Skip to main content
NCBI home page
International Journal of Molecular Sciences logoLink to International Journal of Molecular Sciences
. 2026 Feb 25;27(5):2155. doi: 10.3390/ijms27052155

A Thermo-Sensitive Molecular Switch: Pyrexia-1 Dynamically Regulates Low-Temperature Adaptation in Chrysoperla nipponensis

Yuqing Gao 1, Zeyu Qin 1, Zainab Haruna Abdullahi 1, Dandan Li 1, Zhiwei Kang 2, Zhenzhen Chen 1,*, Yongyu Xu 1,*
Editor: Pedro Martínez-Gómez
PMCID: PMC12984629  PMID: 41828382

Abstract

Cold tolerance of natural enemy insects is a critical determinant of their overwintering survival and efficacy in biological control. The green lacewing (Chrysoperla nipponensis) is an important natural enemy insect that overwinters as adults in nature; however, its high overwintering mortality severely limits its effective application in spring. To investigate the molecular mechanisms underlying low-temperature adaptation, this study focuses on the temperature-sensitive Transient Receptor Potential (TRP) channels and their roles in the cold tolerance of C. nipponensis. The TRPA subfamily gene, Pyrexia-1, was identified and found to be significantly downregulated upon cold exposure. A functional analysis indicates RNAi-mediated knockdown of Pyrexia-1 significantly lowered both the supercooling point and the freezing point of C. nipponensis adults, enhancing their survival rate at −10 °C. These results indicate Pyrexia-1 as a negative regulator of cold tolerance. Further mechanistic investigation revealed that inhibition of Pyrexia-1 function specifically down regulates the expression of trehalase (TRE1) genes, resulting in a marked accumulation of the cryoprotectant trehalose in adults. This metabolic adjustment was accompanied by the upregulation of heat shock protein Hsp70. Overall, these findings establish Pyrexia-1 as a critical molecular switch linking temperature-sensing signals to the metabolic pathways governing freeze resistance, thereby orchestrating the systemic cold adaptation in C. nipponensis. This discovery provides novel insights into the molecular basis of insect low-temperature adaptation and suggests a potential strategy for enhancing the overwintering capacity of natural enemy insects by targeting this regulatory node.

Keywords: Chrysoperla nipponensis, cold tolerance, TRP channels, pyrexia, trehalase

1. Introduction

Global climate change has increased the frequency of extreme temperature events, imposing severe pressures on the survival of ectotherms. As the most diverse group of organisms on Earth, insects exhibit distribution, population dynamics, and ecological functions that are highly dependent on thermal adaptability [1,2]. In temperate and frigid zones, low temperature is a key factor limiting insect overwintering survival and geographic range expansion. The evolutionary mechanisms underlying cold tolerance thus profoundly influence species’ niche breadth [3,4,5]. The green lacewing, Chrysoperla nipponensis, is an important predatory natural enemy in East Asia with significant bio-control potential against agricultural pests including aphids and thrips [6,7]. Adults of this species overwinter via facultative diapause [8]. However, field observations indicate that winter low temperatures can cause over 60% population mortality. Furthermore, “late spring coldness” events can delay population recovery in spring, leading to phenological asynchrony with pest outbreaks and severely undermining annual bio-control efficacy [8]. Consequently, elucidating the molecular regulatory mechanisms of cold tolerance in C. nipponensis is urgently needed to enhance its overwintering survival and advance sustainable, natural enemy-based bio-control technologies.

To cope with cold stress, insects have evolved complex physiological and molecular adaptive strategies. These include the synthesis of cryoprotectants, accumulation of lipid energy reserves, expression of heat shock proteins (HSPs) and antifreeze proteins, and precise regulation of associated gene expression networks [9,10]. Key pathways central to insect cold hardiness encompass trehalose metabolism (responsible for synthesizing a major cryoprotectant) [11,12,13], the heat shock response (maintaining proteostasis) [14,15], and lipid metabolism (regulating membrane fluidity and energy supply) [16]. However, the upstream sensory and regulatory genes that drive these downstream cold-hardiness phenotypes, particularly in ecologically valuable natural enemy insects, remain inadequately characterized.

At the molecular sensory level, the Transient Receptor Potential (TRP) ion channel family serves as a key class of temperature sensors in animals. First discovered in Drosophila [17], members involved in temperature sensation are termed “Thermo-TRP” channels and constitute the molecular basis for perceiving temperature gradients and initiating adaptive responses [18]. TRP channels, found across species from mammals to insects, are crucial not only as cold/heat sensors but are also implicated in diverse physiopathological processes such as inflammatory pain (e.g., rheumatoid arthritis) and acute lung injury, reflecting their role in thermoregulation and adaptive evolution [19,20,21].

In insects, the diversity and functional specificity of TRP channels are particularly prominent, forming a molecular cornerstone for perceiving complex environments and regulating behavioral and physiological adaptations [22]. Comparative genomic studies confirm that insect TRP channels, especially the TRPA subfamily, have undergone significant expansion and diversification during evolution [23]. For instance, in Drosophila melanogaster, multiple TRP channels (e.g., Brv1, TRP, TRPL) participate in cold perception and regulate processes such as low-temperature-induced reproductive diapause [24]. Research on the Texas leafcutter ant (Atta texana) revealed that a hymenopteran-specific TRPA channel possesses unique dual cold/heat activation properties, closely associated with its fungus garden temperature-maintenance behavior [25]. Similarly, the brown planthopper exhibits a negative thermotaxis (cold preference) regulated by TRPA1 channels, which may relate to its selection of specific migratory temperature layers [26]. These studies underscore the pivotal role of TRP channels in insect environmental adaptation and suggest their significant potential as novel targets for pest control [22].

Nevertheless, the precise molecular mechanisms by which specific TRP channels regulate the critical survival trait of insect cold hardiness remain poorly understood. Although studies in ectotherms like the Nile tilapia show that low temperatures can significantly alter the expression patterns of specific TRP channels, hinting at a potential conserved role in temperature stress responses [27], it remains unclear whether and how specific TRP channels directly regulate systemic cold-hardiness phenotypes in insects and what downstream pathways they engage.

Functional studies of the Pyrexia subfamily of TRP channels provide a specific entry point. The established paradigm in D. melanogaster identifies Pyrexia as a high-temperature sensor (activated >40 °C), with its core function being mediation of heat shock protection [18]. However, subsequent research reveals species- and ecological context-specific functionalities. The role of Pyrexia homologs is no longer confined to high-temperature protection. For example, recent functional studies in the agricultural pest pea leafminer (Liriomyza huidobrensis) demonstrate that its pyx gene expression is bidirectionally regulated by temperature, downregulated by low temperature and upregulated by high temperature, which modulates oviposition behavior to adapt to thermal stress [28]. This evidence suggests that Pyrexia homologs may have evolved novel, more complex, and diverse functions related to temperature adaptation in non-model insects. Yet, the direct regulatory role of this gene in the systemic cold hardiness of key natural enemy insects remains entirely unexplored.

Based on this background, we propose the central hypothesis: A Pyrexia homolog in C. nipponensis is a key regulatory factor governing its cold tolerance. To test this hypothesis, we first identified a low-temperature-responsive candidate gene, Pyrexia-1, via transcriptome analysis. We then employed RNAi-mediated loss-of-function assays to systematically evaluate its direct impact on key cold-hardiness phenotypes, including supercooling point, freezing point, and low-temperature survival rate. Furthermore, we screened for potential downstream cold-hardiness-related genes and metabolites regulated by Pyrexia-1 to preliminarily dissect its mechanism of action. This study aims to reveal a potential novel function of a TRP channel in the low-temperature adaptation of a natural enemy insect, providing a new perspective for understanding the molecular evolution of insect environmental adaptation and offering a potential theoretical basis and genetic target for enhancing the overwintering capacity of natural enemies.

