Effects of dietary Chlorella vulgaris and cinnamon oil on growth performance, gut morphology, digestive enzymes, and intestinal gene expression in broilers

Abstract

Antibiotic-free broiler production has increased interest in natural feed additives such as dried Chlorella vulgaris (DCV) and cinnamon oil (CO). This study evaluated DCV, CO, and their combination (DCV&CO) on growth, intestinal function, and immune responses in broilers at 42 days of age.

One hundred twenty one-day-old male broilers were allocated to four dietary treatments (six replicates × five birds): CTRL (basal diet), DCV (1 g/kg diet), CO (0.1 g/kg diet), and DCV&CO (1 g/kg DCV + 0.1 g/kg CO). Growth performance, plasma metabolites, jejunal histomorphometry, digestive enzyme activities, and jejunal mRNA transcripts related to nutrient transport, tight junction function, and cytokine activity were assessed. Broilers fed DCV showed higher body weight gain and better feed conversion ratio (P < < 0.01) without affecting feed intake. CO elevated plasma triglycerides (P < 0.05). Jejunal villus height, villus-to-crypt ratio, and villus area were greater in DCV and DCV&CO (P < 0.05). Lipase activity increased in all supplemented groups; amylase was higher with DCV; protease was higher only with DCV&CO (P < 0.05). Supplemented diets upregulated mRNA expression of nutrient transporters (EAAT3, GLUT2, SGLT1, PEPT1, CAT-1) and tight junction markers (MUC2, TJP2, OCLN, CLDN1, TJP1). Cytokines were modulated: IL-1β increased in DCV, IL-8 in DCV&CO, and TNF-α decreased in all supplemented groups (P < 0.05). DCV and CO, alone or combined, improved growth, intestinal morphology, digestive enzyme activities, and gut barrier function while modulating pro-inflammatory cytokines, supporting their use as natural alternatives to antibiotic growth promoters.

1. Introduction

Global restrictions on the use of antibiotic growth promoters (AGPs) in poultry production have accelerated the search for effective and sustainable feed additives that can maintain growth performance while supporting intestinal health. This shift has prompted increased interest in natural alternatives, including microalgae and phytogenic compounds, which provide both nutritional value and functional bioactive components (Bhanja et al., 2022; Madkour et al., 2024; Madkour, et al., 2025; Saadaoui et al., 2021)

Chlorella vulgaris is a single-celled green microalga valued for its rich protein content, balanced indispensable amino acids, long-chain unsaturated fatty acids, along with diverse vitamins, minerals, and bioactives such as carotenoids and polysaccharides (An et al., 2016; Coelho et al., 2021; Li et al., 2016; Mendes et al., 2024). Dietary inclusion of driedChlorella vulgaris (DCV) has been reported to improve growth performance, antioxidant status, and immune function in poultry, as well as to improve gut morphology and beneficial microbial populations. Its bioactive components, particularly polysaccharides and chlorophyll, are thought to stimulate digestive processes and facilitate epithelial repair (Bošković Cabrol et al., 2024; Kang et al., 2013). DCV polysaccharides are fermentable substrates that can be converted into short-chain fatty acids (SCFAs), which promote intestinal epithelial proliferation, villus development, and TJ protein production. Additionally, Chlorella pigments and antioxidant substances like carotenoids and chlorophyll may reduce oxidative stress–induced TJ disruption, preserving intestinal barrier integrity (Madkour, Ali, et al., 2025; Mavrommatis et al., 2023; Mirzaie et al., 2020; Zhang et al., 2020)

Cinnamon oil (CO), derived from Cinnamomum species, is a phytogenic additive known for its broad biological activities, including inhibition of microbial growth, protection against oxidative stress, and modulation of inflammatory responses. The major active compound, cinnamaldehyde, can suppress pathogenic bacterial proliferation, modulate gut microbial composition, and stimulate the secretion of digestive enzymes. Several studies in broilers have demonstrated changes in feed efficiency, gut morphology, and immune status following CO supplementation (Wang et al., 2025). Recent reviews on nutrient-mediated regulation of intestinal tight junctions suggest that bioactive molecules, such as cinnamaldehyde and phenolic compounds in Cinnamomum essential oil (CO), can modulate gut microbiota composition, mitigate pathogen-induced TJ opening, and upregulate key structural proteins, such as occludin and claudins (Ali et al., 2021; Baskara et al., 2021).

Although the individual benefits of DCV and CO are well documented, limited research has explored their combined effects in poultry diets. Microalgae offer dense nutritional value and functional polysaccharides, while phytogenics like CO enhance digestion and limit microbial competition. Consequently, providing both yields comprehensive improvements in gut function and overall animal performance.

This study evaluated dietary supplementation with DCV and CO, individually or in combination, focusing on their effects on broiler growth traits, intestinal structure, gut enzymatic activity, and the expression of genes associated with absorption processes, epithelial barrier maintenance, and inflammatory regulation. To our knowledge, this is the first study to examine the combined effects of DCV and CO in broilers. We hypothesized that supplementing DCV with CO would produce greater improvements in performance and gut health than either additive alone.

2. Materials and methods

2.1. Ethical approval

All animal experiments were performed in accordance with established ethical standards for animal care and use, with approval granted by the Institutional Animal Research Ethics Committee of Al-Azhar University, Approval No. (AZHU-4D424). The study complied with national and institutional standards for animal welfare.

