Neonatal exposure to an environmentally relevant phthalate mixture alters ovarian function in mice

Abstract

Phthalates are synthetic chemical compounds commonly used in consumer products. Neonates are often exposed to phthalate mixtures, but the effects of neonatal exposure to phthalate mixtures on ovarian health are unclear. Thus, this study tested the hypothesis that neonatal exposure to an environmentally relevant phthalate mixture alters neonatal ovarian function by disrupting steroidogenesis and cell cycle regulation and promoting inflammation, oxidative stress, and apoptosis. CD-1 neonatal mice were orally dosed with corn oil or a phthalate mixture (10, 20, 100 μg/kg/day) daily from post-natal day (PND) 3 to PND 8. Sera and ovaries were collected on PND 8 and PND 10 to quantify follicle numbers and to measure phthalate metabolites, protein levels, and expression of key markers involved in ovarian health. At PND 8, neonatal exposure to the mixture increased the levels of the phthalate metabolites (mono-ethyl phthalate and mono(2-ethylhexyl) phthalate) and C-reactive protein in the sera and it decreased the number of primordial follicles and ovarian expression of Il1-r2. Additionally, the mixture increased the expression of steroidogenic regulators (Cyp17a1 and Lhcgr) and a proapoptotic factor (Bad) in comparison to controls. At PND 10, the mixture decreased the number of primordial follicles and the expression of Cyp17a1, Bad, Bax, Fas, and Cdkn1a, and increased expression of Lhcgr, Fshr, and Bcl2l10 in comparison to controls. Collectively, these data indicate that neonatal exposure to an environmentally relevant phthalate mixture decreases the health of the neonatal ovary.

1. Introduction

Phthalates are a family of synthetic chemical compounds that are widely used as plasticizers in consumer goods (National Research Council Committee on the Health Risks of Phthalates, 2008). Phthalates can be found in most items containing plastic such as water bottles, clothing, toys, automobile upholstery, building materials, cosmetics, and medical tubing (Koniecki et al., 2011; Schettler, 2006). Human exposure to phthalates is ubiquitous and is most common via ingestion. Several phthalates are known endocrine-disrupting chemicals (EDCs) and have been shown to negatively impact female fertility (Panagiotou et al., 2021; Fletcher et al., 2022). Phthalates can alter estrous cyclicity, ovarian morphology, ovarian follicle numbers, hormone production, gene expression, and activity in female mice (Fletcher et al., 2022; Wang et al., 2012). Most studies evaluating the impacts of phthalates have examined the effects of single phthalate exposure on health outcomes; however, exposure to phthalates in humans is more prevalently seen as mixtures.

Phthalates can impact the female reproductive system at all stages in the reproductive lifespan. However, the developing female reproductive system marks a highly sensitive window for exposure to EDCs such as phthalates. During prenatal development, female mice are exposed to high amounts of estradiol from the maternal parent, which starts the steroidogenic process (Devillers et al., 2022). After birth, female mice experience a significant decline in estradiol, which causes them to secrete and produce estradiol independently (Devillers et al., 2022). The production and secretion of sex steroid hormones within female neonates independent of the maternal parent are necessary for proper hypothalamic-pituitary-ovarian (HPO) axis development and function, which regulate primordial follicle pool establishment. During neonatal development (i.e., around post-natal days 8–10), germ cell nests are broken down to form the primordial follicle pool (Mu et al., 2015; Hirshfield, 1991). Specifically, at around PND 3, mouse germ cell nests began to break down into single oocytes (Pepling, 2006). At PND 7, sex steroid hormones become measurable in female mice (Bell, 2018). At this stage, basal levels of progesterone, androstenedione, and luteinizing hormone (LH) are detectable (Mannan and O'Shaughnessy, 1991). At around PND 8, the germ cell nest breakdown and primordial follicle pool establishment are still undergoing development. On PND 10, germ cell nest breakdown is complete and the primordial follicle pool is fully established.

The primordial follicle pool contains a finite number of immature follicles that eventually grow into mature follicles that have the potential to give rise to the mature oocytes needed for fertilization (Fletcher et al., 2022; Grive and Freiman, 2015; Hirshfield, 1991). The establishment of the primordial follicle pool is an irreversible process, which is necessary for female reproductive health. Thus, exposure to phthalates during neonatal development may have long-term consequences that impact the ovarian reserve and reproductive health. However, little information is available about the mechanisms by which neonatal exposure to an environmentally relevant phthalate mixture impacts ovarian reproductive health. Given that inflammation, oxidative stress, apoptosis, and cell cycle inhibition are common mechanisms underlying EDC-induced ovarian toxicity (Huang et al., 2019; Stathori et al., 2024; Dietert, 2012; Zhou and Flaws, 2017; Wang et al., 2023; Warner et al., 2019; Warner et al., 2021), the goal of this study was to determine the extent and underlying mechanisms by which neonatal exposure to an environmentally relevant phthalate mixture alters neonatal ovarian health and function.

Previous work within our laboratory examined the effects of environmentally relevant phthalate mixtures on neonatal ovarian tissue in vitro (Warner et al., 2021). The previous study found that exposure to a phthalate metabolite mixture significantly decreased the number and percentages of abnormal follicles and increased the expression of select cell cycle inhibitors and anti-apoptotic factors in neonatal ovarian tissue compared to controls. However, the same study found that exposure to the parent phthalate mixture significantly increased apoptosis revealed by DNA fragmentation staining in vitro (Warner et al., 2021). This previous in vitro experiment further emphasized that phthalate mixtures can impact ovarian tissue and set the stage for why it is important to examine these effects in vivo. Thus, the current study was designed to evaluate the effects of neonatal exposure to an environmentally relevant mixture of phthalates on key genes regulating the steroidogenic pathway along with several markers known to impact immune signaling, oxidative stress pathways, apoptosis, and cell cycle regulation in vivo. Specifically, this study tested the hypothesis that neonatal exposure to an environmentally relevant phthalate mixture alters neonatal ovarian function by disrupting steroidogenesis and cell cycle regulation and promoting inflammation, oxidative stress, and apoptosis in an in vivo model.