2. Results

2.1. Transcriptome-Based Identification and Validation of the Cold-Tolerance Candidate Gene Pyrexia-1

Transcriptomic analysis of C. nipponensis adults comparing cold-acclimated and control conditions (unpublished data) identified two Pyrexia homologs of the TRPA channel gene, designated herein as Pyrexia-1 and Pyrexia-2. Analysis of the transcriptomic data showed that Pyrexia-1 expression was significantly downregulated following cold acclimation, with transcript levels decreasing to 40.9% (females) and 31.9% (males) of those in the control group (Figure A1A). In contrast, Pyrexia-2 expression showed no significant change (Figure A1B). Subsequent RT-qPCR validation confirmed that cold acclimation significantly suppressed Pyrexia-1 expression. This resulted in a reduction of approximately 66.7% in females and 70.7% in males relative to control levels (Figure 1A). Consistent with the transcriptomic data, the expression level of Pyrexia-2 did not differ significantly between the cold-acclimated and control groups in either sex (Figure 1B). Given its specific and significant downregulation in response to cold exposure, Pyrexia-1 was selected as the candidate gene for subsequent functional investigation.

Figure 1.

Figure 1

Open in a new tab

Validation of mRNA expression levels of (A) Pyrexia-1 and (B) Pyrexia-2 by RT-qPCR. Relative mRNA expression levels under control (CK) and cold-hardening (CH) conditions are shown. Data are mean ± SEM, with scatter points representing individual data points. Statistics: Unpaired t-tests were conducted between different treatments (CK vs. CH) within the same sex. * p < 0.05, *** p < 0.001, ns: not significant.

2.2. Molecular Cloning and Bioinformatics Analysis of the Pyrexia-1 Gene

Sequencing confirmed the successful cloning of the Pyrexia-1 gene, which possesses an open reading frame (ORF) of 3507 bp, encoding a protein of 1168 amino acids. Analysis using the SMART online tool revealed that the Pyrexia-1 protein harbors 13 consecutive ankyrin (ANK) repeat domains within its N-terminal cytoplasmic region, a characteristic architectural feature of the TRPA subfamily. Importantly, a highly conserved ion transport domain (Pfam: Ion_trans), which is essential for forming the ion selectivity pore, was identified between amino acids 735 and 976. Additionally, a C-terminal coiled-coil domain was predicted, potentially involved in mediating channel subunit assembly. To evaluate the evolutionary conservation of this domain architecture, we analyzed homologous Pyrexia proteins from Chrysoperla carnea, D. melanogaster, Diprion similis, Plutella xylostella, Ostrinia nubilalis, Periplaneta americana, and Carabus blaptoides fortunei. The results demonstrated that these key structural domains are highly conserved across species (Figure 2), thereby validating the bioinformatic predictions and supporting the inference of a stable core function for Pyrexia-1 throughout evolution.

Figure 2.

Figure 2

Open in a new tab

Conserved domain analysis of Pyrexia orthologs from 7 insect species, including Cc_Pyrexia-like (Chrysoperla carnea, XP_044734863.1), Dm_pyx (Drosophila melanogaster, NP_612015.1), Ds_Pyrexia-like (Diprion similis, XP_046733997.1), Px_pyx (Plutella xylostella, XP_048484258.1), On_Pyrexia-like (Ostrinia nubilalis, XP_063833659.1), Pa_Pyrexia-like (Periplaneta americana, XP_069685960.1), Cb_pyx (Carabus blaptoides fortunei, GLV35371.1). In the diagram, low compositional complexity is marked in purple, while the ANK and Ion_trans domains are highlighted in green and black boxes, respectively.

Predictions of transmembrane topology and subcellular localization further corroborated its identity as an integral membrane protein. Topology analysis indicated the presence of six canonical transmembrane helices (Figure A2A). Consistent with this, SignalP analysis confirmed the absence of a signal peptide (Figure A2B), which is typical for integral membrane proteins. Furthermore, analysis of the protein’s physicochemical properties revealed a predicted molecular weight of approximately 92.7 kDa and a theoretical isoelectric point of 5.89. The calculated instability index of 35.32 classifies it as a stable protein. Moreover, its high aliphatic index (108.06) suggests potential thermostability, while a grand average of hydropathicity (GRAVY) value of 0.064 indicates an overall hydrophobic character. Collectively, these properties are consistent with those expected for a transmembrane protein.

2.3. Phylogenetic Analysis of Pyrexia Genes

To elucidate the evolutionary relationships of Pyrexia-1 and its paralog Pyrexia-2, we constructed a phylogenetic tree encompassing TRPA channel proteins from diverse insect species (Figure 3). The results show that Pyrexia-1 forms a cluster with a Pyrexia-like protein from the closely related species C. carnea. This pair, in turn, groups together with Pyrexia homologs from coleopteran and lepidopteran insects within a larger, distinct evolutionary clade. In contrast, Pyrexia-2 resides on a separate phylogenetic branch, where it clusters specifically with the canonical pyrexia (pyx) gene from the model organism D. melanogaster.

Figure 3.

Figure 3

Open in a new tab

Phylogenetic analysis of Pyrexia orthologs from 15 insect species. The evolutionary tree was constructed using the Neighbor-Joining method. Bootstrap values (based on 1000 replicates) are shown at the nodes. The red five-pointed stars indicate the two pyrexia genes analyzed in this study.

2.4. Three-Dimensional Structure Prediction of the Pyrexia-1 Protein

A three-dimensional structural model of the Pyrexia-1 protein was successfully predicted using AlphaFold 3 (Figure 4). The model showed high overall confidence (ipTM = 0.7). The predicted structure adopts the canonical topology of a voltage-gated ion channel: the N-terminal cytoplasmic region comprises an ankyrin repeat domain (ANK repeats, residues 123–628) formed by 13 α-helices; the core region consists of six transmembrane helices (S1–S6) that form a central ion pore channel, which corresponds precisely to the ion transport domain identified by sequence analysis (residues 735–976); and the C-terminal region forms a coiled-coil interface, suggesting a potential role in intersubunit assembly. Ramachandran plot analysis (Figure A3) indicated that 93.3% of residues occupy the most favored regions, confirming the model’s excellent stereochemical quality and structural reliability.

Figure 4.

Figure 4

Open in a new tab

Overview of the subunit structure of Pyrexia-1. The transmembrane domain is shown in green and consists of six transmembrane helices (designated S1 through S6). The ankyrin repeat domain is shown in yellow and contains 13 repeats (AR1 through AR13). The coiled-coil domain is shown in pink.

2.5. Spatiotemporal Expression Dynamics of Pyrexia-1

We assessed the spatiotemporal expression profile of Pyrexia-1 in C. nipponensis via RT-qPCR. Analysis across developmental stages revealed that Pyrexia-1 expression was highest in 5-day-old adults, followed by third-instar larvae. During larval development, Pyrexia-1 expression increased progressively with each larval instar, peaking in the third instar (7.89 ± 1.11). Expression then declined in the prepupal stage and reached its lowest level during the pupal stage (0.46 ± 0.13). In adults, expression recovered and peaked in 5-day-old females (16.71 ± 2.34), followed by a decline with further aging (Figure 5A). At the tissue level, Pyrexia-1 expression was predominantly localized to the midgut, where its transcript level was significantly higher than in all other tissues examined. In contrast, no significant differences in expression were detected among the head, wings, integument, and fat body (Figure 5B).