2.2. Animals and experimental design

A total of 120 one-day-old male Indian River broiler chicks were obtained from a commercial hatchery. On arrival, chicks were individually weighed and randomly allocated to four dietary treatments with six replicate cages per treatment and five birds per cage (n= 30 birds/treatment). Birds were reared in a three-tier battery-cage system. Each cage measured 80 × 60 × 45 cm (L × W × H), constructed from galvanized steel wire (25 × 25 mm mesh; 2.5–3.0 mm wire diameter) with a flat wire floor fitted with a removable plastic insert to protect footpads. Tiers were vertically separated by manure trays with drip guards to prevent cross-contamination. Each cage was equipped with a linear feeder providing ≥3–4 cm/bird of feeding space and two nipple drinkers. Treatments were balanced across tiers (top, middle, bottom) to minimize positional effects. Environmental conditions followed a standard broiler program: 33°C during the 1st week, gradually reduced to 24°C by day 21, with a 23L:1D lighting schedule; feed and water were supplied ad libitum. The expected final stocking density at 42 d was ∼20.8 kg/m² (5 birds per 0.48 m²; ∼10 kg live mass per cage). Health and welfare were monitored twice daily, with predefined humane endpoints.

The four experimental treatments were as follows:

• 1Control – basal diet without additives.
• 2DCV – basal diet supplemented with dried Chlorella vulgaris (1 g/kg or 0.1%).
• 3CO – basal diet supplemented with cinnamon oil (0.1 g/kg or 0.01%).
• 4DCV&CO – basal diet supplemented with both dried Chlorella vulgaris (1 g/kg) and cinnamon oil (0.1 g/kg).

2.3. Diets

Mash basal diet was formulated to meet or exceed the nutrient requirements of broilers, following the recommendations provided by the breeder company (Indian River management guide). Diet composition and calculated nutrient contents are presented in Table 1. The dried powder of Chlorella vulgaris (DCV) was obtained from Nanjing NutriHerb BioTech Co., Ltd., Nanjing, China, and cinnamon oil (CO) was sourced from PRIME HERBAL Co., Kanpur, Uttar Pradesh, India, with cinnamaldehyde content verified by gas chromatography (> 85%). All additives were thoroughly mixed into the diets.

Table 1.

Diets formulation and nutrient composition.

Ingredients	Starter diet (%)	Grower diet (%)	Finisher diet (%)
Maize	56.50	60.40	63.80
Soybean meal, 44%	26.60	24.47	23.97
Corn gluten meal	11.00	9.50	6.30
Sunflower oil	1.00	1.50	2.30
Ground limestone	1.60	1.10	1.10
Monocalcium phosphate	1.80	1.70	1.20
NaCl (salt)	0.32	0.32	0.32
Sodium bicarbonate	0.30	0.30	0.30
Premixa	0.30	0.30	0.30
L-lysine-HCl	0.38	0.28	0.28
DL-Methionine	0.20	0.13	0.13
Total	100.00	100.00	100.00
Calculated analysisb (as feed basis)
Metabolizable energy (kcal/kg)	2983.00	3054.00	3109.00
Crude protein, %	23.10	21.52	19.56
Calcium, %	0.98	0.76	0.68
Available phosphorus, %	0.49	0.46	0.36
Lysine, %	1.34	1.18	1.14
Methionine, %	0.68	0.58	0.52
Methionine+ cystine, %	1.08	0.96	0.87

^aVitamins and minerals premix supplied per Kg of diet: Vit A, 13000 IU; Vit D₃, 6000 IU; Vit E, 80 mg; Vit K₃, 4 mg; Vit B₁, 5 mg; Vit B₂, 9 mg; Vit B₆, 5 mg; Vit B_12, 0.035 mg; Niacin, 70 mg; Pantothenic acid, 20 mg; Folic acid, 2 mg; Biotin, 0.25 mg; Choline, 1 g; Magnesium, 0.12 g; Zinc, 0.11 g; Iron, 0.04 g; Copper, 16 mg; Iodine, 1.25 mg; Selenium, 0.3 mg; Kobalt, 0.15 mg.

^bAccording to chemical analysis of (Maize, Soybean meal and Corn gluten meal) otherwise calculated according to NRC (1994).

2.4. Growth performance measurements

Body weight (BW) and feed intake (FI) were recorded by replicate at day 1 and day 42. Body weight gain (BWG) was calculated as the difference between initial and final BW, and feed conversion ratio (FCR) was calculated as FI divided by BWG. There was no mortality during the study period.

2.5. Blood sampling and biochemical analysis

At 41 days of age, blood samples were collected from 12 randomly selected birds per treatment via the jugular vein into anticoagulant vacuum tubes. Plasma was separated by centrifugation at 2,000 × g for 10 min at 4°C and stored at –20°C until analysis. Plasma triglycerides (TG), glucose, and high-density lipoprotein (HDL) concentrations were measured using commercial kits (Glucose GOD–PAP™, Triglycerides GPO–PAP™, HDL Cholesterol™, Egyptian Co. for Biotechnology – Spectrum Diagnostics, Obour City, Cairo, Egypt).

2.6. Intestinal sampling

At the end of the trial, two birds per replicate (n= 12 per treatment) were weighed and slaughtered. After evisceration, a 4 cm jejunal segment (1 cm anterior to Meckel’s diverticulum) was excised and flushed with saline. The proximal 2 cm was snap-frozen in liquid nitrogen and stored at –80°C for RNA extraction. The distal 2 cm was fixed in 10% buffered formalin for histological analysis. Duodenal segments were sealed at both ends, excised, and their digesta emptied into sterile 5 mL tubes, which were immediately frozen in liquid nitrogen.

