Skip to main content
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2026 Mar 16;64(2):e70047. doi: 10.1002/dvg.70047

Generation of a Novel Col8a2P2A‐CreERT2 Mouse Line Enables Targeted Genetic Manipulation of Corneal Endothelial Cells and Modeling of Endothelial Decompensation

Yong Yuan 1, Josiah Holt 1, Samuel Lorry 1, Yen‐Chiao Wang 1, Yueh‐Chiang Hu 2, Zhixing Ma 2, Adam Kaufman 1, Winston Kao 1, Diego G Ogando 3, Chia‐Yang Liu 1,
PMCID: PMC12993115  PMID: 41840915

ABSTRACT

The corneal endothelium is a monolayer of specialized cells that maintains stromal deturgescence and transparency, functions essential for vision. Despite its clinical importance, the developmental origins and homeostatic programs of the endothelium remain poorly understood, in part due to the lack of a lineage‐specific genetic driver. To overcome this limitation, we generated a Col8a2 P2A‐CreERT2 knock‐in mouse line that enables selective genetic manipulations of corneal endothelial cells. Cre activity was validated with reporter alleles and functional importance was assessed by conditional ablation of Col8a2+ cells in adulthood, with phenotypic outcomes evaluated by histology, immunofluorescence, and in vivo imaging. We found that Col8a2 P2A‐CreERT2 drives robust and specific recombination in corneal endothelial cells. Functional assays demonstrated that Col8a2+ cells contribute continuously to Descemet's membrane synthesis and are essential for maintaining endothelial integrity. Ablation disrupted endothelial density and barrier function, resulting in phenotypes resembling human endothelial dystrophies, including features of Fuchs' endothelial corneal dystrophy and posterior polymorphous corneal dystrophy. These findings identify Col8a2+ cells as indispensable regulators of endothelial development, homeostasis, and disease pathogenesis. The Col8a2 P2A‐CreERT2 line provides the first corneal endothelium–specific genetic driver, establishing a platform for mechanistic investigation and therapeutic discovery in endothelial disorders.

Keywords: Col8a2 P2A‐CreERT2 mouse model, corneal endothelium, Descemet's membrane, Fuchs' endothelial corneal dystroph, posterior polymorphous corneal dystrophy

1. Introduction

The corneal endothelium is a highly specialized monolayer of hexagonal cells that lines the posterior surface of the cornea and plays an indispensable role in ocular physiology. By actively transporting ions and fluid from the stroma into the anterior chamber, corneal endothelial cells (CECs) maintain corneal deturgescence and transparency, both of which are essential for preserving visual acuity (Tuft and Coster 1990; Srinivas 2010; Klyce 2020; Bonanno 2012). Because CECs are largely non‐proliferative in vivo, their density progressively declines with age, trauma, or disease. Once the endothelial cell population falls below a critical threshold, the cornea becomes edematous and opaque, leading to irreversible vision loss. Consequently, dysfunction of the corneal endothelium represents one of the leading indications for corneal transplantation worldwide (Gain et al. 2016; Feizi 2018). Despite its clinical importance, the developmental origins, molecular programs, and homeostatic mechanisms that sustain corneal endothelial integrity remain incompletely defined (Zallen and Goldstein 2017; Zavala et al. 2013; Gage et al. 2005). This knowledge gap has significant translational implications: it constrains our ability to model endothelial disorders, such as Fuchs' Endothelial Corneal Dystrophy (FECD), and hinders efforts to develop cell‐based or regenerative therapies to restore corneal clarity. While advances in surgical techniques, including Descemet's Stripping Automated Endothelial Keratoplasty (DSAEK) and Descemet's Membrane Endothelial Keratoplasty (DMEK), have transformed clinical management, corneal transplantation remains limited by donor tissue availability, risk of rejection, and variable long term outcomes. A deeper understanding of endothelial cell biology is therefore urgently needed to inform alternative therapeutic strategies. One major obstacle has been the absence of corneal endothelium–specific genetic tools for in vivo research. The ability to trace endothelial lineage, manipulate gene function, and selectively ablate cell populations is foundational for dissecting developmental pathways and disease mechanisms. Existing Cre driver lines label corneal endothelial cells only indirectly or non‐specifically, often with overlapping recombination in adjacent ocular or extraocular tissues; for example, Wnt1‐Cre (Gage et al. 2005) and P0‐Cre (Feltri et al. 1999; Chen et al. 2017) are widely used to target pre‐migratory and migratory neural crest–derived populations but are not restricted to corneal endothelium, thereby limiting precise genetic interrogation of endothelial cell biology at the mechanistic level. This lack of precision has limited efforts to interrogate endothelial cell biology at the mechanistic level.

Collagen type VIII alpha 2 (Col8a2) encodes a major structural component of Descemet's membrane (DM), the basement membrane secreted by corneal endothelial cells. Col8a2 expression is highly enriched in the corneal endothelium compared to other tissues (Sage et al. 1983). Strikingly, although Col8a2 is expressed broadly, including in vascular, dermal, and renal tissues (Kittelberger et al. 1990), pathogenic mutations in COL8A2 almost exclusively affect the corneal endothelium. Both missense and null alleles have been linked to corneal endothelial diseases such as early‐onset FECD and posterior polymorphous corneal dystrophy type 2 (PPMD/PPCD2) in humans, with parallel phenotypes observed in mouse models (Gottsch, Sundin, et al. 2005; Gottsch, Zhang, et al. 2005; Biswas et al. 2001; Iliff et al. 2012; Aldave et al. 2013; Kannabiran et al. 2022). This apparent paradox underscores a unique tissue‐specific vulnerability: whereas other basement membranes appear tolerant to the loss of Col8a2, the corneal endothelium critically depends on Col8a2+ cell function for DM synthesis and structural integrity. These observations position Col8a2+ cells as central regulators of corneal endothelial development, maintenance, and disease susceptibility. Yet, their precise lineage trajectories, homeostatic requirements, and regenerative potential remain uncharacterized. To address this critical gap, we generated a novel Col8a2 P2A‐CreERT2 knock‐in mouse line that, for the first time, enables lineage‐specific genetic manipulation of corneal endothelial cells in vivo. This tool provides the means to (i) map the developmental and postnatal fate of Col8a2+ cells, (ii) define their functional requirements through conditional ablation, and (iii) assess their contributions to disease pathogenesis in adulthood. In this study, we describe the development and validation of the Col8a2 P2A‐CreERT2 model for investigating corneal endothelial biology. Through spatiotemporal fate mapping, targeted ablation, and disease modeling, we define the homeostatic roles and functional requirements of Col8a2+ cells. This system provides a framework for mechanistic studies of endothelial dystrophies, including FECD and PPCD2, and offers insights that may inform regenerative and gene‐based strategies to preserve or restore corneal transparency.