Figure 5.

Figure 5

Open in a new tab

Expression analysis of Pyrexia-1 in C. nipponensis. (A) mRNA expression levels across different developmental stages. (B) Tissue-specific expression profile in adults. Data are presented as mean ± SEM (n = 3 biological replicates, with scatter points representing individual data points). Different lowercase letters (a–e) above the bars indicate statistically significant differences (p < 0.05) as determined by one-way ANOVA followed by Turkey’s test for post hoc comparisons.

2.6. Functional Analysis: RNAi-Mediated Silencing of Pyrexia-1

To assess the efficiency and persistence of gene knockdown, we monitored the expression level of Pyrexia-1 via RT-qPCR from 1 to 5 days post-injection (dpi). The results demonstrated a stable and sustained RNAi effect: throughout the 5-day period, the mRNA levels of Pyrexia-1 in both female and male adults were significantly lower than those in the control group, confirming effective and durable knockdown of the target gene (Figure 6). Importantly, no significant difference in survival rate was observed between insects injected with dsPyrexia-1 and those injected with dsGFP (control), indicating that the RNAi procedure itself lacked acute toxicity (Figure A4).

Figure 6.

Figure 6

Open in a new tab

RNA interference efficiency of dsPyrexia-1 over five consecutive days. Expression levels after injection in adult females (A) and males (B) are shown (n = 3 biological replicates). Data are presented as mean ± SEM, with scatter points representing individual data points. Statistical significance between the dsPyrexia-1 and dsGFP (control) groups on each day was assessed using two-tailed unpaired t-tests. * p < 0.05, ** p < 0.01, *** p < 0.001.

2.7. Pyrexia-1 Knockdown Enhances Cold Hardiness

Knockdown of Pyrexia-1 significantly improved key physiological indices of cold tolerance. Compared to the control group, both female and male adults injected with dsPyrexia-1 exhibited significantly lower supercooling points (SCPs, Figure 7A) and freezing points (FPs, Figure 7B). Specifically, the mean SCP decreased from −13.75 °C to −16.23 °C in females and from −13.19 °C to −15.99 °C in males. Similarly, the mean FP decreased from −7.53 °C to −9.90 °C in females and from −7.32 °C to −9.61 °C in males.

Figure 7.

Figure 7

Open in a new tab

Effect of Pyrexia-1 silencing on cold tolerance parameters in adults. The impact on (A) supercooling point (SCP; n = 16), (B) freezing point (FP; n = 16), and (C) survival rate after 24 h exposure to −10 °C (n = 50, 5 replicates) is shown. Data are presented as mean ± SEM, with scatter points representing individual data points. Statistical significance was determined by unpaired t-tests between dsPyrexia-1 and dsGFP (control) treatments within the same sex. * p < 0.05, ** p < 0.01, *** p < 0.001.

Consistent with these physiological changes, Pyrexia-1 knockdown also significantly enhanced survival under low-temperature stress (Figure 7C). Following a 24-h exposure to −10 °C, the mortality rate of dsPyrexia-1-injected females was 48.9%, significantly lower than the 67.6% mortality in the control group. A similar trend was observed in males, with mortality decreasing from 68.7% to 50.0%.

2.8. Pyrexia-1 Knockdown Downregulates TRE1 Expression and Induces Trehalose Accumulation

To investigate the downstream mechanism through which Pyrexia-1 regulates cold hardiness, we analyzed changes in the expression of related pathway genes and their corresponding metabolites. Based on comparative transcriptomic analysis between cold-acclimated and control groups, we identified key candidate genes involved in cold-hardiness pathways for subsequent functional investigation (Figure A5). RT-qPCR analysis revealed that Pyrexia-1 knockdown specifically altered gene expression within the heat shock response and trehalose metabolism pathways (Figure 8A). Compared to the dsGFP-injected control group, dsPyrexia-1-treated adults exhibited a significant upregulation of HSP70 expression, while the expression of the trehalase (TRE1) gene was significantly downregulated. In contrast, transcript levels of HSP90, trehalose-6-phosphate synthase (TPS), and fatty acid synthase (FAS) remained unchanged (Figure 8A).

Figure 8.

Figure 8

Open in a new tab

Pyrexia-1 affects gene expression and trehalose levels to regulate cold tolerance. (A) Relative expression levels of downstream cold-tolerance-related genes following Pyrexia-1 knockdown. (B) Fluorescent in situ hybridization showing co-localization of Pyrexia-1 mRNA (green, FAM-labeled) and TRE1 mRNA (red, Cy3-labeled) in the midgut. Yellow signal indicates co-localization. MG, midgut; FG, foregut; HL, hemolymph. Scale bar, 50 μm. Images were acquired using a 40× objective (NA 0.95) at a resolution of 0.1625 μm/pixel. (C) Trehalose content after Pyrexia-1 silencing. Data in (A,C) are presented as mean ± SEM, with scatter points representing individual data points. Statistical significance was determined by unpaired t-tests: for each gene in (A), and within each sex in (C), comparing the dsPyrexia-1 group with the dsGFP control group. * p < 0.05, ** p < 0.01, ns = not significant.

To further examine the tissue-level association between Pyrexia-1 and TRE1, we performed fluorescence in situ hybridization (FISH). The results revealed distinct co-localization signals for Pyrexia-1 mRNA and TRE1 mRNA in the midgut and hemolymph tissues of C. nipponensis (Figure 8B), providing spatial correlational clues for their potential functional association in the same cell type. Consistent with the observed downregulation of TRE1 expression, measurement of trehalose content showed a significantly higher trehalose level in dsPyrexia-1-treated adults compared to the control group (Figure 8C).

3. Discussion

This study provides functional evidence that knockdown of the TRPA channel gene Pyrexia-1 significantly enhances cold hardiness in C. nipponensis, as demonstrated by reduced SCP, FP and improved low-temperature survival. These results indicate that Pyrexia-1 likely maintains a signaling state that suppresses cold adaptation under normal conditions, identifying it as a key negative regulator of cold tolerance in this species. Further mechanistic investigation revealed that Pyrexia-1 inhibition specifically downregulates TRE1 expression, leading to significant trehalose accumulation in adults, along with upregulation of HSP70. To our knowledge, this is the first study linking an insect Pyrexia subfamily member to systemic cold adaptation in a natural enemy, uncovering a novel regulatory mechanism: enhanced cold hardiness via inhibition of TRE1-mediated trehalose hydrolysis and promotion of protective metabolite accumulation.

Both transcriptomic and RT-qPCR analyses consistently showed that cold acclimation triggers a pronounced downregulation of Pyrexia-1 expression in adults (to approximately 33% in females and ~29% in males relative to control levels), while Pyrexia-2 remains unchanged (Figure 1 and Figure A1). This specific response suggests that Pyrexia-1 acts as a key signaling node in the low-temperature response pathway. Loss-of-function experiments further confirmed its negative regulatory role: RNAi-mediated knockdown of Pyrexia-1 lowered both SCP, FP and significantly improved survival at −10 °C (Figure 7). This finding contrasts sharply with the classical model of D. melanogaster pyrexia (pyx), where loss-of-function mutants exhibit drastically reduced tolerance to high temperatures (40 °C), manifesting as rapid heat paralysis [18]. In C. nipponensis, however, inhibition of Pyrexia-1 confers a clear advantage for low-temperature adaptation. This functional divergence is not isolated. Recent studies highlight significant species- and context-dependent thermosensory functions of TRP channels. For instance, a hymenopteran-specific TRPA channel in the Texas leafcutter ant (A. texana) is activated by both heat and cold, exhibiting dual thermosensitivity [25]. Together with the recent observation that pyx regulates low-temperature oviposition behavior in L. huidobrensis [28], this evidence strongly suggests that Pyrexia homologs in non-model insects have evolved diversified temperature-adaptive functions beyond mere heat perception.