2.7. Jejunal histomorphometry

Formalin-fixed jejunal samples were dehydrated in graded ethanol, cleared in xylene, and embedded in paraffin. Sections (5 μm) were cut with a microtome and stained with hematoxylin and eosin. Slides were examined under a light microscope with a digital camera (CMEX-1™, Euromex Microscopen bv, Papenkamp, Arnhem, The Netherlands). Images were analyzed with Image Focus 4™ software (Euromex Microscopen bv) to measure villus height, villus width, crypt depth, and lamina muscularis thickness, as described by HAMPSON (1986) and Nabuurs et al. (1993). Six well-oriented villi per sample were measured and averaged for statistical analysis.

2.8. Digestive enzyme assay

Protease abundance in duodenal digesta was determined using a sandwich ELISA kit (RTDL00870; Assay Genie, Dublin, Ireland). Alpha-amylase activity was measured using a kinetic assay kit (AMYLASE–LQ; Spinreact, Sant Esteve de Bas, Girona, Spain) at 405 nm, and lipase activity was determined using a kinetic colorimetric assay kit (Lipase–LQ; Spinreact). All assays were performed according to the manufacturer’s guidelines.

2.9. RNA isolation and quantitative real-time PCR

Total RNA was isolated from jejunal tissue samples using TRIzol® reagent (Invitrogen Life Technologies, Palo Alto, CA, USA) and subsequently purified with the RNeasy Mini Kit (Qiagen, Valencia, CA, USA). The integrity of RNA was verified by agarose gel electrophoresis, and concentrations were determined with a NanoDrop 1000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). First-strand cDNA was synthesized from 1 μg of total RNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Cat. # K1621). Quantitative real-time PCR was performed using gene-specific primers (Table 2) according to previously described protocols (Hemida et al., 2023; Madkour et al., 2021). Beta-actin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) served as reference genes. Relative gene expression was calculated using the 2^–ΔΔCt method.

Table 2.

Sequences of primers used for quantitative real-time PCR.

Gene	Primer sequence (5-3)		PCR product size (bp)	Accession number	Annealing Tm (°C)
SGLT1 (SLC5A1)	F	CAGAACGTTTGAGGGCTTTGT	186	NM_001293240.2	55
	R	AGCAAGTGGAGCCAATCAGA
GLUT2 (SLC2A2)	F	CACACTATGGGCGCATGCT	68	NM_207178.2	57
	R	ATTGTCCCTGGAGGTGTTGGTG
SLC15A1 (PepT1)	F	TCCCATGGAGTCAACAGGCT	160	NM_204365.2	57
	R	GCTAGAAACAATGCCGGCTG
SLC7A1 (CAT-1)	F	CTCTGGCTTGGTGGTGAACATCTC	89	NM_001145490.2	61
	R	GCGTGCTTGGCTTGAGGGTAG
SLC1A1 (EAAT3)	F	TGCTGCTTTGGATTCCAGTGT	79	XM_424930.8	55.5
	R	AGCAATGACTGTAGTGCAGAAGTAATATATG
MUC2	F	CCCTGGAAGTAGAGGTGACTG	143	JX284122.1	53
	R	TGACAAGCCATTGAAGGACA
Occludin (OCLN)	F	ACGGCAGCACCTACCTCAA	123	NM_205128.1	57
	R	GGGCGAAGAAGCAGATGAG
Claudin-1 (CLDN1)	F	CTTCATCATTGCAGGTCTGTCAG	103	NM_001013611.2	55.5
	R	AAATCTGGTGTTAACGGGTGTG
TJP2	F	GCCCAGAAGCATCCAGACATT	220	XM_046934789.1	57
	R	GTGGCTGTCCGTAGTAACCT
TJP1	F	GGATGTTTATTTGGGCGGC	187	XM_040680630.2	55
	R	GTCACCGTGTGTTGTTCCCAT
IL8	F	GCAAGGTAGGACGCTGGTAA	254	NM_205498.2	55.5
	R	ACAGTGGTGCATCAGAATTGAG
IL-1β	F	CAGCCAGAAAGTGAGGCTCAACA	114	NM_204524.2	57.5
	R	ATGTAGAGCTTGTAGCCCTTGATG
TNF_alpha	F	TCGTGGCATCGTCCTCTCA	106	MF801626.1	56.5
	R	GGGACCACCAGTTTGTTCCTT
GAPDH	F	CTTTGGCATTGTGGAGGGTC	128	NM_204305.2	58-60
	R	ACGCTGGGATGATGTTCTGG
ß-actin	F	CACAATGTACCCTGGCATTG	158	L08165.1	54-56
	R	ACATCTGCTGGAAGGTGGAC

Abbreviations: SGLT1: sodium-glucose cotransporter 1; GLUT2: glucose transporter 2; PepT1: peptide transporter 1; CAT-1: cationic amino acid transporter 1; EAAT3: excitatory amino acid transporter 3; MUC2: mucin 2; OCLN: occludin; CLDN1: claudin 1; TJP2: tight junction protein 2; TJP1: tight junction protein 1; IL-8: interleukin 8; IL-1β: interleukin 1 beta; TNF-α: tumor necrosis factor alpha; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; β-actin: beta-actin.

2.10. Statistical analysis

Analyses were conducted with SPSS software (v.20.0; SPSS Inc., Chicago, IL, USA) using a one-way ANOVA model. Where treatment effects reached statistical significance (P < 0.05), multiple comparisons among means were performed with Tukey’s HSD test. All results are expressed as mean ± SEM. This study was not a factorial design, and the observed differences in the DCV&CO group are treated as discrete treatment effects rather than evidence of synergy.

3. Results

3.1. Growth performance

The effects of dietary dried Chlorella vulgaris (DCV), cinnamon oil (CO), and their combination (DCV&CO) on broiler growth performance are presented in Table 3. Supplementation with DCV significantly increased body weight gain (BWG; P= 0.008) and improved feed conversion ratio (FCR; P= 0.005) compared with the control (CTRL), while feed intake (FI) was unaffected (P= 0.392). Neither CO alone nor the combined supplementation altered BWG, FI, or FCR compared with CTRL.