2. Results and Discussion

2.1. Generation of the Col8a2 P2A‐CreERT2 Knock‐In Mouse Line

Despite the broad expression of Col8a2 in multiple tissues (Kittelberger et al. 1990), pathogenic variants in humans and mice primarily cause anterior segment abnormalities and corneal endothelial dysfunction. This suggests a unique tissue‐specific dependence of the corneal endothelium on Col8a2+ cell function. To establish a genetic system enabling selective manipulation of these cells, we generated a Col8a2 P2A‐CreERT2 knock‐in (Ki) mouse line through CRISPR/Cas9‐mediated homology‐directed repair (HDR). Pronuclear injection of one‐cell zygotes (Nidhi et al. 2021) was used to deliver a single‐guide RNA (sgRNA), Cas9 mRNA, and a donor plasmid containing a synthesized P2A‐CreERT2 cassette (Liu et al. 2017) flanked by Col8a2 homology arms (Figure 1A). Cas9‐induced double‐strand breaks near the Col8a2 stop codon enabled HDR‐mediated insertion of the cassette, generating the Col8a2 P2A‐CreERT2 allele (Figure 1B). The bicistronic transcript encodes both Col8a2 and CreERT2, separated by a 69‐nucleotide P2A self‐cleaving sequence (Figure 1C), thereby allowing co‐expression of both proteins from the endogenous Col8a2 promoter (Figure 1D). This configuration preserves collagen VIIIα2 function while conferring Tamoxifen (Tam) ‐inducible recombinase activity, enabling spatially and temporally controlled genetic manipulation of Col8a2+ cells. Importantly, the Col8a2 P2A‐CreERT2/WT and Col8a2 P2A‐CreERT2/P2A‐CreERT2 mice maintained without Tam were viable, any other tissues examined compared with wild‐type littermates, indicating that the Col8a2 P2A‐CreERT2 knock‐in is phenotypically neutral at the levels assessed. Expression of Col8a2‐P2A from this knock‐in allele was selectively confined to the corneal endothelium, with no detectable signal in the stroma or epithelium, indicating preservation of endogenous Col8a2 expression (Figure S1).

FIGURE 1.

FIGURE 1

Schematic illustrating the targeted insertion of the P2A‐CreERT2 cDNA into the mouse Col8a2 Allele located on chromosome 4 using the CRISPR/Cas9 genome editing system. (A) Pronuclear injection (PNI) at the one‐cell zygote stage with CRISPR/Cas9 components: Single‐guide RNA (sgRNA), Cas9 mRNA, and a donor plasmid containing the P2A‐CreERT2 cassette flanked by Col8a2 homology arms. (B) Cas9‐induced double‐strand break near the stop codon of Col8a2 enables homology‐directed repair (HDR) and targeted insertion of the P2A‐CreERT2 cDNA cassette, generating the Col8a2 P2A‐CreERT2 Ki allele. (C) In Col8a2‐expressing cells, transcription of the Ki locus produces a single bicistronic mRNA Col8a2 P2A‐CreERT2 . (D) During translation, the P2A peptide mediates ribosomal skipping, resulting in the production of two separate proteins: Col8a2‐P2A and P‐CreERT2.

2.2. Spatiotemporal Fate Mapping of Col8a2 + Cells

To validate Cre activity and tissue specificity, Col8a2 P2A‐CreERT2/WT mice were crossed with the Rosa26 mTmG reporter line (Muzumdar et al. 2007). In this system, Cre‐mediated recombination converts membrane‐bound Tomato (mT) fluorescence to membrane‐bound GFP (mG), permanently labeling Col8a2+ cells and their progeny (Figure 2A). Following Tam administration to nursing dams from postnatal day 21 (P21) to P26, approximately 60% of corneal endothelial cells in Col8a2 P2A‐CreERT2 ; Rosa26 mTmG mice underwent successful recombination (mG+), whereas the remaining cells retained mT signal. Notably, mG expression was restricted to the corneal endothelium, with no detectable labeling in the epithelium or stroma (Figure 2B–C9). These results establish the Col8a2 P2A‐CreERT2 mouse as the first Tam‐inducible Cre driver line with high specificity for corneal endothelial cells. The partial recombination efficiency (~60%) may reflect suboptimal Tam delivery or monoallelic Col8a2 expression, similar to what has been reported for Krt12 in corneal epithelium (Hayashi et al. 2010). Optimizing Tam induction protocols or timing could further enhance labeling efficiency (Figure S2 and Table 1). In addition, comprehensive examination of multiple tissues, including the lens, retina, brain, heart, lung, spleen, kidney, liver, and skeletal muscle, revealed no detectable EGFP expression, demonstrating that this mouse line enables highly efficient, spatially and temporally restricted Cre‐mediated recombination specifically in the corneal endothelium (Table 2).

FIGURE 2.

FIGURE 2

Functional validation of Col8a2 P2A‐CreERT2/WT ; Rosa26 mTmG/WT transgenic mice. (A) Schematic illustrating the generation of Col8a2 P2A‐CreERT2/WT ; Rosa26 mTmG/WT mice and Tamoxifen‐inducible expression of membrane‐targeted EGFP (mG) in Col8a2‐expressing cells. (B) Representative monochrome micrograph of a mouse eye; inset (B1) shows a high‐magnification view of mG fluorescence in the corneal endothelium, highlighting successful Cre‐mediated recombination. (C) Confocal z‐stack images from a corneal flat mount of a Col8a2 P2A‐CreERT2/WT ; Rosa26 mTmG/WT mouse induced with Tamoxifen at postnatal day 21 to 26 (P21–P26), illustrating the spatial distribution of mG‐labeled cells within the cornea. Sequential optical sections highlight distinct corneal layers: Basal epithelium (C1), epithelial stromal junction (C2), anterior stroma (C3), anterior middle stroma (C4), middle stroma (C5), posterior stroma (C6), stromal endothelial junction (C7), basal endothelium (C8), and apical endothelium (C9). Notably, mG signal was restricted to the corneal endothelium, with no detectable labeling in other corneal layers.