This functional divergence may be underpinned by two factors. First, differences in ecological niche and life history between species likely shape the specific roles of Pyrexia channels. C. nipponensis overwinters as adults, and its winter survival rate directly determines the population base of the following year [8]. Therefore, natural selection may favor utilizing Pyrexia-1 as a “molecular switch” to drive systemic metabolic reprogramming (e.g., trehalose accumulation)—a survival strategy for coping with prolonged low-temperature stress. In contrast, L. huidobrensis, as a pest species, may have its thermal adaptation more closely linked to reproductive success (oviposition behavior)—a strategy for responding to short-term temperature fluctuations [28].

Second, gene duplication events provide the genetic basis for functional specialization. Sequence and structural analyses confirm that the Pyrexia-1-encoded protein possesses the canonical TRP channel topology (Figure 2), providing a structural basis for its function as a thermosensor [22,29,30]. Notably, two paralogous genes in C. nipponensis were identified, Pyrexia-1 and Pyrexia-2, which reside in distinct phylogenetic clades (Figure 3). This clear evolutionary separation supports the “gene duplication-functional divergence” hypothesis [31,32], suggesting that Pyrexia-1 may have evolved a specialized role in regulating metabolic cold hardiness, while Pyrexia-2 (clustering with D. melanogaster pyx) may retain more ancestral functions related to heat response or behavior. This aligns with the overall pattern of expansion and diversification within the insect TRPA subfamily [23].

Analysis of downstream gene expression revealed a high degree of specificity in Pyrexia-1 action. Its knockdown selectively inhibited TRE1 and induced HSP70, without affecting the synthase gene TPS or HSP90 (Figure 8A). This targeted regulation differs markedly from the global stress response mediated by the heat shock transcription factor (HSF) [32]. HSP70, a molecular chaperone, participates in cellular stress resistance, including membrane stabilization [33]. Its upregulation under extreme temperature stress, particularly cold and heat, is well documented [34,35] and consistent with our observation of cold acclimation-induced HSP70 upregulation (Figure 8). Trehalose, a major insect cryoprotectant [17,36], effectively lowers haemolymph freezing point and stabilizes cellular structures upon accumulation [36]. This provides a direct physiological explanation for the reduced SCP, FP, and enhanced survival following Pyrexia-1 knockdown, aligning with observations in the ladybird beetle Harmonia axyridis, where TRE1 activity is suppressed under low temperatures [37].

Notably, Pyrexia-1 is highly expressed in the midgut and fat body (Figure 5A), organs central to trehalose metabolism and energy storage [38,39,40]. It should be noted that while Pyrexia-1 and TRE1 transcripts co-localize in midgut cells (Figure 8B), co-localization does not demonstrate direct molecular interaction. Future studies employing co-immunoprecipitation or proximity ligation assays are needed to determine whether these proteins physically interact or merely co-exist in the same cellular compartment.

Under normal temperatures, active Pyrexia-1 channels maintain signaling homeostasis—potentially through Ca2+ or cation influx [18,41]—to sustain basal TRE1 transcription of C. nipponensis. Upon cold exposure, downregulation of Pyrexia-1 may interrupt this signal, leading to suppressed TRE1 expression and subsequent trehalose accumulation. The concurrent upregulation of HSP70 may represent either a parallel event or a response to combined cold stress and trehalose accumulation; however, the precise regulatory relationship warrants further investigation. This model provides a mechanistic link between rapid thermosensing and long-term adaptive metabolic reprogramming. Future studies should focus on elucidating intracellular calcium signaling and identifying transcriptional regulators downstream of Pyrexia-1, and employing genome-wide transcriptomic analyses (e.g., RNA-seq) to comprehensively dissect its downstream gene regulatory networks.

4. Materials and Methods

4.1. Insect Rearing and Experimental Colony

Adult C. nipponensis were originally collected from the campus of Shandong Agricultural University. A laboratory colony was established and maintained for multiple generations in a climate-controlled chamber (25 ± 1 °C, 70 ± 5% relative humidity, 15:9 h L:D photoperiod; light intensity 8000 lux) in the Insect Physiology and Ecology Laboratory at the same institution.

To obtain experimental insects, freshly laid eggs were collected and placed in 90 mm × 15 mm disposable Petri dishes containing an ample supply of Corcyra cephalonica eggs as larval food. The first-instar larvae were transferred individually into glass tubes (1 cm in diameter and 7 cm in height) upon hatching. Larvae were reared until pupation on a daily diet of the pea aphid (Megoura japonica), which were themselves reared on broad bean plants (Vicia faba). Upon eclosion, adult males and females were paired and housed in glass jars (8 cm diameter × 10 cm height) covered with cheesecloth. Adults were provided ad libitum with a dry diet consisting of brewer’s yeast powder (a finely ground 10:8 w/w mixture of brewer’s yeast powder and sucrose, passed through a 60-mesh sieve) and a 10% (w/v) honey-water solution.

4.2. Cloning and Sequencing of the Pyrexia-1 Gene

The coding sequence (CDS) of the Pyrexia-1 gene was identified from unpublished transcriptomic data of C. nipponensis adults generated in our laboratory. Sample Preparation and Sequencing: Newly emerged one-day-old adults reared under a short-day photoperiod were subjected to either cold hardening (4 °C, 4 days) or control (25 °C) treatment. Whole-body samples were collected (three biological replicates per group: CK-F, CH-F, CK-M, CH-M). Bioinformatics Analysis: Clean reads were aligned to the reference genome using HISAT2. Transcript assembly and FPKM-based quantification were then performed with StringTie. Differentially expressed genes (DEGs) were identified using the DESeq2 package, with a significance threshold of |log2FC| ≥ 1 (equivalent to FC ≥ 2 or ≤0.5) and a false discovery rate (FDR) q-value < 0.05. Total RNA was extracted from adult lacewings using the FreeZol Reagent kit (Vazyme, Nanjing, China). RNA integrity was verified by 1% agarose gel electrophoresis, and concentration/purity were measured with a NanoDrop One spectrophotometer (Thermo Scientific, Waltham, MA, USA). First-strand cDNA was synthesized from 1 µg of total RNA using the HiScript® II 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme, China). Gene-specific primers for Pyrexia-1 (Table 1) were designed using Primer Premier 5.0. PCR amplification was performed using the 2× Phanta® Max Master Mix (Vazyme, China) in a 50 µL reaction system containing 25 µL of master mix, 2 µL each of forward and reverse primers (10 µM), 3 µL of cDNA template, and 18 µL of ddH2O. The PCR protocol included an initial denaturation at 95 °C for 3 min; 35 cycles of 95 °C for 15 s, 55 °C for 20 s, and 72 °C for 60 s; and a final extension at 72 °C for 5 min. PCR products were separated on a 1% agarose gel, and bands of expected size were excised and purified with the FastPure® Gel DNA Extraction Mini Kit (Vazyme, China). Purified fragments were ligated into the pMD™18-T Vector (Takara, Kusatsu, Japan) and transformed into competent cells. Positive clones were screened and sequenced by BGI Genomics (Shenzhen, China). The resulting sequences were assembled, aligned, and manually verified using DNAMAN 10.0.x software to obtain the complete Pyrexia-1 CDS.

