Skip to main content
NCBI home page
BMC Infectious Diseases logoLink to BMC Infectious Diseases
. 2026 Feb 4;26:490. doi: 10.1186/s12879-026-12598-y

In vitro activity of eight antifungal drugs against clinical and hospital isolates of Candida parapsilosis complex; a multicenter study, 2023–2024

Azam Moslemi 1,2, Maryam Salimi 1,2, Mahdi Abastabar 2,3, Reza Valadan 4, Maryam Moazeni 2,3, Mohammad Taghi Hedayati 2,3, Seyed Reza Aghili 2,3, Leila Faeli 1,5, Zoha Asgari 6,7, Iman Haghani 2,3, Hossein Zarrinfar 8, Sabah Mayahi 3, Tahereh Shokohi 2,3,✉, Hamid Badali 9,✉
PMCID: PMC12958749  PMID: 41639638

Abstract

Background

Candida parapsilosis complex is an emerging opportunistic pathogen associated with bloodstream infections and healthcare‑associated outbreaks, particularly in intensive care units. Rising antifungal resistance underscores the need for continuous surveillance. This multicenter study assessed the in vitro susceptibility of eight antifungal agents against clinical, environmental, and healthcare worker isolates of the C. parapsilosis complex and investigated potential molecular mechanisms of resistance.

Methods

A total of 2,600 samples were collected between May 2023 and December 2024, including 2,180 clinical specimens, 330 environmental samples, and 90 hand swabs from healthcare workers. From these, 527 C. parapsilosis isolates were recovered. Identification was performed using conventional and molecular approaches. Antifungal susceptibility testing followed CLSI M27 (4th edition) guidelines. Isolates exhibiting resistance were further analyzed by sequencing the ERG11 and FKS1 genes.

Results

Among the 527 isolates, 510 originated from clinical settings, 6 from reusable breast pump sets, and 11 from healthcare worker hands. Overall, 10 isolates (1.9%) demonstrated resistance according to CLSI breakpoints, all of which were clinical in origin. Resistance was detected to fluconazole (0.38%), caspofungin (0.95%), and combined caspofungin–anidulafungin resistance (0.57%). The MIC values for fluconazole and caspofunginwere 4 µg/mL, indicating reduced susceptibility among clinical isolates. Voriconazole, clotrimazole, and amphotericin B exhibited strong in vitro activity. No resistance‑associatedmutations were identified in ERG11 or FKS1.

Conclusions

Despite the absence of detectable ERG11 or FKS1 mutations, reduced susceptibility to azoles and echinocandins was observed, primarily among clinical isolates. Environmental and healthcare worker isolates showed lower MIC values, suggesting minimal antifungal selection pressure outside patient care environments. These findings point to emerging antifungal resistance in C. parapsilosis clinical isolates in Iran and emphasize the importance of ongoing surveillance and molecular monitoring to inform therapeutic and infection control strategies. However more studies are required to correlate these findings with clinical outcomes.

Keywords: Candida parapsilosis, Antifungal resistance, ERG11, FKS1, Nosocomial infections

Introduction

In recent years, there has been a global increase in the frequency of severe fungal infections, accompanied by a significant shift in the epidemiological landscape. While Candida albicans was the predominant species causing fungal infections over the past century, non-albicans Candida (NAC) species are now becoming more common [1]. C. parapsilosis is a yeast commonly found on human skin and is considered a standard component of the skin’s microbiome [2]. However, it can also spread in healthcare settings, as it can be transmitted by healthcare workers’(HCWs) hands. Additionally, C. parapsilosis has a tendency to form biofilms on catheters and other medical devices, making it a particular concern for hospitalized patients, especially those who are immunocompromised [3]. Globally, C. parapsilosis accounts for approximately 16% of adult candidemia cases, making it the third most common Candida species causing invasive candidiasis [4]. It is particularly impactful on newborns in neonatal intensive care units, representing 33% of all invasive Candida infections and 80% of infections associated with NAC species in premature infants [2, 5]. Historically, C. parapsilosis has been considered susceptible to fluconazole, which is a standard antifungal treatment regimen for Candida infections [6]. The COVID-19 pandemic has significantly increased fluconazole resistance in C. parapsilosis [7]. The rise in resistance is likely due to several factors, including a surge in patient admissions and the widespread use of antifungal medications during the pandemic. While echinocandins are now the recommended first line treatment for invasive candidiasis, fluconazole remains a crucial part of antifungal therapy. Resistant strains of C. parapsilosis can thrive even when exposed to therapeutic levels of fluconazole, which contributes to treatment failures. Azole resistance in C. parapsilosis is most frequently linked to mutations in the ERG11 gene. This gene encodes lanosterol demethylase, an essential enzyme for maintaining fungal cell membrane integrity and a target of azole antifungals. Mutations in ERG11 that lead to changes in amino acid, particularly the Y132F substitution, can affect the ability of azoles to bind to and inhibit this enzyme, thereby resulting in resistance [4]. The challenges associated with C. parapsilosis infections are heightened by their elevated minimum inhibitory concentration (MIC) values for first line antifungal treatments, specifically echinocandins, when compared to C. albicans and C. glabrata. This highlights important differences among species [8]. Resistance to echinocandin in the C. parapsilosis complex is primarily linked to active mutations in the hotspot regions (HS1, HS2) of the FKS1 gene, which encodes the enzyme complex responsible for 1,3-β-D-glucan synthase. Mutations in these FKS1 hotspot regions have been associated with treatment failure in patients with candidemia, particularly in those who have previously been exposed to echinocandin antifungal therapy [9]. Key challenges presented by this fungal species include the urgent need for effective surveillance measures to prevent and control hospital outbreaks, thereby protecting vulnerable patient populations from direct transmission. Antifungal susceptibility testing is increasingly important for detecting the rising resistance to fluconazole in C. parapsilosis, which is growing at a faster rate than in other Candida species [10]. The lack of comprehensive data regarding the clinical outcomes, antifungal susceptibility patterns, and the underlying molecular mechanisms of antifungal resistance for C. parapsilosis isolates on a national level in Iran lead researchers to conduct this multicenter study, aiming to address these gaps in knowledge. Elucidating these factors will help improve the clinical management of C. parapsilosis infections and provide insights into the extent to which infection control strategies need to be implemented. In this observational study, we evaluated antifungal susceptibility of eight antifungal drugs, including fluconazole (FLZ), itraconazole (ITZ), voriconazole (VRZ), clotrimazole (CLO), miconazole (MZ), caspofungin (CAS), anidulafungin (AFG), and amphotericin B (AmB). This assessment was conducted on a large number of clinical, environmental, and healthcare worker derived C. parapsilosis isolates in Iran. Additionally, we performed molecular analysis on resistant isolates to investigate potential mutations in key resistance-associated genes, specifically ERG11 and FKS1, particularly focusing on their known hotspot regions. This approach aimed to identify the underlying genetic determinants of azole and echinocandin resistance within the C. parapsilosis complex.

Methods

Clinical,environmental, and healthcare workers’ hand sampling

This study received approval from the Ethics Committee of Mazandaran University of Medical Sciences, under the approval number IR.MAZUMS.REC.1402.365, dated September 13, 2023. All procedures were conducted according to the ethical guidelines and regulations.