TABLE 1.

Cre recombination efficiency in Tam‐administered Col8a2 P2A‐CreERT2 ; Rosa26 mTmG/WT mice.

Tam administration period P21‐P26 P21‐P70
Percentage of eGFP‐positive cells in corneal endothelium 61 94.3

TABLE 2.

Tissue survey of Cre recombination activity in Tam‐administered Col8a2 P2ACreERT2 ; Rosa26 mTmG/WT mice from P21 to P70.

Tissue Corneal epithelium Corneal stroma Corneal endothelium Lens Retina Brain Heart Lung Spleen Kidney Skeletal muscle
eGFP expression None Sparce Abundant None None None None None None None None

2.3. Functional Importance of Col8a2 + Cells in Corneal Homeostasis

To define the functional significance of Col8a2+ cells, we generated Col8a2 P2A‐CreERT2 ; Rosa26 floxed‐Stop‐DTA mice (Voehringer et al. 2008), enabling Cre‐dependent expression of diphtheria toxin A (DTA) for targeted ablation of Col8a2+ cells (Figure 3). The Col8a2 P2A‐CreERT2 ; Rosa26 mTmG/floxed‐Stop‐DTA mouse strain was viable and fertile under naïve conditions without tamoxifen administration, indicating that DTA expression is tightly controlled and occurs only following tamoxifen‐induced, Cre‐mediated recombination (Figure S3). For inducible recombination, mice were administered tamoxifen (1 mg per 10 g body weight, i.p.) at P21, P23, and P30 and analyzed at P70. Under this regimen, EGFP‐positive cells reached up to 94.3% (Figure 4C), representing substantially higher recombination efficiency than that achieved with tamoxifen administration from P21 to P26 (61%; Figure 2C9; Table 1). Phalloidin‐633 and DAPI staining revealed normal hexagonal endothelial morphology in control mice (Figure 4A–E), whereas DTA‐expressing mice displayed disrupted cell borders, nuclear disorganization, and reduced endothelial cell density (Figure 4F–J). Quantitative analysis using CellProfiler (Stirling et al. 2021) confirmed a striking decrease in cell density in DTA‐ablated mice (1,247 cells/mm2) compared to controls (2,705 cells/mm2) (Figure 5A,B). Scatter plots of cell area versus compactness further demonstrated marked pleomorphism and polymegathism, characteristic of endothelial stress and dysfunction (Figure 5C). Given the central role of the actin cytoskeleton in maintaining endothelial barrier integrity, we examined peri‐junctional actomyosin ring (PAMR) structure using Phalloidin staining. In control corneas, the PAMR appeared continuous and organized (Figure 6A), whereas DTA‐ablated endothelium exhibited fragmented PAMR and cortical actin granule accumulation (Figure 6B, white arrows), features consistent with early cytoskeletal collapse and apoptosis. Notably, these alterations were detectable as early as P24 after tamoxifen administration at P21, indicating an early association between loss of Col8a2+ cells and cytoskeletal remodeling and cellular stress responses preceding overt degeneration. Quantitative analysis further revealed that approximately 30% of endothelial cells in tamoxifen‐treated Col8a2 P2A‐CreERT2/WT ; Rosa26 floxed‐Stop‐DTA/WT mice (3 days of administration) exhibited prominent cortical actin granules, whereas such structures were not observed in control littermates (Figure 6C). The selective emergence of these cortical actin structures following DTA expression supports an endothelial injury or stress response characterized by active actin reorganization, potentially reflecting early alterations in cortical tension and barrier integrity.

FIGURE 3.

FIGURE 3

Schematic illustrating Tam‐inducible DTA expression and resulting corneal. Endothelial dysfunction. (A) Tam‐treated Col8a2 P2A‐CreERT2/WT ; Rosa26 mTmG/WT control littermate exhibits normal hexagonal endothelial morphology with membrane GFP (mG) expression marking recombined Col8a2+ cells. (B) Tam‐treated Col8a2 P2A‐CreERT2/WT ; Rosa26 mTmG/floxed‐Stop‐DTA mouse displays abnormal corneal endothelial cell morphology, including polymegathism (increased cell size variability) and pleomorphism (irregular cell shapes), consistent with endothelial dysfunction following Col8a2+ cell ablation.

FIGURE 4.

FIGURE 4

Corneal endothelial defects in Tam‐treated Col8a2 P2A‐CreERT2/WT ; Rosa26 mTmG/floxed‐DTA mice. Confocal images of corneal flat mounts stained with Phalloidin (pink) and DAPI (blue) from Tam‐treated mice. (A–E), Col8a2 P2A‐CreERT2/WT ; Rosa26 mTmG/WT control littermates show normal endothelial cell morphology. (F–J), Col8a2 P2A‐CreERT2/WT ; Rosa26 mTmG/floxed‐DTA mice display progressive endothelial defects, including disrupted cell borders and altered nuclear organization, indicative of endothelial dysfunction following Col8a2+ cell ablation. All mice received TAM at postnatal days P21, P23, and P30 and were euthanized at P70 for analysis.

FIGURE 5.

FIGURE 5

Targeted ablation of Col8a2+ cells disrupts corneal endothelial cell density and morphology. (A, B) Representative en face images of corneal endothelium analyzed using CellProfiler. Nuclei are marked in green, and cell borders are outlined with Phalloidin‐633 (in magenta). In control Col8a2 P2A‐CreERT2/WT ; Rosa26 mTmG/WT corneas (A), a dense and organized monolayer is evident, with an average cell density of 2705 cells/mm2. In contrast, Col8a2 P2A‐CreERT2/WT ; Rosa26 mTmG/floxed‐DTA corneas (B) exhibit a marked reduction in endothelial cell density (1247 cells/mm2), reflecting loss of Col8a2+ cells. (C) Scatter plot of individual endothelial cells showing cell area (y‐axis) versus compactness (x‐axis). Control cells (green circle) cluster at higher compactness values, indicative of a uniform, tightly packed morphology. DTA‐treated cells (red asterisk) display broader distribution with increased cell area and reduced compactness, consistent with impaired cellular organization and disrupted monolayer integrity following Col8a2+ cell ablation.

FIGURE 6.