Table 1.

Primers used in this study.

Gene Name Primer Sequence (5′–3′) Remarks
Pyrexia-1 F: AGCCAGCCAACAAGCAAATG RT-qPCR
R: AGCTTCTCCGACAACGTTCA
Pyrexia-2 F: TAGCAGCCGCGTTAGGTTC
R: ACCATCCTCGGCTGCAAAAT
TRE1 F: GATACGGCCCGTGGTGTTAT
R: CTAACAACGGTGGTTGCGAT
TPS F: TAACCGATGAAGACGCTAT
R: AACTGCATCTGTTGAGGG
HSP70 F: ACTGTCCGCATGTTCAAACT
R: CGCATTCTACCGACCCTTCT
HSP90 F: CTTGTAAATACCACTAAACACGCT
R: TGCACGGTTGCATATTACGA
FAS F: GGAGCATTGCAAGTCGAACA
R: ATTTGGATTGTCACCCCTGT
Tub1 F: CGGAAACCAGATTGGAGCTAAG
R: CCAAATGGACCAGAACGTACTG
Pyrexia-1 F1: GGCATTCAAGACCTACGC Clone
R1: ACTTGGCATTAACATTGAGTG
F2: GCTTTCGAAATGGTGCTG
R2: ACGGATCATAAAACCAGAC
Pyrexia-1 dsF: ACAGCGTTGCATTTAGCCTG RNAi
dsR: TGGGCTTACCACTTGGCATT
ds-T7F: TAATACGACTCACTATAGGACAGCGTTGCATTTAGCCTG
ds-T7R: TAATACGACTCACTATAGGTGGGCTTACCACTTGGCATT
GFP dsF: GCGACGTAAACGGCCACAAGT
dsR: GTACAGCTCGTCCATGCCGAG
ds-T7F: GGATCCTAATACGACTCACTATAGGGCGACGTAAACGGCCACAAGT
ds-T7R: GGATCCTAATACGACTCACTATAGGGTACAGCTCGTCCATGCCGAG
Open in a new tab

4.3. Bioinformatics Analysis of the Pyrexia-1 Gene and Its Encoded Protein

The cloned Pyrexia-1 sequence was analyzed using NCBI’s ORF Finder (https://www.ncbi.nlm.nih.gov/orffinder/, accessed on 15 August 2025) to identify its open reading frame (ORF) and corresponding amino acid sequence. The physicochemical properties of the deduced protein—including molecular weight, theoretical isoelectric point (pI), instability index, and grand average of hydropathicity (GRAVY)—were predicted with the ProtParam tool on ExPASy [42]. Signal peptide and transmembrane helix predictions were performed using SignalP-6.0 [43] and TMHMM-2.0 [44], respectively. Structural domains were annotated via the SMART database [45]. The tertiary structure of Pyrexia-1 was predicted using AlphaFold 3 [46] and visualized in PyMOL v1.3r1 [47] for structural analysis. To infer evolutionary relationships, the Pyrexia-1 amino acid sequence was aligned with orthologs from other insect species in MEGA 7.0 using the CLUSTAL W algorithm [48]. A phylogenetic tree was constructed via the neighbor-joining method with 1000 bootstrap replicates to assess branch support.

4.4. Gene Expression Pattern Analysis

Samples from different developmental stages and tissues of C. nipponensis were collected for RNA extraction. Developmental stages included eggs (300 eggs per replicate), 1st-, 2nd-, and 3rd-instar larvae (24, 21, and 12 individuals, respectively), prepupae [12], pupae [12], and adults at 5, 20, and 40 days post-emergence (6 males and 6 females each). Tissue samples (head, wings, cuticle, fat body, and midgut) were dissected from 30 pooled 5-day-old adults per tissue, with three biological replicates per sample type. Total RNA extraction was performed as described in Section 4.2. First-strand cDNA was synthesized from 1 µg of total RNA using the HiScript® II Q RT SuperMix for qPCR (+gDNA wiper) kit (Vazyme, China). Gene-specific qPCR primers for Pyrexia-1 (Table 1) were designed using Primer Premier 5.0. Quantitative real-time PCR (qPCR) was performed using ChamQ SYBR qPCR Master Mix (Vazyme, China) on a Roche LightCycler® 96 instrument. Each 20 µL reaction contained 10 µL of 2× ChamQ SYBR qPCR Master Mix, 1 µL each of forward and reverse primers (10 µM), 1 µL of diluted cDNA (1:10), and 7 µL of ddH2O. The cycling conditions consisted of initial denaturation at 95 °C for 30 s, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s. Melting curve analysis (60–95 °C) was included to verify amplification specificity. The tubulin beta-1 chain gene (Tub1) [49] served as the internal reference for normalization. Relative expression of Pyrexia-1 was calculated using the 2−ΔΔCt method, with three biological replicates per group.

4.5. RNA Interference (RNAi) Experiment

Gene-specific primers (dsPyrexia-1-F, dsPyrexia-1-R) and corresponding T7 promoter-tagged primers (dsPyrexia-1-T7F, dsPyrexia-1-T7R) targeting Pyrexia were designed using Primer Premier 5.0. Similarly, primers were designed for the control gene GFP (Table 1). Double-stranded RNA (dsRNA) for Pyrexia-1 (dsPyrexia-1) and GFP (dsGFP) was synthesized in vitro using the T7 RiboMAX™ Express RNAi System (Promega), with verified plasmid DNA as a template. The quality, concentration, and integrity of dsRNA were assessed as described in Section 4.2.

Healthy, uniformly sized newly emerged adults of both sexes were selected for microinjection. dsRNA was delivered into the membranous area of the mesothoracic sternum using a Nanoject III Programmable Nanoliter Injector (Drummond, Birmingham, AL, USA) fitted with a glass capillary needle. Each insect received 200 nL of dsPyrexia-1 solution (5000 ng/μL) or an equivalent volume of dsGFP as a negative control [50]. Injected adults were then maintained under standard rearing conditions until 5 days post-injection.

Knockdown efficiency was verified by RT-qPCR (as in Section 4.4) on samples collected consecutively for 5 days after injection. Each treatment included three biological replicates, each with three technical replicates. Subsequently, SCP, FP, and mortality after 24-h exposure to −10 °C were measured in 5-day-old male and female adults, as detailed in Section 4.6.

4.6. Measurement of Cold-Tolerance Phenotypes

SCP and FP Determination: The SCP and FP were measured via thermocouple. A fine-wire thermocouple probe from an insect supercooling point meter (SUN-V, Pengcheng Electronics, Beijing, China) was attached to the adult abdomen with glycerol to ensure thermal contact. The insect was then immobilized with cotton in a 1.5 mL microcentrifuge tube. The tube was placed in a programmable low-temperature bath (Hengping, Shanghai, China), and the temperature was decreased at a rate of 2–3 °C/min. Temperature data were recorded in real time, and the SCP (lowest temperature before latent heat release) and FP were automatically identified using custom software (Codeinsect). At least 16 individuals were tested per treatment.

Low-Temperature Mortality Assay: dsRNA-injected adults in their rearing jars were exposed to −10 °C in a low-temperature incubator for 24 h, followed by a 24-h recovery period at 25 °C. Mortality was then assessed; insects unresponsive to gentle mechanical stimulation were considered dead. Each treatment consisted of five biological replicates, with ten insects per replicate.

