Multi-omics analysis reveals RBPJ-mediated regulation of EGF/ACTN2/MYPN/COL21A1 in fibroblast during oviduct functional remodeling of duck

Abstract

The recombinant signal binding protein for immunoglobulin kappa J region (RBPJ) is the central effector of the Notch signaling pathway, which is a highly conserved pathway that regulates developmental and differentiation processes impacting tissue development, morphology, and function. The duck oviduct undergoes dramatic morphological and functional remodeling as laying egg or not, wherein fibroblasts play critical roles in extracellular matrix (ECM) remodeling and tissue homeostasis. However, the regulatory role of RBPJ in duck oviduct fibroblasts remains poorly understood. This study investigated the effects of RBPJ on the proliferation and molecular networks of duck fibroblasts using a RBPJ-overexpression model combined with RNA-seq and LC-MS/MS-based proteomic analysis. A RBPJ-overexpressing fibroblast model was successfully established. Compared to the control group (C), RBPJ overexpression (OE) significantly increased cell proliferation at 24 h (P < 0.01), as verified by CCK-8 and EdU assays. RNA-seq identified 130 differentially expressed genes (DEGs; |log2(fold change) | ≥ 1, P < 0.05), with significant enrichment of the Cytoskeleton in muscle cells pathway. Proteomic analysis detected 569 differentially expressed proteins (DEPs; |Fold change| ≥1.5, P < 0.05), primarily enriched in ECM-receptor interaction. Integrated transcriptome-proteome analysis revealed 12 key molecules. Among which, EGF is well-documented regulators of cell proliferation; ACTN2 (Actinin alpha 2), MYPN (Myopalladin) and COL21A1 (Collagen type XXI alpha 6 chain) were significantly enriched in pathways including ECM–receptor interaction, Cytoskeleton in muscle cells, and Focal adhesion. Collectively, these results indicate that RBPJ promotes fibroblast proliferation and regulates structural modulating by EGF, ACTN2, MYPN and COL21A1 at both the transcriptional and protein levels. Tissue-level verification demonstrated that the mRNA and protein expression levels of RBPJ in the oviduct of laying ducks were significantly elevated compared to ceased laying ducks (P < 0.05). Furthermore, the expression patterns of the 12 key DEGs in tissues aligned with the findings from cell study. This study provides novel molecular insights into RBPJ-mediated regulation of oviduct fibroblast function, offering a better understanding of duck oviduct remodeling during the laying cycle.

Introduction

The recombinant signal binding protein for immunoglobulin kappa J region (RBPJ), also known as C promoter binding factor 1 (CBF1), is the critical transcription factor of Notch signalling pathway, which plays a central role in regulating cell proliferation, apoptosis, differentiation and organogenesis (Xing et al., 2024). Evidence from mammals indicates that RBPJ-mediated Notch signalling contributes to tissue repair and developmental processes, including skeletal and neural development (Tian and Ren, 2023), and participates in stromal cell differentiation within reproductive tissues, thereby influencing tissue remodeling and functional homeostasis (Huang, et al., 2025). These observations suggest that RBPJ functions as a context-dependent regulator of cell fate and tissue homeostasis.

Importantly, mechanistic studies in mammalian models have shown that the Notch–RBPJ axis can influence fibroblast activation and fibrotic programs by modulating transcriptional networks that crosstalk with transforming growth factor-β (TGF-β), mitogen-activated protein kinase (MAPK), and growth-factor signalling pathways. This regulation promotes fibroblast phenotypic conversion, extracellular matrix (ECM) deposition, and altered mechanical responsiveness in stromal compartments (Bakalenko, et al., 2024; Zhang, et al., 2024). Notably, while these mechanistic insights are well-established in mammals, the functional relevance of RBPJ in avian stromal cells, particularly those within the reproductive tract, remains largely unexplored.