FIGURE 6

DTA expression disrupts peri‐junctional actomyosin ring (PAMR) organization in the corneal endothelium. Confocal images of corneal flat mounts stained with Phalloidin‐633 (red) and DAPI (blue) from Tam‐treated mice. (A) Col8a2 P2A‐CreERT2/WT ; Rosa26 WT/WT control littermates exhibit normal PAMR organization, consistent with intact endothelial architecture. (B) Col8a2 P2A‐CreERT2/WT ; Rosa26 floxed‐Stop‐DTA/WT mice display disrupted PAMR with accumulation of cortical Actin granules (arrows), indicative of cytoskeletal breakdown and endothelial apoptosis following DTA‐mediated ablation of Col8a2+ cells. All mice received Tam at postnatal day 21 (P21) and were analyzed at P24. (C) Quantification of cortical Actin granules in control versus DTA‐expressing endothelia.

2.4. Dose‐Dependent Endothelial Dysfunction and Disease Modeling

In heterozygous Col8a2 P2A‐CreERT2/WT ; Rosa26 floxed‐Stop‐DTA/WT mice, ablation induced marked morphological abnormalities without corneal opacification by P70, modeling subclinical endothelial dysfunction (Figures 4 and 5). In contrast, mice homozygous for Col8a 2P2A‐CreERT2 and heterozygous for Rosa26 floxed‐Stop‐DTA exhibited severe DTA‐mediated cellular stress, resulting in a dramatic reduction in corneal endothelial cell density and the rapid onset of corneal edema and opacity within 21 days after tamoxifen administration (Figure 7H–J; Table 3). Brightfield examination confirmed clear corneas in control littermates (Figure 7A,A′), whereas experimental mice developed bilateral corneal thickening and opacity (Figure 7H,H′). Anterior segment OCT imaging further demonstrated normal corneal thickness in controls (Figure 7B,C) compared with pronounced stromal edema in experimental eyes (Figure 7I–J). Confocal microscopy of corneal endothelial flat mounts stained with DAPI, ZO‐1, and Phalloidin‐633 revealed preserved hexagonal endothelial morphology and intact junctional organization in controls (Figure 7D–G), whereas experimental mice displayed cytoskeletal disorganization, tight junction disruption, and loss of hexagonal morphology (Figure 7K–N). These findings suggest that stress‐induced endothelial cell enlargement and fusion initially compensate for cell loss but ultimately fail, leading to barrier collapse and endothelial decompensation. Histological analysis further supported these observations. Control corneas exhibited normal stromal architecture and epithelial integrity (Figure 8A), whereas DTA‐ablated corneas displayed features consistent with bullous keratopathy, including subepithelial fluid‐filled bullae, stromal edema, and epithelial detachment (Figure 8B,B′). These phenotypes closely resemble those observed in advanced corneal endothelial failure, indicating that ablation of Col8a2+ cells disrupts endothelial barrier integrity and fluid homeostasis. It should be noted that the stromal edema visible in Figure 7I,J was no longer apparent in Figure 8B,B′ due to tissue dehydration during the ascending alcohol series used for histological processing. Importantly, no off‐target pathology was detected in other ocular or systemic tissues, including the retina (data not shown), confirming the endothelium‐specific activity of the Col8a2 promoter. Together, these results underscore that Col8a2+ cells are essential for maintaining corneal endothelial density, hexagonal architecture, and cytoskeletal integrity.

FIGURE 7.

FIGURE 7

Tamoxifen‐induced ablation of Col8a2‐lineage cells causes corneal edema and opacity. Col8a2 P2A‐CreERT2/P2A‐CreERT2 ; Rosa26 floxed‐Stop‐DTA/WT mice (experimental) were fed Tamoxifen chow from P21 to P42. Brightfield images show bilateral corneal thickening and opacity in experimental mice (H, H′), compared to clear corneas in control Col8a2 P2A‐CreERT2/P2A‐CreERT2 ; Rosa26 WT/WT littermates (A, A′). Anterior segment OCT imaging reveals significant corneal edema in experimental eyes (I, J) versus controls (B, C). Confocal microscopy of corneal endothelial flat mounts stained with DAPI (D, K), ZO‐1 (E, L), and Phalloidin‐633 (F, M), with merged images (G, N), demonstrates normal hexagonal endothelial cell morphology in controls (D–G) and polymegathism and pleomorphism in experimental mice (K–N). OD, right eye; OS, left eye.

TABLE 3.

Endothelial cell density (ECD) in Tam‐administered mice from P21 to P42.

Genotypes Col8a2 P2A‐CreERT2/P2A‐CreERT2 ; Rosa26 WT/WT Col8a2 P2A‐CreERT2/P2A‐CreERT2 ; Rosa26 floxed‐Stop‐DTA/WT
ECD (mm2) 2768 ± 28 (n = 6) 493 ± 5 (n = 6)

FIGURE 8.

FIGURE 8

Masson's Trichrome staining revealed that DTA‐mediated ablation of corneal endothelial cells induced endothelial decompensation, resulting in marked stromal edema and the formation of epithelial/subepithelial bullae, consistent with bullous keratopathy (arrows in B′). Note that the stromal edema seen in Figure 7I,J is absent in Figure 8B,B′ due to dehydration during histological processing.

2.5. Cytoskeletal Remodeling and Pathophysiological Implications

The cytoskeletal disorganization, pleomorphism, and barrier dysfunction observed after Col8a2+ cell ablation resemble early pathological features of Fuchs' endothelial corneal dystrophy (FECD) and posterior polymorphous corneal dystrophy type 2 (PPCD2) (Zarouchlioti et al. 2018; Klintworth 2009), both of which are linked to COL8A2 mutations in humans (Biswas et al. 2001; Gottsch, Sundin, et al. 2005; Gottsch, Zhang, et al. 2005). The emergence of multinucleated endothelial cells in DTA‐ablated corneas indicates failed compensatory remodeling when neighboring cells cannot sufficiently enlarge to maintain barrier continuity, leading to loss of the uniform hexagonal mosaic and progressive endothelial decompensation (Edelhauser 2000; Joyce 2012; Bahn et al. 1984). Thus, the Col8a2 P2A‐CreERT2 model recapitulates key cytopathological hallmarks of human endothelial dystrophies in a genetically tractable system.