4.7. Analysis of Cold-Hardiness-Related Gene Expression Following Pyrexia-1 Knockdown

To explore downstream effectors regulated by Pyrexia-1, 5-day-old adults (equal numbers of males and females) injected with dsPyrexia-1 or dsGFP (control) were sampled. Total RNA was extracted and cDNA synthesized as in Section 4.2. The expression levels of genes involved in cold stress and energy metabolism were analyzed by RT-qPCR, including (i) heat shock protein genes (HSP70, HSP90), (ii) trehalose metabolism genes (TPS, TRE1), and (iii) fatty acid synthase (FAS). Primers are listed in Table 1. The Tub1 gene served as an internal reference for normalization. Relative expression was calculated using the 2−ΔΔCt method, with three biological replicates per treatment.

4.8. Determination of Trehalose Content

Trehalose content was quantified using a commercial Trehalose Assay Kit (Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s protocol. Five-day-old adults injected with dsPyrexia-1 or dsGFP (control) were weighed, and whole-body homogenates were prepared on ice at a ratio of 1 g tissue per 10 mL extraction buffer. After homogenization, samples were incubated at room temperature for 45 min with intermittent vortexing, followed by centrifugation at 8000× g (25 °C, 10 min). The supernatant was collected for analysis. The assay was conducted in a 96-well plate. Absorbance was measured at 620 nm using a Synergy MX Multi-Mode Microplate Reader (BioTek, Winooski, VT, USA). Trehalose content was calculated as follows: Trehalose Content (mg/g tissue) = [(A_sample − A_blank)/(A_standard − A_blank)] × C_standard (0.04 mg/mL) × V_extraction (1 mL)/Tissue Weight (g) × Dilution Factor. Each replicate consisted of five pooled insects, with five independent biological replicates per treatment.

4.9. Fluorescence In Situ Hybridization (FISH)

Fluorescence in situ hybridization was performed to localize Pyrexia-1 and TRE mRNA transcripts in adult C. nipponensis tissues using custom-synthesized antisense RNA probes (Shanghai Gefan Biotechnology Co., Ltd., Shanghai, China). The probe sequences were as follows: Pyrexia-1 probe: 5′-FAM-CATTGAGTGGTCGACTTGTATCAAACAATTAGGATCGTTTACACT-3′, TRE probe: 5′-Cy3-CTTCCATCAGTGTCAGCAAACCAACGACTACTGAAATCCCAACCAGATTCTGCACCAC-3′. The experiment utilized adult tissue samples of C. nipponensis, with a negative control included wherein hybridization was carried out using hybridization buffer without probes to confirm signal specificity. Adults were fixed in 4% paraformaldehyde for 2 h and embedded in paraffin for sectioning. Tissue slides were deparaffinized in xylene (8 min) and rehydrated through an ethanol gradient. Subsequently, slides were digested with 20 μg/mL proteinase K at 37 °C for 15 min in a DHG-9070A electric thermostatic drying oven (Shanghai Pudong Rongfeng Scientific Instrument Co., Ltd., Shanghai, China). Digestion was terminated with 0.1 M glycine, followed by three washes in 0.1 M PBS (pH 7.5). Slides were then refixed with 4% paraformaldehyde for 10 min, washed three times in PBS, twice in acetic anhydride solution (pH 8.0), and twice in 5× saline sodium citrate (SSC, pH 7.5). Hybridization was performed in a humidified chamber at 65 °C for 48 h using Pyrexia-1 or TRE probes (0.1 µM each). After hybridization, slides were washed once in 2× SSC (pH 7.5), three times in a 1:1 mixture of SSC and ammonium formate, and five times in PBS, followed by counterstaining with 4′,6-diamidino-2-phenylindole (DAPI, GenePharma, Shanghai, China) at room temperature for 5 min. Finally, fluorescence imaging was performed using a Pannoramic MIDI II slide scanner (3D HISTECH) equipped with a Plan-Apochromat 40× objective (NA 0.95) and a pco.edge 4.2 sCMOS camera, resulting in an image acquisition resolution of 0.1625 μm/pixel.

4.10. Statistical Analysis

Data are presented as mean ± standard error of the mean (SEM). Differences in Pyrexia-1 expression levels across developmental stages or among tissues were evaluated using one-way analysis of variance (ANOVA) followed by Turkey’s test for multiple comparisons. Comparisons between two groups were performed using two-tailed Student’s t-tests. Statistical significance was defined as p < 0.05 and denoted as follows: * p < 0.05, ** p < 0.01, *** p < 0.001; ns indicates not significant.

5. Conclusions

In conclusion, this study reveals the critical negative regulatory role of Pyrexia-1 in the cold hardiness of C. nipponensis and its downstream mechanism involving TRE1 inhibition and trehalose accumulation. Theoretically, this work expands the functional understanding of TRP channels in non-model insects by directly linking a temperature-sensing TRP channel to an anti-freeze metabolic pathway. Practically, this offers a novel target for genetic or biotechnological strategies aimed at enhancing the cold tolerance and overwintering capacity of natural enemy insects, with significant potential implications for improving the resilience and efficacy of biological control programs in the face of climate variability.

Appendix A

Figure A1.

Figure A1

Open in a new tab

Transcriptome analysis of Pyrexia isoforms under cold acclimation. Expression levels of Pyrexia-1 (A) and Pyrexia-2 (B) in female and male adults under control (CK) and cold-hardening (CH) conditions are shown. Data are mean ± SEM, with scatter points representing individual data points. Statistics: Unpaired t-tests were conducted between different treatments (CK vs. CH) within the same sex. * p < 0.05, ** p < 0.01, ns, not significant.

Figure A2.

Figure A2

Open in a new tab

Prediction of signal peptide (A) and transmembrane structure (B) of Pyrexia-1 in C. nipponensis.

Figure A3.

Figure A3

Open in a new tab

Ramachandran plot of the Pyrexia-1 model. Red region: most favored allowed region; Yellow region: additionally allowed region; White region: disallowed region.

Figure A4.

Figure A4

Open in a new tab

Survival analysis of C. nipponensis after the injection of dsPyrexia-1 compared with those of dsGFP injection. The groups of dsPyrexia-1 and dsGFP contain about 30 individuals separately. Statistical analysis: Comparison of survival rates between groups was performed using the log-rank test (Mantel–Cox test). ns, not significant.

Figure A5.

Figure A5

Open in a new tab

Heatmap of differentially expressed genes between cold-hardening and control groups. Upregulation and downregulation of gene expression levels are indicated by red and blue, respectively. Gene symbols are listed on the right. CH stands for cold-hardening group, CK for control group; F for female, M for male.

Author Contributions

Y.G.: Conceptualization, Methodology, Software, Validation, Writing, Visualization; Z.Q.: Visualization; Z.H.A.: Review and Editing; D.L.: Review and Editing; Z.K.: Conceptualization, Resources, Review and Editing, Supervision; Z.C.: Review and Editing, Supervision, Project Administration, Funding Acquisition; Y.X.: Conceptualization, Resources, Supervision. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

Ethical review and approval were waived for this study, due to the use of only invertebrate species (Chrysoperla nipponensis), for which Institutional Review Board or ethics committee approval is not required.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interest.

Funding Statement

This work was supported by the National Key Research and Development Program of China (2023YFD1700405) and the National Natural Science Foundation of China (315015904).