2. Methods

The percentages of the phthalates used to develop the phthalate mixture for this study were based on human exposure levels in urine samples from pregnant women in central Illinois (iKids study) (Yazdy et al., 2018). The phthalate mixture has also been used to evaluate its impact on reproductive health in rodents (Zhou et al., 2017; Brehm et al., 2020; Fletcher et al., 2024). The mixture for this study was comprised of 35.22 % diethyl phthalate (DEP), 21.03 % di(2-ethylhexyl) phthalate (DEHP), 15.10 % di-isononyl phthalate (DiNP), 14.91 % dibutyl phthalate (DBP), 8.61 % diisobutyl phthalate (DiBP), and 5.13 % benzylbutyl phthalate (BzBP). All phthalates were purchased from Sigma-Aldrich (St. Louis, MO).

2.1. Animals

Adult female and male CD-1 mice were purchased from Charles River Laboratories (Wilmington MA) and housed individually in the College of Veterinary Medicine Animal Facility at the University of Illinois Urbana-Champaign (Urbana, IL). Prior to phthalate exposure, mice were acclimated to the facility for one week with 12-h light/12-h dark cycles. All mice received Teklad Rodent Diet 8604 (Envigo Madison, Wisconsin) and reverse-osmosis filtered high-purity water ad libitum. Animal handling procedures, including euthanasia and tissue collections, were approved by the University of Illinois Institutional Animal Care and Use Committee (IACUC) at the University of Illinois.

A total of 8 non-treated adult F0 female mice were mated and housed with non-treated adult male mice to create the F1 generation. After 10 days of grouped caging with male and female mice, the pregnant dams were separated and housed individually. These dams were then divided into four different treatment groups of two dams each. The F0 pregnant dams were allowed to give birth naturally to F1 females and males. On post-natal day (PND) 3, F1 neonates were dosed orally with tocopherol-stripped corn oil (vehicle control) or various concentrations of the phthalate mixture (10 μg/mg/day, 20 μg/mg/day, 100 μg/mg/day) until PND 8 (corn oil catalog# 401100, Dyets, Inc., (Bethlehem, Pennsylvania) DEHP catalog#: D201154-500 mL, DEP catalog#: 524972-5 mL, BzBP catalog#: 308501-5 mL, DiBP catalog#: 152641-100 mL, DBP catalog#:524980-25 mL, and DiNP catalog#: 376663-1 L). F1 neonates were weighed and separated daily from F0 females during dosing and immediately placed back in the cage with the respective F0 female mouse. The F0 dams were not dosed during this experiment. Additionally, F1 pups were not dosed prenatally during this experiment. Neonatal pups were individually dosed with the vehicle control or the phthalate mixture. To ensure as little disruption as possible, neonate pups were not tagged and or dosed differently per cage. Thus, an entire litter was dosed in the same manner (with the same vehicle solution or phthalate mixture). In this study, we considered each neonate as the “n” due to the exposure occurring after the prenatal period. This entire experiment was completed twice to have pups from entirely different litters. Therefore our “n” is reflective of siblings and non-siblings. Litters were examined daily and the body weight of each mouse was recorded to monitor if lactation was disrupted by treatment.

Oral exposure to the phthalate mixture was chosen because it is the most common route of phthalate exposure in humans (United States. Environmental Protection Agency, Issuing Body, 2013). The dosing concentrations were chosen to mimic human exposure levels in women (Yazdy et al., 2018). The percentages of the phthalates in the mixture and the vehicle control were selected to relate to other studies evaluating the same phthalate mixture (Zhou et al., 2017; Brehm et al., 2020; Fletcher et al., 2024; Fletcher et al., 2025).

2.2. Sample collection

Some F1 female neonates were euthanized after exposure on PND 8 and the remaining neonates were euthanized on PND 10. Ovaries and sera were collected from all female mice and used in the tissue and sera analyses described below. Some ovaries were frozen at −80 °C and used for RNA extraction, cDNA synthesis, and qPCR analysis as described below. Additionally, some pooled sera (three mice per group) from the 10 and 100 μg/mg/day treatment groups were used for ultra-performance liquid chromatography-mass spectrometry (UPLC-MS) analysis to quantify the amount of phthalate metabolites present: mono (2-ethylhexyl) phthalate (MEHP), mono-isobutyl phthalate (MiBP), mono-ethyl phthalate (MEP), and mono-n-butyl phthalate (MBP) in mouse sera on PND 8. The remaining ovaries were placed in 10 % neutral buffered formalin, embedded in paraffin, and sectioned for histology as described below. Lastly, remaining sera were stored at −80 °C for measurement of C-reactive protein (CRP) as described below.