A total of 2600 samples were collected, including 2180 clinical samples, 330 environmental samples, and 90 hand swabs from healthcare workers. 527 C. parapsilosis isolates were recovered between May 2023 and December 2024. These isolates were sourced from various contexts. including clinical, surrounding environmental, and the hand of healthcare workers’ (HCWs). Although isolates obtained from healthcare workers were analyzed and reported separately, they are considered part of the hospital environment for epidemiological purposes. Clinical samples were obtained from various centers in Iran through body swabs, including the axillae, groin, ears, mouth, rectum, wound, and tissue specimens from burn sites. Additionally, blood samples, scalp, nails, neonatal skin, bronchial aspirates, sputum, catheter sites, and diabetic foot ulcers were included in the study. Each clinical isolate represented a single patient, and duplicate isolates from the same individual were excluded. A total of 330 environmental and 90 hand samples from HCWs’ were collected from five educational hospitals affiliated with Mazandaran University of Medical Sciences. Environmental samples were taken from several areas of the hospital, including inpatient wards, intensive care units (ICUs), neonatal units, outpatient clinics, and patient rooms. All samples were collected using sterile swabs placed in sterile transport media from inanimate surfaces such as bed rails, cardiac monitors, ventilators, infusion pumps, dialysis devices, sinks, cabinets near patient beds, and doorknobs. The samples were transported immediately to the laboratory for microbiological analysis to identify potential pathogenic organisms and conduct susceptibility testing. In addition to clinical isolates collected from the five mentioned hospitals, samples were also obtained from other referral centers. Hand swabs were taken from 90 active nurses during their regular work shifts, without the implementation of specific handwashing protocols. The majority of samples were collected from intensive care units, outpatient clinics, and from nurses who provided post-discharge home based wound care for patients with diabetic foot or pressure ulcers.

Due to the routine submission of clinical isolates for antifungal testing by most participating hospitals, the number of environmental samples was relatively limited and primarily derived from centers with active infection control programs.

Isolates and identification

Samples were transported to the laboratory in sterile containers that contained swabs moistened with a small amount of sterile normal saline. They were subsequently inoculated onto Sabouraud dextrose agar (SDA, Condalab, Spain), which was supplemented with chloramphenicol, ciprofloxacin, and gentamycin. The cultures were incubated at 30 °C for 72 h in the dark. The culture media were checked daily to monitor for growth. For further species identification, positive cultures were sub cultured on a chromogenic medium called CHROMagar Candida (bioMérieux, Marcy l’Étoile, France), and cornmeal agar (CMA) supplemented with 1% Tween 80. This was done to assess the colony color and morphological characteristics, respectively. A distinctive cream colored colony with a mauve tinge on the chromogenic agar, along with the observation of blastoconidia along curved pseudohyphae, and giant mycelial cells in the CMA, were used to support preliminary species differentiation [11]. PCR restriction fragment length polymorphism (RFLP) analysis was performed using the MspI restriction enzyme for confirmation. Genomic DNA was extracted, and amplification of DNA was carried out using universal primers ITS1 and ITS4, as previously described [12]. In summary, 10 µl of PCR product was digested by 1.5 µl of digestion buffer, 5 units of MspI enzyme (Takapouzist, Iran), and distilled water to achieve a final volume of 15 µl, followed by incubation at 37 °C for 2 h. The resulting restriction fragments were visualized on a 2% agarose gel [13]. The restriction enzyme was fail to digest the product from the C. parapsilosis complex isolates, indicating the absence of its recognition site within the amplified region [14]. C. parapsilosis ATCC 22,019 was used as a reference strain for quality control during species identification. Additionally, the hyphal wall protein 1 (HWP1) gene was amplified to differentiate between members of the C. parapsilosis complex, including C. parapsilosis and C. orthopsilosis, as previously described. The HWP1 gene was amplified by PCR using species specific primers for C. parapsilosis (Forward: CGAGGTGAATATGATGCTTGTA; Reverse: CCAACAGAATTGCTTAATACCATA) and C. orthopsilosis (Forward: ACCACCACCTAGTTCTGAG; Reverse: TCACTTGGAAGATTGGAATAACA) [15].

Antifungal susceptibility testing

A total of 527 confirmed C. parapsilosis complex isolates were evaluated for antifungal susceptibility using the broth microdilution method, in accordance with the Clinical and Laboratory Standards Institute (CLSI) M27-4th edition guidelines [16]. All antifungal drugs were dissolved in dimethyl sulfoxide (DMSO; Sigma) and subsequently diluted in RPMI buffered with 0.165 M morpholinepropanesulfonic acid (MOPS) at pH 7.0, without bicarbonate. The final concentrations prepared were as follow: 0.016 to 16 µg/ml for amphotericin B (AmB; Bristol-Myers-Squib), itraconazole (ITZ; Janssen), voriconazole (VRZ), clotrimazole (CLO; Pfizer), and miconazole (MZ; Sigma-Aldrich), 0.063 to 64 µg/ml for fluconazole (FLZ; Sigma-Aldrich), and 0.008 to 16 µg/ml for anidulafungin (AFG; Merck Sharp & Dohme BV) and caspofungin (CAS; Merck Sharp & Dohme BV). Microdilution plates were incubated at 35 °C for 24 h in the dark. and minimum inhibitory concentration (MIC) values were determined visually, defined as the lowest concentration that resulted in 50% inhibition of growth compared to the controls for all antifungals, other than amphotericin B, where the MIC was determined at 100% growth inhibition.

Antifungal agents with established clinical breakpoints (CBP) for C. parapsilosis, such as fluconazole, voriconazole, and echinocandins, were classified as susceptible, intermediate, or resistant according to CLSI M60 (2020) guidelines [17]. For drugs that lack of established CBP, including amphotericin B, itraconazole, miconazole, and clotrimazole, isolates were categorized as wild type (WT) or non-wild type (non-WT) based on epidemiological cutoff values (ECV) reported in CLSI M59 (2020) [18]. The MIC values of each isolate were compared with the corresponding CBP or ECV to determine their susceptibility profile.C. parapsilosis ATCC 22,019 was included as quality control reference on each day of testing.

Design of specific primers and PCR amplification strategy for the FKS1 gene

Primers targeting the FKS1 gene in echinocandin-resistant isolates were designed using AlleleID software (Premier Biosoft, USA). These primers were based on sequences derived from conserved regions identified through the NCBI database analysis (GenBank accession no. EU221325.1). Before synthesis, the designed primers were evaluated for specificity, melting temperature, and potential secondary structures (Table 1). The primer design resulted in two specific sets for the FKS1: outer primers that produce a 2600 bp amplicon covering the entire gene, and nested inner primers that target the HS1 and HS2 regions for sequencing (Table 1; Fig. 1).

Table 1.

Provide a summary of the nucleotide sequences for the utilized primers

Oligonucleotide Target gene Purpose Sequence (5′ to 3′) Product Size (bp)
FKS1 Outer Forward FKS1 Amplification of the entire FKS1 gene TCTGTTGTTGGATTCTTCATTG 2670
FKS1 Outer Reverse FKS1 Amplification of the entire FKS1 gene CACCCATATAAATTGACGAGTC 2670
FKS1 Inner Forward FKS1 Sequencing the Hotspot 2 region TGAATGCCATGATGAGAGG 681
FKS1 Inner Reverse FKS1 Sequencing of the Hotspot 1 region TTCTGATGGAACTTGATGGT 654
ERG11 Forward ERG11 Amplification of the ERG11 gene and sequencing TTATTGGATTCCCTGGGTTG 650
ERG11 Reverse ERG11 Amplification of the ERG11 gene TCATCAATGTCACCCGTCTC 650
Open in a new tab

Fig. 1.

Fig. 1

Open in a new tab

Schematic map of the FKS1 gene open reading frame of C. parapsilosis. The sequences shown here were originated from the NCBI GenBank database (accession no.EU221325.1)

PCR amplification was performed in 20 µL reactions that contained: 10 µL Master Mix, 0.5 µL each of the outer forward/reverse primers, 2 µL DNA template (~ 50 ng), and 7 µL dH₂O. Thermal cycling conditions were as follows: 95 °C for 2 min (initial denaturation); 37 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 3 min ; followed by a final extension at 72 °C for 10 min. The success of the amplification was confirmed through agarose gel electrophoresis (Fig. 2).

Fig. 2.

Fig. 2

Open in a new tab

Gel electrophoresis used to verify the size and integrity of the PCR products (about 2600 bp) amplifying the FKS1 gene. Lane 1; isolate No 299, Lane 2; Negative control, Lane 3; isolate No188, M.L; Molecular ladder; 3Kb

Amplification of the ERG11 gene in fluconazole resistant isolates

Primers targeting the ERG11 gene in fluconazole-resistant isolates were designed using AlleleID software (Premier Biosoft, USA). The sequences were derived from conserved regions identified through analysis of the NCBI database, ensuring their effectiveness in detecting mutations associated with azole resistance. The reference ERG11 gene sequence (GenBank accession no. ON209433.1) was obtained from the NCBI database and confirmed through BLAST analysis to ensure specificity for C. parapsilosis (Table 1).

The amplification of the ERG11 gene was carried out in a 25 µL reaction volume, which included the following components:12.5 µL of master mix,1 µL of each forward and reverse primer (final concentration of 1 µM), 2 µL of DNA template (approximately 50 ng), and 8.5 µL of deionized water (dH₂O). The amplification conditions were as follows: an Initial denaturation at 94 °C for 5 min, followed by 35 cycles consisting of denaturation at 94 °C for 15 s, annealing at 56 °C for 30 s, extension at 72 °C for 30 s, and a final extension at 72 °C for 10 min. The PCR product was analyzed by electrophoresis on a 1.5% agarose gel stained with a DNA-safe dye. A single distinct band of approximately 650 base pairs was observed, corresponding to the expected size of the ERG11 gene fragment.

Sequencing and analysis

After electrophoresis, target DNA fragments were excised and purified using the Favorgen Gel Extraction Kit (Favorgen Biotech Corp., Taiwan) following the manufacturer’s protocol. All amplicons were sequenced using Sanger sequencing, and subsequent sequence analyses were performed using MEGA 11 software to identify potential mutations in the targeted regions.

Results

A total of 2,600 samples were collected during the study period from patients, healthcare workers’ hands, and environmental surfaces. From these, 527 isolates were identified at the species level using PCR amplification of the ITS region followed by RFLP analysis. This approach is a well‑established and reliable method for Candida species identification, enabling differentiation based on characteristic restriction fragment patterns. To further confirm the accuracy of species identification within the C. parapsilosis complex, amplification of the HWP1gene was also performed. This amplification produced PCR products of approximately 840 bp for C. parapsilosis and 900 bp for C. orthopsilosis. All studied yeast isolates showed an expected band and was in “psilosis” clade.

Out of 527 C. parapsilosis complex isolates, 510 Clinical samples were obtained from various body sites. Among the clinical samples, the majority were derived from burn wounds (165 isolates, 32.4%), followed by onychomycosis (84 isolates, 16.5%), neonatal skin (47 isolates, 9.2%), diabetic foot ulcers (30 isolates, 5.9%), axillary regions (26 isolates, 5.1%), groin (24 isolates, 4.7%), sputum (23 isolates, 4.5%), blood (22 isolates, 4.3%), vaginal swabs (16 isolates, 3.1%), ear secretions (15 isolates, 2.9%), and bronchoalveolar lavage (BAL) samples (15 isolates, 2.9%). Other sources included mouth swabs (9 isolates, 1.8%), toe/finger web spaces (8 isolates, 1.6%), eye secretions and tears (6 isolates, 1.2%), decubitus ulcers (5 isolates, 1.0%), neck samples (5 isolates, 1.0%), nasal swabs (4 isolates, 0.8%), urine (3 isolates, 0.6%), the sole of the foot (2 isolates, 0.4%), and the scalp (1 isolate, 0.2%).These samples were collected from multiple cities across Iran, such as Mashhad, Dezful, Sari, Rasht, Qaemshahr, and Tehran. Furthermore, 11 samples from HCWs were obtained through composite hand swabs from nurses working in intensive care units, outpatient clinics, and nursing home care units. Six environmental samples were collected from reusable breast pump sets used in a hospital setting. A summary of the isolation sources and sampling contexts is provided in Table 2.

Table 2.

Origin and distribution of C. parapsilosis complex isolates from clinical, environmental, and healthcare worker sources

Origin of the sample Sample Type Source of positive isolates: C. parapsilosis complex
(n = 527)		 % of Total Isolates Collection details

Clinical

n = 2180

Various Swabs (n = 428) includes samples from the following sites: axilla, groin, neck, scalp, vagina, ear, eye (tears/secretions), oral cavity, foot sole, interdigital spaces (hands/feet), and decubitus ulcer

Respiratory Samples (n = 208) includes: bronchoalveolar lavage (BAL) samples (70), sputum (48), Nasal swabs (90)

burn sites biopsies (n = 697)

nails (n = 380)

blood samples

(n = 92)

scalp (n = 35)

neonatal skin swab (n = 190)

diabetic foot ulcers (n = 150)

n  = 510

burn wounds (165 isolates, 32.4%), onychomycosis (84 isolates, 16.5%), neonatal skin (47 isolates, 9.2%), diabetic foot ulcers (30 isolates, 5.9%), axillary regions (26 isolates, 5.1%), groin (24 isolates, 4.7%), sputum (23 isolates, 4.5%), blood (22 isolates, 4.3%), vaginal swabs (16 isolates, 3.1%), ear secretions (15 isolates, 2.9%), bronchoalveolar lavage (BAL) samples (15 isolates,2.9%), mouth swabs (9 isolates, 1.8%), toe/finger web spaces (8 isolates, 1.6%), eye secretions and tears (6 isolates, 1.2%), decubitus ulcers (5 isolates, 1.0%), neck samples (5 isolates, 1.0%), nasal swabs (4 isolates, 0.8%), urine (3 isolates, 0.6%), the sole of the foot (2 isolates, 0.4%), scalp (1 isolate, 0.2%)

 96.8%

Collected from patients admitted

in hospitals across Iran

Environmental

n = 330

 Inanimate surfaces such as bed rails (78), cardiac monitors (60), ventilators (46), infusion pumps (28), dialysis devices (52), sinks (13), cabinets near patient beds (20), doorknobs (21), reusable breast pump sets​ (12)

n  = 6

reusable breast pump sets (100%)

 1.1%

Environmental samples

were collected from

hospitals affiliated with

Mazandaran University

of Medical Sciences.

Healthcare workers’ hands

n = 90

hand swabs from

nurses

n  = 11

6 were obtained from ICU/NICU staff, 4 from outpatient clinic nurses, and 1 from a home care nurse

 2.1%

Collected from healthcare

workers in hospitals affiliated

with Mazandaran University

of Medical Sciences

during regular work shifts, prior hand hygiene
Open in a new tab

Yeast colonization on hcws’ hands

A total of ninety samples were collected from the hands of 90 nurses. Among these, 52 nurses worked in intensive care units, 35 worked in outpatient clinics, and 3 were home care nurses. The sampling occurred during their normal work shifts, without any specific handwashing or preparatory measures. It was found that 75% (n = 68) of the nurses carried yeasts on their hands. This included 71% (n = 37) of the intensive care unit nurses, 80% (n = 28) of the outpatient clinic nurses, and all 3 (100%) of the home care nurses. Within the hand cultures tested, 29 out of 36 male nurses (83%) and 39 out of 54 female nurses (73%) were positive for yeast colonization. A total of 11 C. parapsilosis isolates were obtained from the collected samples (see Table 3). No isolates of Candida orthopsilosis or Candida metapsilosis were found. Among the isolates recovered from healthcare workers’ hands, C. parapsilosis complex was the second most frequently isolated species after the Candida albicans complex.

Table 3.

Prevalence of yeast colonization among healthcare workers based on unit and gender

Group Total Nurses (N) Nurses with Yeast Colonization (n) Percentage of Yeast Colonization Male Nurses Positive (n) Female Nurses Positive (n) C. parapsilosis Isolates
ICU, NICU* Nurses 52 37 71% 16 21 6
Outpatient Clinic Nurses 35 28 80% 10 18 4
HCNs ** 3 3 100% 3 0 1
Total (All Nurses) 90 68 75% 29 39 11
Open in a new tab

*NICU; Neonatal Intensive Care Unit. ** HCNs: Home care nurses

Antifungal susceptibility profile

Antifungal susceptibility testing was performed according to CLSI) M27-4th edition guidelines (Table 4). Among the 527 isolates, which included clinical, environmental, and HWC hand-derived samples, 10 isolates (1.897%) showed in vitro resistance based on CLSI breakpoints. Specifically, two isolates (0.38%) exhibited resistance to fluconazole, five isolates (0.95%) were resistant to caspofungin, and three isolates (0.57%) exhibited resistance to both caspofungin and anidulafungin.

Table 4.

In vitro antifungal susceptibility of eight antifungal agents against total C. parapsilosis complex isolates sourced from clinical settings, environmental samples, and healthcare workers in Iran

Sample type of C. parapsilosis Type of complex of C. parapsilosis Anti-fungal No. of isolates / MIC (µg/mL) (µg/mL)
64 32 16 8 4 2 1 0.5 0.25 0.125 0.063 0.032 0.016
MIC Range MIC 50 MIC 90 G mean
Clinical(n = 510) C. parapsilosis sensu stricto (n = 507) FLZ 0 0 2 0 150 86 88 65 59 41 16 0 0 0.063-16 1 4 1.02
VRZ 0 0 1 0 0 0 0 65 71 8 62 78 142 0.016-16 0.063 0.5 0.07
CLO 0 0 0 0 0 0 0 55 51 88 83 62 168 0.016-0.5 0.063 0.5 0.06
MZ 0 0 0 0 0 2 54 84 83 112 83 44 45 0.016–2 0.125 1 0.147
ITZ 0 0 0 1 0 0 0 107 102 125 72 69 33 0.016-8 0.125 0.5 0.127
CAS 0 0 8 0 59 53 49 60 50 38 64 75 51 0.016-16 0.25 4 0.252
AFG 0 0 1 2 18 40 41 31 40 35 89 94 114 0.016-16 0.063 2 0.106
AMB 0 0 0 0 0 0 39 108 149 130 65 8 8 0.016-1 0.25 0.5 0.209
C. orthopsilosis (n = 3) FLZ 0 0 0 0 0 0 0 1 0 2 0 0 0 0.125-0.5 0.125 0.5 0.25
VRZ 0 0 0 0 0 0 0 0 2 1 0 0 0 0.125–0.25 0.25 0.25 0.19
CLO 0 0 0 0 0 0 0 0 2 1 0 0 0 0.125–0.25 0.25 0.25 0.198
MZ 0 0 0 0 0 0 0 2 1 0 0 0 0 0.25–0.5 0.5 0.5 0.39
ITZ 0 0 0 0 0 0 0 2 0 0 1 0 0 0.063-0.5 0.5 0.5 0.25
CAS 0 0 0 0 0 0 0 0 2 0 0 1 0 0.032–0.25 0.25 0.25 0.126
AFG 0 0 0 0 0 0 0 0 0 2 1 0 0 0.063–0.125 0.125 0.125 0.1
AMB 0 0 0 0 0 0 0 0 1 1 1 0 0 0.063–0.25 0.125 0.25 0.126
Environmental (n = 6) C. parapsilosis sensu stricto (n = 6) FLZ 0 0 0 0 1 0 1 2 0 2 0 0 0 0.125-4 0.5 2.5 0.5
VRZ 0 0 0 0 0 0 0 0 0 0 3 0 3 0.016–0.063 0.039 0.063 0.031
CLO 0 0 0 0 0 0 0 1 0 0 1 0 4 0.016-0.5 0.016 0.28 0.035
MZ 0 0 0 0 0 0 0 1 1 2 0 0 2 0.016-0.5 0.125 0.375 0.089
ITZ 0 0 0 0 0 0 0 1 3 0 1 1 0 0.032-0.5 0.25 0.375 0.158
CAS 0 0 0 0 0 1 3 1 1 0 0 0 0 0.25-2 1 1.5 0.793
AFG 0 0 0 0 0 0 0 2 2 2 0 0 0 0.125-0.5 0.25 0.5 0.25
AMB 0 0 0 0 0 0 1 0 5 0 0 0 0 0.25-1 0.25 0.625 0.315
HWCs’hand (n = 11) C. parapsilosis sensu stricto (n = 11) FLZ 0 0 0 0 0 0 0 1 6 4 0 0 0 0.125-0.5 0.25 0.45 0.206
VRZ 0 0 0 0 0 0 0 0 3 1 1 1 5 0.016–0.25 0.032 0.25 0.049
CLO 0 0 0 0 0 0 0 1 1 0 2 1 6 0.016-0.5 0.016 0.45 0.038
MZ 0 0 0 0 0 0 3 6 1 0 0 1 0 0.032-1 0.5 1 0.441
ITZ 0 0 0 0 0 0 0 0 0 0 2 9 0 0.032–0.063 0.032 0.063 0.036
CAS 0 0 0 0 0 0 0 0 9 2 0 0 0 0.125–0.25 0.25 0.25 0.22
AFG 0 0 0 0 0 0 0 0 3 1 3 1 3 0.016–0.25 0.063 0.25 0.063
AMB 0 0 0 0 0 0 0 0 0 7 4 0 0 0.063–0.125 0.125 0.125 0.097
Total(n = 527) Total C. parapsilosis complex FlZ 0 0 2 0 151 86 89 69 65 49 16 0 0 0.063-16 1 4 0.983
VRZ 0 0 1 0 0 0 0 65 76 90 66 79 150 0.016-16 0.063 0.5 0.069
CLO 0 0 0 0 0 0 0 57 54 89 86 63 178 0.016-0.5 0.063 0.5 0.059
MZ 0 0 0 0 0 2 57 93 86 114 83 45 47 0.016-2 0.125 1 0.15
ITZ 0 0 0 1 0 0 0 108 105 125 76 79 33 0.016-8 0.125 0.5 0.125
CAS 0 0 8 0 59 54 52 61 62 40 64 76 51 0.016-16 0.25 4 0.255
AFG 0 0 1 2 18 40 41 33 45 42 93 95 117 0.016-16 0.063 2 0.106
AMB 0 0 0 0 0 0 40 108 155 138 70 8 8 0.016-1 0.25 0.5 0.206
Open in a new tab

FLZ, Fluconazole; VRZ, Voriconazole; ITZ, Itraconazole; AFG, Anidulafungin; and AMB, Amphotericin B. CAS, caspofungin; MZ, Miconazole; CLO, Clotrimazole; MIC, Minimum inhibitory concentration. GM, Geometric mean value; MIC50/90, MIC required to inhibit 50% and 90% of the isolates, respectively

Fluconazole showed a relatively wide MIC range of 0.063–16 µg/mL, with MIC50 and MIC90 values of 1 and 4 µg/mL, respectively. Although most isolates fell within the susceptible dose-dependent range, a small proportion, particularly among clinical isolates, showed elevated MIC indicative of reduced susceptibility. Voriconazole (VRZ) demonstrated strong activity, with an overall MIC range of 0.016–16 µg /mL. The MIC50 and MIC90 values of 0.063 and 0.5 µg/mL resulting in a geometric mean (Gmean) MIC of voriconazole was 0.069 µg /mL, indicating potent effectiveness, especially among non clinical isolates. Clotrimazole (CLO) also exhibited strong in vitro activity, with a MIC50 (0.063 µg /mL), a MIC90 (0.5 µg /mL), and a low Gmean MIC (0.059 µg /mL).

No resistant isolates were found in any of the groups tested. Miconazole (MZ) showed moderate activity, with a broader MIC range of 0.016–2 µg /mL. The MIC50 and MIC90 values were 0.125 µg /mL and 1 µg /mL, respectively, resulting in a Gmean MIC (0.15 µg /mL). This indicates a relatively higher MIC among clinical isolates compared to environmental and hand derived isolates from HWC. Itraconazole (ITZ) showed a narrow MIC range of 0.016–8 µg /mL, with MIC 50 and MIC 90 values of 0.125 and 0.5 µg /mL, respectively. The Gmean MIC was 0.125 µg /mL, reflecting consistent susceptibility across all 527 sources of isolates.

Among the echinocandins, caspofungin (CAS) showed reduced activity, with a wide MIC range of 0.016–16 µg /mL, and an elevated MIC 90 of 4 µg /mL, suggesting intrinsic reduced susceptibility in the C. parapsilosis complex. The Gmean MIC for caspofungin was 0.255 µg /mL. Anidulafungin (AFG) demonstrated potent activity with MIC50 and MIC90 values of 0.063 and 2 µg /mL, respectively, leading to a Gmean MIC of 0.106 µg /mL. While most isolates were susceptible, some clinical isolates showed higher MICs.Amphotericin B (AMB) showed consistent activity, with a MIC range of 0.016 to 1 µg /mL, MIC50 and MIC90 values of 0.25 and 0.5 µg /mL, respectively. The Gmean MIC was 0.206 µg /mL, with no evidence of resistance. Among the tested drugs, voriconazole, clotrimazole, and amphotericin B demonstrated potent activity against the majority of isolates, with overall low MIC90 values of 0.5 µg/mL. In contrast, caspofungin showed less in vitro activity.

Molecular analysis of the resistant isolates

Ten isolates (1.897%) exhibited in vitro resistance according to CLSI breakpoints. Specifically, two isolates (0.38%) were resistant to fluconazole, while eight isolates (1.52%) demonstrated resistance to echinocandins. Using newly designed outer and inner primers that target the FKS1 gene, the hotspot regions (HS1 and HS2) were successfully amplified and sequenced in the majority of C. parapsilosis complex isolates. This facilitated the accurate detection of potential resistance associated mutations. To investigate the molecular basis of antifungal resistance, the ERG11 and FKS1 genes in the resistant isolates were sequenced; however, no mutations were found in the sequenced regions of both genes. The obtained sequences have been deposited in the NCBI GenBank database with the accession numbers PV764592 to PV764597 and PQ721052.

Discussion

C. parapsilosis is one of the most clinically relevant non-albicans Candida (NAC) species, particularly in hospital setting. It is globally recognized as the second or third most frequently isolated Candida species in intensive care unit (ICU) [19]. In this study, we analyzed the antifungal susceptibility profiles and resistance associated genetic markers in 527 isolates of the C. parapsilosis complex. Similar to Candida auris, C. parapsilosis frequently demonstrates multidrug resistance and possesses a high potential for hospital transmission through direct patient contact [20].

In this study, clinical isolates showed higher MIC for fluconazole and echinocandins compared to isolate from environmental sources and healthcare workers’ hands. Similar to a previous study conducted in 2021, the researcher observed greater resistance to fluconazole in clinical isolates [21]. In our study, fluconazole-resistant strains of C. parapsilosis were exclusively found in clinical samples, particularly from sites of active infection, with no resistance detected on hands or in environmental sources. This pattern likely indicates increased antifungal pressure in clinical settings, as evidenced by elevated MIC90 values for fluconazole and caspofungin among clinical isolates. In contrast, all environmental isolate and those from healthcare workers remained fully susceptible to all tested antifungal agents, suggesting limited antifungal exposure and low selective pressure in non-clinical settings. Additionally, none of the C. parapsilosis complex isolates in our study showed resistance to amphotericin B, confirming the drug’s continued efficacy against this species in our setting.

This finding aligns with a review article [19] that assessed 28 studies, where six reported no resistance to amphotericin B, based on CLSI guidelines and/or E-test (gradient diffusion assay).

The study highlights that voriconazole (GM = 0.0689) and clotrimazole (GM = 0.059) exhibit strong activity against C. parapsilosis, suggesting that voriconazole is more effective than fluconazole for treating candida infections [22]. Our data indicate that clotrimazole (CLO) is highly effective across all C. parapsilosis isolates. Similarly, previous research in 2015 found that all isolates from onychomycosis patients were susceptible to CLO with a geometric mean of 0.35 µg/ml. Both studies highlight clotrimazole as a valuable treatment option for Candida infections, particularly in cases resistant to other azoles, such as FLZ [23]. In line with a study conducted in 2020 [24], our findings showed high in vitro susceptibility of clinical isolates within the C. parapsilosis species complex to itraconazole with a MIC90 of 0.5 µg/mL. In a study examining 101 Iranian isolates, 89.1% were found to be wild type to itraconazole. This supports the continued efficacy of itraconazole against C. parapsilosis and highlights the importance of species level identification. In contrast, Hassanmoghadam et al. [25] reported that 89% (n = 94) of C. parapsilosis isolates from the various body sites had MIC values ≥ 1 µg/mL, indicating resistance. This discrepancy may reflect regional differences or prolonged use of itraconazole for prophylaxis or treatment within their patient population. In a study conducted in Mexico [26] all clinical isolates of C. parapsilosis were found to be susceptible to FLZ, amphotericin B, 5-fluorocytosine, and ketoconazole, while showing resistance to miconazole and itraconazole. In contrast, our study found no resistance to itraconazole, suggesting potential regional differences or variations in antifungal usage. Our findings align with a study by Kord et al. [27] in Iran, which reported high MIC values for echinocandins against clinical isolates of C. parapsilosis complex. Specifically, the MIC50 and MIC90 values were 1 µg/mL and 4 µg/mL for caspofungin, and 2 µg/mL and 4 µg/mL for anidulafungin, respectively. These values were notably higher compared to other non-albicans Candida species. Similarly, our study showed elevated MIC90 for these drugs (4 µg/mL for caspofungin and 2 µg/mL for anidulafungin), raising concerns about reduced susceptibility .In contrast, another study [9] found that all tested isolates of C. parapsilosis showed full susceptibility to micafungin and caspofungin (MIC < 4 µg/mL). A Brazilian study [28] involving 124 pediatric clinical isolates reported no resistance profile, which may be attributed to geographic, demographic, antifungal prescribing, or local epidemiological factors that influence the emergence of resistance.

Global surveillance study revealed outbreaks of FLZ resistant C. parapsilosis, often linked to the nosocomial transmission of genetically related strains [29–31]. However, in our study, only two FLZ resistant clinical isolates were identified, resulting in a prevalence of 1.96% among the 510 isolates, which aligns with global resistance estimates (2% to 5%) [1]. This highlights the necessity of routine antifungal susceptibility testing, especially since FLZ continue to be the standard first line treatment, particularly in resource limited settings. Furthermore, FLZ prophylaxis and cross-transmission within healthcare settings may foster the emergence and spread of azole-resistant C. parapsilosis strains [32, 33].

Recently, a rise in C. parapsilosis candidemia was observed during the COVID-19 pandemic at a large hospital in Seoul [34], but it was not linked to a specific clone (Y132F), due to the low rate of FLZ resistance [35]. Comprehensive antifungal stewardship programs are highly recommended in choosing antifungal treatment regimens and mitigating resistance patterns [36]. Moreover, incorporating fungal biomarker testing into ICU protocols can help reduce unnecessary FLZ use by enabling targeted empirical therapy for high risk patients [37]. Persistent environmental contamination by C. parapsilosis and C. auris in healthcare settings continues to pose a significant risk for hospital acquired infections [1]. Several studies linked outbreaks of C. parapsilosis to biofilm on Central Venous Catheters )CVCs (and hand transmission through healthcare workers’ hands, emphasizing the need for rigorous surveillance and strict infection control measures [38–42]. Our study identified six C. parapsilosis isolates on equipment in a neonatal unit, specifically on breast pump sets, indicating a risk of infection from contaminated devices.

Notably, a multicenter study reported a 46.6% in hospital mortality rate among patients with C. parapsilosis complex candidemia in Iran from 2015 to 2019 [43]. Effective infection control is crucial, especially for vulnerable groups like neonates and patients receiving parenteral nutrition, who are at a higher risk of C. parapsilosis candidemia due to biofilm formation on CVCs and transmission from healthcare workers [1]. In a related study, an outbreak of C. parapsilosis candidemia in pediatric oncology patients was linked to bloodstream isolates detected on the hands of healthcare workers, underscoring the role of inadequate infection control practices, including improper PPE use and contaminated hospital environments, in facilitating nosocomial transmission [44]. Both an earlier outbreak [45] and the recent outbreak [46] reported inadequate PPE use, which led to the contamination of healthcare workers’ hands and shared computer keyboards. This highlights the role of improper PPE practices in nosocomial transmission of infections. Consequently, both contaminated surfaces and healthcare workers’ hands pose significant risks to patients and staff [47].

A significant percentage of C. parapsilosis was detected on hands of healthcare workers, specifically (57%) [48], which is comparable to the 59.7% found in clinical specimens. Identical genotypes of C. parapsilosis present in both hand and blood samples suggest a possibility of horizontal transmission. Our study identified C. parapsilosis in 11 healthcare workers, emphasizing the urgent need for reinforced infection control measures and strict adherence to hand hygiene, especially in high-risk areas such as the NICU.

In addition, three isolates were identified as C. orthopsilosis, all of which were collected from patients. None of these isolates showed resistance to the tested antifungal agents. Due to their limited number, they were not analyzed individually; however, their MIC values fell within the susceptible range. This finding aligns with previous studies indicating that C. orthopsilosis typically exhibits lower MIC values and has limited clinical significance compared to C. parapsilosis sensu stricto [49, 50].

Our analysis of resistant C. parapsilosis isolates showed no mutations in the ERG11 or FKS1 hotspot regions. We amplified and sequenced HS1 and HS2 regions of the FKS1 gene, consistent with previous studies [9, 43], which also found no mutations associated with echinocandin resistance. Sequencing of the ERG11 gene revealed no FLZ resistance mutations, including the Y132F mutation. This aligns with earlier findings that observed reduced azole susceptibility in the absence of ERG11 mutations [43]. Our results contrast with earlier studies [21] that linked ERG11 mutations to azole resistance. The absence of these mutations in our isolates suggests alternative mechanisms of resistance, such as overexpression of efflux pump genes (e.g., CDR1, MDR1), modifications in membrane sterol composition, or novel mutations outside the traditional hotspots. Additionally, factors such as biofilm formation and stress response pathways (e.g., heat shock proteins, oxidative stress regulators) may also contribute to the observed reduced susceptibility, as noted in prior investigations [51, 52]. Further molecular analyses, such as transcriptomics or whole genome sequencing (WGS), are needed to clarify the resistance mechanisms. This highlights the ongoing need for surveillance, rapid diagnostics, and antifungal stewardship. A 2010 study published in the European Journal of Pediatrics linked an outbreak of C. parapsilosis in pediatric patients to the hands of healthcare workers through molecular analyses [26].

In 2021, a comprehensive environmental screening [21], consistent with the previous findings [45, 53], revealed that C. parapsilosis was the most prevalent Candida species found on HCWs’ hands and surfaces. This finding indicates a potential for the horizontal transmission of a specific clone. However, a study conducted by Sharma et al. (2025) in North India found no dominant clone among FLZ resistant C. parapsilosis isolates from various clinical specimens. This suggests that resistance can arise from multiple independent introductions rather than from a single source [54].

The practical validation of the designed primers is crucial. In our study, we tested newly designed primers targeting the FKS1 gene, including the hotspot regions (HS1 and HS2) on clinical isolates of the C. parapsilosis complex to ensure their specificity and reliability. We also optimized the PCR conditions, such as primer concentrations, melting temperatures, and annealing temperatures to maximize amplification efficiency and minimize non-specific products. These steps are essential to confirm that the primers are suitable for downstream sequencing and potential routine diagnostic applications. To enhance workflow efficiency and reduce experimental costs, e designed a single pair of primers that amplifies a PCR fragment containing both hotspot 1 and hotspot 2 regions of the FKS1 gene. This approach significantly decreases the number of required PCR reactions and sequencing runs, leading to lower reagent consumption, shorter turnaround times, and overall cost savings. Furthermore, it enables the simultaneous assessment of both mutation-prone regions in a single amplification run, thereby improving data consistency and facilitating direct comparison of mutation patterns. This approach offers a more efficient and cost-effective alternative to amplifying the two hotspots separately. However, this study has several notable limitations. Firstly, we were unable to perform molecular typing techniques, which could have provided a clearer understanding of clonal relationships and transmission dynamics in healthcare-associated infections. Future studies should incorporate genotyping strategies to enhance epidemiological insights into the transmission of C. parapsilosis. Secondly, while we sequenced the ERG11 and FKS1 hotspots to investigate antifungal resistance, we did not examine other resistance-associated genes or perform gene expression analyses. These additional analyses could provide valuable information, especially for FLZ resistant strains lacking known mutations. Furthermore, only six environmental C. parapsilosis complex isolates were recovered in this study, which limits the generalizability to our conclusions about environmental contamination and its role in hospital transmission. Lastly, the absence of clinical data from patients with the isolates hindered our ability to assess treatment outcomes or draw correlations. To address these issues, coordinated surveillance systems at local, national, and international levels are essential for monitoring emerging resistance patterns. Integrating WGS into these efforts will help to track genotype circulation and accurately identify transmission networks, ultimately enabling better management within institutions to inform therapeutic decision-making.

Conclusion

This study highlights the antifungal susceptibility patterns of C. parapsilosis complex isolates from clinical, environmental, and healthcare worker sources in Iran. Overall, a low prevalence of antifungal resistance was observed, with newer triazoles showing consistent in vitro activity. No resistance associated mutations were detected in the ERG11or FKS1 genes, suggesting that alternative resistance mechanisms may be involved. These findings underscore the importance of continued surveillance and molecular investigations to guide effective antifungal therapy and infection control strategies. However, further studies are warranted to correlate these findings with clinical outcomes.

Acknowledgements

The authors express their sincere appreciation to the hospital staff and laboratory personnel for their invaluable support in sample collection and processing. We also extend our gratitude to the Molecular Mycology Laboratory team for their dedicated technical assistance throughout the study.

Abbreviations

CLSI

Clinical Laboratory Standards Institute

PCR

Polymerase Chain Reaction

DMSO

Dimethyl sulfoxide

Author contributions

A.M., T.S., and H.B. made the primary contributions to writing the manuscript. M.A., M.S., R.V., M.Z., M.T.H., S.R.A., Z.A., L.F., I.H., H.Z., and S.M. oversaw project follow‑up, conducted literature searches, and contributed to revising the manuscript. All authors read, reviewed, and approved the final version.

Funding

This research was financially supported by Mazandaran University of Medical Sciences, Sari, Iran (Grant nr 17967).

Data availability

Data is provided within the manuscript files. The DNA sequences generated during the current study have been deposited in the NCBI GenBank repository under accession numbers PV764592 to PV764597 and PQ721052.

Declarations

Ethics approval and consent to participate

All human subjects, materials, or data procedures were conducted by ethical standards established by the institutional and/or national research committee, adhering to the 1964 Helsinki Declaration and its subsequent amendments or comparable ethical guidelines. All participants, or their parents or legal guardians, provided informed consent for their participation in the study. This study was approved by the Ethics Committee of Mazandaran University of Medical Sciences, under the approval number IR.MAZUMS.REC.1402.365. All procedures were conducted according to the ethical guidelines and regulations.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Tahereh Shokohi, Email: shokohi.tahereh@gmail.com.

Hamid Badali, Email: hamid.badali@utsa.edu.

References

  • 1.Tóth R, Nosek J, Mora-Montes HM, Gabaldon T, Bliss JM, Nosanchuk JD, et al. Candida parapsilosis: from genes to the bedside. Clin Microbiol Rev. 2019;32(2). 10.1128/cmr00111-18. . [DOI] [PMC free article] [PubMed]
  • 2.Pammi M, Holland L, Butler G, Gacser A, Bliss JM. Candida parapsilosis is a significant neonatal pathogen: a systematic review and meta-analysis. Pediatr Infect Dis J. 2013;32(5):e206–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Zoppo M, Poma N, Di Luca M, Bottai D, Tavanti A. Genetic manipulation as a tool to unravel Candida parapsilosis species complex virulence and drug resistance: state of the Art. J Fungi. 2021;7(6):459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Govrins M, Lass-Flörl C. Candida parapsilosis complex in the clinical setting. Nat Rev Microbiol. 2024;22(1):46–59. [DOI] [PubMed] [Google Scholar]
  • 5.Harrington R, Kindermann SL, Hou Q, Taylor RJ, Azie N, Horn DL. Candidemia and invasive candidiasis among hospitalized neonates and pediatric patients. Curr Med Res Opin. 2017;33(10):1803–12. [DOI] [PubMed] [Google Scholar]
  • 6.Pappas PG, Lionakis MS, Arendrup MC, Ostrosky-Zeichner L, Kullberg BJ. Invasive candidiasis. Nat Reviews Disease Primers. 2018;4(1):1–20. [DOI] [PubMed] [Google Scholar]
  • 7.Arastehfar A, Ünal N, Hoşbul T, Alper Özarslan M, Sultan Karakoyun A, Polat F, et al. editors. Candidemia among coronavirus disease 2019 patients in Turkey admitted to intensive care units: a retrospective multicenter study. Open forum infectious diseases; 2022: Oxford University Press US. [DOI] [PMC free article] [PubMed]
  • 8.Diab-Elschahawi M, Forstner C, Hagen F, Meis JF, Lassnig AM, Presterl E, et al. Microsatellite genotyping clarified conspicuous accumulation of Candida parapsilosis at a cardiothoracic surgery intensive care unit. J Clin Microbiol. 2012;50(11):3422–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Khalifa HO, Watanabe A, Kamei K. Antifungal resistance and genotyping of clinical Candida parapsilosis complex in Japan. J Fungi. 2023;10(1):4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Pfaller MA, Carvalhaes CG, DeVries S, Rhomberg PR, Castanheira M. Impact of COVID-19 on the antifungal susceptibility profiles of isolates collected in a global surveillance program that monitors invasive fungal infections. Med Mycol. 2022;60(5):myac028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Bharathi R. Comparison of chromogenic media with the corn meal agar for speciation of Candida. J Pure Appl Microbiol. 2018;12(3):1617–. [Google Scholar]
  • 12.Hashemi SE, Shokohi T, Abastabar M, Aslani N, Ghadamzadeh M, Haghani I. Species distribution and susceptibility profiles of Candida species isolated from vulvovaginal candidiasis, emergence of C. lusitaniae. Curr Med Mycol. 2019;5(4):26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Mohammadi R, Mirhendi H, Rezaei-Matehkolaei A, Ghahri M, Shidfar MR, Jalalizand N, et al. Molecular identification and distribution profile of Candida species isolated from Iranian patients. Med Mycol. 2013;51(6):657–63. [DOI] [PubMed] [Google Scholar]
  • 14.Moslemi A, Shokohi T, Salimi M, Faeli L, Davoodi L, Kashi Z, et al. Clinic-mycological spectrum of Candida infection in diabetic foot ulcers in a tertiary care hospital. Curr Med Mycol. 2023;9(4):9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Abastabar M, Hosseinpoor S, Hedayati MT, Shokohi T, Valadan R, Mirhendi H, et al. Hyphal wall protein 1 gene: A potential marker for the identification of different Candida species and phylogenetic analysis. Curr Med Mycol. 2016;2(4):1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Clinical and Laboratory Standards Institute (CLSI). Reference method for broth dilution antifungal susceptibility testing of yeasts. 4th ed. CLSI standard M27. Wayne PC.
  • 17.(CLSI) CaLSI. Performance Standards for Antifungal Susceptibility Testing of Yeasts. 2nd Edition. Wayne, PA, USA: Clinical and Laboratory Standards Institute. 2020.
  • 18.(CLSI) CaLSI. Epidemiological Cutoff Values for Antifungal Susceptibility Testing. 3rd Edition. Wayne, PA, USA: Clinical and Laboratory Standards Institute. 2020.
  • 19.Asogan M, Kim HY, Kidd S, Alastruey-Izquierdo A, Govender NP, Dao A, et al. Candida parapsilosis: A systematic review to inform the world health organization fungal priority pathogens list. Med Mycol. 2024;62(6):myad131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Brassington PJ, Klefisch F-R, Graf B, Pfüller R, Kurzai O, Walther G, et al. Genomic reconstruction of an azole-resistant Candida parapsilosis outbreak and the creation of a multi-locus sequence typing scheme: a retrospective observational and genomic epidemiology study. Lancet Microbe. 2025;6(1). [DOI] [PubMed]
  • 21.Thomaz DY, de Almeida JN Jr, Sejas ON, Del Negro GM, Carvalho GO, Gimenes VM, et al. Environmental clonal spread of azole-resistant Candida parapsilosis with Erg11-Y132F mutation causing a large candidemia outbreak in a Brazilian cancer referral center. J Fungi. 2021;7(4):259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Wu Y, Wei D, Gong X, Shen Y, Zhu Y, Wang J, et al. Initial use of voriconazole positively affects outcome of Candida parapsilosis bloodstream infection: a retrospective analysis. Translational Pediatr. 2020;9(4):480. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Pakshir K, Zomorodian K, Zakaei A, Motamedi M, Ghiasi MR, Karamitalab M. Molecular identification and in-vitro antifungal susceptibility testing of Candida species isolated from patients with onychomycosis. Curr Med Mycol. 2015;1(4):26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Khodavaisy S, Badali H, Meis J, Modiri M, Mahmoudi S, Abtahi H, et al. Comparative in vitro activities of seven antifungal drugs against clinical isolates of Candida parapsilosis complex. J De Mycol Medicale. 2020;30(3):100968. [DOI] [PubMed] [Google Scholar]
  • 25.Hassanmoghadam F, Shokohi T, Hedayati MT, Aslani N, Haghani I, Nabili M, et al. High prevalence of Itraconazole resistance among Candida parapsilosis isolated from Iran. Curr Med Mycol. 2019;5(3):43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Hernández-Castro R, Arroyo-Escalante S, Carrillo-Casas EM, Moncada-Barrón D, Álvarez-Verona E, Hernández-Delgado L, et al. Outbreak of Candida parapsilosis in a neonatal intensive care unit: a health care workers source. Eur J Pediatrics. 2010;169:783–7. [DOI] [PubMed] [Google Scholar]