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Régnière J., Powell J., Bentz B., Nealis V. Effects of temperature on development, survival and reproduction of insects: Experimental design, data analysis and modeling. J. Insect Physiol. 2012;58:634–647. doi: 10.1016/j.jinsphys.2012.01.010. [DOI] [PubMed] [Google Scholar]
  • 2.Sinclair B.J., Coello Alvarado L.E., Ferguson L.V. An invitation to measure insect cold tolerance: Methods, approaches, and workflow. J. Therm. Biol. 2015;53:180–197. doi: 10.1016/j.jtherbio.2015.11.003. [DOI] [PubMed] [Google Scholar]
  • 3.Jaworski T., Hilszczanski J. The effect of temperature and humidity changes on insects development their impact on forest ecosystems in the expected climate change. For. Res. Pap. 2014;74:345–355. doi: 10.2478/frp-2013-0033. [DOI] [Google Scholar]
  • 4.Teets N.M., Denlinger D.L. Physiological mechanisms of seasonal and rapid cold-hardening in insects. Physiol. Entomol. 2013;38:105–116. doi: 10.1111/phen.12019. [DOI] [Google Scholar]
  • 5.Feng Y., Zhang L., Li W., Yang X., Zong S. Cold hardiness of overwintering larvae of Sphenoptera sp. (Coleoptera: Buprestidae) in Western China. J. Econ. Entomol. 2018;111:247–251. doi: 10.1093/jee/tox304. [DOI] [PubMed] [Google Scholar]
  • 6.Memon S.A., Omar D., Muhamad R., Sajap A.S., Asib N., Gilal A.A. Comparison of growth parameters of the predator, Chrysoperla nipponensis-B (Neuroptera: Chrysopidae) reared on a diet of eggs of Corcyra cephalonica (Lepidoptera: Pyralidae) and an artificial diet containing ginger. Eur. J. Entomol. 2016;113:387–392. doi: 10.14411/eje.2016.049. [DOI] [Google Scholar]
  • 7.Liu S.Y., Gao Y.Q., Shi R.J., Huang H.Y., Xu Y.Y., Chen Z.Z. Transcriptomics Provide Insights into the Photoperiodic Regulation of Reproductive Diapause in the Green Lacewing, Chrysoperla nipponensis (Okamoto) (Neuroptera: Chrysopidae) Insects. 2024;15:136. doi: 10.3390/insects15020136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Xu Y.Y., Mou J.Y., Hu C. Research and application of Chrysoperla nipponensis. Insect Knowl. 1999;36:313–315. [Google Scholar]
  • 9.Costanzo J.P., Lee R.E., Jr. Avoidance and tolerance of freezing in ectothermic vertebrates. J. Exp. Biol. 2013;216:1961–1967. doi: 10.1242/jeb.070268. [DOI] [PubMed] [Google Scholar]
  • 10.Toxopeus J., Sinclair B.J. Mechanisms underlying insect freeze tolerance. Biol. Rev. 2018;93:1891–1914. doi: 10.1111/brv.12425. [DOI] [PubMed] [Google Scholar]
  • 11.Vrba P., Nedvěd O., Zahradníčková H., Konvička M. More complex than expected: Cold hardiness and the concentration of cryoprotectants in overwintering larvae of five Erebia butterflies (Lepidoptera: Nymphalidae) Eur. J. Entomol. 2017;114:470–480. doi: 10.14411/eje.2017.060. [DOI] [Google Scholar]
  • 12.Mohammadzadeh M., Izadi H. Cold Acclimation of Trogoderma granarium Everts Is Tightly Linked to Regulation of Enzyme Activity, Energy Content, and Ion Concentration. Front. Physiol. 2018;9:1427. doi: 10.3389/fphys.2018.01427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Pampurova S., Verschooten K., Avonce N., Van Dijck P. Functional screening of a cDNA library from the desiccation-tolerant plant Selaginella lepidophylla in yeast mutants identifies trehalose biosynthesis genes of plant and microbial origin. J. Plant Res. 2014;127:803–813. doi: 10.1007/s10265-014-0663-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Khanmohamadi F., Khajehali J., Izadi H. Diapause and Cold Hardiness of the Almond Wasp, Eurytoma amygdali (Hymenoptera: Eurytomidae), Two Independent Phenomena. J. Econ. Entomol. 2016;109:1646–1650. doi: 10.1093/jee/tow150. [DOI] [PubMed] [Google Scholar]
  • 15.Mollaei M., Izadi H., Šimek P., Koštál V. Overwintering biology and limits of cold tolerance in larvae of pistachio twig borer, Kermania pistaciella. Bull. Entomol. Res. 2016;106:538–545. doi: 10.1017/S0007485316000237. [DOI] [PubMed] [Google Scholar]
  • 16.Liu X., He A., Lu D., Hu D., Tan M., Abere A., Goodarzi P., Ahmad B., Kleiboeker B., Finck B.N., et al. Peroxisomal metabolism of branched fatty acids regulates energy homeostasis. Nature. 2025;646:1223–1231. doi: 10.1038/s41586-025-09517-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Minke B., Wu C., Pak W.L. Induction of photoreceptor voltage noise in the dark in Drosophila mutant. Nature. 1975;258:84–87. doi: 10.1038/258084a0. [DOI] [PubMed] [Google Scholar]
  • 18.Lee Y., Lee Y., Lee J., Bang S., Hyun S., Kang J., Hong S.T., Bae E., Kaang B.K., Kim J. Pyrexia is a new thermal transient receptor potential channel endowing tolerance to high temperatures in Drosophila melanogaster. Nat. Genet. 2005;37:305–310. doi: 10.1038/ng1513. [DOI] [PubMed] [Google Scholar]
  • 19.Wang Y.D., Xu Y., Zhu C.M., Liu K., Zhao G., Hua H., Wang M., Li X. Transient receptor potential channels TRPA1 and TRPV1 are involved in chronic pain relief via Pulsed Radiofrequency in Rheumatoid Arthritis rat. Neuropharmacology. 2025;278:110548. doi: 10.1016/j.neuropharm.2025.110548. [DOI] [PubMed] [Google Scholar]
  • 20.Feng A., Yang Y., Rong R. Thermosensitive transient receptor potential channel proteins: Emerging targets for acute lung injury: A review. Int. J. Biol. Macromol. 2025;327:147506. doi: 10.1016/j.ijbiomac.2025.147506. [DOI] [PubMed] [Google Scholar]
  • 21.Bertolesi G.E., Heshami N., McFarlane S. Evolutionary adaptations of TRPA1 thermosensitivity and skin thermoregulation in vertebrates. iScience. 2025;28:113369. doi: 10.1016/j.isci.2025.113369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Paschapur A.U., Manoj M.S., Pavan J.S., Subramanian S. Exploiting TRP channel diversity in insects: A pathway to next-generation pest management. Arch. Toxicol. 2025;99:2277–2297. doi: 10.1007/s00204-025-04012-4. [DOI] [PubMed] [Google Scholar]
  • 23.Matsuura H., Sokabe T., Kohno K., Tominaga M., Kadowaki T. Evolutionary conservation and changes in insect TRP channels. BMC Evol. Biol. 2009;9:228. doi: 10.1186/1471-2148-9-228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Andreatta G., Montagnese S., Costa R. Cold-Sensing TRP Channels and Temperature Preference Modulate Ovarian Development in the Model Organism Drosophila melanogaster. Int. J. Mol. Sci. 2025;26:5638. doi: 10.3390/ijms26125638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.York J.M., Taylor T.N., LaPotin S., Lu Y., Mueller U. Hymenopteran-specific TRPA channel from the Texas leaf cutter ant (Atta texana) is heat and cold activated and expression correlates with environmental temperature. Insect Sci. 2025;32:301–320. doi: 10.1111/1744-7917.13364. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.He H., Zhao R., Hu K., Qiu L., Ding W., Li Y. A novel negative thermotaxis behavior in rice planthoppers is regulated by TRPA1 channel. Pest Manag. Sci. 2020;76:3003–3011. doi: 10.1002/ps.5846. [DOI] [PubMed] [Google Scholar]