2.6. Translational and Regenerative Implications

Beyond disease modeling, this system offers powerful regenerative and developmental research applications. Tamoxifen‐inducible Cre activation enables precise lineage tracing of Col8a2+ cells, allowing investigation of their proliferative capacity during development, aging, injury, and stress. These studies can help resolve long‐standing debates regarding the proliferative potential of corneal endothelial cells in vivo (Joyce 2005; Okumura et al. 2014). Moreover, integration of this model with human iPSC‐derived endothelial cells or corneal organoids (Zhu et al. 2019; Manafi et al. 2021; Ng et al. 2023) could extend its translational relevance for therapeutic development, including gene correction and pharmacological screening.

2.7. Limitations and Future Directions

Despite its advantages, several limitations remain. Recombination efficiency was incomplete, necessitating further optimization of Tam dosing and timing. Comprehensive evaluation of extraocular Cre activity is also warranted, although no pathology was observed in this study. Finally, interspecies differences between mouse and human corneal endothelia, including density, regenerative potential, and stress responses, should be considered when extrapolating findings (Van Horn et al. 1977; Joyce 2003; Pei et al. 2021).

2.8. Summary

The Col8a2 P2A‐CreERT2 line represents a robust, corneal endothelium–specific, and Tamoxifen‐ inducible genetic tool for dissecting endothelial biology. The system enables both lineage tracing and conditional ablation of Col8a2+ cells, providing mechanistic insights into their essential role in maintaining endothelial homeostasis and modeling human endothelial dystrophies. By filling a critical methodological gap in ocular genetics, this mouse line will be made available to the research community, thereby opening new avenues for investigating corneal pathophysiology and developing regenerative and gene‐based therapies.

3. Methods

3.1. Generation of Col8a2 P2A‐CreERT2 Knock‐In Mice and Genotyping

The Col8a2 P2A‐CreERT2 knock‐in mouse line was generated using CRISPR/Cas9‐mediated genome editing. A single‐guide RNA (sgRNA) was designed to target the genomic region immediately upstream of the Col8a2 stop codon. In vitro–transcribed sgRNA, Cas9 mRNA, and a donor plasmid containing the P2A‐CreERT2 cassette flanked by ~1–2 kb Col8a2 homology arms were microinjected into the pronucleus of C57BL/6J one‐cell stage zygotes. Injected embryos were transferred into pseudopregnant recipient females for gestation. Founder mice were screened for targeted integration by PCR analysis and confirmed by Sanger sequencing of the 5′ and 3′ junctions. Correctly targeted founders were bred to C57BL/6J mice (The Jackson Laboratory) to establish germline transmission. The knock‐in allele (hereafter referred to as Col8a2 P2A‐CreERT2 ) was maintained on a C57BL/6J background. Genomic DNA was isolated from ear biopsies using an alkali‐lysis method. Briefly, tissue samples were incubated in 50 μL of 50 mM NaOH at 95°C for 20 min, followed by neutralization with 50 μL of 100 mM Tris‐HCl (pH 8.3). The crude DNA lysate was clarified by brief centrifugation, and 1–2 μL of the supernatant was used directly for PCR. PCR primers were designed to distinguish the wild‐type and knock‐in alleles. The wild‐type allele was detected using a forward primer (5′‐TACGACGAATACAAGAAGGGCTAC‐3′) upstream of the insertion site and a reverse primer (5′‐GAAAGCAGGTCAGTCTTCTCGGG‐3′) located downstream in the 3′ untranslated region (expected product: 325 bp). The knock‐in allele was detected using the forward primer (5′‐AGGCAGAGGGTTTCCCTGCCACAGC‐3′) within the CreERT2 cassette with the same reverse primer (expected product: 183 bp). PCR amplification was performed using Phusion High‐Fidelity DNA Polymerase (0.02 U/μL, NEB #M0530) in a 20 μL reaction. Cycling conditions were as follows: initial denaturation at 95°C for 5 min; 35 cycles of 95°C for 30 s and 72°C for 1 min (combined annealing/extension); followed by a final extension at 72°C for 5 min. Amplicons were resolved on 1.5% agarose gels and visualized with ethidium bromide.

3.2. Breeding, Crossing Strategy, and Tamoxifen Induction

Col8a2 P2A‐CreERT2 mice were crossed with Rosa26 mTmG (JAX #007676) (Muzumdar et al. 2007) or Rosa26 floxed‐Stop‐DTA (JAX #009669) (Voehringer et al. 2008) reporter strains to generate experimental cohorts for fate mapping and ablation studies, respectively. In the Rosa26 mTmG line, cells ubiquitously express membrane‐targeted tdTomato (mT) until Cre‐mediated recombination excises the floxed‐Stop cassette, after which membrane‐targeted EGFP (mG) is expressed, permanently marking Col8a2‐derived cells and their progeny. In the Rosa26 floxed‐Stop‐DTA line, Cre‐mediated excision of the Stop cassette drives diphtheria toxin A (DTA) expression, resulting in ablation of Col8a2‐expressing cells. Experimental mice were generated by crossing heterozygous Col8a2 P2A‐CreERT2 mice with homozygous reporter lines. Offspring were genotyped for both the Col8a2 P2A‐CreERT2 allele and the reporter allele. Reporter‐positive littermates lacking Cre served as negative controls. Both male and female mice were used for experiments unless otherwise specified. Tamoxifen (Sigma‐Aldrich, T5648) was dissolved in corn oil (20 mg/mL) by sonication and brief heating at 37°C and stored at 4°C protected from light. For postnatal induction, Tamoxifen was administered by intraperitoneal (i.p.) injection at a dose of 75 mg/kg body weight daily for 3 consecutive days, unless otherwise noted. Control mice received vehicle alone. The efficiency and specificity of recombination were verified in each experimental cohort by reporter analysis. Continuous Tam treatment as shown in Figure 7 was administered with Tam diet (Tamoxifen Citrate, TD.130860, Teklad Custom Diets, Madison, WI) in the dam.

3.3. Corneal Whole‐Mount Immunostaining

Eyes were enucleated at the indicated time points and fixed in 4% paraformaldehyde (PFA) in PBS for 30 min at room temperature. Corneas were dissected from the globe by removing the sclera, lens, and iris, followed by radial incisions to flatten the tissue. Whole‐mount corneas were permeabilized with 0.3% Triton X‐100 in PBS for 30 min and blocked with 5% normal donkey serum (Jackson ImmunoResearch, Code: 017‐000‐121) in PBS containing 0.1% Triton X‐100 for 1 h at room temperature. Tissues were incubated with rabbit anti‐ZO‐1 (ThermoFisher, Cat # 33‐9100) or rabbit anti‐P2A (EMD Millipore, Corp, Cat#ABS31) antibodies diluted in blocking buffer overnight at 4°C with gentle rocking. After washes with PBS containing 0.1% Triton X‐100, corneas were incubated with goat ant‐rabbit IgG Alexa Fluor–conjugated secondary antibodies (Invitrogen, Cat # A‐11008, or Cat # A‐21245, 1:500) for 2 h at room temperature. Actin filaments were labeled with Alexa Fluor 633–conjugated phalloidin (Invitrogen, catalog # A22284, 1:200). Nuclei were counterstained with DAPI (Sigma, D954 2, 1 μg/mL). After staining, corneas were mounted epithelial side up on glass slides with Fluoromount‐G (SouthernBiotech) and coverslipped. Imaging was performed using a Leica confocal laser scanning microscope (Leica TCS SP8) with z‐stack acquisition spanning the entire corneal thickness. Images were processed with Fiji/ImageJ and Adobe Photoshop, and identical acquisition parameters were applied across experimental groups.

3.4. CellProfiler Analysis of Corneal Endothelial Cell Density and Morphometry

Flat‐mounted corneas were stained with phalloidin‐633 to delineate endothelial cell borders and imaged by confocal microscopy. Images were imported into CellProfiler (Broad Institute, v.4.x) (Carpenter et al. 2006; McQuin et al. 2018), and a custom pipeline was applied for automated segmentation and morphometric analysis. Briefly, images were converted to grayscale and enhanced for contrast, followed by segmentation of individual endothelial cells using the “Identify Primary Objects” module. Endothelial cell density was calculated as the total number of segmented cells per unit area (cells/mm2). For morphometric analysis, the “Measure Object Size and Shape” module was used to quantify individual cell areas, from which mean cell size and frequency distribution were derived. These outputs allowed assessment of both overall endothelial density and cell size variability (polymegathism) across experimental groups.

3.5. Histology and Staining

Paraffin‐embedded eye sections (5 μm) were deparaffinized and rehydrated by standard procedures. Histological examination was visualized by Masson's Trichrome staining using a commercial kit following the manufacturer's protocol (Masson's Trichrome Stain Kit, StatLab, item #: 23203113).

3.6. Statistical Analysis

All analyses were performed in GraphPad Prism 10. Two‐group comparisons will use unpaired two‐tailed Student's t‐tests for normally distributed data (Shapiro‐Wilk test) or Mann‐Whitney U tests otherwise. Significance is set at p < 0.05. Data are reported as mean ± SD unless noted. Image quantification and outcome assessments will be performed with investigators blinded to genotype and treatment. All experiments include at least N = 3 biological replicates per group. Key comparisons in ablation experiments use N = 6 mice per group, based on preliminary effect size and variance estimates. Technical replicates (e.g., multiple fields per eye) were averaged per biological replicate. Power analyses (G*Power 3.1) assumed α = 0.05, power = 0.8, and effect sizes from preliminary data. Sample sizes may be adjusted based on observed variability.

Funding

This work was supported by National Institutes of Health, NIH/R21 EY36160 (DO), NIH/R01 EY29071 (CYL), R21 EY037000 (CYL).

Disclosure

The authors have nothing to report.

Ethics Statement

All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Cincinnati and conducted in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research.

Supporting information

Figure S1: Expression of Col8a2‐P2A in the corneal endothelium of Col8a2 P2A‐CreERT2 mice. Whole‐mount immunofluorescence staining was performed using an anti‐P2A antibody (green), with DAPI for nuclear staining (blue) and phalloidin for F‐actin visualization (pink). P2A‐positive signal was detected in the corneal endothelium (A), but not in the stroma (B) or epithelium (C), indicating preservation of endogenous Col8a2 expression.

Figure S2: Heterogeneous Col8a2‐P2A and Cre‐mediated‐mG expression in the corneal endothelium of tamoxifen‐treated Col8a2 P2A‐CreERT2/WT ; Rosa26 mTmG/WT mice. Whole‐mount immunofluorescence staining was performed using an anti‐P2A antibody (pink), Cre‐mediated membrane GFP (mG, green), and DAPI for nuclear staining (blue). Col8a2‐P2A expression was detected uniformly in the corneal endothelium, but not in the epithelium or stroma. In contrast, mG‐positive signals were observed specifically within the corneal endothelium (C), but not in the stroma (B) or epithelium (A), and displayed a heterogeneous pattern, consistent with incomplete tamoxifen‐induced Cre recombination.

Figure S3: Tam‐induced ablation of Col8a2‐lineage cells leads to corneal edema and opacity. Col8a2 P2A‐CreERT2 ; Rosa26 floxed‐Stop‐DTA/WT mice were fed Tam‐containing chow (w/Tam, right panels) or control chow (w/o Tam, left panels) from postnatal day 21 (P21) to P42. Corneal endothelial flat mounts were analyzed by confocal microscopy following staining with DAPI (A, E), anti‐ZO‐1 (B, F), and phalloidin‐633 (C, G); merged images are shown in (D, H). Non–Tam‐treated mice exhibit a regular hexagonal endothelial cell morphology (A–D). In contrast, Tam‐induced DTA expression leads to marked endothelial cell loss, characterized by polymegathism and pleomorphism (E–H).

DVG-64-e70047-s001.docx (2.6MB, docx)

Data Availability Statement

Data generated in this study are available from the corresponding author upon reasonable request and subject to institutional approval. Animal models will be made available to the research community.