Table 3.

Effects of dietary supplementation of dried Chlorella vulgaris, cinnamon oil, and their combination on growth performance of broiler chickens^a,b.

Parameter	CTRL	DCV	CO	DCV&CO	P valuec	SEMd
BWG (g)	2337.00b	2464.00a	2362.00ab	2343.00b	0.008	±15.00
FI (g)	3482.00	3536.00	3439.00	3412.00	0.392	±26.00
FCR	1.49a	1.43b	1.46ab	1.46ab	0.005	±0.06

^aControl diet (CTRL), Control diet supplemented with dried Chlorella vulgaris (DCV); Control diet supplemented with cinnamon oil (CO); Control diet supplemented with combination of Chlorella vulgaris and cinnamon oil (DCV&CO). BWG: body weight gain, FI: feed intake, FCR: feed conversion ratio.

^bData are the means from 6 replicates with 5 chicks/replicate (total of 30 broilers per group).

^cGroups with different letters for each parameter are significantly different (P < 0.05).

^dStandard error of means.

3.2. Plasma metabolites

Levels of glucose, triglycerides (TG), and high-density lipoprotein (HDL) in plasma are shown in Fig. 1. Birds receiving CO had significantly higher TG concentrations than CTRL (P= 0.014). No dietary treatment affected plasma glucose or HDL levels (P > 0.05).

Fig. 1.

Effects of dietary supplementation of dried Chlorella vulgaris, cinnamon oil, and their combination on some plasma metabolites: glucose, triglycerides (TG), and high-density lipoprotein (HDL) in broiler chickens. Control diet (CTRL), Control diet supplemented with dried Chlorella vulgaris (DCV); Control diet supplemented with cinnamon oil (CO); Control diet supplemented with combination of Chlorella vulgaris and cinnamon oil (DCV&CO). Data are the means ± SEM of 12 birds per group. Groups with different letters for each parameter are significantly different (P < 0.05).

3.3. Jejunal histomorphometry

Morphometric parameters of the jejunum are summarized in Table 4. Villus height was increased significantly in birds fed DCV or DCV&CO compared with CTRL (P= 0.001). DCV also elevated villus-to-crypt ratio (P= 0.010) and villus surface area (P= 0.032). Villus width, crypt depth, and lamina muscularis thickness were not affected (P > 0.05).

Table 4.

Effects of dietary supplementation of dried Chlorella vulgaris, cinnamon oil, and their combination on Jejunal Histomorphometry in broiler chickens^a,b.

Histomorphometric Parameters	CTRL	DCV	CO	DCV&CO	P value3	SEM4
Villus Height, µm	832.00b	955.00a	879.00ab	950.00a	0.001	±13.24
Villus Width, µm	106.00	107.00	103.00	105.00	0.898	±1.92
Crypt Depth, µm	101.00	106.00	112.00	111.00	0.148	±1.98
Lamina Muscularis Thickness, µm	154.00	181.00	169.00	195.00	0.267	±7.42
Villus/Crypt Ratio	7.60b	9.10a	7.90ab	8.80ab	0.010	±0.19
Villus Area, µm2	266201.00b	321699.00a	285566.00ab	315887.00ab	0.032	±7775.00

^aControl diet (CTRL), Control diet supplemented with dried Chlorella vulgaris (DCV); Control diet supplemented with cinnamon oil (CO); Control diet supplemented with combination of Chlorella vulgaris and cinnamon oil (DCV&CO).

^bData are the means from 12 birds per group.

^cGroups with different letters for each parameter are significantly different (P < 0.05).

^dStandard error of means.

3.4. Duodenal digestive enzyme activity

The activities of lipase, amylase, and abundance of protease in the duodenum are shown in Fig. 2. Lipase activity was significantly higher in all supplemented groups compared with CTRL (P < 0.05). DCV increased amylase activity relative to CO, DCV&CO, and CTRL (P < 0.05). Protease concentration was unaffected by DCV or CO alone, but significantly increased in the DCV&CO group compared with all other treatments (P < 0.05).

Fig. 2.

Effects of dietary supplementation of dried Chlorella vulgaris, cinnamon oil, and their combination on duodenal digestive enzymes in broiler chickens (lipase, amylase, and protease). Control diet (CTRL), Control diet supplemented with dried Chlorella vulgaris (DCV); Control diet supplemented with cinnamon oil (CO); Control diet supplemented with combination of Chlorella vulgaris and cinnamon oil (DCV&CO). Data are the means ± SEM of 12 birds per group. Groups with different letters for each parameter are significantly different (P < 0.05).

3.5. Jejunal nutrient transporter gene expression

Relative mRNA abundances of EAAT3, GLUT2, PEPT1, SGLT1, and CAT-1 are shown in Fig. 3. All supplemented groups had higher EAAT3, SGLT1, and CAT-1 expression than CTRL (P < 0.05), indicating a transcriptional upregulation of key amino acid and glucose transporters, although functional absorption was not directly assessed. DCV increased GLUT2 expression compared with DCV&CO and CTRL (P < 0.05). PEPT1 expression was greater in DCV and DCV&CO groups than in CO and CTRL (P < 0.05).

Fig. 3.