  • 27.Deng W., Wang Y., Niu Q., Xu Q., Wang X., Zheng Y., Wang D., Wei L. Genome-Wide Identification of the Transient Receptor Potential Channel Family in Nile Tilapia and Expression Analysis in Response to Cold Stress. Animals. 2025;15:3645. doi: 10.3390/ani15243645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Wu Y., Wang H., Hu Z., Pan M., Wu Y., Guo X., Ge J., Wang Z., Yang M. The pyrexia channel remodels egg-laying of Liriomyza huidobrensis in response to temperature change. Pest Manag. Sci. 2024;80:4306–4313. doi: 10.1002/ps.8135. [DOI] [PubMed] [Google Scholar]
  • 29.Tian Y., Zheng J. The TRP channels serving as chemical-to-electrical signal converter. Physiol. Rev. 2025;105:1033–1074. doi: 10.1152/physrev.00012.2024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Paschapur A.U., Marella S.M., Rajarushi C.N., Pavan J.S., Subramanian S. Genomic landscape of TRP channels in Bemisia tabaci: Identification and molecular characterization. 3 Biotech. 2026;16:13. doi: 10.1007/s13205-025-04638-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Wang H., Dong Y., Wan B., Ji Y., Xu Q. Identification and Characterization Analysis of Transient Receptor Potential Mucolipin Protein of Laodelphax striatellus Fallén. Insects. 2021;12:1107. doi: 10.3390/insects12121107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Barna J., Csermely P., Vellai T. Roles of heat shock factor 1 beyond the heat shock response. Cell. Mol. Life Sci. 2018;75:2897–2916. doi: 10.1007/s00018-018-2836-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Backe S.J., Heritz J.A., Mollapour M. Hsp70 and Hsp90 post-translational modifications and translating the chaperone code. Cell Stress Chaperones. 2025;30:100118. doi: 10.1016/j.cstres.2025.100118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ma Q., Dong J.H., Li F.X., Zhu K.Y., Cheng W.N. Molecular characteristics and functional study of heat shock protein gene SmHsp60 in Sitodiplosis mosellana (Diptera: Cecidomyidae) Acta Entomol. Sin. 2023;66:859–869. [Google Scholar]
  • 35.Tan Y., Zhang Y., Huo Z.J., Zhou X.R., Shan Y.M., Pang B.P. Molecular cloning and expression profiling of the heat shock protein gene GdHsp70 in Galeruca daurica (Coleoptera: Chrysomelidae) Acta Entomol. Sin. 2017;60:865–875. [Google Scholar]
  • 36.Tellis M.B., Chaudhari B.Y., Deshpande S.V., Nikam S.V., Barvkar V.T., Kotkar H.M., Joshi R.S. Trehalose transporter-like gene diversity and dynamics enhances stress response and recovery in Helicoverpa armigera. Gene. 2023;862:147259. doi: 10.1016/j.gene.2023.147259. [DOI] [PubMed] [Google Scholar]
  • 37.Shi Z., Liu X., Xu Q., Qin Z., Wang S., Zhang F., Wang S., Tang B. Two novel soluble trehalase genes cloned from Harmonia axyridis and regulation of the enzyme in a rapid changing temperature. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2016;198:10–18. doi: 10.1016/j.cbpb.2016.03.002. [DOI] [PubMed] [Google Scholar]
  • 38.Dupuis B., Pocquet N., Failloux A.B. Understanding the role of trehalose in interactions between Wolbachia and Aedes aegypti. Front. Cell. Infect. Microbiol. 2025;15:1547873. doi: 10.3389/fcimb.2025.1547873. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Kanamori Y., Saito A., Hagiwara-Komoda Y., Tanaka D., Mitsumasu K., Kikuta S., Watanabe M., Cornette R., Kikawada T., Okuda T. The trehalose transporter 1 gene sequence is conserved in insects and encodes proteins with different kinetic properties involved in trehalose import into peripheral tissues. Insect Biochem. Mol. Biol. 2010;40:30–37. doi: 10.1016/j.ibmb.2009.12.006. [DOI] [PubMed] [Google Scholar]
  • 40.Kazek M., Chodáková L., Lehr K., Strych L., Nedbalová P., McMullen E., Bajgar A., Opekar S., Šimek P., Moos M., et al. Glucose and trehalose metabolism through the cyclic pentose phosphate pathway shapes pathogen resistance and host protection in Drosophila. PLoS Biol. 2024;22:e3002299. doi: 10.1371/journal.pbio.3002299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Kamikouchi A., Inagaki H.K., Effertz T., Hendrich O., Fiala A., Göpfert M.C., Ito K. The neural basis of Drosophila gravity-sensing and hearing. Nature. 2009;458:165–171. doi: 10.1038/nature07810. [DOI] [PubMed] [Google Scholar]
  • 42.Wilkins M.R., Gasteiger E., Bairoch A., Sanchez J.C., Williams K.L., Appel R.D., Hochstrasser D.F. Protein identification and analysis tools in the ExPASy server. Methods Mol. Biol. 1999;112:531–552. doi: 10.1385/1-59259-584-7:531. [DOI] [PubMed] [Google Scholar]
  • 43.Teufel F., Almagro Armenteros J.J., Johansen A.R., Gíslason M.H., Pihl S.I., Tsirigos K.D., Winther O., Brunak S., von Heijne G., Nielsen H. SignalP 6.0 predicts all five types of signal peptides using protein language models. Nat. Biotechnol. 2022;40:1023–1025. doi: 10.1038/s41587-021-01156-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Krogh A., Larsson B., von Heijne G., Sonnhammer E.L. Predicting transmembrane protein topology with a hidden Markov model: Application to complete genomes. J. Mol. Biol. 2001;305:567–580. doi: 10.1006/jmbi.2000.4315. [DOI] [PubMed] [Google Scholar]
  • 45.Letunic I., Khedkar S., Bork P. SMART: Recent updates, new developments and status in 2020. Nucleic Acids Res. 2021;49:D458–D460. doi: 10.1093/nar/gkaa937. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Jumper J., Evans R., Pritzel A., Green T., Figurnov M., Ronneberger O., Tunyasuvunakool K., Bates R., Žídek A., Potapenko A., et al. Highly accurate protein structure prediction with AlphaFold. Nature. 2021;596:583–589. doi: 10.1038/s41586-021-03819-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Varadi M., Anyango S., Deshpande M., Nair S., Natassia C., Yordanova G., Yuan D., Stroe O., Wood G., Laydon A., et al. AlphaFold Protein Structure Database: Massively expanding the structural coverage of protein-sequence space with high-accuracy models. Nucleic Acids Res. 2022;50:D439–D444. doi: 10.1093/nar/gkab1061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Kumar S., Stecher G., Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016;33:1870–1874. doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Wang X., Kong X., Liu S., Huang H., Chen Z., Xu Y. Selection of Reference Genes for Quantitative Real-Time PCR in Chrysoperla nipponensis (Neuroptera: Chrysopidae) Under Tissues in Reproduction and Diapause. J. Insect Sci. 2020;20:20. doi: 10.1093/jisesa/ieaa079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Wang X., Xu M., Kong X., Zhong S., Kabissa J.J., Li D., Kang Z., Xu Y., Chen Z. The role of insulin receptor InR in photoperiod-regulated reproductive diapause of Chrysoperla nipponensis. Insect Biochem. Mol. Biol. 2025;180:104305. doi: 10.1016/j.ibmb.2025.104305. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Articles from International Journal of Molecular Sciences are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES