signal peptides. The OaUPA1 amino acid sequence from O. asiaticus was very similar to that of the L. migratoria LmUAP1 homolog for the first two thirds of the sequence, in that they showed >90% identity with each other in those regions. However, OaUPA1 contained many more amino acids: 1127 for OaUPA1 compared to 699 for LmUAP1 (Figure 1). The OaUPA2 amino acid sequence had only slightly more amino acids than LmUAP2 and was >90% identical overall (Figure 1). Phylogenetic analysis of the full-length amino acid sequences of 21 insect species showed that OaUAP1 and OaUAP2 clustered closely with LmUAP1 and LmUAP2 but were found in different branches (Figure 2).
Figure 1.
Sequence identities between the UAP proteins of Oedaleus asiaticus (OaUAP1 and OaUAP2) and Locusta migratoria (LmUAP1 and LmUAP2). Numbers on the right are amino acid residue positions within each UAP protein. Residues with >90% similarity (gray); fully conserved residues (black). The stars (*) indicate positions where the amino acid residue is identical (fully conserved) across all four sequences (OaUAP1, OaUAP2, LmUAP1, LmUAP2). They appear both in the consensus line (below) and between sequence rows for better visibility, following standard alignment notation.
Figure 2.
Phylogenetic analysis of UAP proteins from Oedaleus asiaticus and other species. GenBank accession numbers: LmUAP1 (Locusta migratoria, JX484802.1), LmUAP2 (L. migratoria, JX484803.1), SaUAP (Schistocerca americana, XM_047128908.1), SpUAP (Schistocerca piceifrons, XM_047246339.1), SnUAP (Schistocerca nitens, XM_049949963.1), CsUAP (Cryptotermes secundus, XM_023863264.2), SsUAP (Schistocerca serialis, XP_049953534.1), GbUAP (Gryllus bimaculatus, GLG98533.1), BgUAP (Blattella germanica, PSN34428.1), MqUAP (Macrosteles quadrilineatus, XP_054271074.1), SfUAP (Sogatella furcifera, AQS60688.1), NlUAP-like (Nilaparvata lugens, XP_022189563.1), DmUAP (Drosophila melanogaster, AAN71363.1), DmUAPA (Drosophila melanogaster, NP_609032), DmUAPB (Drosophila melanogaster, NP_723183), AaUAP (Aedes aegypti, EAT47260), CqUAP (Culex quinquefasciatus, EDS38218), ApUAP (Acyrthosiphon pisum, XP_001944680), TcUAP1 (Tribolium castaneum, NP_001164533), TcUAP2 (NP_001164533), MmUAP (Mus musculus, BC017547), SeUAP (Spodoptera exigua, ACN29686), HsUAPA (Homo sapiens, NP_003106), HsUAPB (Q16222.3), ScUAP-like (Saccharomyces cerevisiae, NP_010180.1), ScUAP (Saccharomyces cerevisiae, NC_001134), CeUAP1 (Caenorhabditis elegans, NP_497777), and CeUAP2 (NP_500511.2). Clades highlighted in the blue and purple correspond to OaUAP1 and OaUAP2, respectively.
3.2. Expression Patterns of UAP Genes
The spatiotemporal expression analysis indicates clear differences between OaUAP1 and OaUAP2 with respect to time and tissue (Figure 3A,B and Figure 4A,B). The highest expression of OaUAP1 was found in the epidermis, whereas expression in the other tissues was considerably lower. Instead, OaUAP2 appeared to be highly expressed in the fat body. OaUAP1 peaked in the fifth-instar nymphs, whereas expression was low in all other stages. In comparison, OaUAP2 was more highly expressed in both the fifth-instar nymphs and adult stages.
Figure 3.
Expression of UDP-N-acetylglucosamine pyrophosphorylases (UAPs) genes across developmental stages of Oedaleus asiaticus. (A) OaUAP1 and (B) OaUAP2. EG, eggs; N1–N5, first- to fifth-instar nymphs; AF, adult female; AM, adult male. β-actin was used as the internal reference gene for normalization. Different letters above bars indicate significant differences in gene expression at p < 0.05 (Duncan’s multiple range test).
Figure 4.
Expression of UDP-N-acetylglucosamine pyrophosphorylases (UAPs) genes across different tissues of Oedaleus asiaticus. (A) OaUAP1 and (B) OaUAP2. FB, fat body; MT, Malpighian tubules; FG, foregut; MG, midgut; HG, hindgut; SG, salivary gland; TR, trachea; IN, integument. Relative expression was normalized to β-actin (internal reference gene). Different letters indicate significant differences in gene expression at p < 0.05 (Duncan’s multiple range test).
3.3. Functional Roles of UAP Genes
RNA interference (RNAi) was adopted for studying the functions of OaUAP1 and OaUAP2 in the development and growth of O. asiaticus. The dsRNAs specific to both genes were injected into fourth-instar nymphs three days post-molt. The expression levels of OaUAP1 and OaUAP2 were significantly reduced post-injection, with OaUAP1 showing 77.78% knockdown at 48 h and OaUAP2 showing 41.10% knockdown at 72 h (Figure 5A). Nymphal mortality reached about 100% after four days of dsRNA treatment (Figure 5B). Phenotypic observations showed that dsOaUAP1-injected nymphs revealed shrinkage all over the body and a lack of ecdysis particularly for the cuticle of the abdomen and hind legs and they could not move normally until death. In contrast, dsOaUAP2-injected nymphs showed partial normal development, with dorsal plate cracks, exudation of green fluid, and wing eversion. The proportion of representative lethal phenotypes at 48 h post-injection was 76% for dsOaUAP1 and 83% for dsOaUAP2 (Figure 5C). The green morph of O. asiaticus represents solitary individuals with weaker resistance, while the brown morph is gregarious with stronger resistance; in this experiment, the proportion of green individuals was 35%.