Fibroblasts, as the predominant stromal cell type in most tissues, are pivotal for tissue architecture and function (Plikus, et al., 2021). They synthesise and remodel ECM, secrete cytokines and growth factors that regulate neighbouring epithelial and smooth muscle cells (Yoshitake, et al., 2022), and mediate repair responses following injury (Hsiao, et al., 2023). In avian species, the oviduct relies on coordinated stromal-epithelial crosstalk to sustain epithelial differentiation, secretory function, and smooth muscle contractility, all of which are prerequisites for normal egg formation and transport (Sun, et al., 2023). Given that fibroblasts are the major producers of ECM and regulatory cytokines in the stromal compartment, their proliferation, phenotypic switching, or matrix secretion capacity could directly impact oviductal homeostasis. Thus, the proliferation and matrix output of fibroblasts are likely important determinants of oviductal structural integrity and physiological performance during the laying cycle. However, most mechanistic studies on Notch/RBPJ in stromal biology has been conducted in mammalian systems, and there is a paucity of data regarding how RBPJ regulates the proliferation, phenotypic remodeling, and ECM metabolism of duck oviduct fibroblasts.

Based on the conserved roles of RBPJ in fibroblast regulation across mammalian tissue and the central importance of fibroblasts for oviduct physiology, we hypothesise that RBPJ regulates the biological function of duck oviduct fibroblasts, thereby may influence oviduct tissue properties. Therefore, the present study aimed to investigate the functional role of RBPJ in primary duck embryonic fibroblasts via RBPJ overexpression combined with multi-omics analysis, with the goal of elucidating the molecular mechanisms by which RBPJ shapes stromal matrix composition and mechanical programs relevant to oviduct physiology.

Materials and methods

Sample collection, cell isolation and culture

Twelve-day-old duck embryos (Jinyun Partridge Duck; obtained from Zhejiang Xinchang Agricultural Development Co., LTD) were collected for the isolation of primary fibroblasts. Tissues from the magnum of the oviduct of 500-day-old Jinyun Partridge ducks were collected for gene and protein expression analysis (obtained from Zhejiang Xinchang Agricultural Development Co., LTD). All animal experiments were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals approved by the Animal Ethics Committee of Zhejiang A&F University (Approval No.: ZAFUAC202581).

Leg muscle tissue was selected for fibroblast isolation as a well-established primary cell model. The same as oviduct fibroblasts, muscle fibroblasts at early embryo share the commonalities of stromal cells, providing a reference for reproduction-related research. Taking duck embryo leg muscle fibroblasts as an in vitro model, it is speculated that its molecular mechanism can be compared with that of oviduct fibroblasts. Leg muscle tissue was dissected from the embryos using sterile surgical scissors. The dissected tissue was rinsed three times with phosphate-buffered saline (PBS) to remove blood and debris, then minced into 1∼2 mm³ fragments.

The tissue fragments were resuspended in 0.25% (w/v) trypsin-EDTA (25200072, Gibco, USA) and digested at 37°C for 20 min. An equal volume of complete culture medium—Dulbecco's modified Eagle's medium (DMEM, Gibco, USA) supplemented with 5% fetal bovine serum (FBS, A5256701, Gibco, USA), 100 U/mL penicillin, and 100 μg/mL streptomycin (15140148, Gibco, USA) —was added to terminate digestion. After centrifuge (1000 rpm, 5 min), the supernatant was discarded.

The resulting cell pellet was resuspended in 2 mg/mL (w/v) collagenase IV (17104019, Gibco, USA) and digested at 37°C for 10 minutes, followed by the addition of complete culture medium to stop digestion. Subsequentially, the cell suspension was filtered through a 70 μm cell strainer to remove undigested tissue fragments. The filtrate was centrifuged at 1000 rpm for 5 min to collect the cell pellet, which was resuspended in complete culture medium and seeded into a 10 cm sterile culture dish.

The dish was incubated at 37°C in a humidified atmosphere of 5% CO₂ for 1 h. Then, the cell suspension was discarded. The adherent cells were supplement with complete culture medium, and continue to culture at 37°C and 5% CO₂. The medium was refreshed every 24 h, and passage 2 (P2) cells were used for all subsequent experiments.

Cell immunofluorescence identification

Fibroblasts (P2) were seeded in 12-well plates at a density of 5 × 10⁴ cells per well and cultured to ∼50% confluency at 37°C in a humidified atmosphere of 5% CO₂. Cells were fixed in 4% (w/v) paraformaldehyde (PFA, BL-G002, Sbjbio, China) for 30 min at room temperature, followed by three washes with 1 × phosphate-buffered saline (PBS) to remove residual PFA. Cells were then permeabilized with 0.1% (w/v) Triton X-100 (T109026, aladdin, China) for 15 min at RT and washed three times with 1 × PBS (5 min each).