References

  1. Aldave, A. J. , Han J., and Frausto R. F.. 2013. “Genetics of the Corneal Endothelial Dystrophies: 341 an Evidence‐Based Review.” Clinical Genetics 84, no. 2: 109–119. 10.1111/cge.12191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bahn, C. F. , Falls H. F., Varley G. A., Meyer R. F., Edelhauser H. F., and Bourne W. M.. 1984. “Classification of Corneal Endothelial Disorders Based on Neural Crest Origin.” Ophthalmology 91, no. 6: 558–563. 10.1016/s0161-6420(84)34249-x. [DOI] [PubMed] [Google Scholar]
  3. Biswas, S. , Munier F. L., Yardley J., et al. 2001. “Missense Mutations in COL8A2, the Gene Encoding the alpha2 Chain of Type VIII Collagen, Cause Two Forms of Corneal Endothelial Dystrophy.” Human Molecular Genetics 10, no. 21: 2415–2423. 10.1093/hmg/10.21.2415. [DOI] [PubMed] [Google Scholar]
  4. Bonanno, J. A. 2012. “Molecular Mechanisms Underlying the Corneal Endothelial Pump.” Experimental Eye Research 95, no. 1: 2–7. 10.1016/j.exer.2011.06.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Carpenter, A. E. , Jones T. R., Lamprecht M. R., et al. 2006. “CellProfiler: Image Analysis Software for Identifying and Quantifying Cell Phenotypes.” Genome Biology 7, no. 10: R100. 10.1186/gb-2006-7-10-r100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chen, G. , Ishan M., Yang J., et al. 2017. “Specific and Spatial Labeling of P0‐Cre Versus Wnt1‐Cre in Cranial Neural Crest in Early Mouse Embryos.” Genesis 55, no. 6: e23034. 10.1002/dvg.23034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Edelhauser, H. F. 2000. “The Resiliency of the Corneal Endothelium to Refractive and Intraocular Surgery.” Cornea 19, no. 3: 263–273. 10.1097/00003226-200005000-00002. [DOI] [PubMed] [Google Scholar]
  8. Feizi, S. 2018. “Corneal Endothelial Cell Dysfunction: Etiologies and Management.” Therapeutic Advances in Ophthalmology 10: 2515841418815802. 10.1177/2515841418815802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Feltri, M. L. , D'Antonio M., Previtali S., Fasolini M., Messing A., and Wrabetz L.. 1999. “P0 Cre Transgenic Mice for Inactivation of Adhesion Molecules in Schwann Cells.” Annals of the New York Academy of Sciences 883, no. 1: 116–123. [PubMed] [Google Scholar]
  10. Gage, P. J. , Rhoades W., Prucka S. K., and Hjalt T.. 2005. “Fate Maps of Neural Crest and Mesoderm in the Mammalian Eye.” Investigative Ophthalmology & Visual Science 46, no. 11: 4200–4208. 10.1167/iovs.05-0691. [DOI] [PubMed] [Google Scholar]
  11. Gain, P. , Jullienne R., He Z., et al. 2016. “Global Survey of Corneal Transplantation and Eye Banking.” JAMA Ophthalmology 134, no. 2: 167–173. 10.1001/jamaophthalmol.2015.4776. [DOI] [PubMed] [Google Scholar]
  12. Gottsch, J. D. , Sundin O. H., Liu S. H., et al. 2005. “Inheritance of a Novel COL8A2 Mutation Defines a Distinct Early‐Onset Subtype of Fuchs Corneal Dystrophy.” Investigative Ophthalmology & Visual Science 46, no. 6: 1934–1939. 10.1167/iovs.04-0937. [DOI] [PubMed] [Google Scholar]
  13. Gottsch, J. D. , Zhang C., Sundin O. H., Bell W. R., Stark W. J., and Green W. R.. 2005. “Fuchs Corneal Dystrophy: Aberrant Collagen Distribution in an L450W Mutant of the COL8A2 Gene.” Investigative Ophthalmology & Visual Science 46, no. 12: 4504–4511. 10.1167/iovs.05-0497. [DOI] [PubMed] [Google Scholar]
  14. Hayashi, Y. , Call M. K., Liu C. Y., et al. 2010. “Monoallelic Expression of Krt12 Gene During Corneal‐Type Epithelium Differentiation of Limbal Stem Cells.” Investigative Ophthalmology & Visual Science 51, no. 9: 4562–4568. 10.1167/iovs.10-5331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Iliff, B. W. , Riazuddin S. A., and Gottsch J. D.. 2012. “The Genetics of Fuchs' Corneal Dystrophy.” Expert Review of Ophthalmology 7, no. 4: 363–375. 10.1586/eop.12.39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Joyce, N. C. 2003. “Proliferative Capacity of the Corneal Endothelium.” Progress in Retinal and Eye Research 22, no. 3: 359–389. 10.1016/s1350-9462(02)00065-4. [DOI] [PubMed] [Google Scholar]
  17. Joyce, N. C. 2005. “Cell Cycle Status in Human Corneal Endothelium.” Experimental Eye Research 81, no. 6: 629–638. 10.1016/j.exer.2005.06.012. [DOI] [PubMed] [Google Scholar]
  18. Joyce, N. C. 2012. “Proliferative Capacity of Corneal Endothelial Cells.” Experimental Eye Research 95, no. 1: 16–23. 10.1016/j.exer.2011.08.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kannabiran, C. , Chaurasia S., Ramappa M., and Mootha V. V.. 2022. “Update on the Genetics of Corneal Endothelial Dystrophies.” Indian Journal of Ophthalmology 70, no. 7: 2239–2248. 10.4103/ijo.IJO_992_22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kittelberger, R. , Davis P. F., Flynn D. W., and Greenhill N. S.. 1990. “Distribution of Type VIII Collagen in Tissues: An Immunohistochemical Study.” Connective Tissue Research 24, no. 3–4: 303–318. 10.3109/03008209009152157. [DOI] [PubMed] [Google Scholar]
  21. Klintworth, G. K. 2009. “Corneal Dystrophies.” Orphanet Journal of Rare Diseases 4: 7. 10.1186/1750-1172-4-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Klyce, S. D. 2020. “Endothelial Pump and Barrier Function.” Experimental Eye Research 198: 108068. 10.1016/j.exer.2020.108068. [DOI] [PubMed] [Google Scholar]
  23. Liu, Z. , Chen O., Wall J. B. J., et al. 2017. “Systematic Comparison of 2A Peptides for Cloning Multi‐Genes in a Polycistronic Vector.” Scientific Reports 7, no. 1: 2193. 10.1038/s41598-017-02460-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Manafi, N. , Shokri F., Achberger K., et al. 2021. “Organoids and Organ Chips in Ophthalmology.” Ocular Surface 19: 1–15. 10.1016/j.jtos.2020.11.004. [DOI] [PubMed] [Google Scholar]
  25. McQuin, C. , Goodman A., Chernyshev V., et al. 2018. “CellProfiler 3.0: Next‐Generation Image Processing for Biology.” PLoS Biology 16, no. 7: e2005970. 10.1371/journal.pbio.2005970. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Muzumdar, M. D. , Tasic B., Miyamichi K., Li L., and Luo L.. 2007. “A Global Double422 Fluorescent Cre Reporter Mouse.” Genesis 45, no. 9: 593–605. 10.1002/dvg.20335. [DOI] [PubMed] [Google Scholar]
  27. Ng, X. Y. , Peh G. S. L., Yam G. H., Tay H. G., and Mehta J. S.. 2023. “Corneal Endothelial‐Like Cells Derived From Induced Pluripotent Stem Cells for Cell Therapy.” International Journal of Molecular Sciences 24, no. 15: 12433. 10.3390/ijms241512433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Nidhi, S. , Anand U., Oleksak P., et al. 2021. “Novel CRISPR‐Cas Systems: An Updated Review of the Current Achievements, Applications, and Future Research Perspectives.” International Journal of Molecular Sciences 22, no. 7: 3327. 10.3390/ijms22073327. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Okumura, N. , Kinoshita S., and Koizumi N.. 2014. “Cell‐Based Approach for Treatment of Corneal Endothelial Dysfunction.” Cornea 33, no. Suppl. 11: S37–S41. 10.1097/ICO.0000000000000229. [DOI] [PubMed] [Google Scholar]
  30. Pei, W. , Chen J., Wu W., Wei W., Yu Y., and Feng Y.. 2021. “Comparison of the Rabbit and Human Corneal Endothelial Proteomes Regarding Proliferative Capacity.” Experimental Eye Research 209: 108629. 10.1016/j.exer.2021.108629. [DOI] [PubMed] [Google Scholar]
  31. Sage, H. , Trüeb B., and Bornstein P.. 1983. “Biosynthetic and Structural Properties of Endothelial Cell Type VIII Collagen.” Journal of Biological Chemistry 258, no. 21: 13391–13401. [PubMed] [Google Scholar]
  32. Srinivas, S. P. 2010. “Dynamic Regulation of Barrier Integrity of the Corneal Endothelium.” Optometry and Vision Science 87, no. 4: E239–E254. 10.1097/OPX.0b013e3181d39464. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Stirling, D. R. , Swain‐Bowden M. J., Lucas A. M., Carpenter A. E., Cimini B. A., and Goodman A.. 2021. “CellProfiler 4: Improvements in Speed, Utility, and Usability.” BMC Bioinformatics 22, no. 1: 433. 10.1186/s12859-021-04344-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Tuft, S. J. , and Coster D. J.. 1990. “The Corneal Endothelium.” Eye 4, no. Pt 3: 389–424. 10.1038/eye.1990.53. [DOI] [PubMed] [Google Scholar]
  35. Van Horn, D. L. , Sendele D. D., Seideman S., and Buco P. J.. 1977. “Regenerative Capacity of the Corneal Endothelium in Rabbit and Cat.” Investigative Ophthalmology & Visual Science 16, no. 7: 597–613. [PubMed] [Google Scholar]
  36. Voehringer, D. , Liang H. E., and Locksley R. M.. 2008. “Homeostasis and Effector Function of Lymphopenia‐Induced “Memory‐Like” T Cells in Constitutively T Cell‐Depleted Mice.” Journal of Immunology 180, no. 7: 4742–4753. 10.4049/jimmunol.180.7.4742. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Zallen, J. A. , and Goldstein B.. 2017. “Cellular Mechanisms of Morphogenesis.” Seminars in Cell & Developmental Biology 67: 101–102. 10.1016/j.semcdb.2017.06.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Zarouchlioti, C. , Sanchez‐Pintado B., Hafford Tear N. J., et al. 2018. “Antisense Therapy for a Common Corneal Dystrophy Ameliorates TCF4 Repeat Expansion‐Mediated Toxicity.” American Journal of Human Genetics 102, no. 4: 528–539. 10.1016/j.ajhg.2018.02.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Zavala, J. , López Jaime G. R., Rodríguez Barrientos C. A., and Valdez‐Garcia J.. 2013. “Corneal Endothelium: Developmental Strategies for Regeneration.” Eye (London) 27, no. 5: 579–588. 10.1038/eye.2013.15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Zhu, Q. , Zhu Y., Tighe S., Liu Y., and Hu M.. 2019. “Engineering of Human Corneal Endothelial Cells In Vitro.” International Journal of Medical Sciences 16, no. 4: 507–512. 10.7150/ijms.30759. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1: Expression of Col8a2‐P2A in the corneal endothelium of Col8a2 P2A‐CreERT2 mice. Whole‐mount immunofluorescence staining was performed using an anti‐P2A antibody (green), with DAPI for nuclear staining (blue) and phalloidin for F‐actin visualization (pink). P2A‐positive signal was detected in the corneal endothelium (A), but not in the stroma (B) or epithelium (C), indicating preservation of endogenous Col8a2 expression.