Figure 5.
Effect of OaUAP double-stranded RNA (dsRNA) on gene expression and development in Oedaleus asiaticus. (A) Silencing efficiency of OaUAP1 and OaUAP2 at 12, 24, 48, and 72 h post-injection. (B) Survival rates of nymphs following dsOaUAP injection. (C) Representative phenotypes of nymphs after dsOaUAP treatment. Different letters represent significance.
3.4. Regulation of UAP Gene Expression
The foreign hormones affect and control the developmental transition in the insects. The 20E injection resulted in very high up-regulation of chitin biosynthesis pathway genes. Compared with the ethanol control (10%), 20E increased the transcript level for OaUAP. At 2.5 μg/μL, OaUAP1 increased by 9 at 12 h and by 19.9 at 24 h (Figure 6A), whereas OaUAP2 expression rose by 10.4 at 24 h (Figure 6B). In contrast, VA treatment resulted in a dose-dependent decrease in OaUAP transcript levels, indicating that this compound exerts an inhibitory effect on chitin synthesis genes.VA inhibited OaUAP1 transcripts by almost 86.6% at 20 μg/μL within a period of 12 h (Figure 6C). Last, but not least, the highest inhibition for the same concentration occurs at 48 h with a reduction in transcript levels of about 81.7% for OaUAP2 (Figure 6D).
Figure 6.
Relative transcript levels of OaUAPs in Oedaleus asiaticus following treatment with 20-hydroxyecdysone (20E) and validamycin (VA). (A,B) OaUAP expression after 20E treatment; (C,D) OaUAP expression after VA treatment. Different letters indicate significant differences in gene expression at p < 0.05 (Duncan’s test).
4. Discussion
UAP genes are key regulators of chitin biosynthesis in insects in the formation of the exoskeleton, tracheal linings, and other chitin-containing structures while also being involved in protein glycosylation [40,45,69,70]. Historically, only one single UAP gene was reported in insect genomes [15,46,71] but increasing genomic and transcriptomic resources have revealed the presence of additional paralogs in species like T. castaneum [44,46], L. migratoria [42,72], and L. decemlineata [15,73], indicating species-specific duplications which may suggest functional specialization. The present study has successfully identified two UAP genes, namely OaUAP1 and OaUAP2, from the O. asiaticus transcriptome. The nucleotide lengths were found to be 2157 and 3646 bp, respectively (Figure 1). The ORFs produce 484 and 493 amino acids, and their molecular weights are 55.08 kDa and 55.88 kDa, respectively. The isoelectric points are 6.05 and 6.25, respectively (Figure 1). Phylogenetic analysis positioned OaUAP1 and OaUAP2 next to LmUAP1 and LmUAP2 in terms of relationships but on different branches, indicating both conserved enzymatic functions and possible divergence (Figure 2). Spatiotemporal expression profiling revealed that OaUAP1 is predominantly expressed in the epidermis, with the highest peaks occurring in fifth instars, whereas OaUAP2 is mainly expressed in the fat body, with increased levels in fifth instars and adults (Figure 3 and Figure 4). The differential expression strongly indicates functional divergence following gene duplication, thus allowing tissue- and stage-specific control of chitin biosynthesis and the associated metabolism [9,74]. These patterns are consistent with previous findings in L. migratoria, where LmUAP1 is enriched in epidermal tissues and LmUAP2 is preferentially expressed in the fat body [42,72], and in L. decemlineata, where LdUAP1 and LdUAP2 are specialized in the cuticle and peritrophic matrix, respectively [75].
RNA interference (RNAi)-based functional validation established the indispensable roles of OaUAP1 and OaUAP2 in molting and survival. The knockdown of either gene led to failed molting, which included incomplete ecdysis and lethal phenotypes (Figure 5), thus confirming their very vital role in chitin biosynthesis and exoskeleton formation. Essentially, OaUAP1-dsRNA-injected nymphs underwent shrinkage of the whole body, failure of cuticle shedding from the abdominal region, and locomotion, whereas OaUAP2-dsRNA-injected nymphs showed cracks in the dorsal plates, exudation of greenish fluid, and everted wings (Figure 5C). The high proportions of lethal phenotypes (76% for dsOaUAP1 and 83% for dsOaUAP2 at 48 h) underscore the critical dependency on these genes, with the green morph (35% in our experiment) showing potentially higher susceptibility due to its solitary and weaker resistance traits compared to the gregarious brown morph. The phenotypes are consistent with previous observations in L. migratoria and L. decemlineata [15,36,42,75], indicating UAP paralogs that, while differing in their expression patterns, function in a convergent manner for the maintenance of molting integrity [42,46]. However, notable differences were observed when compared to L. migratoria. In L. migratoria, the RNAi-mediated knockdown of LmUAP1 in the early seconds and fifth-instar nymphs led to a rapid cessation of feeding, loss of responsiveness to physical stimuli, and 100% mortality within approximately two days, whereas the knockdown of LmUAP2 had no significant effect on molting, development, or survival [42]. In contrast, in O. asiaticus, the silencing of both OaUAP1 and OaUAP2 resulted in severe molting defects and high mortality rates, although the phenotypes were distinct between the two genes (e.g., whole-body shrinkage and complete ecdysis failure for OaUAP1, versus partial development with dorsal cracks and wing eversion for OaUAP2). These contrasting outcomes highlight potential species-specific functional divergence in the roles of UAP paralogs within orthopteran chitin biosynthesis pathways.