Effects of dietary supplementation of dried Chlorella vulgaris, cinnamon oil, and their combination on the mRNA levels of jejunal nutrient transporters: excitatory amino acid transporter 3 (EAAT3), glucose transporter 2 (GLUT2), peptide transporter 1 (PEPT1), sodium-glucose cotransporter 1 (SGLT1), and cationic amino acid transporter 1 (CAT-1) in broiler chickens. Control diet (CTRL), Control diet supplemented with dried Chlorella vulgaris (DCV); Control diet supplemented with cinnamon oil (CO); Control diet supplemented with combination of Chlorella vulgaris and cinnamon oil (DCV&CO). Data are the means ± SEM of 6 birds per group. Groups with different letters for each parameter are significantly different (P < 0.05).

3.6. Jejunal tight junction protein gene expression

Expression profiles of MUC2, TJP2, OCLN, CLDN1, and TJP1 are shown in Fig. 4. MUC2 expression was higher in all supplemented groups compared with CTRL (P < 0.05), with DCV&CO showing the highest value, consistent with a potential improvement in mucin production at the transcript level. DCV increased TJP2, OCLN, CLDN1, and TJP1 expression compared with CTRL (P < 0.05). OCLN expression in CO-fed birds did not differ from CTRL, and CLDN1 expression in DCV&CO birds was similar to CTRL (P > 0.05), indicating that transcriptional responses of individual tight junction markers varied among treatments and that these findings should be interpreted as molecular indicators rather than direct proof of barrier strengthening.

Fig. 4.

Effects of dietary supplementation of dried Chlorella vulgaris, cinnamon oil, and their combination on the mRNA levels of mucin (MUC2) and tight junction proteins: tight junction protein 2 (TJP2), occludin (OCLN), claudin1 (CLDN1), tight junction protein 1 (TJP1) in the jejunum of broiler chickens. Control diet (CTRL), Control diet supplemented with dried Chlorella vulgaris (DCV); Control diet supplemented with cinnamon oil (CO); Control diet supplemented with combination of Chlorella vulgaris and cinnamon oil (DCV&CO). Data are the means ± SEM of 6 birds per group. Groups with different letters for each parameter are significantly different (P < 0.05).

3.7. Jejunal pro-inflammatory cytokine gene expression

The relative mRNA levels of IL-8, IL-1β, and TNF-α are shown in Fig. 5. IL-8 expression was highest in DCV&CO, exceeding both DCV and CTRL (P < 0.05). DCV increased IL-1β expression compared with all other groups (P < 0.05), reflecting a treatment‑dependent modulation of inflammatory signaling at the mRNA level rather than confirmed changes in functional immune responsiveness. Expression of TNF-α was reduced in all supplemented groups compared with CTRL (P < 0.05), which is compatible with a dampened pro‑inflammatory state; however, downstream protein levels and cytokine activity were not assessed in this investigation.

Fig. 5.

Effects of dietary supplementation of dried Chlorella vulgaris, cinnamon oil, and their combination on the mRNA levels of interleukin-8 (IL-8), tumor necrosis factor (TNF-α), and interleukin-1beta (IL-1β) in the jejunum of broiler chickens. Control diet (CTRL), Control diet supplemented with dried Chlorella vulgaris (DCV); Control diet supplemented with cinnamon oil (CO); Control diet supplemented with combination of Chlorella vulgaris and cinnamon oil (DCV&CO). Data are the means ± SEM of 6 birds per group. Groups with different letters for each parameter are significantly different (P < 0.05).

4. Discussion

In recent years, the intricate relationship between poultry nutrition and gastrointestinal health has become a major focus of research, which has major implications for animal health and productivity (Abd El-Hack et al., 2023; Abdel-Moneim et al., 2022; Sakr et al., 2022). Integrating bioactive substances to boost gut health and immunity serves as a viable strategy for antibiotic-free production while advancing the sustainability of the chicken industry (Abdel-Moneim, et al., 2022; Al-Sagheer et al., 2023; Elnesr et al., 2023).

4.1. Growth performance

The current study demonstrated that dietary Chlorella vulgaris (1 g/kg or 0.1%) can improve BWG of broiler chickens. The efficacy of dietary Chlorella vulgaris may stem from its ability to enhance intestinal health by augmenting beneficial bacterial populations, diminishing harmful bacterial populations, regulating various ileal gene expression, and enhancing intestinal histomorphology. DCV-fed birds exhibited enhanced body weight gain and improved FCR, coinciding with increased villus height, villus-to-crypt ratio, and villus area, however crypt depth and lamina muscularis remained unaltered. Longer villi and greater surface area augment the absorptive capacity, which in conjunction with elevated expression of SGLT1, GLUT2, PEPT1, EAAT3, and CAT-1, likely boost nutrition absorption and energy acquisition, offering a credible rationale for the enhanced performance observed in DCV birds. A previous study reported that including 0.15% or 0.5% Chlorella vulgaris in the diet enhanced FBW and BWG compared with the control (An et al., 2016). Moreover, the increase in BWG was reflected in improved FCR, indicating the beneficial effect of Chlorella vulgaris on feed utilization. Comparable results were noted by Kang et al. (2013), who discovered that body weight gain was significantly elevated in groups treated with antibiotic growth promoters (AGP) and Chlorella (1.0% Chlorella powder, 1.0% Chlorella growth factor) compared to the control group. This suggests that dietary Chlorella may serve as a substitute for AGP in broiler feed promoting optimal growth performance. However, increasing dietary levels of Chlorella vulgaris up to 10% did not enhance growth performance of broiler chickens (Coelho et al., 2021). Although specific dosages of Chlorella vulgaris supplementation have demonstrated potential in improving growth performance, varying dosage and feeding period can yield disparate results regarding nutritional advantages and physiological consequences. A possible explanation for the decline in performance observed after the highest Chlorella vulgaris inclusion levels is the palatability and the increased gut-level digesta viscosity caused by the protein gelation and high non-starch polysaccharide contents of microalgae (Bošković Cabrol et al., 2024; Boskovic Cabrol et al., 2022). Research has shown that including Chlorella vulgaris in the diet at levels not exceeding 2% can enhance feed utilization efficiency without detrimentally impacting growth, however elevated levels with or without exogenous enzymes may not yield further advantages or could result in negative consequences (Alfaia et al., 2021; Boskovic Cabrol et al., 2022; Coelho et al., 2021). The present study indicates that dietary cinnamon oil (0.1 g/kg or 0.01%), or its combination with Chlorella vulgaris, did not significantly influence BWG, FI, and FCR of broiler chickens. This finding aligns with the studies conducted by Lee et al. (2003) and Hernández, Madrid, García, Orengo, and Megías (2004), which demonstrated that dietary administration of 100 ppm (0.01%) of cinnamaldehyde or 200 ppm of a blend of capsaicin, cinnamaldehyde, and carvacrol did not enhance growth performance of broiler chickens. The ineffectiveness of the dietary cinnamon may be associated with reduced water consumption, an interesting finding derived from a previous investigation by Lee et al. (2003), who found that the administration of cinnamaldehyde systematically reduced water consumption, with an average decrease of 10% compared to the control group. However, water consumption was not recorded in the current study. On the other hand, it is possible that cinnamon oil changes the make-up of the bacteria in the digestive tract through its antimicrobial properties. Disrupting the equilibrium of beneficial bacteria could severely affect digestion and absorption.