  • 27.Kord M, Salehi M, Hashemi SJ, Abdollahi A, Alijani N, Maleki A, et al. Clinical, epidemiological, and mycological features of patients with candidemia: experience in two tertiary referral centers in Iran. Curr Med Mycol. 2022;8(3):9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Peixoto PH, Silva ML, Portela FV, da Silva B, Milanez E, de Oliveira D, et al. Clinical, epidemiological and laboratory features of invasive Candida parapsilosis complex infections in a Brazilian pediatric reference hospital during the COVID-19 pandemic. J Fungi. 2023;9(8):844. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Thomaz DY, de Almeida JN Jr, Lima GME, Nunes MO, Camargo CH, Grenfell RC, et al. An azole-resistant Candida parapsilosis outbreak: clonal persistence in the intensive care unit of a Brazilian teaching hospital. Front Microbiol. 2018;9:2997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Souza ACR, Fuchs BB, Pinhati HM, Siqueira RA, Hagen F, Meis JF, et al. Candida parapsilosis resistance to fluconazole: molecular mechanisms and in vivo impact in infected galleria Mellonella larvae. Antimicrob Agents Chemother. 2015;59(10):6581–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Fekkar A, Blaize M, Bouglé A, Normand A-C, Raoelina A, Kornblum D, et al. Hospital outbreak of fluconazole-resistant Candida parapsilosis: arguments for clonal transmission and long-term persistence. Antimicrob Agents Chemother. 2021;65(5):02036–20. 10.1128/aac. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Arastehfar A, Daneshnia F, Hilmioğlu-Polat S, Fang W, Yaşar M, Polat F, et al. First report of candidemia clonal outbreak caused by emerging fluconazole-resistant Candida parapsilosis isolates harboring Y132F and/or Y132F + K143R in Turkey. Antimicrob Agents Chemother. 2020;64(10):01001–20. 10.1128/aac. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Mesini A, Mikulska M, Giacobbe DR, Del Puente F, Gandolfo N, Codda G, et al. Changing epidemiology of candidaemia: increase in fluconazole-resistant Candida parapsilosis. Mycoses. 2020;63(4):361–8. [DOI] [PubMed] [Google Scholar]
  • 34.Won EJ, Sung H, Kim M-N. Changing epidemiology of clinical isolates of Candida species during the coronavirus disease 2019 pandemic: data analysis from a Korean tertiary care hospital for 6 years (2017–2022). J Fungi. 2024;10(3):193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Won EJ, Sung H, Kim M-N. Clinical characteristics of candidemia due to Candida parapsilosis with serial episodes: insights from 5-Year data collection at a tertiary hospital in Korea. J Fungi. 2024;10(9):624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Capoor MR, Subudhi CP, Collier A, Bal AM. Antifungal stewardship with an emphasis on candidaemia. J Global Antimicrob Resist. 2019;19:262–8. [DOI] [PubMed] [Google Scholar]
  • 37.Colombo A, de Almeida Júnior J, Slavin MA, Chen SC, Sorrell TC. Candida and invasive mould diseases in non-neutropenic critically ill patients and patients with haematological cancer. Lancet Infect Dis. 2017;17(11):e344–56. [DOI] [PubMed] [Google Scholar]
  • 38.Marcos-Zambrano LJ, Escribano P, Sanguinetti M, de la Pedrosa EGG, De Carolis E, Vella A, et al. Clusters of patients with candidaemia due to genotypes of Candida albicans and Candida parapsilosis: differences in frequency between hospitals. Clin Microbiol Infect. 2015;21(7):677–83. [DOI] [PubMed] [Google Scholar]
  • 39.Calà C, Fontana I, Di Carlo P, Mascarella C, Fasciana T, Reale S, et al. Candida parapsilosis infection: a multilocus microsatellite genotyping-based survey demonstrating an outbreak in hospitalized patients. Annals Clin Lab Sci. 2020;50(5):657–64. [PubMed] [Google Scholar]
  • 40.Singh A, Singh PK, de Groot T, Kumar A, Mathur P, Tarai B, et al. Emergence of clonal fluconazole-resistant Candida parapsilosis clinical isolates in a multicentre laboratory-based surveillance study in India. J Antimicrob Chemother. 2019;74(5):1260–8. [DOI] [PubMed] [Google Scholar]
  • 41.Martini C, Torelli R, De Groot T, De Carolis E, Morandotti GA, De Angelis G, et al. Prevalence and clonal distribution of azole-resistant Candida parapsilosis isolates causing bloodstream infections in a large Italian hospital. Front Cell Infect Microbiol. 2020;10:232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Asadzadeh M, Ahmad S, Al-Sweih N, Hagen F, Meis JF, Khan Z. High-resolution fingerprinting of Candida parapsilosis isolates suggests persistence and transmission of infections among neonatal intensive care unit patients in Kuwait. Sci Rep. 2019;9(1):1340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Arastehfar A, Daneshnia F, Najafzadeh MJ, Hagen F, Mahmoudi S, Salehi M, et al. Evaluation of molecular epidemiology, clinical characteristics, antifungal susceptibility profiles, and molecular mechanisms of antifungal resistance of Iranian Candida parapsilosis species complex blood isolates. Front Cell Infect Microbiol. 2020;10:206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Barchiesi F, Caggiano G, Maracci M, Arzeni D, Scalise G, Montagna MT. Antifungal susceptibility patterns of yeast isolates causing bloodstream infections. J Antimicrob Chemother. 2003;51(2):431–3. [DOI] [PubMed] [Google Scholar]
  • 45.Caggiano G, Fioriti S, Morroni G, Apollonio F, Triggiano F, D’Achille G, et al. Genotypic and phenotypic characteristics of Candida parapsilosis bloodstream isolates: health care associated infections in a teaching hospital in Italy. J Infect Public Health. 2024;17(6):967–74. [DOI] [PubMed] [Google Scholar]
  • 46.Girou E, Chai S, Oppein F, Legrand P, Ducellier D, Cizeau F, et al. Misuse of gloves: the foundation for poor compliance with hand hygiene and potential for microbial transmission? J Hosp Infect. 2004;57(2):162–9. [DOI] [PubMed] [Google Scholar]
  • 47.Otter JA, Yezli S, Salkeld JA, French GL. Evidence that contaminated surfaces contribute to the transmission of hospital pathogens and an overview of strategies to address contaminated surfaces in hospital settings. Am J Infect Control. 2013;41(5):S6–11. [DOI] [PubMed] [Google Scholar]
  • 48.Delfino D, Scordino F, Pernice I, Passo CL, Galbo R, David A, et al. Potential association of specific Candida parapsilosis genotypes, bloodstream infections and colonization of health workers’ hands. Clin Microbiol Infect. 2014;20(11):O946–51. [DOI] [PubMed] [Google Scholar]
  • 49.da Silva EM, Mansano ESB, de Souza Bonfim-Mendonça P, Olegário R, Tobaldini-Valério F, Fiorini A, et al. High colonization by Candida parapsilosis sensu stricto on hands and surfaces in an adult intensive care unit. J Med Mycol. 2021;31(2):101110. [DOI] [PubMed] [Google Scholar]
  • 50.Pfaller MA, Diekema DJ. The epidemiology of invasive candidiasis. Candida Candidiasis. 2011:449–80.
  • 51.Silva A, Miranda I, Guida A, Synnott J, Rocha R, Silva R, et al. Transcriptional profiling of azole-resistant Candida parapsilosis strains. Antimicrob Agents Chemother. 2011;55(7):3546–56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Taff HT, Mitchell KF, Edward JA, Andes DR. Mechanisms of Candida biofilm drug resistance. Future Microbiol. 2013;8(10):1325–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Sakita KM, Faria DR, da Silva EM, Tobaldini-Valério FK, Kioshima ES, Svidzinski TIE, et al. Healthcare workers’ hands as a vehicle for the transmission of virulent strains of Candida spp.: A virulence factor approach. Microb Pathog. 2017;113:225–32. [DOI] [PubMed] [Google Scholar]
  • 54.Sharma V, Das S, Spruijtenburg B, de Groot T, Meijer E, Kaur H, et al. Genotypic diversity and molecular basis of fluconazole resistance in Candida parapsilosis clinical isolates collected over 7 years in a Tertiary-Care hospital in North India. Mycoses. 2025;68(5):e70062. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data is provided within the manuscript files. The DNA sequences generated during the current study have been deposited in the NCBI GenBank repository under accession numbers PV764592 to PV764597 and PQ721052.

Articles from BMC Infectious Diseases are provided here courtesy of BMC

RESOURCES