Moreover, hormonal regulation elucidated the dynamic roles of OaUAPs. When exposed to 20E, OaUAP1 and OaUAP2 were significantly upregulated (Figure 6A,B) as expected, in agreement with the conserved role of ecdysteroids in molting and remodeling cuticles. On the contrary, VA considerably suppressed OaUAP expression in terms of doses as well as time (Figure 6C,D), thereby linking energy metabolism to chitin biosynthesis. These results were identified in Spodoptera exigua (Hübner) and Nilaparvata lugens (Stål) as well as soybean aphid and Panonychus citri (McGregor) [76,77,78]; however, recent work [46,79] adds to the evidence of the hormonal modulation of UAP expression across insect taxa. In developmental profiling, OaUAP1 expression was detected early in nymphal development at stages N1 and N2, peaked in fifth-instar nymphs, and afterward decreased in adults (Figure 3A and Figure 4A), suggesting a key role in the final deposition of the nymphal cuticle [15,36].
The short molting cycles for very early instars may explain the low expression levels seen during this period, illustrating an adaptive form of chitin metabolism regulation according to developmental demands [80,81].
5. Conclusions
OaUAP1 and OaUAP2 are identified as important molecules involved in chitin biosynthesis, molting, and hormonal regulation in O. asiaticus. By phylogenetics, spatiotemporal expression, RNAi functional assays, and hormonal treatments, this study forms a comprehensive framework for UAP function in orthopteran insects. These findings do not just add to basic knowledge but also provide a basis for RNAi-based pest management targeting UAP genes towards the environmentally sustainable control of grasshopper populations.
Acknowledgments
The authors gratefully acknowledge the generous financial support and provision of facilities provided by the Key Laboratory of Biohazard Monitoring, Green Prevention and Control for Artificial Grassland, the Ministry of Agriculture and Rural Affairs, the Institute of Grassland Research of Chinese Academy of Agricultural Sciences (Hohhot, Inner Mongolia, China), and the Ordos Ecological Environment Vocational College (Ordos, Inner Mongolia, China). This study would not have been possible without their unwavering support.
Author Contributions
Conceptualization, H.-Y.G. and S.-J.G.; methodology, S.-J.G. and Y.Z.; software, H.-Y.G. and M.L.; validation, Y.Z. and F.Y.; formal analysis, H.-Y.G. and F.Y.; investigation, J.Z., H.-Y.G. and Y.Z.; resources, S.-J.G.; writing—original draft preparation, H.-Y.G., S.-J.G. and J.Z.; writing—review and editing, S.-J.G., Y.Z. and E.R.; supervision, S.-J.G. All authors have read and agreed to the published version of the manuscript.
Data Availability Statement
The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.
Conflicts of Interest
The authors declare no conflicts of interest.
Funding Statement
This research was funded by the Natural Science Foundation of Inner Mongolia (2025MS03076) and the Ordos Key Research and Development Science and Technology Project (YF20240068).
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
References
- 1.Merzendorfer H., Zimoch L. Chitin metabolism in insects: Structure, function and regulation of chitin synthases and chitinases. J. Exp. Biol. 2003;206:4393–4412. doi: 10.1242/jeb.00709. [DOI] [PubMed] [Google Scholar]
- 2.Merzendorfer H. Insect chitin synthases: A review. J. Comp. Physiol. B. 2006;176:1–15. doi: 10.1007/s00360-005-0005-3. [DOI] [PubMed] [Google Scholar]
- 3.Kaisler M., van den Broek L.A., Boeriu C.G. Chitin and Chitosan as Sources of Bio-Based Building Blocks and Chemicals. In: Crini G., Lichtfouse E., editors. Chitin and Chitosan: Properties and Applications. Wiley; Hoboken, NJ, USA: 2019. pp. 229–244. [DOI] [Google Scholar]
- 4.Iber B.T., Kasan N.A., Torsabo D., Omuwa J.W. A review of various sources of chitin and chitosan in nature. J. Renew. Mater. 2022;10:1097. doi: 10.32604/jrm.2022.018142. [DOI] [Google Scholar]
- 5.Arakane Y., Dixit R., Begum K., Park Y., Specht C.A., Merzendorfer H., Kramer K.J., Muthukrishnan S., Beeman R.W. Analysis of functions of the chitin deacetylase gene family in Tribolium castaneum. Insect Biochem. Mol. Biol. 2009;39:355–365. doi: 10.1016/j.ibmb.2009.02.002. [DOI] [PubMed] [Google Scholar]