4.2. Plasma metabolites

Plasma glucose and HDL cholesterol concentrations were unaffected by supplementation, in agreement with earlier studies on Chlorella vulgaris (Kotrbáček et al., 2013) and cinnamon (Dosoky et al., 2021). However, CO supplementation increased TG levels, possibly due to enhanced insulin sensitivity and lipid storage mechanisms (Anand et al., 2010; Gao et al., 2021). Cinnamaldehyde and polyphenols in cinnamon oil may stimulate lipogenic enzyme activity, increasing circulating TG concentrations (Çelik et al., 2022; Tuzcu et al., 2017).

4.3. Jejunal histomorphology

Evidence suggests that dietary composition may affect intestinal morphology, particularly villus, crypt, and mucosal thickness (Al-Sagheer et al., 2023; Elbaz et al., 2021). We assessed structural alterations in intestinal morphology using the histomorphology examination of the jejunum. We propose that this measure may partially indicate intestinal functionality, which could be influenced by dietary supplements. Most nutrient absorption occurs in the jejunal portion of the small intestine. The villi are fundamental structures in the small intestine. An increase in villi height would directly increase the intestine's capacity to absorb nutrients by increasing surface area and absorption capacity. The current results showed that villus height was significantly elevated in birds fed diets containing Chlorella vulgaris, cinnamon, or both. While the villus/crypt ratio and villus surface area were significantly increased by dietary Chlorella vulgaris. However, it showed no effect on villus width, crypt depth, and lamina muscularis thickness. DCV polysaccharides can serve as fermentable substrates for commensal microbes to produce SCFAs (Zhang et al., 2020). SCFAs, especially butyrate, are essential because they stimulate the growth of the crypt-villus axis, raise the height of the villus, and reinforce the integrity of the tight junction (Gieryńska et al., 2022). It is important to note that SCFAs were not quantified, and this theory requires further targeted studies; however, it is plausible that DCV-driven SCFA generation contributed to the enhanced villus architecture and barrier-related gene expression observed in our study. A previous study demonstrated that supplementation of 25, 50 and 75 g/kg of Chlorella by-product or 10 g /kg of Chlorella by-product considerably raised villus height and crypt depth (Kang et al., 2017; Mirzaie et al., 2020), respectively. The current findings are consistent with previous research showing that including cinnamon oil or cinnamon bark powder in the diet increases duodenal villus height (Chowdhury et al., 2018; Qaid et al., 2021). The antimicrobial activities of the supplements are responsible for the improvement in intestinal morphology that was seen in this study Alimohammadi et al. (2024). These chemicals prevent abnormal villus remodeling by limiting pathogenic colonization and increasing beneficial bacteria, which in turn prevent villus damage. Furthermore, the transgenic Chlorella vulgaris was found to have a beneficial prebiotic effect, accelerating the growth of four different probiotic bacterial species and reducing the pH of their growth medium (Saha et al., 2024). However, another study reported no significant effects of 0.8% dietary Chlorella vulgaris biomass on intestinal histomorphology parameters (Roques et al., 2022). According to recent findings by Alimohammadi et al. (2024), dietary supplementation with 3 g/kg of cinnamon powder did not enhance intestinal histomorphology. The observed discrepancy in outcomes may be attributable to the administered doses or the characteristics of the supplemented product and its structure.

