Skip to main content
Frontiers in Transplantation logoLink to Frontiers in Transplantation
. 2026 Feb 20;5:1740314. doi: 10.3389/frtra.2026.1740314

Mechanisms inducing differentiation of adult islet progenitor-like cells into functional islet-like organoids

Carly M Darden 1,2,, Jayachandra Kuncha 1,, Jeffrey T Kirkland 2, Jordan Mattke 1, Srividya Vasu 1, Prathab Balaji Saravanan 1,†,#, Bashoo Naziruddin 2, Michael C Lawrence 1,*
PMCID: PMC12963012  PMID: 41798991

Abstract

Introduction

Adult pancreatic tissue contains cell populations with latent regenerative potential, but the processes governing their expansion and differentiation into endocrine lineages remain unclear.

Methods

Adult human pancreatic cells obtained from donor tissue were isolated and expanded and analyzed for lineage potential using single-cell RNA sequencing, flow cytometry, and functional assays. A CD9+ PROCR+ RGS16+ subpopulation, termed islet progenitor-like cells (IPCs), was evaluated for proliferative capacity and differentiation potential.

Results

IPCs exhibited robust proliferative capacity and, upon differentiation, formed insulin- and glucagon-secreting organoids. Treatment of IPCs with the small molecule ISX9 induced expression of key transcription factors RFX6 and NEUROD1 through calcium-dependent chromatin remodeling mediated by NFAT recruitment of p300 and displacement of histone deacetylases (HDAC1-3). Pharmacologic inhibition of HDACs further enhanced IPC maturation and glucose-stimulated insulin secretion.

Discussion

These findings define the molecular and epigenetic mechanisms driving the expansion and differentiation of adult IPCs into functional islet-like organoids, providing a foundation for future regenerative approaches using adult pancreatic tissue as a renewable source for endocrine cell replacement.

Keywords: adult islet stem cells, beta-cell differentiation, chromatin remodeling, islet cell differentiation, islet cell replacement, islet progenitor cells, islet regeneration, islet-like organoids

Introduction

Islet transplantation offers a promising cell replacement therapy to prevent or reverse diabetes in individuals who have lost functional beta and alpha cells. However, the limited availability of donor islet tissue remains a major barrier to its broader clinical application. This limitation has driven intense investigation into alternative strategies, including in vitro islet cell engineering and beta-cell expansion to restore or maintain islet cell mass and function.

Significant progress has been made in generating stem cell-derived “beta-like” cells by directing their differentiation through stepwise protocols that mimic developmental processes. These protocols guide human embryonic stem cells (hESCs) or induced pluripotent stem cells (iPSCs) through definitive endoderm and pancreatic progenitor stages to ultimately produce glucose-responsive, insulin-secreting cells (13). Most strategies employ 4 to 7 sequential culture stages that activate key transcription factors critical to islet development, including PDX1, NEUROG3, RFX6, NEUROD1, NKX2-2, NKX6-1, MAFA, and MAFB (414).

Stem cell-derived islets (sc-islets) have demonstrated the ability to reverse diabetes in animal models and are currently being evaluated in phase I and II clinical trials (15). While their therapeutic potential is substantial, use of hESCs and iPSCs for treating type 1 diabetes (T1D) requires immunosuppression and raises concerns about tumorigenicity, oncogenic mutations, and ethical issues related to embryonic sources (1618). As a result, alternative approaches using non-embryonic, non-genetically modified adult-derived cells, including chemically-induced iPSCs, are under active investigation (1923).

Studies have shown that insulin- and glucagon-producing cells can be derived from pancreatic ductal epithelial cells and mesenchymal stromal/stem cells (MSCs) (2436). However, these source populations are highly heterogeneous, and the specific cell subtypes capable of endocrine differentiation remain poorly defined. Even cultures purified for canonical MSC surface markers contain diverse subpopulations with varying differentiation potentials, influenced by both tissue origin and culture conditions. Moreover, it remains unclear whether these cells can directly give rise to insulin-producing cells or primarily support the function and proliferation of existing beta cells.

A longstanding question in the field is whether an adult human stem cell population exists that can generate functional, glucose-responsive beta cells. Some studies have provided evidence of de novo beta-cell regeneration in both animal and human models (3739). Yet, other lineage tracing studies in mice have demonstrated that beta cells are no longer produced once existing insulin-producing cells are ablated (40). These findings have led to alternative hypotheses, including the possibility that beta-cell regeneration arises not from pluripotent precursors, but from dedifferentiated or partially differentiated beta cells retained in a progenitor-like state (4146).

Supporting this idea, we have observed that stressed or cultured beta cells can undergo dedifferentiation, and under specific conditions, regain insulin production and secretory function in vitro (47). Based on these observations, we hypothesized that beta cells can revert to a progenitor state, enabling their expansion and redifferentiation into functional endocrine phenotypes. In this study, we identify and characterize a subpopulation of adult islet progenitor-like cells (IPCs) from adult human pancreas donor tissue and delineate the signaling and chromatin-regulatory mechanisms that induce their differentiation into functional islet-like organoids (hereafter referred to as islet organoids). These findings provide mechanistic insight into adult pancreatic plasticity and establish a foundation for future studies aimed at clinically scalable expansion and conversion of IPCs for autologous islet cell replacement therapies.

Materials and methods

Reagents and recombinant DNA constructs

Antibodies used were as follows: NFATC2, RGS16, NEUROD1, NEUROG3, p300, HDAC1, HDAC2, and HDAC3 (Santa Cruz Biotechnology, Inc); CD45-Alexa Fluor and CD29-Alexa Fluor (BioLegend); HLA Class 1 ABC (Abcam); and CD34-APC, CD105-APC, CD90-PE, CD73-PE (BD Biosciences). Gluc-ON reporters for RFX6 (HPRM53326-PG04), NEUROD1 (HPRM69533-PG04), and INS (HPRM30189-PG04) promoters were obtained from GeneCopoeia. Plasmid expression vectors dominant-negative NFAT PxIxIT motif (dnNFAT) and mutated dnNFAT AxAxAA motif (dnNFATm) were previously described (4851).

Cell and tissue culture

Adult human pancreatic tissue from multiple donors was obtained from research islet cell isolations performed in the cGMP Islet Cell Processing Laboratory at Baylor University Medical Center in accordance with institutional and national guidelines and regulations. Briefly, pancreata were enzymatically digested with collagenase and mechanically dissociated in a Ricordi chamber. Following enzyme dilution and washing, digested tissue was subjected to density gradient purification using a COBE 2,991 cell processor. Multiple fractions were collected during purification, each containing variable proportions of islet and non-islet pancreatic tissue. Fractions with lower islet purity and COBE bag remnant fractions, which are typically discarded after clinical isolation, were cultured in vitro under expansion conditions. Digested pancreatic tissue from multiple donors was obtained from the cGMP Islet Cell Processing Laboratory at Baylor University Medical Center in accordance with institutional and national guidelines and regulations. Pancreatic tissue and IPCs were washed, cultured, and expanded in RPMI 1,640 (Gibco) containing 11 mM glucose, 10% heat-inactivated fetal bovine serum, 10 mM HEPES (pH 7.4), 2 mM L-glutamine, 1 mM sodium pyruvate, 50 μM β-mercaptoethanol, 100 U/mL penicillin, and 100 μg/mL streptomycin at 37°C in 5% CO2 humidified air. IPCs were expanded to high clonal density for up to 28 days to produce IPC clusters. Analysis of IPCs and IPC clusters was performed on weekly passages 8–15. FBS was reduced to 2%–5% for ISX9-induced islet cell differentiation. IPCs and IPC clusters were cultured and differentiated in Nunc Lab-Tek II Chamber Slide Systems (Thermo Fisher Scientific) for immunofluorescent staining. Krebs-Ringer bicarbonate HEPES buffer media was used with low (2.8 mM) and high (16.7 mM) glucose for glucose-stimulated insulin secretion and high (50 mM) KCl for depolarization experiments. RPMI 1,640 with 2 mM L-glutamine, 1:200 ITS-X, 10 µM triiodo-L-thyronine (T3), 10 µM ALK5 inhibitor II, 10 µM ZnSO4, and 10 µg/mL heparin was used as a base medium for end stages 5–7 of sc-islet differentiation supplemented as follows: stage 5 endocrine progenitors (SANT-1, 0.05 µM retinoic acid, and 100 nM LDN193189 for 3 days), stage 6 immature sc-islets [100 nM gamma secretase inhibitor XX (GSiXX), and 100 nM LDN193189 for 7 days], and stage 7 mature sc-islets [n-acetyl cysteine (NAC), Trolox, and 2 μM R428 for 7d].

Sc-RNA sequencing and analysis

IPCs were cultured in 10 cm culture dishes and washed twice with sterile, cold 1× phosphate-buffered saline (PBS). Cells were dissociated into single-cell suspensions using TrypLE Express (Gibco, no phenol red) at 37°C for 5–8 min and diluted 1:1 with PBS. Enzymatic activity was neutralized with complete culture medium (RPMI supplemented with 10% FBS), and cells were gently triturated to minimize clumping. The suspension was filtered through a 70 µm cell strainer and centrifuged at 2000 rpm for 5 min at 4°C. Pellets were resuspended in cold PBS containing 0.4% BSA. Cell counts and viability were determined using AO/PI staining on an automated cell counter. Suspensions were adjusted to 1,200 cells/µL with ≥90% viability and maintained on ice prior to loading onto the Chromium X platform for library preparation.

Human pancreatic IPCs were processed using the 10x Genomics Chromium Next GEM Single Cell 3′ Reagent Kit v3. Single-cell libraries were generated using Gel Bead-in-Emulsions and sequenced on an Illumina NextSeq 2,000 platform (P2-100 flow cell). Raw sequencing data were processed using the Cell Ranger Count pipeline (v7.1.0) aligned to the GRCh38-2020-A human reference genome.

Approximately 100,000 barcodes were retained following quality control filtering (200–82,150 UMIs; 200–8,749 detected genes; <20% mitochondrial transcripts). Automated reference-based annotation was performed using Azimuth (HuBMAP). Clustering and visualization were conducted using Loupe Browser with graph-based nearest-neighbor clustering, identifying 20 transcriptionally distinct clusters. Cluster-enriched marker genes were identified using differential expression analysis relative to all other clusters, and IPC-enriched clusters were defined based on coordinated expression of progenitor-associated transcripts.