- 6.Patel S., Goyal A. Chitin and chitinase: Role in pathogenicity, allergenicity and health. Int. J. Biol. Macromol. 2017;97:331–338. doi: 10.1016/j.ijbiomac.2017.01.042. [DOI] [PubMed] [Google Scholar]
- 7.Tang W.J., Fernandez J.G., Sohn J.J., Amemiya C.T. Chitin is endogenously produced in vertebrates. Curr. Biol. 2015;25:897–900. doi: 10.1016/j.cub.2015.01.058. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Singh R., Upadhyay S.K., Singh M., Sharma I., Sharma P., Kamboj P., Saini A., Voraha R., Sharma A.K., Upadhyay T.K., et al. Chitin, chitinases and chitin derivatives in biopharmaceutical, agricultural and environmental perspective. Biointerface Res. Appl. Chem. 2021;11:9985–10005. doi: 10.33263/BRIAC113.998510005. [DOI] [Google Scholar]
- 9.Zhu K.Y., Merzendorfer H., Zhang W., Zhang J., Muthukrishnan S. Biosynthesis, turnover, and functions of chitin in insects. Annu. Rev. Entomol. 2016;61:177–196. doi: 10.1146/annurev-ento-010715-023933. [DOI] [PubMed] [Google Scholar]
- 10.Hahn T., Tafi E., Paul A., Salvia R., Falabella P., Zibek S. Current state of chitin purification and chitosan production from insects. J. Chem. Technol. Biotechnol. 2020;95:2775–2795. doi: 10.1002/jctb.6533. [DOI] [Google Scholar]
- 11.Cohen E. Chitin synthesis and degradation as targets for pesticide action. Arch. Insect Biochem. Physiol. 1993;22:245–261. doi: 10.1002/arch.940220118. [DOI] [PubMed] [Google Scholar]
- 12.Araújo S.J., Aslam H., Tear G., Casanova J. Mummy/cystic encodes an enzyme required for chitin and glycan synthesis, involved in trachea, embryonic cuticle and CNS development analysis of its role in Drosophila tracheal morphogenesis. Dev. Biol. 2005;288:179–193. doi: 10.1016/j.ydbio.2005.09.031. [DOI] [PubMed] [Google Scholar]
- 13.Pesch Y.Y., Riedel D., Patil K.R., Loch G., Behr M. Chitinases and imaginal disc growth factors organize the extracellular matrix formation at barrier tissues in insects. Sci. Rep. 2016;6:18340. doi: 10.1038/srep18340. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Palaka B.K., Velmurugan Ilavarasi A., Sapam T.D., Kotapati K.V., Nallala V.S., Khan M.B., Ampasala D.R. Molecular cloning, gene expression analysis, and in silico characterization of UDP-N-acetylglucosamine pyrophosphorylase from Bombyx mori. Biotechnol. Appl. Biochem. 2019;66:880–899. doi: 10.1002/bab.1802. [DOI] [PubMed] [Google Scholar]
- 15.Shi J.F., Fu J., Mu L.L., Guo W.C., Li G.Q. Two Leptinotarsa uridine diphosphate N-acetylglucosamine pyrophosphorylases are specialized for chitin synthesis in larval epidermal cuticle and midgut peritrophic matrix. Insect Biochem. Mol. Biol. 2016;68:1–12. doi: 10.1016/j.ibmb.2015.11.005. [DOI] [PubMed] [Google Scholar]
- 16.Wang Y., Gao L., Moussian B. Drosophila, chitin and insect pest management. Curr. Pharm. Des. 2020;26:3546–3553. doi: 10.2174/1381612826666200721002354. [DOI] [PubMed] [Google Scholar]
- 17.Kaur M., Nagpal M., Dhingra G.A., Rathee A. Exploring chitin: Novel pathways and structures as promising targets for biopesticides. Z. Naturforschung C. 2024;79:125–136. doi: 10.1515/znc-2024-0027. [DOI] [PubMed] [Google Scholar]
- 18.Khan A., Smagghe G., Li S., Shakeel M., Yang G., Ahmed N. Insect metamorphosis and chitin metabolism under miRNA regulation: A review with current advances. Pest Manag. Sci. 2025;81:3437–3451. doi: 10.1002/ps.8758. [DOI] [PubMed] [Google Scholar]
- 19.Merzendorfer H. The cellular basis of chitin synthesis in fungi and insects: Common principles and differences. Eur. J. Cell Biol. 2011;90:759–769. doi: 10.1016/j.ejcb.2011.04.014. [DOI] [PubMed] [Google Scholar]
- 20.Ali M.W., Khan M.M., Song F., Wu L., He L., Wang Z., Zhang Z.Y., Zhang H., Jiang Y. RNA interference-based silencing of the Chitin Synthase 1 gene for reproductive and developmental disruptions in Panonychus citri. Insects. 2020;11:786. doi: 10.3390/insects11110786. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Zhu Q., Li F., Shu Q., Feng P., Wang Y., Dai M., Mao T., Sun H., Wei J., Li B. Disruption of peritrophic matrix chitin metabolism and gut immune by chlorantraniliprole results in pathogenic bacterial infection in Bombyx mori. Pestic. Biochem. Physiol. 2023;193:105430. doi: 10.1016/j.pestbp.2023.105430. [DOI] [PubMed] [Google Scholar]
- 22.Lyu Z., Chen J., Lyu J., Guo P., Liu J., Liu J., Zhang W. Spraying double-stranded RNA targets UDP-N-acetylglucosamine pyrophosphorylase in the control of Nilaparvata lugens. Int. J. Biol. Macromol. 2024;271:132455. doi: 10.1016/j.ijbiomac.2024.132455. [DOI] [PubMed] [Google Scholar]