2.3. Liquid chromatography mass spectrometry (LC-MS) analysis

Samples were analyzed with the Sciex QTrap 6500+ LC-MS/MS system (Framingham, MA). Software Analyst 1.7.3 was used for data acquisition and analysis. The Waters I-class plus UPLC system includes a degasser, an autosampler, a column oven, and a binary pump. The Multiple Reaction Monitoring (MRM) based UPLC-MS/MS analysis was performed as previously described (Warner et al., 2019) with some minor changes: The LC separation was performed on a Waters Acquity UPLC BEH C18 column (2.1 × 50 mm, 1.7 μm) with mobile phase A (0.1 % formic acid in water) and mobile phase B (0.1 % formic acid in acetonitrile). The autosampler was set at 10 °C and the column was kept at 50 °C. The injection volume was 5 μL. The gradient was as follows: 0–0.5 min, 20 %B; 2.0 min, 35 % B; 3.0 min, 50 %B; 4.0–5.5 min, 100 % B; 5.6–7.0 min, 20 %B. The flow rate was 0.5 mL/min.

2.4. Gene expression analysis

Frozen whole ovaries collected on PND 8 and PND 10 were used for qPCR analysis (n = 6 ovaries per treatment group). Total RNA was extracted from whole ovaries using RNA easy Mini Kits (Qiagen, Inc., Valencia CA) according to manufacturer's protocol. Total RNA (100 ng) was reverse transcribed to complementary DNA (cDNA) using iScript Reverse Transcriptase (Bio-Rad Laboratories, Inc., Hercules, CA). qPCR analysis was performed using the CFX96 C1000 Real-Time PCR Detection System and CFX Manager Software (Bio-Rad Laboratories, Inc., Hercules, CA) according to the manufacturer's protocol. All gene expression data were normalized to the housekeeping gene beta-actin (Actb). The selected genes evaluated were those involved in the steroidogenic pathway: FSH receptor (Fshr), LH receptor (Lhcgr), steroidogenic acute regulatory protein (Star), cytochrome P450 side-chain cleavage (Cyp11a1), 3β-hydroxysteroid dehydrogenase 1 (Hsd3b1), cytochrome P450 steroid 17-α-hydroxylase 1 (Cyp17a1), 17β-hydroxysteroid dehydrogenase 1 (Hsd17b1), and cytochrome P450 aromatase (Cyp19a1) (Table 1). Other genes included oxidative stress and apoptotic markers: catalase (Cat), glutathione peroxidase (Gpx), glutathione reductase (Gsr), superoxide dismutase 1 (Sod1); BCL2-associated agonist of cell death (Bad), BCL2-associated X protein (Bax), B cell leukemia/lymphoma 2 (Bcl2), Bcl2-like 10 (Bcl2l10), BCL2-related ovarian killer protein (Bok), caspase 3 (Casp3), caspase 8 (Casp8), Fas cell surface death receptor (Fas), TNF receptor-associated factor 3 (Traf3); and cell cycle regulators: cyclin A2 (Ccna2), cyclin E1 (Ccne1), cyclin B1(Ccnb1), cyclin D2 (Ccnd2), cyclin-dependent kinase 4 (Cdk4), and cyclin-dependent kinase inhibitor 1 A (Cdkn1a) (Table 1). Immune genes (interleukin-1 receptor type 1 (Il1-r1), and interleukin-1 receptor type 2 (Il1-r2)) were also evaluated were also evaluated in this study (Table 1).

Table 1.

Primer sequences for qPCR analyses.

Gene Name	Gene Symbol	5’-Forward-3’	5’-Reverse-3’
Beta-actin	Actb	GGGCACAGTGTGGGTGAC	CTGGCACCACACCTTCTAC
FSH receptor	Fshr	GGAGAGACTGGATCTTGTGAAAGG	GCAGATGTGTTCTCCAACCTACC
LH receptor	Lhcgr	AACCCGGTGCTTTTTACAAACC	TCCCATTGAATGCATGGCTT
Steroidogenic acute regulatory protein	STAR	CAGGGAGAGGTGGCTATGCA	CCGTGTCTTTTCCAATCCTCTG
Cytochrome P450 side-chain cleavage	Cyp11a1	AGATCCCTTCCCCTGGTGACAATG	CGCATGAGAAGAGTATCGACGCATC
3β-hydroxysteroid dehydrogenase 1	Hsd3b1	CAGGAGAAAGAACTGCAGGAGGTC	GCACACTTGCTTGAACACAGGC
Cytochrome P450 steroid 17-α-hydroxylase 1	Cyp17a1	CCAGGACCCAAGTGTGTTCT	CCTGATACGAAGCACTTCTCG
17β-hydroxysteroid dehydrogenase 1	Hsd17b1	ACTGTGCCAGCAAGTTTGCG	AAGCGGTTCGTGGAGAAGTAG
Cytochrome P450 aromatase	Cyp19a1	CATGGTCCCGGAAACTGTGA	GTAGTAGTTGCAGGCACTTC
Catalase	Cat	GCAGATACCTGTGAACTGTC	GTAGAATGTCCGCACCTGAG
Glutathione peroxidase	Gpx	CCTCAAGTACGTCCGACCTG	CAATGTCGTTGCGGCACACC
Glutathione reductase	Gsr	CAGTTGGCATGTCATCAAGCA	CGAATGTTGCATAGCCGTGG
Superoxide dismutase 1	Sod1	TTCCGTCCGTCGGCTTCTCGT	CGCACACCGCTTTCATCGCC
BCL2-associated agonist of cell death	Bad	AAGTCCGATCCCGGAATCC	GCTCACTCGGCTCAAACTCT
BCL2-associated X protein	Bax	TGAAGACAGGGGCCTTTTTG	AATTCGCCGGAGACACTCG
B cell leukemia/lymphoma 2	Bcl2	ATGCCTTTGTGGAACTATATGGC	GGTATGCACCCAGAGTGATGC
Bcl2-like 10	Bcl2l10	CGCTACACACACTGACTGGA	CTTTAGGATCCCCTGCCCTG
BCL2-related ovarian killer protein	Bok	CTGCCCCTGGAGGACGCTTG	CCGTCACCACAGGCTCCGAC
Caspase 3	Casp3	TGGTGATGAAGGGGTCATTTATG	TTCGGCTTTCCAGTCAGACTC
Caspase 8	Casp8	CGAGAGGAGATGGTGAGAGAGC	CAGGCTCAAGTCATCTTCCAGC
Fas cell surface death receptor	Fas	TATCAAGGAGGCCCATTTTGC	TGTTTCCACTTCTAAACCATGCT
TNF receptor-associated factor 3	Traf3	CAGCCTAACCCACCCCTAAAG	TCTTCCACCGTCTTCACAAAC
Cyclin A2	Ccna2	GCTCTACTGCCCGGAGGCTGA	TGGCCTACATGTCCTCTGGGGAA
Cyclin E1	Ccne1	GGTGTCCTCGCTGCTTCTGCTT	CCGGATAACCATGGCGAACGGA
Cyclin B1	Ccnb1	TGCATTCTCTCAGTGCCCTCCACA	AGACAGGAGTGGCGCCTTGGT
Cyclin D2	Ccnd2	CCTTTGACGCAGGCTCCCTTCT	ACCCTGGTGCACGCATGCAAA
Cyclin-dependent kinase 4	Cdk4	AGAAACCCTCGCTGAAGCGGCA	TGGGGGTGAACCTCGTAAGGAGA
Cyclin-dependent kinase inhibitor 1A	Cdkn1a	TTAGGCAGCTCCAGTGGCAACC	ACCCCCACCACCACACACCATA
Interleukin 1 receptor, type I	IL1-r1	GTGCTACTGGGGCTCATTTGT	GGAGTAAGAGGACACTTGCGAAT
Interleukin 1 receptor, type II	IL1-r2	GTAAATGTATAGCATTGGGCTCC	CACTGTTGGAGTGGTGAAAGC