DNA transfection

Intact islet organoids were detached from tissue culture by 10 min incubation with TrypLE Express (Gibco) at 37°C and filtered prior to electroporation of ∼100 islet organoids per sample with 2 µg total DNA using a Neon Transfection System (ThermoFisher Scientific) for 2 pulses of 1,200 V for 20 ms. Islet organoids were cultured 24 h prior to experimental treatments. The Secrete-Pair Dual Luminescence Assay Kit (GeneCopoeia) was used to normalize for promoter-reporter transfection. Cells were then lysed in passive lysis buffer, and Firefly and Renilla luminescence was measured with a dual luciferase assay kit (Promega). Luminescence was measured using the Cytation5 Cell Imaging Multi-Mode Reader (BioTek).

Diabetic nude mouse bioassay

NU/J (Nude mice, Jackson Laboratory, RRID:IMSR_JAX:002019, cat no. 002019, male, 8–12 wks old) between 24 and 28 g were rendered diabetic by intraperitoneal administration of 200 mg/kg body weight of STZ (Sigma). Mice were considered diabetic when fasting blood glucose was >200 mg/dL for 3 or more consecutive days. Mice were assigned to experimental groups using a randomization procedure to minimize selection bias. Each mouse was assigned a unique identification number and randomly allocated to either treatment or control group. Animals were anesthetized using inhaled isoflurane delivered via a calibrated vaporizer at concentrations ranging from 1%–3% during surgery and maintained at a flow rate of approximately 1 L/min until loss of pedal reflex and slowed respiration. Full-dose human islets (3,000 IEQ), marginal-dose human islets (1,500 IEQ), IPCs alone (1 × 106), and marginal-dose islets with IPCs were transplanted into kidney capsules of diabetic nude mice. Slow release EthiqaXR analgesic was administered immediately post-surgery in order to provide strong pain relief with a safe respiratory profile that lasts several hours to reduce the need for handling mice and causing additional stress. Blood glucose and animal health were monitored daily. Mice were fasted for 6 h with water provided ad libitum prior to intraperitoneal administration of 20% glucose solution at 2 g glucose/kg body weight. Blood glucose was measured at 30-minute intervals for intraperitoneal glucose tolerance test (IPGTT) analyses. All animal surgeries and procedures were performed in accordance with approved institutional animal care and use committee protocols. In the diabetic experimental group, a subset of animals developed extreme hyperglycemia and associated clinical signs (e.g., weight loss, dehydration, lethargy) consistent with advanced diabetes. In accordance with our approved humane endpoints, these animals were euthanized to prevent unnecessary suffering. Euthanasia was performed by anesthetic overdose (5% isoflurane via vaporizer) followed by cervical dislocation to ensure death, in accordance with institutional and federal guidelines. The development of severe diabetes was an anticipated outcome of the experimental model, and all animals were closely monitored throughout the study. No unexpected adverse events occurred in the control group.

Nude mice were housed in a conventional facility maintained at 20–22°C with a 12-hour light-dark cycle. Mice were kept in individually ventilated cages (IVCs) with a maximum of five mice per cage. Cages contained autoclaved wood-chip bedding and animals had ad libitum access to sterilized food and water. Environmental enrichment, including nesting material and shelters, was provided to promote well-being.

Whole-mount immunofluorescent staining

3D IPC-derived islet organoids and IPC monolayers were cultured on chamber slides. Culture medium was removed, and samples were gently washed with PBS. Cells were fixed with ice-cold 100% methanol for 5 min at −30 °C, followed by three washes in Wash Buffer (PBS containing 0.1% BSA and 0.1% Triton X-100). Cells were then blocked with blocking buffer (PBS containing 5% BSA and 0.1% Triton X-100) for 30 min at room temperature. Blocking buffer was removed and cells were incubated with primary antibody (1:100 dilution) prepared in dilution buffer (PBS containing 1% BSA and 0.1% Triton X-100) overnight at 4°C. Cells were then washed three times for 5 min in wash buffer and incubated with secondary antibody in dilution buffer for 1 h at room temperature. Following three additional washes, slides were mounted using VECTASHIELD® HardSet™ mounting medium. Samples were imaged and analyzed by an Olympus BX61 TRF Fluorescent Microscope.

Flow cytometry

Cells were detached from the culture flask and dissociated into single cells by 10 min incubation in TrypLE Express (Gibco) at 37°C. Dissociated IPCs were filtered through a 40 µm sterile nylon cell strainer (Fisher Scientific), and single cells were then washed twice with FACS buffer (2% FBS in PBS). Viability and counting were performed using 0.4% Trypan Blue solution (Thermo Fisher Scientific). A total of 1 × 106 cells in suspension were labeled with fluorochrome-conjugated surface antibody CD9. For intracellular staining of PROCR and RGS16, cells were fixed and permeabilized using Cytofix/Cytoperm (BD Biosciences) according to the manufacturer's instructions. FACS data were acquired on an LSR Fortessa flow cytometer with 5 lasers and 18 channels (BD Biosciences). Fluorescence minus one (FMO) cell sets and unstained cells served as biological negative controls. FACS data were analyzed by FlowJo software version 10.10.0.

Chromatin immunoprecipitation (ChIP) assays

ChIP assays were performed as previously described (47). Islet organoids were fixed, and chromatin DNA-protein was cross-linked with 1% formaldehyde and sonicated with a Bioruptor 200 (Diagenode) to produce DNA fragments. DNA-protein complexes were immunoprecipitated with indicated antibodies or IgG isotype controls, extensively washed, and the cross-links were reversed by heating to 65°C for 4 h in Tris-HCl (pH 6.5), 5 M NaCl, and 0.5 M EDTA. DNA was extracted by phenol/CHCl3 and precipitated with ethanol. Precipitated DNA and 1% control inputs were analyzed by real-time quantitative polymerase chain reaction (qPCR).

Real-time qPCR

Total RNA was isolated with the Qiagen RNeasy Mini Kit. Equal amounts of cDNA were synthesized using a High Capacity Reverse Transcription Kit (ThermoFisher). TaqMan primers were mixed with TaqMan Universal Master Mix II, with uracil N-glycosylase (ThermoFisher). 18S was amplified as an internal control. qPCR was performed using the Bio-Rad CFX connect system with TaqMan Primer Assays to detect 18S and target genes (ThermoFisher). RT2 qPCR primer assays were used to amplify NFATC2, PDX1, NEUROG3, RFX6, NEUROD1, NKX2-2, NKX6-1, MAFA, MAFB, SLC2A2, INS, and GCG genes (Qiagen). Primer sequences used to detect DNA input and immunoprecipitated 5′-flank promoter regions of human NEUROG3, RFX6, NEUROD1, and INS genes included RFX6 −499 to −274, 5ʹ- TGCAAAGACTGAGCGGTACT and 5ʹ- CCCTCCTTCCCGTTCTCTCA; NEUROD1 −516 to −70, 5ʹ-AGGCCACTCGCTCTGATCTA and 5ʹ-CTGAGGGGCTAGCAGGTCTA; NEUROG3, to −598 to −21, 5ʹ-TGGAAGGGACATAGGCAGGA and 5ʹ- CACGCTTTATCTGCTTCGCC; and INS −204 to −46, 5′-GTCCTGAGGAAGAGGTGCTG and 5′- CCATCTCCCCTACCTGTCAA.

Insulin and glucagon secretion assays

Islet clusters pretreated with ITF2357 for 24 h and ISX9 for 14 days were isolated from cell cultures and incubated for 2 h in DMEM medium for recovery. Islet organoids were then transferred to low (2.8 mM) or high (16.7 mM) glucose in KRBH medium for 60 min before replacing and stimulating in static incubation conditions with high (for insulin release) or low (for glucagon release) glucose KRBH medium for 60 min, respectively. Insulin and glucagon protein from cells and supernatant were measured by Insulin (ALPCO) and Glucagon Quantikine (R&D Systems) ELISA kits, respectively.

Statistical methods

Statistical analysis was performed using GraphPad Prism version 9.0 (La Jolla, CA). Statistical significance for more than two groups was determined by two-way analysis of variance and Sidak's multiple comparison test. Direct comparisons between two experimental groups were determined using unpaired Student's t test. Differences were considered significant when p values were <0.05 (*), <0.01 (**), and <0.001 (***).

Results

Single cell RNA-seq analysis of expanded pancreatic tissue reveals a subpopulation of islet progenitor cells in a dedifferentiated state

We used transcriptomic profiling to analyze single cells from cultured human pancreatic tissue to identify and characterize progenitor cells expanded in culture. Adult pancreatic samples were collected from islet cell purification fractions during islet isolation procedures and expanded in culture for 8–15 passages (Supplementary Table S1). Single-cell RNA sequencing was then performed on dissociated cells to profile the expanded populations. A total of 100,000 cell barcodes were processed and analyzed using reference-based mapping against integrated human pancreatic tissue scRNA-seq datasets from six independent studies using various single-cell technologies compiled in the Human BioMolecular Atlas Program (HuBMAP) (52, 53).

Automated cell type annotation using Azimuth identified multiple pancreatic cell subtypes with transcriptomic signatures matching activated stellate cells, ductal cells, and beta cells (Figure 1A) (54). Clustering and visualization were performed using Loupe Browser (10x Genomics), which applies graph-based clustering following dimensionality reduction. This analysis identified 20 transcriptionally distinct clusters (Figure 1B). Clusters 9, 10, 14, 17, and 18 were selected based on differential gene expression relative to all other clusters and coordinated expression of endocrine progenitor–associated transcripts, together with reduced expression of mature endocrine, acinar, and endothelial markers (Figures 1B–D; Supplementary Table S2). Marker enrichment within clusters was determined using differential expression analysis implemented in Loupe Browser.

Figure 1.

Figure composed of four panels showing human pancreatic tissue single-cell RNA sequencing data. Panel A displays colored t-SNE plots comparing standard and expanded pancreatic tissue, with distinct labeled clusters like Beta, Ductal, Immune, and Stellate. Panel B shows a circular t-SNE plot clustering cells into twenty groups, with select cluster details enlarged. Panel C presents violin plots for each cell type across clusters, including Acinar, Islet, Progenitor, and Endothelial, illustrating expression variation. Panel D provides t-SNE visualizations highlighting marker expression in specific pancreatic and mesenchymal cell subtypes.

Identification of IPCs in expanded human pancreatic tissue by single cell transcriptomic profiling. (A) Azimuth automated cell type annotation mapping of scRNA-seq data from expanded human pancreatic tissue (100,000 cells) referenced to dataset aggregates (n = 6) from human pancreatic tissue (35,000 cells) and (B) Seurat analysis of highly variant genes and dimensionality reduction by t-distributed stochastic neighbor embedding (t-SNE). (C) Gene expression profiling and (D) t-SNE mapping of cluster 9, 10, 14, 17, and 18 subpopulations containing islet cell progenitor cell markers (9,289 cells). Data shown are results from one donor.

Importantly, this subpopulation lacked expression of mature endocrine, acinar, or endothelial markers while expressing transcripts associated with immature beta-like states and beta cell-disallowed genes. These transcriptional features are consistent with a progenitor-like or partially dedifferentiated endocrine phenotype.

IPCs express multiple progenitor markers and signaling pathways associated with regeneration

Further reclustering and differential gene expression analysis of the IPC population revealed strong upregulation (>50-fold) of transcripts including CD81, MMP2, TEAD1, YAP1, CD9, KRT19, BMPR1A, PPP3R1, PPP3CC, ALDH1A, ALDH1B1, HDAC1, HDAC3, and FOXO1 (Figure 2A). Gene set enrichment analysis (GSEA) of the top 100 upregulated genes showed highest enrichment in pancreatic progenitor cell types, matched against the PanglaoDB and CellMarker 2.0 databases (Supplementary Table S3) (55, 56). The most enriched signaling pathways included those associated with epithelial-mesenchymal transition (EMT) and beta-cell development, based on matches to the MSigDB Human Molecular Signatures database (Supplementary Table S4A) (57). Gene Ontology analysis of Molecular Function revealed strong enrichment in ALDH activity and BMP receptor signaling (Supplementary Table S4B) (58, 59).

Figure 2.

Panel A contains a volcano plot with gene names, plotting log base two fold change on the x-axis and negative log base ten p-value on the y-axis, highlighting differentially expressed genes in red and blue. Panel B displays multiple UMAP plots grouped by gene function, showing expression patterns for progenitor markers, metabolic enzymes, surface molecules, acetylation enzymes, nuclear factor of activated T cells, and housekeeping genes, with gene names indicated above each UMAP plot.

Gene enrichment analysis of IPCs in expanded human pancreatic tissue. (A) Differential gene expression analysis and (B) Uniform Manifold Approximation and Projection (UMAP) analysis of IPCs. Data shown are results from one donor.

Uniform Manifold Approximation and Projection (UMAP) highlighted selective expression of progenitor genes KRT19, SOX9, FOXO1, and RGS16, enriched in one of two major IPC subpopulations (Figure 2B). This cluster also co-expressed surface molecules (CD9, CD81, PROCR/CD201, BMPR1A), metabolic regulators (ALDH1A, PPP3CC), histone modification enzymes (HDAC1-3, EP300), and NFAT family transcription factors (NFATC1–C4).

The gene enrichment analyses suggest that the expanded IPC population is in a state of EMT, as previously shown to be a characteristic of an islet cell progenitor state (6062). Moreover, IPCs selectively express surface markers previously identified in pancreatic endocrine progenitor cells and immature beta cells, including CD9, CD81, PROCR, and BMPR1A (34, 6367). The IPCs are enriched with ALDH1 isozymes 1A1 and 1B1, which were shown to be associated with regulation of differentiation of endocrine progenitor cells (68, 69). High relative expression of histone modification enzymes p300 and HDAC family members indicates the cells' potential capability to regulate genes at the chromatin level. The IPCs are also enriched with calcium/calmodulin dependent phosphatase calcineurin (CN) A and B subunits and downstream transcription factor targets of the NFAT family, suggesting potential capacity to modulate genes in response to calcium signaling. This is in line with previous observations that beta cells utilize CN/NFAT signaling to maintain beta-cell differentiation, mass, and function (47, 50, 7075). Altogether, these data indicate that the expanded IPCs express gene profiles with islet endocrine progenitor characteristics and the potential capacity to support islet cell regeneration and function.

Expanded IPCs enhance islet graft function in vivo

Because expanded IPCs exhibited gene expression profiles suggestive of islet regenerative capacity, we examined their potential to provide supportive effects in vivo when combined with islet grafts. Expanded human IPCs were co-transplanted with subtherapeutic (marginal) doses of human islets into streptozotocin-induced diabetic nude mice. Co-transplantation resulted in improved glycemic control compared with marginal islets alone, as assessed by longitudinal blood glucose monitoring and intraperitoneal glucose tolerance testing (Supplementary Figures S1A–C). Following nephrectomy of the graft-bearing kidney, a subset of co-transplanted animals exhibited transient residual glycemic effects.

CD9+, PROCR+ IPCs form RGS16+ IPC clusters with the capacity to differentiate into islet organoids in vitro

Previous studies have indicated that various sources of adult human tissues can differentiate into insulin-producing cells in vitro (25, 28, 31, 43, 44, 7678). Thus, we sought to determine if expanded IPCs have the potential to differentiate and become glucose-responsive islet-like cells in vitro. Dissociated IPCs formed monolayers that expanded into cellular networks and formed dense islet-like cell clusters upon reaching high density within 30 days of culture (Figure 3A). To define markers for further characterization of IPCs with potential islet regenerative properties, we performed flow cytometry to confirm expression of surface molecules identified in our transcriptomic analysis of highly differentially expressed genes clustering with islet progenitor, immature beta cell, and beta-cell disallowed genes (Figures 1, 2A). Flow cytometry analysis confirmed co-expression of CD9 and PROCR surface proteins on expanded IPCs (Figure 3B). The IPCs also internally expressed islet cell progenitor protein RGS16 corresponding to the single cell RNA-seq data, indicating its clustering with islet cell progenitor genes. RGS16 was previously identified as a marker for early pancreatic progenitors that is temporally expressed in IPCs prior to terminal maturation (79, 80). Dimensional reduction analysis heat mapping of protein expression by t-SNE confirmed high co-expression of CD9 and PROCR surface molecules overlapping with a large subset of IPCs expressing RGS16 (Figure 3C). Immunofluorescent staining showed RGS16 was selectively expressed in the IPC clusters of expanded IPCs which were devoid of insulin (Figure 4A). Overall, the results suggested that CD9+PROCR+ IPCs expand and form IPC clusters containing RGS16+ islet-like cells in a dedifferentiated or progenitor state.

Figure 3.

Panel A shows phase-contrast microscopy images of cell cultures at 6, 12, and 30 days, with three replicates per time point, and cultures forming spheroid-like structures over time. Panel B presents three histograms comparing fluorescence intensity for CD9, PROCR, and RGS16 markers, each with blue and red distribution curves. Panel C displays three t-SNE plots visualizing cellular clustering patterns for CD9, PROCR, and RGS16, with color gradients mapping cell populations.

Characterization of IPCs and formation of IPC clusters. (A) Micrograph brightfield (200×) images of expansion of IPCs and formation of IPC clusters within 30 days of culture. Flow cytometry analyses of pancreatic progenitor and beta cell dedifferentiation surface markers CD9 and PROCR and internal islet endocrine lineage marker RGS16 expressed in IPCs by (B) counts and fluorescent intensity and (C) t-distributed stochastic neighbor embedding (t-SNE) heat mapping of CD9, PROCR, and RGS16 protein expression. Data shown are representative results from at least three independent experiments.

Figure 4.

Panel A shows fluorescent microscopy of cell clusters labeled for insulin (INS, red) and RGS16 (green) at 100X magnification. Panel B displays separate and merged images of INS and RGS16 staining at higher magnification. Panel C presents immunostaining at 400X for INS (red), glucagon (GCG, green), and their merged images. Panel D shows dithizone staining images at 10X and 100X magnification highlighting islet organoids. Panel E contains bar graphs quantifying insulin release and stimulation index from islets and organoids under low and high glucose. Panel F presents a line graph of calcium signaling in response to potassium chloride stimulation over time. Panel G includes bar graphs quantifying glucagon release and stimulation index from islets and organoids, comparing low and high glucose.

Differentiation of RGS16+ IPC clusters into islet organoids by ISX9. Immunofluorescent staining of RGS16 and islet hormones INS and GCG in human IPCs treated with (A) DMSO (control) and (B,C) ISX9 for 14 days in vitro to assess for (B) INS (red)/RGS16 (green) and (C) INS (red)/GCG (green) cellular co-localization. (D) Dithizone staining of IPC organoids treated with ISX9 for 14 days. (E) Glucose-stimulated insulin secretion assay comparing human islet organoids to normal isolated islets. (F) Assessment of intracellular calcium release in islet organoids by KCl-induced depolarization. (G) Glucagon release in islet organoids in response to high (25 mM) and low (2.5 mM) glucose. Graphed values are expressed as mean ± SD. Asterisks indicate statistically significant differences low- and high-glucose conditions within each group (*p < 0.05, **p < 0.01, ***p < 0.001; two-tailed Student's t-test). Absence of an asterisk indicates no statistically significant difference. Data shown are representative of at least three independent experiments.

Our transcriptomic analysis indicated that CD9, PROCR, and RGS16 genes also clustered with cells expressing NFAT and HDAC signaling enzymes. We previously showed that small molecule differentiator isoxazole-9 (ISX9) could restore beta-cell function and prevent dedifferentiation by NFAT-mediated regulation of p300 and HDAC of beta-cell differentiation and disallowed genes at the chromatin level (47). Thus, we hypothesized that ISX9 could likewise induce differentiation or maturation of expanded IPCs that retained this signaling system. Treatment of expanded IPCs with ISX9 for 14 days resulted in selective expression of insulin and glucagon within islet organoids as determined by immunofluorescent staining (Figures 4B,C). The surrounding IPC monolayer remained largely unstained (Supplementary Figure S3). Notably, residual RGS16 expression was observed in the inner core of large islet organoids, suggesting that some of the core cells were not completely differentiated (Figure 4B). Likewise, some core organoid cells co-expressed both insulin and glucagon, indicating that these islet-like cells remained in an immature state (Figure 4C). However, most insulin-expressing organoid cells no longer expressed RGS16, and a large portion of the islet organoid cells expressed insulin and glucagon independently. Moreover, the islet organoids also intensely stained burgundy red with diphenylthiocarbazone (dithizone), suggesting enrichment of zinc-containing insulin granules, which are produced by mature beta cells (Figure 4D).

To assess functional maturity of islet organoids, we tested their ability to release insulin and glucagon in response to glucose. Indeed, the islet organoids released insulin in response to high glucose with stimulation indices comparable to those of freshly isolated human islets (Figure 4E). They also exhibited K+-induced depolarization as determined by calcium influx in response to 30 mM K+ (Figure 4F), suggesting functional KATP channels as expressed in mature beta cells. Furthermore, the islet organoids showed increased glucagon release in response to low glucose, indicative of alpha-like cell function (Figure 4G). These data indicate that the RGS16+ IPC clusters can be differentiated into functional glucose-responsive islet organoids within 14-day treatment with ISX9 in vitro.

ISX9 induces sequential activation of islet-lineage transcription factors that drive alpha- and beta-cell differentiation

To identify transcription factors that may contribute to islet organoid differentiation from IPCs in culture, we tracked expression of genes known to be determinants of islet endocrine lineages during defined stages of islet cell development. Time-course analysis showed NFATC2 to be one of the earliest genes expressed within 6 h of ISX9 stimulation (Figure 5). Early endocrine progenitor gene NGN3 was reduced and often undetectable within 14 days of ISX9 treatment. In contrast, islet differentiation transcription factors RFX6 and ND1 were highly inducible within 24 h, followed by induction of NKX2.2 and NKX6.1 occurring within 48 h. Beta-cell and alpha-cell restricted transcription factors MAFA and MAFB were expressed within 2 and 7 days, respectively. PAX6 and ARX, which are associated with differentiation of alpha cells, were progressively expressed alongside induction of beta-cell-lineage transcription factors. Finally, insulin and glucagon along with the SLC2A2 (GLUT2) transporter gene expression were detected within 7–14 days upon ISX9 treatment. These data indicate that IPC islet organoid differentiation in vitro recapitulates gene programming similar to what is observed during islet endocrine cell specification in stem cells and developing islets.

Figure 5.

Multi-panel bar graph displays fold gene expression levels for fifteen genes (NFATC2, PDX1, NEUROG3, RFX6, NEUROD1, NKX2-2, NKX6-1, MAFB, MAFA, PAX6, ARX, SLC2A2, INS, GCG) over time points from zero to fourteen days of ISX9 treatment, with error bars indicating variability.

Time-course analysis of islet cell lineage genes expressed during IPC islet organoid differentiation. Expression of mRNA for transcription factors involved in islet cell differentiation and maturation in IPCs treated with ISX9 for up to 14 days. Graphed values are expressed as mean ± SD. Data shown are results from at least three independent experiments.

CN and NFAT signaling is required to induce RFX6 and NEUROD1 gene expression in differentiating IPC islet organoids

RFX6 and NEUROD1 have been shown to be the earliest transcription factors that promote differentiation of endocrine progenitors into islet-specific cell lineages. Both transcription factors are also required to maintain beta-cell identity, maturation, and functional state (8184). Because ISX9 was previously shown to modulate calcium and CN/NFAT signaling in islet cells, we sought to determine if NFAT was required for activation of RFX6 or NEUROD1 genes during organoid differentiation. ISX9-induced differentiation of IPC organoids correlated with the rapid induction of NFATC2 prior to expression of RFX6 and NEUROD1 in comparison to other NFAT isoforms (Figures 5, 6A). Selective induction of NFATC2 expression by ISX9 was independent of CN activity, as it was insensitive to CN inhibitor FK506. Promoter-reporter assays showed increased RFX6 and NEUROD1 gene promoter activity after 24 h treatment with ISX9 (Figure 6B). Induction of RFX6 and NEUROD1 promoters was blocked by CN inhibitor FK506 or overexpression of a dominant negative NFAT (dnNFAT) protein containing a truncated PxIxIT box motif as compared to DMSO and mutated dnNFAT controls. These data indicate that ISX9 induced expression of both RFX6 and NEUROD1 at the gene promoter level in IPC organoids in a CN- and NFAT-dependent manner.

Figure 6.

Figure with three data panels labeled A, B, and C, showing bar graphs comparing DMSO, ISX9, and FK506 effects. Panel A displays NFATC gene expression, highlighting strong NFATC2 induction by ISX9 and FK506. Panel B presents fold promoter activity for RFX6 and NEUROD1 promoters, showing significant increases with ISX9, especially in wild-type and dominant negative NFAT conditions. Panel C shows fold enrichment from ChIP analyses at RFX6, NEUROD1, and NEUROG3 promoters, indicating differential enrichment for NFATc2, p300, and HDACs, with statistical significance denoted by asterisks. Each panel uses blue, light blue, and red bars for DMSO, ISX9, and FK506, respectively.

Requirement of CN/NFAT signaling to recruit p300 to RFX6 and NEUROD1 promoters during ISX9-induced IPC islet organoid differentiation (A) induction of NFAT family isoform genes in IPC clusters treated with ISX9 for 24 h in the presence of CN inhibitor FK506. (B) RFX6 and NEUROD1 promoter activation by ISX9 in IPCs in the presence of FK506 or transfected with gene vectors overexpressing dominant negative NFAT (dnNFAT) and mutated control (dnNFATm). (C) ChIP assay of association of NFATC2, p300, HDAC1, HDAC2, and HDAC3 with RFX6, NEUROD1, and NEUROG3 promoters upon 6 h treatment of IPCs with ISX9 with and without 24 h pretreatment with ITF2357. Graphed values are expressed as mean ± SD. Asterisks above bars indicate statistically significant differences (*p < 0.05, ***p < 0.001) in mean values for treatments based on a two-way ANOVA and Sidak's multiple comparison test. Data shown are results from at least three independent experiments using IPCs derived from three individual donors.

HDAC inhibition and activation of CN/NFAT signaling induces insulin gene expression in adult IPCs

We previously showed that calcium-dependent CN/NFAT is required for beta-cell differentiation and insulin gene transcription (47). Small molecule differentiation inducer ISX9 was able to prevent dedifferentiation of stressed islet beta cells by preserving intracellular calcium signaling and CN/NFATc2-mediated induction of beta-cell transcription factors and repression of disallowed genes. In contrast, extended exposure of islets to stress resulted in loss of CN/NFATc2 signaling, accumulation of HDACs on the RFX6 gene promoter, and beta-cell dedifferentiation. Thus, we hypothesized that inhibiting HDACs and reactivating CN/NFAT in IPC clusters would promote their differentiation into islet organoids.

To test this hypothesis, we pretreated IPCs with HDAC inhibitor ITF2357 for 24 h prior to treatment with ISX9 or inhibition of NFAT deactivating kinase Dyrk1a by harmine. Insulin gene transcription was induced within 10 days of exposure to both ISX9 and harmine, which in each case was accentuated by pretreatment with ITF2357 (Supplementary Figure S2). Both ISX9 and harmine showed enhanced effects to induce insulin expression in IPCs compared to treatment with modified end-stage differentiation protocols commonly used to stimulate endocrine cell progenitor stage to mature sc-islets (stages 5–7) in hESCs and iPSCs. These results suggest that CN/NFAT signaling can be targeted to pro-differentiate adult IPCs with relatively high proficiency.

NFATc2 mediates chromatin assembly of histone acetylation-modifying enzymes p300 and HDACs on the RFX6 and NEUROD1 gene promoters

To determine if NFATC2 directly binds to the RFX6 gene promoter, we performed chromatin immunoprecipitation (ChIP) assays on islet organoids cultured in ISX9 for 24 h. ChIP analysis revealed significant increases in enrichment of NFATC2 on the 5ʹ flanking region of the RFX6 and NEUROD1 gene promoters (Figure 6C). In contrast, ISX9 had no effect on NFATC2 binding to the upstream endocrine progenitor transcription factor NEUROG3. Association of NFAT with the RFX6 and NEUROD1 promoters was largely prevented by FK506, indicating the requirement of CN for NFAT-mediated transcription. Previous studies showed that ISX9 could enhance p300 acetyltransferase recruitment to the insulin gene promoter to acetylate histones in MIN6 beta cells (41). We therefore sought to determine effects of ISX9 to target chromatin-related proteins to the RFX6 and NEUROD1 gene promoters in islet organoids. ChIP analysis was performed on ISX9-treated islet organoids to assess DNA promoter assembly of NFATC2 and histone-modifying enzymes p300 and HDACs. NFATC2 association correlated with accumulation of p300 upon the RFX6 and NEUROD1 promoters within 6 h of ISX9 treatment (Figure 6C). By contrast, HDACs were depleted on the RFX6 and NEUROD1 promoters under conditions that stimulated NFATC2 binding. In each case, FK506 inhibited effects of ISX9 to promote p300 and diminish HDAC accumulation on the RFX6 promoter. In contrast, ISX9 and FK506 did not affect association of p300 or HDACs with the NGN3 promoter, indicating that ISX9-induced CN/NFAT signaling mediates specificity of p300 recruitment toward the RFX6 and NEUROD1 genes (Figure 4D). Pretreatment of IPC clusters with HDAC inhibitor ITF2357 (50 nM) enhanced the effects of ISX9 to recruit p300 to the RFX6 and NEUROD1 promoters and also induced a significant increase in the ratio of p300:HDAC accumulation on the NEUROG3 promoter. FK506 blocked effects of ITF2357 on the RFX6 and NEUROD1 promoters, but p300 and HDAC accumulation on the NGN3 promoter were unchanged. Increases in p300:HDAC ratios correlated with increased gene expression. Whereas ISX9 selectively induced transcriptional activity of the RFX6 and NEUROD1 genes, ITF2357 globally promoted transcription from all genes. The results delineate CN/NFAT-mediated displacement of HDACs by p300 to selectively activate the RFX6 and NEUROD1 genes in response to ISX9 and a global effect of ITF2357 to increase the ratio of p300:HDAC promoter accumulation on genes to enhance induction of transcriptional activity. These data suggest that CN/NFATc2-mediated recruitment of p300 and induction of the RFX6 and NEUROD1 genes bypasses requirements of NGN3 to promote differentiation of IPCs to an islet-like phenotype.

IPC-derived islet organoids are glucose- and GLP-1-responsive

To release appropriate and sustainable insulin in response to physiological demand, beta cells must regulate insulin production in response to changes in glucose and nutrient-responsive incretins including peptide hormone glucagon-like peptide 1 (GLP-1). Therefore, we assessed effects of high (16.7 mM) glucose and GLP-1 on insulin gene expression and output in IPC-derived islet organoids (Figure 7). ChIP analysis of the insulin promoter demonstrated binding of key transcription factors PDX1, NEUROD1, and MAFA known to regulate insulin gene transcription in mature beta cells (Figure 7A). NFATC2 and MAFA showed highest enrichment upon the insulin gene promoter in response to glucose and GLP-1. The effect of NFATC2 and MAFA was enhanced along with significant enrichment of PDX1 and NEUROD1 upon the insulin gene promoter when IPC clusters were primed for 24 h with ITF2357 prior to 24-hour treatment with ISX9. Islet organoids transfected with a luciferase insulin gene promoter-reporter showed upregulation of the insulin gene in response to glucose and GLP-1, corresponding to increased binding of NFATc2 with PDX-1, NeuroD1, and MafA to the insulin gene promoter (Figures 7A,B). Insulin promoter activity was stimulated more than 5-fold in the presence of high glucose and GLP-1, which was enhanced to more than 10-fold when IPC clusters were primed with ITF2357. To test effects of glucose and GLP-1 on insulin secretion, we performed glucose-stimulated insulin secretion assays on IPC-derived islet organoids. High glucose treatment of islet organoids for 2 h resulted in insulin release of 7.7 ± 2.1 pg/h/organoid and 17.0 ± 5.3 pg/h/organoid in the presence of GLP-1 (Figure 7C). Overall, these data indicate that differentiated islet organoids produce and release insulin in response to glucose and GLP-1 by mechanisms similar to those observed in mature pancreatic beta cells.

Figure 7.

Panel A shows a bar graph of fold enrichment for four transcription factors (NFATC2, PDX1, ND1, MAFA) at the INS gene promoter under different conditions, with bars indicating higher enrichment for NFATC2 and MAFA under G16.7 plus GLP-1 and ITF2357 treatments. Panel B presents a bar graph of fold promoter activity in three glucose conditions, revealing significantly increased activity with ITF2357, particularly under G16.7 plus GLP-1. Panel C displays a bar graph of insulin released per hour per organoid, similarly highlighting increased secretion with ITF2357 and highest under G16.7 plus GLP-1, with significance indicated by asterisks.

Glucose and GLP-1 responsiveness of differentiated IPC islet organoids. (A) ChIP assay of association of NFATC2, PDX1, ND1, and MAFA in islet organoids in response to 20 min treatment with high glucose (G16.7) and GLP-1. (B) Insulin-promoter activity in response to 24 h treatment with high glucose (G16.7) and GLP-1. (C) Glucose-stimulated insulin secretion assay of islet organoid insulin secretion in response to 2 h treatment with high glucose (G16.7) and GLP-1. Graphed values are expressed as mean ± SD. Asterisks above graphs indicate statistically significant differences (*p < 0.05) in mean values for treatments compared to 2.8 mM glucose controls based on a two-tailed Student's t test. Asterisks above bars indicate statistically significant differences (*p < 0.05, **p < 0.01) in mean values for treatments based on a two-way ANOVA and Sidak's multiple comparison test. Data shown are results from at least three independent experiments using islet cultures derived from three individual donors.

Discussion

A large body of evidence over the past century has indicated that the pancreas possesses regenerative capacity for both exocrine and endocrine tissue (8591). Several models of pancreatic injury have shown that repair and restoration are facilitated in part by stem cell progenitors, which are capable of regenerating pancreatic tissue (8592). However, the identity of adult islet progenitor cells remains unresolved, primarily due to the lack of specific markers for defining or tracking such populations. Moreover, the notion that adult stem/progenitor cells contribute to islet regeneration has been controversial, as lineage tracing studies in transgenic mice have suggested that increases in beta-cell mass after birth occur primarily through replication of pre-existing beta cells (40).

In this study, we identified and characterized expandable adult pancreatic cells, CD9+, PROCR+ IPCs, that give rise to a subset of RGS16+ IPC clusters with the capacity to differentiate into glucose-responsive islet organoids in vitro and in vivo. Using this model, we further explored the mechanisms governing islet lineage differentiation by interrogating developmental transcriptional programs activated during IPC-to-organoid transition.

Differentiation of IPC clusters into insulin- and glucagon-producing islet organoids could be driven by ISX9, a small molecule previously shown to preserve beta-cell identity through chromatin modulation. ISX9-induced differentiation was dependent on calcineurin (CN) signaling and binding of NFATC2 to the RFX6 and NEUROD1 gene promoters. This promoter association was accompanied by CN-dependent recruitment of the histone acetyltransferase p300 and displacement of histone deacetylases HDAC1-3, suggesting that transcriptional activation is regulated, at least in part, by site-specific chromatin acetylation. Pretreatment with the HDAC inhibitor ITF2357 globally increased p300 enrichment on the RFX6 promoter and enhanced islet organoid differentiation.

Collectively, these data suggest that CN/NFATC2 contributes to selective epigenetic induction of the RFX6 gene to bypass the need for NGN3, a transcription factor essential during embryonic islet development (6, 7). In contrast, induction of the NGN3 promoter to enhance the potency of differentiation by HDAC inhibition occurred independently of CN activity or binding of NFATC2. These distinct mechanisms define critical signaling components required for inducing genes that initiate differentiation of IPC clusters into islet organoids.

Importantly, induction of the RFX6 and NEUROD1 genes permitted expression of genes in islet organoids required for both terminally differentiated beta cells and alpha cells. The resulting mature islet organoids expressed and released insulin and glucagon in a glucose-regulated manner. The islet organoid beta-like cells activated canonical insulin transcription factors, including PDX1, NEUROD1, and MAFA, and exhibited NFATC2 binding to the insulin promoter in response to glucose and GLP-1, recapitulating signaling pathways used by mature beta cells to maintain glucose responsiveness.

Limitations of our study include the exclusive use of male mice, which does not account for potential sex-specific effects in diabetes pathophysiology or treatment response. The frequency and anatomical distribution of IPCs in native human pancreatic tissue remain to be determined and warrant further investigation. In addition, the relatively small sample size limits statistical power and may constrain the generalizability of these findings.

In vivo studies were performed using expanded IPCs co-transplanted with marginal human islets to assess whether IPCs could enhance graft function under suboptimal conditions. Fully differentiated organoids were not transplanted in the present study due to current limitations in generating sufficient organoid mass to match standard human islet equivalents used in the transplantation model. The relatively modest magnitude of glycemic improvement likely reflects both limited cell dose and incomplete functional maturation at the time of transplantation. Future studies will focus on scaling IPC expansion and differentiation, as well as optimizing protocols to increase islet organoid graft mass and functional output prior to transplantation.

The anatomical and physiological basis of the transient residual glycemic effects observed following nephrectomy was not directly determined. Ongoing investigations are evaluating whether IPC migration contributes to restoration of pancreatic function; however, the observed effects may also reflect indirect or host-mediated cellular mechanisms rather than sustained extra-graft insulin production.

Alpha cells play an important role in counterregulatory responses to hypoglycemia and in paracrine modulation of β-cell function. Although definitive confirmation of fully mature α-cell identity was not established, ISX9-induced IPC-derived islet organoids demonstrated upregulation of ARX and PAX6, distinct regions of glucagon expression, and glucose-responsive glucagon secretion under low-glucose conditions. These findings support activation of α-like transcriptional and functional programs within differentiated clusters. However, the precise extent of α-cell maturation and spatial organization remains to be determined and may influence the overall functional integration of IPC-derived organoids.

Terminology describing three-dimensional endocrine aggregates varies across the literature and includes “pseudoislets”, “spheroids”, and “islet organoids”. The IPC-derived structures described here are self-organized, multi-lineage endocrine clusters that fall within the typical size range of isolated human islets (approximately 50–300 µm) and exhibit glucose-responsive hormone secretion. While complete recapitulation of native islet cytoarchitecture was not definitively demonstrated, these structures fulfill key functional and compositional criteria consistent with islet organoids. Further refinement of spatial organization and endocrine cell ratios may enhance architectural fidelity to native islets.

Overall, these findings provide new insight to methodologies and mechanisms for expansion and differentiation of adult human IPCs into islet organoids (Figure 8). While recent advances have demonstrated the ability to derive beta cells from human pluripotent stem cells (1, 2, 9395), no naturally existing adult islet progenitor cell has been definitively identified to selectively regenerate islet organoids in humans. We report that IPC clusters selectively express RGS16, an islet progenitor marker, and can be differentiated by ISX9 via CN/NFAT-mediated activation of RFX6. This process is enhanced by ITF2357, which facilitates chromatin remodeling by NFAT to induce activation of genes required for driving islet cell differentiation and maturation.

Figure 8.

Flowchart diagram showing steps for IPC identification and expansion: starting from adult human pancreatic tissue, leading to identification and enrichment of IPCs, formation of RGS16-positive clusters, ISX9-mediated islet cell differentiation with gene regulation pathways, and resulting in functional islet-like organoids.

Schematic overview of IPC isolation, expansion, and differentiation. Adult human pancreatic tissue obtained from islet cell isolation fractions was expanded in vitro to generate a CD9+ PROCR+ IPC-enriched population. IPCs were identified using transcriptomic and phenotypic analyses (scRNA-seq, flow cytometry, and immunofluorescence). An RGS16+ organoid-forming subset was characterized within the expanded population. IPC clusters were subsequently subjected to ISX9-mediated differentiation. ISX9 treatment stimulated calcineurin (CN)/NFAT signaling, promoted NFATC2–p300 association and binding at RFX6 and NEUROD1 promoters, and induced downstream endocrine transcriptional programs (NGN3, RFX6, NEUROD1, NKX2.2, NKX6.1, MAFA), resulting in functional islet organoids.

The identification of signaling pathways and transcriptional targets that govern adult IPC differentiation into functional islet organoids represents a critical advance toward regenerative medicine strategies for diabetes. These findings may enable the development of scalable, cell-based and pharmacologically directed therapies to restore islet endocrine function in individuals with pancreatic disease or diabetes.

Acknowledgments

We thank Jean Philippe Blanck, Rauf Shahbazov, and Faisal Kunnathodi for technical assistance. We thank Ashley Hopkins at Baylor Scott & White Research Institute for administrative support throughout the development and filing of the related patent application. We also acknowledge the Baylor Healthcare System Foundation for funding support.

Funding Statement

The author(s) declared that financial support was received for this work and/or its publication. Baylor Scott and White Dallas Foundation. This work was supported by Breakthrough T1D (grant number 3-SRA-2025-1633-S-B).

Footnotes

Edited by: Shaojun Shi, Southern Medical University, China

Reviewed by: Rosalia Fernandez Alonso, University of León, Spain

Marija Đorđević, University of Belgrade, Serbia

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: https://www.ncbi.nlm.nih.gov/, PRJNA1290648; SAMN49931282; SRS25765186.

Ethics statement

The requirement of ethical approval was waived by Waiver granted under institutional policy for studies using de-identified human tissues obtained from an Organ Procurement Organization (Southwest Transplant Alliance, Dallas, TX), as these do not constitute human subjects research under U.S. federal regulations (45 CFR 46.102). for the studies on humans because Ethical approval was waived because the study used de-identified human pancreatic tissue obtained from an accredited Organ Procurement Organization (Southwest Transplant Alliance, Dallas, TX). The material was provided for research purposes with no identifiable donor information, and therefore did not meet the regulatory definition of human subjects research under 45 CFR 46.102. The studies were conducted in accordance with the local legislation and institutional requirements. Written informed consent for participation was not required from the participants or the participants' legal guardians/next of kin in accordance with the national legislation and institutional requirements. The human samples used in this study were acquired from a by- product of routine care or industry. The animal study was approved by Institutional Animal Care and Use Committee (IACUC) of the Dallas VA Medical Center. The study was conducted in accordance with the local legislation and institutional requirements.

Author contributions

CD: Formal analysis, Investigation, Methodology, Visualization, Writing – review & editing. JK: Formal analysis, Investigation, Methodology, Visualization, Writing – review & editing. JeK: Investigation, Writing – review & editing. JM: Investigation, Writing – review & editing. SV: Investigation, Writing – review & editing. PS: Investigation, Writing – review & editing. BN: Writing – review & editing, Resources. ML: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Software, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing.

Conflict of interest

The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

The author ML declared that they were an editorial board member of Frontiers at the time of submission. This had no impact on the peer review process and the final decision.

Generative AI statement

The author(s) declared that generative AI was not used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher's note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/frtra.2026.1740314/full#supplementary-material

Datasheet1.pdf (267.2KB, pdf)

References

  • 1.Rezania A, Bruin JE, Arora P, Rubin A, Batushansky I, Asadi A, et al. Reversal of diabetes with insulin-producing cells derived in vitro from human pluripotent stem cells. Nat Biotechnol. (2014) 32(11):1121–33. 10.1038/nbt.3033 [DOI] [PubMed] [Google Scholar]
  • 2.Pagliuca FW, Millman JR, Gurtler M, Segel M, Van Dervort A, Ryu JH, et al. Generation of functional human pancreatic beta cells in vitro. Cell. (2014) 159(2):428–39. 10.1016/j.cell.2014.09.040 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Balboa D, Barsby T, Lithovius V, Saarimaki-Vire J, Omar-Hmeadi M, Dyachok O, et al. Functional, metabolic and transcriptional maturation of human pancreatic islets derived from stem cells. Nat Biotechnol. (2022) 40(7):1042–55. 10.1038/s41587-022-01219-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Jonsson J, Carlsson L, Edlund T, Edlund H. Insulin-promoter-factor 1 is required for pancreas development in mice. Nature. (1994) 371(6498):606–9. 10.1038/371606a0 [DOI] [PubMed] [Google Scholar]
  • 5.McGrath PS, Watson CL, Ingram C, Helmrath MA, Wells JM. The basic Helix-loop-Helix transcription factor NEUROG3 is required for development of the human endocrine pancreas. Diabetes. (2015) 64(7):2497–505. 10.2337/db14-1412 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Salisbury RJ, Blaylock J, Berry AA, Jennings RE, De Krijger R, Piper Hanley K, et al. The window period of NEUROGENIN3 during human gestation. Islets. (2014) 6(3):e954436. 10.4161/19382014.2014.954436 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Gradwohl G, Dierich A, LeMeur M, Guillemot F. Neurogenin3 is required for the development of the four endocrine cell lineages of the pancreas. Proc Natl Acad Sci U S A. (2000) 97(4):1607–11. 10.1073/pnas.97.4.1607 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Schwitzgebel VM, Scheel DW, Conners JR, Kalamaras J, Lee JE, Anderson DJ, et al. Expression of neurogenin3 reveals an islet cell precursor population in the pancreas. Development. (2000) 127(16):3533–42. 10.1242/dev.127.16.3533 [DOI] [PubMed] [Google Scholar]
  • 9.Naya FJ, Huang HP, Qiu Y, Mutoh H, DeMayo FJ, Leiter AB, et al. Diabetes, defective pancreatic morphogenesis, and abnormal enteroendocrine differentiation in BETA2/neuroD-deficient mice. Genes Dev. (1997) 11(18):2323–34. 10.1101/gad.11.18.2323 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Huang HP, Liu M, El-Hodiri HM, Chu K, Jamrich M, Tsai MJ. Regulation of the pancreatic islet-specific gene BETA2 (neuroD) by neurogenin 3. Mol Cell Biol. (2000) 20(9):3292–307. 10.1128/MCB.20.9.3292-3307.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Huang HP, Chu K, Nemoz-Gaillard E, Elberg D, Tsai MJ. Neogenesis of beta-cells in adult BETA2/NeuroD-deficient mice. Mol Endocrinol. (2002) 16(3):541–51. 10.1210/mend.16.3.0784 [DOI] [PubMed] [Google Scholar]
  • 12.Sussel L, Kalamaras J, Hartigan-O'Connor DJ, Meneses JJ, Pedersen RA, Rubenstein JL, et al. Mice lacking the homeodomain transcription factor Nkx2.2 have diabetes due to arrested differentiation of pancreatic beta cells. Development. (1998) 125(12):2213–21. 10.1242/dev.125.12.2213 [DOI] [PubMed] [Google Scholar]
  • 13.Sander M, Sussel L, Conners J, Scheel D, Kalamaras J, Dela Cruz F, et al. Homeobox gene Nkx6.1 lies downstream of Nkx2.2 in the major pathway of beta-cell formation in the pancreas. Development. (2000) 127(24):5533–40. 10.1242/dev.127.24.5533 [DOI] [PubMed] [Google Scholar]
  • 14.Artner I, Hang Y, Mazur M, Yamamoto T, Guo M, Lindner J, et al. Mafa and MafB regulate genes critical to beta-cells in a unique temporal manner. Diabetes. (2010) 59(10):2530–9. 10.2337/db10-0190 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Hogrebe NJ, Ishahak M, Millman JR. Developments in stem cell-derived islet replacement therapy for treating type 1 diabetes. Cell Stem Cell. (2023) 30(5):530–48. 10.1016/j.stem.2023.04.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Merkle FT, Ghosh S, Kamitaki N, Mitchell J, Avior Y, Mello C, et al. Human pluripotent stem cells recurrently acquire and expand dominant negative P53 mutations. Nature. (2017) 545(7653):229–33. 10.1038/nature22312 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Sordi V, Pellegrini S, Piemonti L. Immunological issues after stem cell-based beta cell replacement. Curr Diab Rep. (2017) 17(9):68. 10.1007/s11892-017-0901-4 [DOI] [PubMed] [Google Scholar]
  • 18.Volarevic V, Markovic BS, Gazdic M, Volarevic A, Jovicic N, Arsenijevic N, et al. Ethical and safety issues of stem cell-based therapy. Int J Med Sci. (2018) 15(1):36–45. 10.7150/ijms.21666 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Hou P, Li Y, Zhang X, Liu C, Guan J, Li H, et al. Pluripotent stem cells induced from mouse somatic cells by small-molecule compounds. Science. (2013) 341(6146):651–4. 10.1126/science.1239278 [DOI] [PubMed] [Google Scholar]
  • 20.Zhao T, Fu Y, Zhu J, Liu Y, Zhang Q, Yi Z, et al. Single-cell RNA-seq reveals dynamic early embryonic-like programs during chemical reprogramming. Cell Stem Cell. (2018) 23(1):31–45.e7. 10.1016/j.stem.2018.05.025 [DOI] [PubMed] [Google Scholar]
  • 21.Guan J, Wang G, Wang J, Zhang Z, Fu Y, Cheng L, et al. Chemical reprogramming of human somatic cells to pluripotent stem cells. Nature. (2022) 605(7909):325–31. 10.1038/s41586-022-04593-5 [DOI] [PubMed] [Google Scholar]
  • 22.Du Y, Liang Z, Wang S, Sun D, Wang X, Liew SY, et al. Human pluripotent stem-cell-derived islets ameliorate diabetes in non-human primates. Nat Med. (2022) 28(2):272–82. 10.1038/s41591-021-01645-7 [DOI] [PubMed] [Google Scholar]
  • 23.Liuyang S, Wang G, Wang Y, He H, Lyu Y, Cheng L, et al. Highly efficient and rapid generation of human pluripotent stem cells by chemical reprogramming. Cell Stem Cell. (2023) 30(4):450–9.e9. 10.1016/j.stem.2023.02.008 [DOI] [PubMed] [Google Scholar]
  • 24.Bonner-Weir S, Taneja M, Weir GC, Tatarkiewicz K, Song KH, Sharma A, et al. In vitro cultivation of human islets from expanded ductal tissue. Proc Natl Acad Sci U S A. (2000) 97(14):7999–8004. 10.1073/pnas.97.14.7999 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Gao R, Ustinov J, Korsgren O, Otonkoski T. In vitro neogenesis of human islets reflects the plasticity of differentiated human pancreatic cells. Diabetologia. (2005) 48(11):2296–304. 10.1007/s00125-005-1935-8 [DOI] [PubMed] [Google Scholar]
  • 26.Yatoh S, Dodge R, Akashi T, Omer A, Sharma A, Weir GC, et al. Differentiation of affinity-purified human pancreatic duct cells to beta-cells. Diabetes. (2007) 56(7):1802–9. 10.2337/db06-1670 [DOI] [PubMed] [Google Scholar]
  • 27.Davani B, Ikonomou L, Raaka BM, Geras-Raaka E, Morton RA, Marcus-Samuels B, et al. Human islet-derived precursor cells are mesenchymal stromal cells that differentiate and mature to hormone-expressing cells in vivo. Stem Cells. (2007) 25(12):3215–22. 10.1634/stemcells.2007-0323 [DOI] [PubMed] [Google Scholar]
  • 28.Limbert C, Jakob F, Ebert R, Path G, Niu X, Bretzel G, et al. Human pancreatic islet-derived precursor cells display mesenchymal stem cell features and differentiation capacity. J Stem Cells Regen Med. (2007) 2(1):93–4. 10.1055/s-2007-982168 [DOI] [PubMed] [Google Scholar]
  • 29.Bonner-Weir S, Inada A, Yatoh S, Li WC, Aye T, Toschi E, et al. Transdifferentiation of pancreatic ductal cells to endocrine beta-cells. Biochem Soc Trans. (2008) 36(Pt 3):353–6. 10.1042/BST0360353 [DOI] [PubMed] [Google Scholar]
  • 30.Inada A, Nienaber C, Katsuta H, Fujitani Y, Levine J, Morita R, et al. Carbonic anhydrase II-positive pancreatic cells are progenitors for both endocrine and exocrine pancreas after birth. Proc Natl Acad Sci U S A. (2008) 105(50):19915–9. 10.1073/pnas.0805803105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Zanini C, Bruno S, Mandili G, Baci D, Cerutti F, Cenacchi G, et al. Differentiation of mesenchymal stem cells derived from pancreatic islets and bone marrow into islet-like cell phenotype. PLoS One. (2011) 6(12):e28175. 10.1371/journal.pone.0028175 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Gopurappilly R, Bhat V, Bhonde R. Pancreatic tissue resident mesenchymal stromal cell (MSC)-like cells as a source of in vitro islet neogenesis. J Cell Biochem. (2013) 114(10):2240–7. 10.1002/jcb.24572 [DOI] [PubMed] [Google Scholar]
  • 33.Jara C, Oyarzun-Ampuero F, Carrion F, Gonzalez-Echeverria E, Cappelli C, Caviedes P. Microencapsulation of cellular aggregates composed of differentiated insulin and glucagon-producing cells from human mesenchymal stem cells derived from adipose tissue. Diabetol Metab Syndr. (2020) 12:66. 10.1186/s13098-020-00573-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Qadir MMF, Alvarez-Cubela S, Klein D, van Dijk J, Muniz-Anquela R, Moreno-Hernandez YB, et al. Single-cell resolution analysis of the human pancreatic ductal progenitor cell niche. Proc Natl Acad Sci U S A. (2020) 117(20):10876–87. 10.1073/pnas.1918314117 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Ghoneim MA, Gabr MM, Refaie AF, El-Halawani SM, Al-Issawi MM, Elbassiouny BL, et al. Transplantation of insulin-producing cells derived from human mesenchymal stromal/stem cells into diabetic humanized mice. Stem Cell Res Ther. (2022) 13(1):350. 10.1186/s13287-022-03048-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Gabr MM, El-Halawani SM, Refaie AF, Khater SM, Ismail AM, Karras MS, et al. Modulation of naive mesenchymal stromal cells by extracellular vesicles derived from insulin-producing cells: an in vitro study. Sci Rep. (2024) 14(1):17844. 10.1038/s41598-024-68104-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Seaberg RM, Smukler SR, Kieffer TJ, Enikolopov G, Asghar Z, Wheeler MB, et al. Clonal identification of multipotent precursors from adult mouse pancreas that generate neural and pancreatic lineages. Nat Biotechnol. (2004) 22(9):1115–24. 10.1038/nbt1004 [DOI] [PubMed] [Google Scholar]
  • 38.Smukler SR, Arntfield ME, Razavi R, Bikopoulos G, Karpowicz P, Seaberg R, et al. The adult mouse and human pancreas contain rare multipotent stem cells that express insulin. Cell Stem Cell. (2011) 8(3):281–93. 10.1016/j.stem.2011.01.015 [DOI] [PubMed] [Google Scholar]
  • 39.Razavi R, Najafabadi HS, Abdullah S, Smukler S, Arntfield M, van der Kooy D. Diabetes enhances the proliferation of adult pancreatic multipotent progenitor cells and biases their differentiation to more beta-cell production. Diabetes. (2015) 64(4):1311–23. 10.2337/db14-0070 [DOI] [PubMed] [Google Scholar]
  • 40.Dor Y, Brown J, Martinez OI, Melton DA. Adult pancreatic beta-cells are formed by self-duplication rather than stem-cell differentiation. Nature. (2004) 429(6987):41–6. 10.1038/nature02520 [DOI] [PubMed] [Google Scholar]
  • 41.Russ HA, Bar Y, Ravassard P, Efrat S. In vitro proliferation of cells derived from adult human beta-cells revealed by cell-lineage tracing. Diabetes. (2008) 57(6):1575–83. 10.2337/db07-1283 [DOI] [PubMed] [Google Scholar]
  • 42.Russ HA, Sintov E, Anker-Kitai L, Friedman O, Lenz A, Toren G, et al. Insulin-producing cells generated from dedifferentiated human pancreatic beta cells expanded in vitro. PLoS One. (2011) 6(9):e25566. 10.1371/journal.pone.0025566 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Ouziel-Yahalom L, Zalzman M, Anker-Kitai L, Knoller S, Bar Y, Glandt M, et al. Expansion and redifferentiation of adult human pancreatic islet cells. Biochem Biophys Res Commun. (2006) 341(2):291–8. 10.1016/j.bbrc.2005.12.187 [DOI] [PubMed] [Google Scholar]
  • 44.Gallo R, Gambelli F, Gava B, Sasdelli F, Tellone V, Masini M, et al. Generation and expansion of multipotent mesenchymal progenitor cells from cultured human pancreatic islets. Cell Death Differ. (2007) 14(11):1860–71. 10.1038/sj.cdd.4402199 [DOI] [PubMed] [Google Scholar]
  • 45.Bar Y, Russ HA, Sintov E, Anker-Kitai L, Knoller S, Efrat S. Redifferentiation of expanded human pancreatic beta-cell-derived cells by inhibition of the NOTCH pathway. J Biol Chem. (2012) 287(21):17269–80. 10.1074/jbc.M111.319152 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Sintov E, Nathan G, Knoller S, Pasmanik-Chor M, Russ HA, Efrat S. Inhibition of ZEB1 expression induces redifferentiation of adult human beta cells expanded in vitro. Sci Rep. (2015) 5:13024. 10.1038/srep13024 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Darden CM, Vasu S, Mattke J, Liu Y, Rhodes CJ, Naziruddin B, et al. Calcineurin/NFATc2 and PI3K/AKT signaling maintains beta-cell identity and function during metabolic and inflammatory stress. iScience. (2022) 25(4):104125. 10.1016/j.isci.2022.104125 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Chow CW, Rincon M, Davis RJ. Requirement for transcription factor NFAT in interleukin-2 expression. Mol Cell Biol. (1999) 19(3):2300–7. 10.1128/MCB.19.3.2300 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Lawrence MC, Naziruddin B, Levy MF, Jackson A, McGlynn K. Calcineurin/nuclear factor of activated T cells and MAPK signaling induce TNF-{alpha} gene expression in pancreatic islet endocrine cells. J Biol Chem. (2011) 286(2):1025–36. 10.1074/jbc.M110.158675 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Lawrence MC, Borenstein-Auerbach N, McGlynn K, Kunnathodi F, Shahbazov R, Syed I, et al. NFAT Targets signaling molecules to gene promoters in pancreatic beta-cells. Mol Endocrinol. (2015) 29(2):274–88. 10.1210/me.2014-1066 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Yoshimatsu G, Kunnathodi F, Saravanan PB, Shahbazov R, Chang C, Darden CM, et al. Pancreatic beta cell-derived IP-10/CXCL10 isletokine mediates early loss of graft function in islet cell transplantation. Diabetes. (2017) 66(11):2857–67. 10.2337/db17-0578 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Hu BC. The human body at cellular resolution: the NIH human biomolecular atlas program. Nature. (2019) 574(7777):187–92. 10.1038/s41586-019-1629-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Jain S, Pei L, Spraggins JM, Angelo M, Carson JP, Gehlenborg N, et al. Advances and prospects for the human BioMolecular atlas program (HuBMAP). Nat Cell Biol. (2023) 25(8):1089–100. 10.1038/s41556-023-01194-w [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Hao Y, Hao S, Andersen-Nissen E, Mauck WM, 3rd, Zheng S, Butler A, et al. Integrated analysis of multimodal single-cell data. Cell. (2021) 184(13):3573–87.e29. 10.1016/j.cell.2021.04.048 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Franzen O, Gan LM, Bjorkegren JLM. PanglaoDB: a web server for exploration of mouse and human single-cell RNA sequencing data. Database. (2019) 2019:baz046. 10.1093/database/baz046 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Zhang X, Lan Y, Xu J, Quan F, Zhao E, Deng C, et al. Cellmarker: a manually curated resource of cell markers in human and mouse. Nucleic Acids Res. (2019) 47(D1):D721–D8. 10.1093/nar/gky900 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. (2005) 102(43):15545–50. 10.1073/pnas.0506580102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, et al. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium . Nat Genet. (2000) 25(1):25–9. 10.1038/75556 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Gene Ontology C, Aleksander SA, Balhoff J, Carbon S, Cherry JM, Drabkin HJ, et al. The gene ontology knowledgebase in 2023. Genetics. (2023) 224(1):iyad031. 10.1093/genetics/iyad031 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Gershengorn MC, Hardikar AA, Wei C, Geras-Raaka E, Marcus-Samuels B, Raaka BM. Epithelial-to-mesenchymal transition generates proliferative human islet precursor cells. Science. (2004) 306(5705):2261–4. 10.1126/science.1101968 [DOI] [PubMed] [Google Scholar]
  • 61.Davani B, Ariely S, Ikonomou L, Oron Y, Gershengorn MC. Human islet-derived precursor cells can cycle between epithelial clusters and mesenchymal phenotypes. J Cell Mol Med. (2009) 13(8B):2570–81. 10.1111/j.1582-4934.2008.00570.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Russ HA, Ravassard P, Kerr-Conte J, Pattou F, Efrat S. Epithelial-mesenchymal transition in cells expanded in vitro from lineage-traced adult human pancreatic beta cells. PLoS One. (2009) 4(7):e6417. 10.1371/journal.pone.0006417 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Dorrell C, Schug J, Canaday PS, Russ HA, Tarlow BD, Grompe MT, et al. Human islets contain four distinct subtypes of beta cells. Nat Commun. (2016) 7:11756. 10.1038/ncomms11756 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Qadir MMF, Alvarez-Cubela S, Klein D, Lanzoni G, Garcia-Santana C, Montalvo A, et al. P2RY1/ALK3-expressing cells within the adult human exocrine pancreas are BMP-7 expandable and exhibit progenitor-like characteristics. Cell Rep. (2018) 22(9):2408–20. 10.1016/j.celrep.2018.02.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Li X, Yang KY, Chan VW, Leung KT, Zhang XB, Wong AS, et al. Single-cell RNA-seq reveals that CD9 is a negative marker of glucose-responsive pancreatic beta-like cells derived from human pluripotent stem cells. Stem Cell Rep. (2020) 15(5):1111–26. 10.1016/j.stemcr.2020.09.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Wang D, Wang J, Bai L, Pan H, Feng H, Clevers H, et al. Long-term expansion of pancreatic islet organoids from resident procr(+) progenitors. Cell. (2020) 180(6):1198–211.e19. 10.1016/j.cell.2020.02.048 [DOI] [PubMed] [Google Scholar]
  • 67.Salinno C, Buttner M, Cota P, Tritschler S, Tarquis-Medina M, Bastidas-Ponce A, et al. CD81 Marks immature and dedifferentiated pancreatic beta-cells. Mol Metab. (2021) 49:101188. 10.1016/j.molmet.2021.101188 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Ioannou M, Serafimidis I, Arnes L, Sussel L, Singh S, Vasiliou V, et al. ALDH1B1 Is a potential stem/progenitor marker for multiple pancreas progenitor pools. Dev Biol. (2013) 374(1):153–63. 10.1016/j.ydbio.2012.10.030 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Anastasiou V, Ninou E, Alexopoulou D, Stertmann J, Muller A, Dahl A, et al. Aldehyde dehydrogenase activity is necessary for beta cell development and functionality in mice. Diabetologia (2016) 59(1):139–50. 10.1007/s00125-015-3784-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Lawrence MC, Bhatt HS, Watterson JM, Easom RA. Regulation of insulin gene transcription by a Ca(2+)-responsive pathway involving calcineurin and nuclear factor of activated T cells. Mol Endocrinol. (2001) 15(10):1758–67. 10.1210/mend.15.10.0702 [DOI] [PubMed] [Google Scholar]
  • 71.Lawrence MC, Bhatt HS, Easom RA. NFAT Regulates insulin gene promoter activity in response to synergistic pathways induced by glucose and glucagon-like peptide-1. Diabetes. (2002) 51(3):691–8. 10.2337/diabetes.51.3.691 [DOI] [PubMed] [Google Scholar]
  • 72.Keller MP, Paul PK, Rabaglia ME, Stapleton DS, Schueler KL, Broman AT, et al. The transcription factor Nfatc2 regulates beta-cell proliferation and genes associated with type 2 diabetes in mouse and human islets. PLoS Genet. (2016) 12(12):e1006466. 10.1371/journal.pgen.1006466 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Zhao J, Zong W, Zhao Y, Gou D, Liang S, Shen J, et al. In vivo imaging of beta-cell function reveals glucose-mediated heterogeneity of beta-cell functional development. eLife. (2019) 8:e41540. 10.7554/eLife.41540 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Miranda JG, Schleicher WE, Wells KL, Ramirez DG, Landgrave SP, Benninger RKP. Dynamic changes in beta-cell [Ca(2+)] regulate NFAT activation, gene transcription, and islet gap junction communication. Mol Metab. (2022) 57:101430. 10.1016/j.molmet.2021.101430 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Simonett SP, Shin S, Herring JA, Bacher R, Smith LA, Dong C, et al. Identification of direct transcriptional targets of NFATC2 that promote beta cell proliferation. J Clin Invest. (2021) 131(21):e144833. 10.1172/JCI144833 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Gao R, Ustinov J, Pulkkinen MA, Lundin K, Korsgren O, Otonkoski T. Characterization of endocrine progenitor cells and critical factors for their differentiation in human adult pancreatic cell culture. Diabetes. (2003) 52(8):2007–15. 10.2337/diabetes.52.8.2007 [DOI] [PubMed] [Google Scholar]
  • 77.Sordi V, Melzi R, Mercalli A, Formicola R, Doglioni C, Tiboni F, et al. Mesenchymal cells appearing in pancreatic tissue culture are bone marrow-derived stem cells with the capacity to improve transplanted islet function. Stem Cells. (2010) 28(1):140–51. 10.1002/stem.259 [DOI] [PubMed] [Google Scholar]
  • 78.Loomans CJM, Williams Giuliani N, Balak J, Ringnalda F, van Gurp L, Huch M, et al. Expansion of adult human pancreatic tissue yields organoids harboring progenitor cells with endocrine differentiation potential. Stem Cell Rep. (2018) 10(3):712–24. 10.1016/j.stemcr.2018.02.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Villasenor A, Wang ZV, Rivera LB, Ocal O, Asterholm IW, Scherer PE, et al. Rgs16 and Rgs8 in embryonic endocrine pancreas and mouse models of diabetes. Dis Model Mech. (2010) 3(9–10):567–80. 10.1242/dmm.003210 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Pashkov V, Huang J, Parameswara VK, Kedzierski W, Kurrasch DM, Tall GG, et al. Regulator of G protein signaling (RGS16) inhibits hepatic fatty acid oxidation in a carbohydrate response element-binding protein (ChREBP)-dependent manner. J Biol Chem. (2011) 286(17):15116–25. 10.1074/jbc.M110.216234 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Piccand J, Strasser P, Hodson DJ, Meunier A, Ye T, Keime C, et al. Rfx6 maintains the functional identity of adult pancreatic beta cells. Cell Rep. (2014) 9(6):2219–32. 10.1016/j.celrep.2014.11.033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Smith SB, Qu HQ, Taleb N, Kishimoto NY, Scheel DW, Lu Y, et al. Rfx6 directs islet formation and insulin production in mice and humans. Nature. (2010) 463(7282):775–80. 10.1038/nature08748 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Bohuslavova R, Smolik O, Malfatti J, Berkova Z, Novakova Z, Saudek F, et al. NEUROD1 Is required for the early alpha and beta endocrine differentiation in the pancreas. Int J Mol Sci. (2021) 22(13):6713. 10.3390/ijms22136713 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Bohuslavova R, Fabriciova V, Smolik O, Lebron-Mora L, Abaffy P, Benesova S, et al. NEUROD1 Reinforces endocrine cell fate acquisition in pancreatic development. Nat Commun. (2023) 14(1):5554. 10.1038/s41467-023-41306-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85.Cecil RL. On hypertrophy and regeneration of the islands of langerhans. J Exp Med. (1911) 14(5):500–19. 10.1084/jem.14.5.500 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Martin JM, Gregor WH, Lacy PE, Evens RG. The effect of hyperglycemia upon islet regeneration in rats. Diabetes. (1963) 12:538–44. 10.2337/diab.12.6.538 [DOI] [PubMed] [Google Scholar]
  • 87.Fitzgerald PJ, Carol BM, Rosenstock L. Pancreatic acinar cell regeneration. Nature. (1966) 212(5062):594–6. 10.1038/212594a0 [DOI] [PubMed] [Google Scholar]
  • 88.Steiner H, Oelz O, Zahnd G, Foresch ER. Studies on islet cell regeneration, hyperplasia and intrainsular cellular interrelations in long lasting streptozotocin diabetes in rats. Diabetologia. (1970) 6(6):558–64. 10.1007/BF00418221 [DOI] [PubMed] [Google Scholar]
  • 89.Brockenbrough JS, Weir GC, Bonner-Weir S. Discordance of exocrine and endocrine growth after 90% pancreatectomy in rats. Diabetes. (1988) 37(2):232–6. 10.2337/diab.37.2.232 [DOI] [PubMed] [Google Scholar]
  • 90.Bonner-Weir S, Baxter LA, Schuppin GT, Smith FE. A second pathway for regeneration of adult exocrine and endocrine pancreas. A possible recapitulation of embryonic development. Diabetes. (1993) 42(12):1715–20. 10.2337/diab.42.12.1715 [DOI] [PubMed] [Google Scholar]
  • 91.Peshavaria M, Larmie BL, Lausier J, Satish B, Habibovic A, Roskens V, et al. Regulation of pancreatic beta-cell regeneration in the normoglycemic 60% partial-pancreatectomy mouse. Diabetes. (2006) 55(12):3289–98. 10.2337/db06-0017 [DOI] [PubMed] [Google Scholar]
  • 92.Xu X, D'Hoker J, Stange G, Bonne S, De Leu N, Xiao X, et al. Beta cells can be generated from endogenous progenitors in injured adult mouse pancreas. Cell. (2008) 132(2):197–207. 10.1016/j.cell.2007.12.015 [DOI] [PubMed] [Google Scholar]
  • 93.Jeon K, Lim H, Kim JH, Thuan NV, Park SH, Lim YM, et al. Differentiation and transplantation of functional pancreatic beta cells generated from induced pluripotent stem cells derived from a type 1 diabetes mouse model. Stem Cells Dev. (2012) 21(14):2642–55. 10.1089/scd.2011.0665 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94.Lahmy R, Soleimani M, Sanati MH, Behmanesh M, Kouhkan F, Mobarra N. MiRNA-375 promotes beta pancreatic differentiation in human induced pluripotent stem (hiPS) cells. Mol Biol Rep. (2014) 41(4):2055–66. 10.1007/s11033-014-3054-4 [DOI] [PubMed] [Google Scholar]
  • 95.Haller C, Piccand J, De Franceschi F, Ohi Y, Bhoumik A, Boss C, et al. Macroencapsulated human iPSC-derived pancreatic progenitors protect against STZ-induced hyperglycemia in mice. Stem Cell Rep. (2019) 12(4):787–800. 10.1016/j.stemcr.2019.02.002 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Datasheet1.pdf (267.2KB, pdf)

Data Availability Statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: https://www.ncbi.nlm.nih.gov/, PRJNA1290648; SAMN49931282; SRS25765186.


Articles from Frontiers in Transplantation are provided here courtesy of Frontiers Media SA

RESOURCES