- 23.Liu X., Cooper A.M., Zhang J., Zhu K.Y. Biosynthesis, modifications and degradation of chitin in the formation and turnover of peritrophic matrix in insects. J. Insect Physiol. 2019;114:109–115. doi: 10.1016/j.jinsphys.2019.03.006. [DOI] [PubMed] [Google Scholar]
- 24.Rana S., Rajurkar A.B., Kumar K.K., Mohankumar S. Comparative analysis of Chitin SynthaseA dsRNA mediated RNA interference for management of crop pests of different families of Lepidoptera. Front. Plant Sci. 2020;11:427. doi: 10.3389/fpls.2020.00427. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Silver K., Cooper A.M., Zhu K.Y. Strategies for enhancing the efficiency of RNA interference in insects. Pest Manag. Sci. 2021;77:2645–2658. doi: 10.1002/ps.6277. [DOI] [PubMed] [Google Scholar]
- 26.Amiri A. Identifying effective genes as targets for RNA interference in sustainable pest control strategies. J. Epigenet. 2025;6:1–16. doi: 10.22111/jep.2025.50424.1075. [DOI] [Google Scholar]
- 27.Liu X., Zhang J., Zhu K.Y. Chitin in arthropods: Biosynthesis, modification, and metabolism. In: Yang Q., Fukamizo T., editors. Targeting Chitin-Containing Organisms. Springer; Singapore: 2019. pp. 169–207. [DOI] [PubMed] [Google Scholar]
- 28.Muthukrishnan S., Merzendorfer H., Arakane Y., Yang Q. Chitin organizing and modifying enzymes and proteins involved in remodeling of the insect cuticle. Adv. Exp. Med. Biol. 2019;1142:83–114. doi: 10.1007/978-981-13-7318-3_5. [DOI] [PubMed] [Google Scholar]
- 29.Zhang X., Yuan J., Li F., Xiang J. Chitin synthesis and degradation in crustaceans: A genomic view and application. Mar. Drugs. 2021;19:153. doi: 10.3390/md19030153. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Candy D.J., Kilby B.A. Studies on chitin synthesis in the desert locust. J. Exp. Biol. 1962;39:129–140. doi: 10.1242/jeb.39.1.129. [DOI] [Google Scholar]
- 31.Chen Q.W., Jin S., Zhang L., Shen Q.D., Wei P., Wei Z.M., Wang S.G., Tang B. Regulatory functions of trehalose-6-phosphate synthase in the chitin biosynthesis pathway in Tribolium castaneum (Coleoptera: Tenebrionidae) revealed by RNA interference. Bull. Entomol. Res. 2018;108:388–399. doi: 10.1017/S000748531700089X. [DOI] [PubMed] [Google Scholar]
- 32.Liu X.Y., Wang S.S., Zhong F., Zhou M., Jiang X.Y., Cheng Y.S., Dan Y.H., Hu G., Li C., Tang B., et al. Chitinase (CHI) of Spodoptera frugiperda affects molting development by regulating the metabolism of chitin and trehalose. Front. Physiol. 2022;13:1034926. doi: 10.3389/fphys.2022.1034926. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Liu Y., Li B., Chen T., Tian S., Zhang Z. The synthesis, degradation and biological function of trehalose-6-phosphate. Stress Biol. 2025;5:38. doi: 10.1007/s44154-025-00235-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Maruyama D., Nishitani Y., Nonaka T., Kita A., Fukami T.A., Mio T., Yamada-Okabe H., Yamada-Okabe T., Miki K. Crystal structure of uridine-diphospho-N-acetylglucosamine pyrophosphorylase from Candida albicans and catalytic reaction mechanism. J. Biol. Chem. 2007;282:17221–17230. doi: 10.1074/jbc.M611873200. [DOI] [PubMed] [Google Scholar]
- 35.Fang W., Du T., Raimi O.G., Hurtado-Guerrero R., Urbaniak M.D., Ibrahim A.F., Ferguson M.A., Jin C., Aalten D.M. Genetic and structural validation of Aspergillus fumigatus UDP-N-acetylglucosamine pyrophosphorylase as an antifungal target. Mol. Microbiol. 2013;89:479–493. doi: 10.1111/mmi.12290. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Jiang L.H., Mu L.L., Jin L., Anjum A.A., Li G.Q. Silencing uridine diphosphate N-acetylglucosamine pyrophosphorylase gene impairs larval development in Henosepilachna vigintioctopunctata. Pest Manag. Sci. 2022;78:3894–3902. doi: 10.1002/ps.6643. [DOI] [PubMed] [Google Scholar]
- 37.Yang W.J., Wu Y.B., Chen L., Xu K.K., Xie Y.F., Wang J.J. Two chitin biosynthesis pathway genes in Bactrocera dorsalis (Diptera: Tephritidae): Molecular characteristics, expression patterns, and roles in larval–pupal transition. J. Econ. Entomol. 2015;108:2433–2442. doi: 10.1093/jee/tov186. [DOI] [PubMed] [Google Scholar]