2.5. CRP analysis

Sera were obtained by centrifugation of blood samples at 1500 x g for 10 min and subjected to enzyme-linked immunosorbent assays (ELISAs) for measurement of CRP (Thermo Fisher Scientific, Catalog # EM20RB) according to the manufacturer's instructions. The minimum detectable concentration of mouse CRP was 0.15 ng/mL. The intra- and inter-assay coefficients of variability were less than 12 %.

2.6. Histological examination

Ovaries were fixed in 10 % neutral buffered formalin, embedded in paraffin, and serial sectioned at 5 μm. Serial sections were mounted on glass slides and stained with hematoxylin and eosin (H&E). These slides were then imaged using a NanoZoomer Digital Pathology System (Hamamatsu) and analyzed using the FIJI version of ImageJ (n = 3 per treatment group). Every 5th section of the ovary was used to count the number of germ cells, primordial follicles, primary follicles, and secondary follicles. Follicle types were assessed using previously defined criteria (Pedersen and Peters, 1968; Grive and Freiman, 2015; Warner et al., 2021). Briefly, follicles were classified based on the following criteria: germ cells contained large nuclei surrounded by an oval or round shape, primordial follicles contained an oocyte surrounded by a flattened single layer of squamous granulosa cells, primary follicles contained an oocyte surrounded by a single layer of cuboidal granulosa cells, and secondary (pre-antral) follicles contained an oocyte surrounded by a two or more layers of cuboidal granulosa cells. When follicles fell between two categories, they were assigned to the less developed category. To avoid redundant counting, only follicles with a clear nucleus inside the oocyte were counted.

2.7. Statistical analysis

If data were normally distributed and met the assumption of homogeneity of variance, one-way ANOVA followed by Dunnett post-hoc comparison tests were performed. If equal variance was not assumed, a Games-Howell post-hoc comparisons tests were performed. If normal distribution was not assumed, the Kruskal-Wallis test was used for comparison between groups, followed by the Dunn's multiple comparison test. Statistical significance was assigned P ≤ 0.05. If P-values were greater than 0.05, but less than 0.1, data were considered to exhibit borderline significance. The software GraphPad Prism (GraphPad Prism version 10.0.0 for Windows, GraphPad Software, Boston, Massachusetts USA, www.graphpad.com) was used for data analysis.

3. Results

3.1. Effects of neonatal exposure to an environmentally relevant phthalate mixture on serum levels of phthalate metabolites and body weight on PND 8

Neonatal phthalate exposure did not significantly affect the weights of neonatal mice in comparison to controls on PND 8 (Fig. 1A). Furthermore, neonatal phthalate exposure did not result in malformations, increased mortality, vomiting, or lethargy in the neonates. However, neonatal mice were exposed to higher levels of phthalates than controls as evidenced by significantly higher levels of DEHP and DEP metabolites (MEHP and MEP) in the 100 μg/kg/day treatment group in comparison to controls on PND 8 (Fig. 1B, D; n = 4, significant difference if p ≤ 0.05).

Fig. 1.

Effects of neonatal exposure to a phthalate mixture on neonate weight and serum levels of phthalate metabolites on PND 8. Neonatal CD-1 mice were dosed with vehicle control (corn oil) or phthalate mixture (10 and 100 μg/kg/day) from PND 3 to PND 8. Weights were recorded daily. Sera were pooled from selected females on PND 8 and used to measure phthalate metabolite levels via UPLC-MS/MS (panels A-E; n = 4, p values are shown above comparison lines on the graphs; significant difference if p ≤ 0.05).

3.2. Effects of neonatal exposure to an environmentally relevant phthalate mixture on ovarian follicle numbers in female mice on PNDs 8 and 10

Neonatal exposure to an environmentally relevant phthalate mixture did not significantly alter the number of germ cells, primary follicles, or secondary follicles on PND 8 in comparison to controls (Fig. 2A). In contrast, neonatal exposure to the phthalate mixture significantly decreased the number of primordial follicles (10, 20 and 100 μg/kg/day) in comparison to controls on PND 8 (Fig. 2; n = 3–4, significant difference, p ≤ 0.05). Furthermore, neonatal exposure to the mixture borderline increased the number of germ cells (20 μg/kg/day) and significantly decreased the number of primordial follicles (10, 20 and 100 μg/kg/day) on PND 10 in comparison to controls (Fig. 2B; n = 5–6, borderline difference, p is 0.05 < p < 0.10, significant difference, p ≤ 0.05). Additionally, neonatal exposure to the mixture borderline increased the number of primary follicles (10 μg/kg/day) on PND 10 in comparison to controls (Fig. 2B; n = 5–6, borderline difference, p is 0.05 < p < 0.10).

Fig. 2.

Effects of neonatal exposure to a phthalate mixture on follicle numbers on PND 8. Neonatal CD-1 mice were dosed with vehicle control (corn oil) or phthalate mixture (10, 20 and 100 μg/kg/day) from PND 3 to PND 8. Ovaries from selected females on PND 8 and PND 10 were embedded in paraffin, sectioned, and stained with H&E to count numbers of different ovarian follicle types (PND 8, panel A; n = 3–4, p values are shown above comparison lines on the graphs; significant difference if p ≤ 0.05; PND 10, panel B; n = 5–6, p values are shown above comparison lines on the graphs; significant difference if p ≤ 0.05).

3.3. Effects of neonatal exposure to an environmentally relevant phthalate mixture on ovarian expression of regulators of steroidogenesis on PNDs 8 and 10

Neonatal exposure to an environmentally relevant phthalate mixture did not significantly alter ovarian gene expression of the steroidogenic regulators known as Star, Hsd3b1, Hsd17b1, or Cyp19a1 in comparison to controls on PND 8 (Fig. 3A,C,E,F). However, neonatal exposure to the phthalate mixture borderline decreased the ovarian expression of Cyp11a1 (20 μg/kg/day) in comparison to controls on PND 8 (Fig. 3B; n = 6, borderline difference, p is 0.05 < p < 0.10) Furthermore, neonatal exposure to the phthalate mixture significantly increased ovarian expression of Cyp17a1 (10 μg/kg/day) and Lhcgr (100 μg/kg/day) in comparison to controls on PND 8 (Fig. 3D, G; n = 6, significant difference, p ≤ 0.05.)

Fig. 3.

Effects of neonatal exposure to a phthalate mixture on the ovarian expression of genes involved in the steroidogenic pathway on PND 8. Neonatal CD-1 mice were dosed with vehicle control (corn oil) or phthalate mixture (10, 20 and 100 μg/kg/day) from PND 3 to PND 8. Ovaries from selected females on PND 8 were used to measure gene expression via qPCR analysis (panels A-G; n = 6, p values are shown above comparison lines on the graphs; significant difference if p ≤ 0.05, borderline difference if p is 0.05 < p < 0.10).

Neonatal exposure to an environmentally relevant phthalate mixture did not significantly alter ovarian expression of Star, Cyp11a1, Hsd3b1, Hsd17b1, Hsd17b1, or Cyp19a1 in comparison to controls on PND 10 (Fig. 4H-J, L, M). In contrast, neonatal exposure to the phthalate mixture significantly or borderline increased ovarian expression of Cyp17a1 (20 μg/kg/day), Lhcgr (10, 20, and 100 μg/kg/day), and Fshr (20, and 100 μg/kg/day) in comparison to controls on PND 10 (Fig. 4K, N, O; n = 6, borderline difference, p is 0.05 < p < 0.10, significant difference, p ≤ 0.05.)

Fig. 4.

Effects of neonatal exposure to a phthalate mixture on ovarian expression genes involved in the steroidogenic pathway on PND 10. Neonatal CD-1 mice were dosed with vehicle control (corn oil) or phthalate mixture (10, 20, and 100 μg/kg/day) from PND 3 to PND 8. Ovaries from selected females on PND 10 were used to measure gene expression via qPCR analysis (panels H-O; n = 6, p values are shown above comparison lines on the graphs; significant difference if p ≤ 0.05, borderline difference if p is 0.05 < p < 0.10).

3.4. Effects of neonatal exposure to an environmentally relevant phthalate mixture on ovarian expression of apoptotic factors on PNDs 8 and 10

Neonatal exposure to an environmentally relevant phthalate mixture significantly increased ovarian expression of the pro-apoptotic factor Bad (100 μg/kg/day) in comparison to controls on PND 8 (Fig. 5A; n = 6, significant difference, p ≤ 0.05). However, exposure to the mixture did not significantly alter ovarian expression of other apoptotic factors: Bok, Casp3, Casp8, Bax, Fas, Traf3, or Bcl2l10 in comparison to controls on PND 8 (Fig. 5B-H).

Fig. 5.

Effects of neonatal exposure to a phthalate mixture on selected apoptotic genes on PND 8. Neonatal CD-1 mice were dosed with vehicle control (corn oil) or phthalate mixture (10, 20 and 100 μg/kg/day) from PND 3 to PND 8. Ovaries from selected females on PND 8 were used to measure gene expression via qPCR analysis (panels A-H; n = 6, p values are shown above comparison lines on the graphs; significant difference if p ≤ 0.05).

Neonatal exposure to an environmentally relevant phthalate mixture significantly or borderline decreased ovarian expression of proapoptotic factors: Bad (10, 20, and 100 μg/kg/day), Casp8 (10 μg/kg/day), Bax (10 μg/kg/day), and Fas (10, and 100 μg/kg/day) in comparison to controls on PND 10 (Fig. 6I, L-N; n = 6, borderline difference, p is 0.05 < p < 0.10, significant difference, p ≤ 0.05). Neonatal exposure to the mixture (20 μg/kg/day) also significantly increased ovarian expression of Bcl2l10, an apoptotic suppressor, on PND 10 in comparison to controls (Fig. 6P; n = 6, significant difference, p ≤ 0.05.). However, exposure to the mixture did not significantly alter ovarian expression of other apoptotic factors: Bok, Casp3, Traf3 or Bcl2 in comparison to controls on PND 10 (Fig. 6J,K, O, Q).

Fig. 6.

Effects of neonatal exposure to a phthalate mixture on selected apoptotic genes on PND 10. Neonatal CD-1 mice were dosed with vehicle control (corn oil) or phthalate mixture (10, 20 and 100 μg/kg/day) from PND 3 to PND 8. Ovaries from selected females on PND 10 were used to measure gene expression via qPCR analysis (panels I-Q; n = 6, p values are shown above comparison lines on the graphs; significant difference if p ≤ 0.05, borderline difference if p is 0.05 < p < 0.10).

3.5. Effects of neonatal exposure to an environmentally relevant phthalate mixture on ovarian expression of antioxidant enzymes and cell cycle regulators on PNDs 8 and 10

Neonatal exposure to an environmentally relevant phthalate mixture (100 μg/kg/day) borderline increased ovarian expression of antioxidant enzymes: Cat, Gpx, and Gsr on PND 8 in comparison to controls (Fig. 7B-D; n = 6, borderline difference, p is 0.05 < p < 0.10). However, exposure to the mixture did not significantly affect ovarian expression of the antioxidant enzyme Sod1 or the cell cycle regulators: Ccne1, Ccnb1, Ccna2, and Cdk4 on PND 8 in comparison to controls (Fig. 7A,E-H).

Fig. 7.

Effects of neonatal exposure to a phthalate mixture on selected oxidative stress markers and cell cycle regulators on PND 8. Neonatal CD-1 mice were dosed with vehicle control (corn oil) or phthalate mixture (10, 20 and 100 μg/kg/day) from PND 3 to PND 8. Ovaries from selected females on PND 8 were used to measure gene expression via qPCR analysis (panels A-H; n = 6, p values are shown above comparison lines on the graphs; borderline difference if p is 0.05 < p < 0.10).

Further, neonatal exposure to an environmentally relevant phthalate mixture did not significantly alter ovarian expression of any antioxidant enzymes evaluated on PND 10 in comparison to controls (Fig. 8I-K). Similarly, exposure to the phthalate mixture did not significantly alter ovarian expression of the cell cycle regulators: Ccne1, Ccnb1, Ccna2, Cdk4, and Ccnd2 on PND 10 in comparison to controls (Fig. 8L-O, Q). In contrast, neonatal exposure to the mixture significantly decreased ovarian expression of the cell cycle inhibitor Cdkn1a (10, 20 and 100 μg/kg/day) in comparison to controls on PND 10 (Fig. 8P; n = 6, significant difference, p ≤ 0.05).

Fig. 8.

Effects of neonatal exposure to a phthalate mixture on selected oxidative stress markers and cell cycle regulators on PND 10. Neonatal CD-1 mice were dosed with vehicle control (corn oil) or phthalate mixture (10, 20 and 100 μg/kg/day) from PND 3 to PND 8. Ovaries from selected females on PND 10 were used to measure gene expression via qPCR analysis (panels I-Q; n = 6, p values are shown above comparison lines on the graphs; significant difference if p ≤ 0.05).

3.6. Effects of neonatal exposure to an environmentally relevant phthalate mixture on immune factors in female mice on PNDs 8 and 10

Neonatal exposure to an environmentally relevant phthalate mixture significantly increased the levels of CRP (100 μg/kg/day), a marker of systemic inflammation, in mouse sera on PND 8, but not PND 10 in comparison to controls (Fig. 9AB; n = 6, significant difference, p ≤ 0.05). Additionally, neonatal exposure to an environmentally relevant phthalate mixture borderline or significantly decreased ovarian expression of Il1-r2, a factor involved in inhibition of IL-1 signaling (20 and 100 μg/kg/day) on PND 8 in comparison to controls (Fig. 9D; n = 6, borderline difference, p is 0.05 < p < 0.10, significant difference, p ≤ 0.05). Exposure to the mixture did not significantly alter the expression of Il1-r1 on PND 8 in comparison to controls (Fig. 9C), but it increased ovarian expression of Il1-r1 (100 μg/kg/day), a factor involved in IL-1 signal transduction, on PND 10 in comparison to controls (Fig. 9E; n = 6, borderline difference, p is 0.05 < p < 0.10). Lastly, exposure to the mixture did not significantly alter the expression of Il1-r2 on PND 10 in comparison to controls (Fig. 9F).

Fig. 9.

Effects of neonatal exposure to a phthalate mixture on selected immune markers on PND 8 and 10. Neonatal CD-1 mice were dosed with vehicle control (corn oil) or phthalate mixture (10, 20 and 100 μg/kg/day) from PND 3 to PND 8. Sera and ovaries from selected females on PNDs 8 and 10 were used to measure CRP levels and gene expression via qPCR analysis (PND 8, Panels A,C,D) (PND 10, Panels B,E,F) (n = 6, p values are shown above comparison lines on the graphs; borderline difference if p is 0.05 < p < 0.10, significant difference if p ≤ 0.05).

4. Discussion

In summary, this study tested the hypothesis that neonatal exposure to an environmentally relevant phthalate mixture alters neonatal ovarian function by promoting inflammation, oxidative stress, and apoptosis while also disrupting steroidogenesis and cell cycle regulation in an in vivo model. Collectively, our data show that neonatal exposure to an environmentally relevant phthalate mixture decreases primordial follicle numbers and suggests that this may be due, in part, to disruptions in inflammation, oxidative stress, and apoptosis pathways.

Our data indicate that neonatal exposure to a phthalate mixture significantly increases the levels of the DEP and DEHP metabolites known as MEP and MEHP in the sera on PND 8 in comparison to controls. This finding is relevant for two major reasons. First, it demonstrates the validity of our oral exposure method in neonatal pups because we show that oral exposure to the mixture increases the levels of circulating phthalates. Second, the phthalate mixture used in this study was comprised of primarily DEP (35.22 %) and DEHP (21.03 %). The detection of the metabolites of DEP and DEHP (i.e., MEP and MEHP) indicates that neonatal mice absorb the parent compounds and are able to convert them to their respective metabolites.

Our data also show that neonatal exposure to an environmentally relevant phthalate mixture does not significantly impact neonatal body weight in comparison to the controls. Furthermore, during the entire duration of the experiment, the phthalate treatment did not lead to indications of malformations, increased mortality, vomiting, or lethargy within neonates. These data suggest that lactation was not significantly impacted and neonatal mice were still nursing across all groups. These data also suggest that oral exposure to the phthalate mixture does not cause overt toxicity to the animals and that the observed effects of the phthalate mixture on the ovary are not due to overt toxicity.

Our findings indicate that neonatal exposure to the phthalate mixture significantly increased the ovarian expression of key regulators of steroidogenesis on PND 8 and PND 10. Exposure to the mixture significantly increased the expression of Lhcgr and Cyp17a1 on PND 8 in comparison to controls (Table 2). Furthermore, exposure to the mixture also significantly increased ovarian gene expression of steroidogenic regulators Lhcgr, Cyp17a1, and Fshr on PND 10 in comparison to controls (Table 3). Collectively, these data suggest that exposure to the phthalate mixture may impact luteinizing hormone (LH) signaling at both the PND 8 and 10 time points. LH is produced in the pituitary and stimulates LH receptors found on thecal cells of the ovarian follicle to stimulate the production of androgens. Thus, our data also suggest that the phthalate mixture may target the developing thecal cells. The mixture-induced changes in ovarian expression of Lhcgr could ultimately contribute to the mixture-induced increases in the expression of Cyp17a1 at both PND 8 and PND 10 time points. Cyp17a1 is a key enzyme involved in the conversion of the androgens that are needed to produce estradiol, the major female hormone. These data are consistent with previous studies showing that dietary exposure to a phthalate mixture altered LH and estradiol levels in adult CD-1 female mice after 6 months of exposure (Safar et al., 2023) and that prenatal exposure to the same phthalate mixture used in this study significantly increased LH levels in F1 and F3 generation mice (Brehm et al., 2020). It is important to note that previous studies were conducted in adult female mice exposed to phthalates or in offspring exposed to phthalates in utero. Our study demonstrates that phthalate exposure during the neonatal period also affects the neonatal ovary. It is important to note that although our data suggest that the phthalate mixture may interfere with LH signaling, we could not measure LH or sex steroid hormones in this study. This is because we could not obtain enough serum from neonatal pups to accurately measure hormone levels in the circulation.

Table 2.

Summary of PND 8 factors significantly altered.

PND 8	Altered Factors
Sera	MEHP, MEP, CRP
RNA	Cyp17a1, Lhcgr, Bad, Il1-r2
Histology	Primordial follicles

Factors significantly decreased are in normal arial font. Factors significantly increased are in bold arial font.

Table 3.

Summary of PND 10 factors significantly altered.

PND 10	Altered Factors
RNA	Cyp17a1, Lhcgr, Fshr, Bad, Bax, Fas, Bc12l10, Cdkn1a
Histology	Primordial follicles

Factors significantly decreased are in normal arial font. Factors significantly increased are in bold arial font.

We also found that the mixture significantly altered the expression of several factors that regulate apoptosis. Neonatal exposure to the mixture increased ovarian gene expression of the pro-apoptotic factor Bad on PND 8, but decreased ovarian gene expression of pro-apoptotic factors (Bad, Bax, and Fas) and a cell cycle inhibitor (Cdkn1a) on PND 10 in comparison to controls (Tables 2–3). Furthermore, neonatal exposure to the mixture significantly increased the expression of apoptotic inhibitor Bcl2l10 on PND 10 in comparison to controls. These data suggest that the phthalate mixture may be promoting apoptosis at earlier timepoints, but decreasing apoptosis at later timepoints due to possible compensation. Further, these data suggest that the mixture-induced alterations in apoptotic factors may lead to the loss of ovarian follicles. This is because we also found that exposure to the phthalate mixture significantly decreased primordial follicle numbers in all treatment groups compared to control on PND 8 (Table 2). This correlates with the mixture-induced increase in ovarian expression of Bad on PND 8. These findings are consistent with previous studies using single phthalate exposure paradigms. A previous study evaluating DEHP exposure in a whole ovary culture system found that DEHP (25–100 μM) inhibited the assembly of primordial follicles and increased the number of observed apoptotic oocytes (Mu et al., 2015). Similarly, the same study injected DEHP (2.5–10 μg) in neonatal mice from PND 0 to 4 and found that DEHP significantly decreased the number of primordial follicles compared to control (Mu et al., 2015). DEHP is one of the major phthalates used in our mixture. Thus, it is possible that the phthalate mixture may be significantly decreasing primordial follicle numbers in ovarian tissue at PND 8 by targeting primordial follicles to undergo apoptosis. This correlates with a study evaluating the same phthalate mixture, which showed that in vitro exposure to the mixture significantly increased DNA fragmentation staining in neonatal ovarian tissue (Warner et al., 2021).

Neonatal exposure to the phthalate mixture also significantly decreased the number of primordial follicles present in all treatment groups at PND 10 in comparison to the controls (Table 3). However, we found inverse changes of apoptotic factors expression at PND 10 in comparison to PND 8. Neonatal exposure to the mixture decreased the expression of pro-apoptotic factors (Bad, Bax, and Fas) and a cell cycle inhibitor (Cdkn1a), but increased the expression of apoptotic inhibitor Bcl2l10 (Table 3). These changes suggest that the ovary may be trying to compensate for the loss of primordial follicles at PND 10 by decreasing the expression of proapoptotic factors and increasing the expression of antiapoptotic factors. However, the changes in expression of apoptotic and cell cycle factors were not able to significantly reduce the number of primordial follicles lost from exposure to the mixture at PND 8. This could correlate with the significant decrease in the number of primordial follicles at the PND 10 time point, which is similar to the changes evaluated in follicle type at PND 8. The mixture-induced increase in Bcl2l10 expression at PND 10 observed in our study is also similar to the phthalate-induced effects on the ovary in vitro. A previous study showed that phthalate metabolite mixture exposure significantly increased the expression of Bcl2l10 in neonatal ovaries cultured in vitro (Warner et al., 2021). Thus, our data indicate that the mixture may have similar effects on the neonatal ovary both in vitro and in vivo.

Lastly, exposure to the phthalate mixture increased inflammation in ovarian tissue and sera. The phthalate mixture significantly increased CRP levels and significantly decreased ovarian gene expression of Il1-r2, a factor involved in inhibiting IL-1 signaling, on PND 8 in comparison to controls (Table 2). Additionally, exposure to the mixture borderline increased the ovarian gene expression of Il1-r1, a factor involved in IL-1 signal transduction, compared to control. Collectively, these data suggest that neonatal exposure to the mixture may be promoting inflammation in ovarian tissue and serum at PND 8 and PND 10 through IL-1 signaling pathway activation. IL-1 is considered to play an important role in ovarian physiology (Gérard et al., 2004). Induced expression of proinflammatory genes can happen when interleukin-1 alpha (IL-1α) binds to its receptor, IL-1r1 (Gérard et al., 2004). Studies show that IL-1α-KO mice have an increased pregnancy rate, increased mean litter size, and a significantly increased number of secondary and antral follicles (Uri-Belapolsky et al., 2014). This shows that the upregulation of IL-1α and its receptors have the potential to negatively impact female reproductive health through the promotion of inflammation. Furthermore, a study in which primary mouse hepatocytes were exposed to a range of cytokine concentrations (1 to 100 units/ml) for 8- or 18-h demonstrated that IL-1 induced a three-fold increase in CRP mRNA levels (Ku and Mortensen, 1993). This suggests that CRP promotes IL-1 signaling. Our current data are consistent with a previous study that found that prenatal exposure to the same phthalate mixture at 200 μg/kg/day increased the levels of CRP in the F1 female offspring on PND 21 in comparison to controls (Fletcher et al., 2024). This suggests that the phthalate mixture promotes inflammation through the production and increase of CRP levels. This also further highlights that phthalates can promote inflammation during neonatal development as well.

In summary, the neonatal period marks a highly sensitive window critical for proper HPO axis development, production and secretion of sex steroid hormones and enzymes, as well as the establishment of the primordial follicle pool. Exposure to phthalates during this period could interfere with the proper formation and growth of the ovarian follicles necessary for regulating the reproductive cycle and releasing a mature oocyte during ovulation. In previous studies, prenatal phthalate exposure has been shown to alter apoptosis, disrupt hormone production, and impact cyclicity in female adult mice and in vitro phthalate exposure has been shown to have similar effects in ovarian tissue (Fletcher et al., 2025; Fletcher et al., 2022; Zhou et al., 2017; Hannon et al., 2015). This study found that neonatal exposure to an environmentally relevant phthalate mixture alters ovarian function in mice by significantly altering the steroidogenic, apoptotic, and inflammation pathways. Ultimately, these changes may have contributed to the significant decrease in primordial follicle numbers observed in the phthalate-mixture exposed ovarian tissue. Disruption of key processes such as steroidogenesis and folliculogenesis through the promotion of apoptosis and inflammation during neonatal development can severely impact longterm female reproductive health. The exhaust of germ cells within the ovary could potentially lead to accelerated ovarian aging and early onset of reproductive senescence. Prolonged apoptosis and inflammation are key mechanisms associated with ovarian aging (Yan et al., 2022; Lliberos et al., 2021). This study further emphasized the impacts that phthalates can have on neonatal development and the possible disruption of long-term ovarian health. Future studies will examine whether the phthalate mixture affects proteins involved in steroidogenesis, apoptosis, oxidative stress, cell cycle regulation, and inflammation in the neonatal ovaries. In addition, future studies will examine the effects of neonatal exposure to the phthalate mixture on reproductive endpoints in later life.

Appendix A. Supplementary data

Supplementary data to this article can be found online at https://doi.org/10.1016/j.taap.2025.117372.

Data availability

Data will be made available on request.