Figure S2: Heterogeneous Col8a2‐P2A and Cre‐mediated‐mG expression in the corneal endothelium of tamoxifen‐treated Col8a2 P2A‐CreERT2/WT ; Rosa26 mTmG/WT mice. Whole‐mount immunofluorescence staining was performed using an anti‐P2A antibody (pink), Cre‐mediated membrane GFP (mG, green), and DAPI for nuclear staining (blue). Col8a2‐P2A expression was detected uniformly in the corneal endothelium, but not in the epithelium or stroma. In contrast, mG‐positive signals were observed specifically within the corneal endothelium (C), but not in the stroma (B) or epithelium (A), and displayed a heterogeneous pattern, consistent with incomplete tamoxifen‐induced Cre recombination.

Figure S3: Tam‐induced ablation of Col8a2‐lineage cells leads to corneal edema and opacity. Col8a2 P2A‐CreERT2 ; Rosa26 floxed‐Stop‐DTA/WT mice were fed Tam‐containing chow (w/Tam, right panels) or control chow (w/o Tam, left panels) from postnatal day 21 (P21) to P42. Corneal endothelial flat mounts were analyzed by confocal microscopy following staining with DAPI (A, E), anti‐ZO‐1 (B, F), and phalloidin‐633 (C, G); merged images are shown in (D, H). Non–Tam‐treated mice exhibit a regular hexagonal endothelial cell morphology (A–D). In contrast, Tam‐induced DTA expression leads to marked endothelial cell loss, characterized by polymegathism and pleomorphism (E–H).

DVG-64-e70047-s001.docx (2.6MB, docx)

Data Availability Statement

Data generated in this study are available from the corresponding author upon reasonable request and subject to institutional approval. Animal models will be made available to the research community.


Articles from Genesis (New York, N.y. : 2000) are provided here courtesy of Wiley

RESOURCES