- 38.Miller S., Shippy T.D., Tamayo B., Hosmani P.S., Flores-Gonzalez M., Mueller L.A., Hunter W.B., Brown S.J., D’Elia T., Saha S. Annotation of chitin biosynthesis genes in Diaphorina citri, the Asian citrus psyllid. Gigabyte. 2021;2021:gigabyte23. doi: 10.46471/gigabyte.23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Li L., Wang Y.Q., Li G.Y., Song Q.S., Stanley D., Wei S.J., Zhu J.Y. Genomic and transcriptomic analyses of chitin metabolism enzymes in Tenebrio molitor. Arch. Insect Biochem. Physiol. 2022;111:e21950. doi: 10.1002/arch.21950. [DOI] [PubMed] [Google Scholar]
- 40.Schimmelpfeng K., Strunk M., Stork T., Klämbt C. Mummy encodes an UDP-N-acetylglucosamine-dipohosphorylase and is required during Drosophila dorsal closure and nervous system development. Mech. Dev. 2006;123:487–499. doi: 10.1016/j.mod.2006.03.004. [DOI] [PubMed] [Google Scholar]
- 41.Muhseen Z.T., Ahmad S., Li G. Structural basis of UDP-N-acetylglucosamine pyrophosphorylase and identification of promising terpenes to control Aedes aegypti. Colloids Surf. B Biointerfaces. 2021;204:111820. doi: 10.1016/j.colsurfb.2021.111820. [DOI] [PubMed] [Google Scholar]
- 42.Liu X., Li F., Li D., Ma E., Zhang W., Zhu K.Y., Zhang J. Molecular and functional analysis of UDP-N-acetylglucosamine pyrophosphorylases from the migratory locust, Locusta migratoria. PLoS ONE. 2013;8:e71970. doi: 10.1371/journal.pone.0071970. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Wang Y.W., Li Y.Z., Li G.Q., Wan P.J., Li C. Identification of cuticular protein genes in the Colorado potato beetle Leptinotarsa decemlineata (Coleoptera: Chrysomelidae) J. Econ. Entomol. 2019;112:912–923. doi: 10.1093/jee/toy396. [DOI] [PubMed] [Google Scholar]
- 44.Kim B.E., Choi B., Park W.R., Kim Y.J., Mun S., Choi H.S., Kim D.K. Nuclear receptor HR3 mediates transcriptional regulation of chitin metabolic genes during molting in Tribolium castaneum. Pest Manag. Sci. 2022;78:4377–4387. doi: 10.1002/ps.7056. [DOI] [PubMed] [Google Scholar]
- 45.Wang Z., Long G.Y., Zhou C., Jin D.C., Yang H., Yang W.J. Molecular characterization of UDP-N-acetylglucosamine pyrophosphorylase and its role in the growth and development of the white-backed planthopper Sogatella furcifera (Hemiptera: Delphacidae) Genes. 2022;13:1340. doi: 10.3390/genes13081340. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Arakane Y., Baguinon M.C., Jasrapuria S., Chaudhari S., Doyungan A., Kramer K.J., Muthukrishnan S., Beeman R.W. Both UDP-acetylglucosamine pyrophosphorylases of Tribolium castaneum are critical for molting, survival and fecundity. Insect Biochem. Mol. Biol. 2011;41:42–50. doi: 10.1016/j.ibmb.2010.09.011. [DOI] [PubMed] [Google Scholar]
- 47.Knorr E., Fishilevich E., Tenbusch L., Frey M.L., Rangasamy M., Billion A., Worden S.E., Gandra P., Arora K., Lo W., et al. Gene silencing in Tribolium castaneum as a tool for the targeted identification of candidate RNAi targets in crop pests. Sci. Rep. 2018;8:2061. doi: 10.1038/s41598-018-20416-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Liu D.D., Smagghe G., Halberg K.V., Cruz J., Franch-Marro X., Martín D. RNAi in the Red Flour Beetle (Tribolium castaneum): Current Status and Future Perspectives. In: Abd-Elsalam K.A., Lim K.T., editors. RNA Interference in Agriculture: Basic Science to Applications from Bioinformatics and Laboratory Assays over Regulatory Issues to Field Uses. Burleigh Dodds Science Publishing; Cambridge, UK: 2025. pp. 183–248. [Google Scholar]
- 49.Shi J.F., Cheng M.H., Zhou W., Zeng M.Z., Chen Y., Yang J.X., Wu H., Ye Q.H., Tang H., Zhang Q., et al. Crucial roles of specialized chitinases in elytral and hindwing cuticles construction in Leptinotarsa decemlineata. Pest Manag. Sci. 2024;80:4437–4449. doi: 10.1002/ps.8141. [DOI] [PubMed] [Google Scholar]
- 50.Liu W., Liu X., Zhao X., Zhu K.Y., Zhang J. RNAi in the Migratory Locust: Functional Studies of the Genes in the Formation and Development of Cuticle. In: Abd-Elsalam K.A., Lim K.T., editors. RNA Interference in Agriculture: Basic Science to Applications from Bioinformatics and Laboratory Assays over Regulatory Issues to Field Uses. Springer Nature; Cham, Switzerland: 2025. pp. 249–268. [Google Scholar]
- 51.Zhang T., Huo Y., Dong Q., Liu W., Gao L., Zhou J., Li D., Zhang X., Zhang J., Zhang M. LmCht5-1 and LmCht5-2 promote the degradation of serosal and pro-nymphal cuticles during locust embryonic development. Biology. 2022;11:1778. doi: 10.3390/biology11121778. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Belovsky G.E., Slade J.B. Grasshoppers affect grassland ecosystem functioning: Spatial and temporal variation. Basic Appl. Ecol. 2018;26:24–34. doi: 10.1016/j.baae.2017.09.003. [DOI] [Google Scholar]
- 53.Lucas J.M., Jonas J., Laws A.N., Branson D.H., Pennings S.C., Prather C.M., Strickland M.S. Functional and taxonomic diversity of grasshoppers differentially shape above-and below-ground communities and their function. Funct. Ecol. 2020;35:167–180. doi: 10.1111/1365-2435.13682. [DOI] [Google Scholar]
- 54.Zhang N., Zhang H.Y., He B., Xin Z.Y., Lin H. Spatiotemporal heterogeneity of the potential occurrence of Oedaleus asiaticus in Inner Mongolia steppe habitats. J. Arid Environ. 2015;116:33–43. doi: 10.1016/j.jaridenv.2015.01.019. [DOI] [Google Scholar]
- 55.Huang X., McNeill M., Zhang Z. Quantitative analysis of plant consumption and preference by Oedaleus asiaticus (Acrididae: Oedipodinae) in changed plant communities consisting of three grass species. Environ. Entomol. 2016;45:163–170. doi: 10.1093/ee/nvv172. [DOI] [PubMed] [Google Scholar]
- 56.Huang X.B., McNeill M.R., Ma J.C., Qin X.H., Tu X.B., Cao G.C., Wang G.J., Nong X.Q., Zhang Z.H. Biological and ecological evidences suggest Stipa krylovii (Pooideae), contributes to optimal growth performance and population distribution of the grasshopper Oedaleus asiaticus. Bull. Entomol. Res. 2017;107:401–409. doi: 10.1017/S000748531600105X. [DOI] [PubMed] [Google Scholar]
- 57.Du B., Shan Y., Huang W., Dong Y., Gao S., Yue Y., Guo J., Ga L., Zhang Y., Han H. Relationship of Oedaleus asiaticus densities with soil moisture and land surface temperature in Inner Mongolia, China. Agronomy. 2025;15:998. doi: 10.3390/agronomy15040998. [DOI] [Google Scholar]
- 58.Chen J., Tang B., Chen H., Yao Q., Huang X., Chen J., Zhang D., Zhang W. Different functions of the insect soluble and membrane-bound trehalase genes in chitin biosynthesis revealed by RNA interference. PLoS ONE. 2010;5:e10133. doi: 10.1371/journal.pone.0010133. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Malireddi P., Jarpla M., Patel Rajesh D., Bandhavi H.L., Desai H.R. Safeguarding insects as bio-indicators of environmental changes and pollution: A Review. Plant Arch. 2025;25:1018–1032. doi: 10.51470/PLANTARCHIVES.2025.v25.supplement-1.138. [DOI] [Google Scholar]
- 60.Dong W., Zhang X., Zhang X., Wu H., Zhang M., Ma E., Zhang J. Susceptibility and potential biochemical mechanism of Oedaleus asiaticus to beta-cypermethrin and deltamethrin in the Inner Mongolia, China. Pestic. Biochem. Physiol. 2016;132:47–52. doi: 10.1016/j.pestbp.2015.11.011. [DOI] [PubMed] [Google Scholar]
- 61.Cui B., Huang X., Li S., Hao K., Chang B.H., Tu X., Pang B., Zhang Z. Quercetin affects the growth and development of the grasshopper Oedaleus asiaticus (Orthoptera: Acrididae) J. Econ. Entomol. 2019;112:1175–1182. doi: 10.1093/jee/toz050. [DOI] [PubMed] [Google Scholar]
- 62.Gao S., Tan Y., Han H., Guo N., Gao H., Xu L., Lin K. Resistance to beta-cypermethrin, azadirachtin, and matrine, and biochemical characterization of field populations of Oedaleus asiaticus (Bey-Bienko) in Inner Mongolia, northern China. J. Insect Sci. 2022;22:1. doi: 10.1093/jisesa/ieac063. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Sparks T.C., Nauen R. IRAC: Mode of action classification and insecticide resistance management. Pestic. Biochem. Physiol. 2015;121:122–128. doi: 10.1016/j.pestbp.2014.11.014. [DOI] [PubMed] [Google Scholar]
- 64.Bass C., Denholm I., Williamson M.S., Nauen R. The global status of insect resistance to neonicotinoid insecticides. Pestic. Biochem. Physiol. 2015;121:78–87. doi: 10.1016/j.pestbp.2015.04.004. [DOI] [PubMed] [Google Scholar]
- 65.Zhou W., Li M., Achal V. A comprehensive review on environmental and human health impacts of chemical pesticide usage. Emerg. Contam. 2025;11:100410. doi: 10.1016/j.emcon.2024.100410. [DOI] [Google Scholar]
- 66.Pathak V.M., Verma V.K., Rawat B.S., Kaur B., Babu N., Sharma A., Dewali S., Yadav M., Kumari R., Singh S., et al. Current status of pesticide effects on environment, human health and it’s eco-friendly management as bioremediation: A comprehensive review. Front. Microbiol. 2022;13:962619. doi: 10.3389/fmicb.2022.962619. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Saitou N., Nei M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987;4:406–425. doi: 10.1093/oxfordjournals.molbev.a040454. [DOI] [PubMed] [Google Scholar]
- 68.Tamura K., Peterson D., Peterson N., Stecher G., Nei M., Kumar S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011;28:2731–2739. doi: 10.1093/molbev/msr121. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Das J., Kumar R., Shah V., Sharma A.K. Functional characterization of chitin synthesis pathway genes, HaAGM and HaUAP, reveal their crucial roles in ecdysis and survival of Helicoverpa armigera (Hübner) Pestic. Biochem. Physiol. 2022;188:105273. doi: 10.1016/j.pestbp.2022.105273. [DOI] [PubMed] [Google Scholar]
- 70.Yu A., Beck M., Merzendorfer H., Yang Q. Advances in understanding insect chitin biosynthesis. Insect Biochem. Mol. Biol. 2024;164:104058. doi: 10.1016/j.ibmb.2023.104058. [DOI] [PubMed] [Google Scholar]
- 71.Lu Q., Zhou Y., Ding Y., Cui Y., Li W., Liu T. Structure and inhibition of insect UDP-N-acetylglucosamine pyrophosphorylase: A key enzyme in the hexosamine biosynthesis pathway. J. Agric. Food Chem. 2024;72:19286–19294. doi: 10.1021/acs.jafc.4c03834. [DOI] [PubMed] [Google Scholar]
- 72.Liu X.J., Sun Y.W., Li D.Q., Li S., Ma E.B., Zhang J.Z. Identification of LmUAP1 as a 20-hydroxyecdysone response gene in the chitin biosynthesis pathway from the migratory locust, Locusta migratoria. Insect Sci. 2018;25:211–221. doi: 10.1111/1744-7917.12406. [DOI] [PubMed] [Google Scholar]
- 73.Chen Y., Tang H., Zhou W., Li C., Chen Y.N., Zhang Q., Fu K.Y., Guo W.C., Shi J.F. Identification of chitinase genes and roles in the larval–pupal transition of Leptinotarsa decemlineata. Pest Manag. Sci. 2024;80:282–295. doi: 10.1002/ps.7754. [DOI] [PubMed] [Google Scholar]
- 74.Tetreau G., Cao X., Chen Y.R., Muthukrishnan S., Jiang H., Blissard G.W., Kanost M.R., Wang P. Overview of chitin me-tabolism enzymes in Manduca sexta: Identification, domain organization, phylogenetic analysis and gene expression. Insect Biochem. Mol. Biol. 2015;62:114–126. doi: 10.1016/j.ibmb.2015.01.006. [DOI] [PubMed] [Google Scholar]
- 75.Zhou Y.J., Du J., Li S.W., Shakeel M., Li J.J., Meng X.G. Cloning, characterization, and RNA interference effect of the UDP-N-acetylglucosamine pyrophosphorylase gene in Cnaphalocrocis medinalis. Genes. 2021;12:464. doi: 10.3390/genes12040464. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Xia W.K., Shen X.M., Ding T.B., Niu J.Z., Zhong R., Liao C.Y., Feng Y.C., Dou W., Wang J.J. Functional analysis of a chitinase gene during the larval-nymph transition in Panonychus citri by RNA interference. Exp. Appl. Acarol. 2016;70:1–15. doi: 10.1007/s10493-016-0063-0. [DOI] [PubMed] [Google Scholar]
- 77.Tang B., Yang M., Shen Q., Xu Y., Wang H., Wang S. Suppressing the activity of trehalase with validamycin disrupts the trehalose and chitin biosynthesis pathways in the rice brown planthopper, Nilaparvata lugens. Pestic. Biochem. Physiol. 2017;137:81–90. doi: 10.1016/j.pestbp.2016.10.003. [DOI] [PubMed] [Google Scholar]
- 78.Zhang Z., Ma Y., Ma X., Hu H., Wang D., Song X., Ren X., Ma Y. Combined transcriptomic analysis and RNA interference reveal the effects of methoxyfenozide on ecdysone signaling pathway of Spodoptera exigua. Int. J. Mol. Sci. 2021;22:9080. doi: 10.3390/ijms22169080. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Koyama T., Saeed U., Rewitz K., Halberg K.V. The integrative physiology of hormone signaling: Insights from insect models. Physiology. 2025;40:343–362. doi: 10.1152/physiol.00030.2024. [DOI] [PubMed] [Google Scholar]
- 80.Vyas M., Fisher T.W., He R., Nelson W., Yin G., Cicero J.M., Willer M., Kim R., Kramer R., May G.A., et al. Asian citrus psyllid expression profiles suggest Candidatus Liberibacter asiaticus-mediated alteration of adult nutrition and metabolism, and of nymphal development and immunity. PLoS ONE. 2015;10:e0130328. doi: 10.1371/journal.pone.0130328. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.He R., Fisher T.W., Saha S., Peiz-Stelinski K., Willis M.A., Gang D.R., Brown J.K. Differential gene expression of Asian citrus psyllids infected with ‘Ca. Liberibacter asiaticus’ reveals hyper-susceptibility to invasion by instar fourth-fifth and teneral adult stages. Front. Plant Sci. 2023;14:1229620. doi: 10.3389/fpls.2023.1229620. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.