4.4. Digestive enzyme assay

There is limited understanding of the mode of action via which dietary supplementation of essential oils or microalgae affects digestive enzymes, particularly within the small intestine. Assessing enzyme activities in this region could shed light on how these supplements affect digestive function, as significant nutrient digestion occurs here. Our results indicated that dietary Chlorella alone exerted a beneficial effect on lipase and amylase activities, but not on protease activity. Only Chlorella showed a significant enhancement in the digestive activity of amylase. Augmented lipase activity in all supplemented groups and heightened amylase levels with DCV may indicate greater stimulation of the exocrine pancreas and/or stability of enzymes by bioactive substances. Chlorella vulgaris has a hard cell wall made of polysaccharides and glycoproteins, which might delay digestion and nutrition extraction and result in an elevated demand and production of amylase (Alfaia et al., 2021; Safi et al., 2014). Amylase is typically used to hydrolyze starch in cell walls (Shivakumar et al., 2024). The targeted elevation of protease levels in the DCV&CO group serves as a supplementary effect, as CO phenolics, such as cinnamaldehyde and associated terpenoids, have been documented to augment pancreatic trypsin and amylase activities, perhaps co-supplemented with DCV to amplify protease production. Nonetheless, these pathways are suggested and necessitate validation through direct measurements of pancreatic secretions. However, these findings should be viewed as preliminary indicators of exocrine response rather than absolute quantification of enzyme mass. Cinnamaldehyde and carvacrol are key constituents of cinnamon essential oil. Research has demonstrated that a feed supplement containing carvacrol, cinnamaldehyde, and capsaicin in combination can improve the activities of pancreatic trypsin and α-amylase in both tissue and jejunal digesta of broiler chickens (Jang et al., 2007). Mixture of thymol and carvacrol improved digestive trypsin activity, lipase, and protease in the intestine digesta of 24-d-age broiler chickens in a dose-dependent manner (Hashemipour et al., 2013). However, amylase concentration was not influenced by the supplements in agreement with our findings for cinnamon oil supplementation (Hashemipour et al., 2013). It is possible that the bioactive components of cinnamon oil are more effective against lipids than carbohydrates. This selectivity may help explain why lipase levels are elevated, while amylase and protease activities remain unchanged. Evidence shows that various compounds in plant extracts have inherent bioactivities that affect metabolism and physiological responses. Flavones derived from soy proteins had minimal influence on the in vitro breakdown of protein–phenol complexes during peptic or pancreatic digestion (Rawel et al., 2002). But polyphenols can sequester lysine, tryptophan, and cysteine residues by combining with proteins to produce leather-like precipitates. Having proteins bonded in this way reduced their digestibility and biological value (Rawel et al., 2002). Zdunczyk et al. (2002) found that flavone extracts from skullcaps reduced the actual digestibility of casein protein in rats by about 2%. The biochemical environment of the digesta may influence antibody binding in cross-species applications. Therefore, the lack of species-specific validation for the rat PRSS1 kit in chicken samples is a limitation of the study.

4.5. Nutrient transporter gene expression

The current study evaluated the effects of dietary supplementation with Chlorella vulgaris, cinnamon oil, or their combination on the expression of EAAT3, GLUT2, PEPT1, SGLT1, and CAT-1 in the jejunum of broiler chickens.

EAAT3 and CAT-1 are essential for the transfer of anionic and cationic amino acids, respectively. EAAT3 plays a role in maintaining low local glutamate levels and is crucial for activating the mTOR pathway, which is essential for nutrient sensing and cellular development. While CATs serve as the principal amino acid transport mechanism by which tissues accumulate lysine, arginine, and ornithine within cellular amino acid reservoirs for nitrogen metabolism. Enhanced enzymatic hydrolysis, shown by heightened activity of amylase, lipase, and abundance of protease, was associated with increased luminal availability of monosaccharides, fatty acids, and peptides, which may subsequently upregulate transporter expression via nutrient-sensing pathways. The simultaneous overexpression of these transporters, together with increased digestive enzyme levels, indicates a heightened capability for nutritional utilization; however, direct assessments of functional absorption were not performed in this work. The elevated expression of EAAT3 and CAT-1 in the in this study may be related to the abundance of associated-nutrients in the digestive tract of supplemented birds (Humphrey et al., 2004), potentially reflecting increased luminal availability of these amino acids, although direct correlations with transporter abundance or functional flux were not established. The transmembrane transporter GLUT2 is continuously expressed in β-cells and functions as a glucose sensor due to its low glucose affinity. The abundance of GLUT2 was positively correlated with dietary caloric intake and regulates key aspects of the liver's glucose metabolism (Thorens, 1996). The SGLT1, which is linked to glucose absorption, was also elevated due to the dietary supplements, suggesting a transcriptional response to dietary carbohydrates; however, functional glucose uptake was not measured. Previous studies reported that the increased mRNA expression of SGLT1 and GLUT2 led to enhanced glucose absorption (Shehata et al., 2022; Yin et al., 2019). We can conclude that alterations in the types and levels of nutrient transporters reflect tissues' capacity to adjust to changes in the nutritional profile of the diet or the availability of nutrients. Therefore, our data propose that dietary supplements used in this study stimulated the expression of transported genes via enhancing the feed utilization and gut health, but without direct protein or flux assays, causality with functional nutrient utilization remains inferential.

4.6. Tight junction proteins and mucins

This study reports the relative expression of several genes linked to intestinal barrier function (MUC2,TJP2, OCLN, CLDN, and TJP1). The current study found significantly higher MUC2 gene expression in all supplemented groups compared with the control group. MUC2, a major gel-forming mucin, is an extensively glycosylated protein that creates a physical barrier, safeguarding epithelial cells from stress-induced injury (Forder et al., 2012). Furthermore, mucins have the ability to affect tight junction proteins (TJPs) and interact with them to modulate the structural and functional integrity of the gut barrier. Recent findings suggest that MUC2 can improve tight junction repair in response to cellular gaps (Yan et al., 2024). The antimicrobial and antioxidant activity of both cinnamon oil and Chlorella vulgaris may contribute to the high mucin gene expression in the intestine of treated birds, as shown above, particularly in their DCV&CO group. The upregulation of MUC2 may help regulate the colonization of the microbiota by providing colonization sites and trapping harmful bacteria (Zhang et al., 2015). The present study showed that Chlorella vulgaris had the highest significant effect on the evaluated TJPs (TJP2, OCLN, CLDN1, and TJP1). Tight junction proteins primarily serve to form a barrier that prevents paracellular leakage and modulates the passage of ions, water, and solutes between cells (Lee et al., 2018). The integrity of tight junctions is dynamically regulated by the interactions between integral transmembrane proteins (e.g., OCLN and CLDN) and peripheral membrane proteins (e.g., TJP1, TJP2, and TJP-3) (Lee et al., 2018). SCFAs produced from DCV and antioxidant pigments may safeguard TJPs proteins from oxidative damage and facilitate their assembly. Cinnamaldehyde and polyphenols have been demonstrated to affect tight junction composition and barrier functionality both in vitro and in vivo (Sampath et al., 2024; Sandoval-Ramírez et al., 2021; Zheng et al., 2023), indicating that the observed elevation in OCLN, CLDN1, and TJP1 expression may be partially attributable to these substances. The current data demonstrated that dietary supplements upregulated the mRNA levels of TJP1 and TJP2. The TJ proteins link junctional proteins, including OCLN and CLDN, to the actin cytoskeleton, hence preserving tight junction formation and functionality (B. Lee et al., 2018). However, the functions of TJ proteins in tight junctions are not completely understood. Research demonstrates that while TJP1-deficient cells may preserve the architecture of tight junctions and display normal permeability, the functionality of other TJPs, including OCLN and CLDN, in the assembly of tight junctions was impeded in these cells (Lee, 2015; Umeda et al., 2004). The study also showed high OCLN expression in the group fed Chlorella and cinnamon oil. While CLDN1 was upregulated in the cinnamon oil-fed group. This high expression of TJPs may be attributed to the bioactive ingredients in these supplements, which have antioxidant and antimicrobial properties.

4.7. Inflammatory cytokines

The observed alterations in mRNA expression of pro-inflammatory cytokines suggest that dietary interventions with Chlorella vulgaris, cinnamon oil, or their combination distinctly modulate the intestinal immune response in broiler chickens. The elevated IL-8 expression in the DCV&CO group compared to DCV and CTRL suggests a mild chemotactic immune activation, likely driven by the bioactive compounds in cinnamon oil. IL-8 is a key chemokine that recruits neutrophils to the site of inflammation. While an increase in IL-8 may initially reflect immune modulation, it could also represent enhanced mucosal surveillance and preparedness against enteric pathogens, particularly in the absence of overt inflammatory damage (Kogut et al., 2018).

Conversely, the upregulation of IL-1β in birds fed Chlorella vulgaris alone may indicate a transient pro-inflammatory state, potentially triggered by immunostimulatory components such as β-glucans, lipopolysaccharide-like compounds, or other microalgal polysaccharides (Lee et al., 2023; Mirzaie et al., 2020). This response may reflect an initial priming of the mucosal immune system. Notably, co-administration with cinnamon oil effectively attenuated IL-1β expression, highlighting the anti-inflammatory potential of this phytogenic additive and its capacity to balance Chlorella-induced immune activation (Elazab et al., 2021; Tabatabaei et al., 2015).

The significant reduction in TNF-α expression across all supplemented groups (DCV, CO, DCV&CO) compared to control implies a systemic anti-inflammatory effect exerted by both Chlorella vulgaris and cinnamon oil. TNF-α is a central mediator of acute inflammation, and its downregulation suggests that these feed additives may enhance intestinal homeostasis and reduce the risk of chronic inflammation or gut barrier disruption (Aggarwal et al., 2022; Elazab et al., 2021).

Overall, these findings point to a complementary immunomodulatory effect whereby Chlorella vulgaris initiates mild immune stimulation, while cinnamon oil tempers the inflammatory response—thereby supporting intestinal health without triggering excessive inflammation. Such modulation may be particularly beneficial in antibiotic-free poultry production systems, where maintaining immune balance is critical for optimal growth and disease resistance (Kogut et al., 2018; Lee et al., 2023).

5. Conclusion

Dietary supplementation with Chlorella vulgaris (DCV) and cinnamon oil (CO), either individually or in combination, exerted beneficial effects on broiler intestinal health and function. DCV enhanced growth performance, improved jejunal morphology, stimulated digestive enzyme activities, and upregulated nutrient transporter genes, indicating improved absorptive capacity. CO demonstrated anti-inflammatory activity, as reflected by reduced TNF-α expression and modulation of other cytokines, and contributed to gut barrier protection through increased MUC2 and tight junction protein expression.

The dietary DCV&CO group showed beneficial effects— modulating intestinal integrity, nutrient utilization, and immune responses without inducing excessive inflammation. These findings support the potential of DCV and CO as natural feed additives to promote gut health and performance in antibiotic-free broiler production. Future research should focus on defining optimal inclusion levels and evaluating their efficacy under commercial production conditions.

Availability of data and materials

The datasets generated and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Funding

This research received no external funding.

Consent for publication

Not applicable.

Ethical statement

All animal experiments were performed in accordance with established ethical standards for animal care and use, with approval granted by the Institutional Animal Research Ethics Committee of Al-Azhar University, Approval No. (AZHU-4D424). The study complied with national and institutional standards for animal welfare.

CRediT authorship contribution statement

Ahmed Kewan: Writing – original draft, Project administration, Investigation, Formal analysis, Conceptualization. Mahmoud Madkour: Validation, Methodology, Formal analysis. Abdelkawy A. El-Ghoul: Methodology, Investigation, Formal analysis. Roshdy A. Abo-Salem: Methodology, Investigation, Formal analysis. Waleed Abdelmoez: Methodology, Investigation, Formal analysis. Ahmed Ramzy: Methodology, Investigation, Formal analysis. Khaled S. Sayed: Methodology, Investigation, Formal analysis. Mohamed Hosny: Methodology, Investigation, Formal analysis. Abdelrazeq M. Shehata: Writing – review & editing, Writing – original draft, Investigation, Formal analysis.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.