To minimized non-specific binding, cells were blocked with BeyoFC™ FcR Blocking Solution (C1752S, Beyotime, China) for 15 minutes at RT. was After blocking, cells were incubated overnight at 4°Cwith the following primary antibodies diluted in Dilution Buffer: Vimentin (mouse monoclonal antibody, 1:100, 60330-1-Ig, Proteintech, China) or Decorin (mouse monoclonal antibody, 1:100, 66847-1-Ig, Proteintech, China).

After primary antibody incubation, cells were washed three times with 1 × Tris-buffered saline with Tween-20 (TBST) for 5 min each to remove unbound primary antibodies. Cells were then incubated with AF594-labeled Rabbit Anti-Mouse IgG (1:10000, K1031R-AF594, Solarbio, China) and Hochest 33342 (1:10000, B2261, Merck, Germany) for 1 h at RT in the dark.

Subsequently, cells were washed three times with 1 × TBST for 5 min each, and fluorescence images were acquired using a Nikon ECLIPSE Ts2R-FL fluorescence microscope (Nikon, Japan). Six random fields were captured per well, with 3 wells analyzed per group. Merged images and intensity quantification were performed using Image J software (Version 1.8.0).

Establishment of RBPJ-Overexpression fibroblast cells

The full length of the RBPJ coding sequence (NCBI Reference sequence: XM_072037727.1) was synthesized and cloned by PCR and subcloned into a commercially available pcDNA3.1+ vector, using the NheI and BamHI restriction sites. Fibroblasts (P2) were seeded into 6-well plates at a density of 2 × 10⁵ cells per well and cultured at 37°C in a humidified atmosphere of 5% CO₂ until reaching ∼70% confluence. Prior to transfection, the existing medium was aspirated, and each well was replaced with Opti-MEM (31985070, Gibco, USA) to optimize transfection efficiency. Cells were then transfected with either pcDNA3.1+ empty vector (C group) or pcDNA3.1-RBPJ overexpression plasmid (OE group) using Lipofectamine 3000 (Lipo3000) Transfection Reagent and P3000 Reagent (L3000008, Invitrogen, USA), strictly following the manufacturer’s instructions.

After transfection, cells were maintained at 37°C in a humidified atmosphere of 5% CO₂. Quantitative real-time PCR (qPCR) was performed at 24 h post-transfection to detect RBPJ mRNA expression levels, and Western blotting was conducted at 48 h post-transfection to verify RBPJ protein expression levels.

RNA extraction, reverse transcription, and qPCR

Total RNA was extracted from fibroblasts (OE and C) and oviduct tissue (laying and ceasing laying) using TRIzol® Reagent (15596026, Invitrogen, USA) according to the manufacturer’s instructions. cDNA synthesis was performed using the PrimeScript^TM FAST RT reagent Kit with gDNA Eraser (RR092A, Takara, China). Gene-specific primers for qPCR were designed using the Primer-BLAST tool (National Center for Biotechnology Information, NCBI), with Beta-actin (ACTB) as the internal reference gene to normalize target gene expression. Primer sequences are listed in Table 1. qPCR was performed on a QuantStudio^TM 3 Real-Time PCR System (applied biosystems, USA) using Universal SYBR ® Green qPCR Master Mix (HY-K0501A, MCE, USA). Each sample was analyzed in three biological replicates and three technical replicates. The relative mRNA expression levels were calculated using the 2^-ΔΔct method (Livak and Schmittgen, 2001).

Table 1.

Primer information.

Gene name	Primer Sequences	size
ACTB-F	AGCCATCTTTCTTGGGTATGGA	158 bp
ACTB-R	TTGTCACAAGGGTGTGGGTG
RBPJ-F	TAATCCAGTTTCAAGCCACTCC	165 bp
RBPJ-R	CTTGGACTGGTTGACGGACC
ACTN2-F	TGCCCGCAGCTCTATTGAAA	191 bp
ACTN2-R	ATCCAACACGGATGTGCTCC
GNG4-F	GCTGCAGCAGATTTATTGGCA	101 bp
GNG4-R	AGTTTCTTCTCCCTGAAGGGATTT
EGF-F	ACTGGGCTAGGCCATCACTA	136 bp
EGF-R	AGGCAAGGATTTGTCCCTGG
NOS2-F	ACAGCCCAAACATCCTGGAG	190 bp
NOS2-R	GGCCCTTGTCCATCTCTTGT
CADM3-F	CGTCGTGGCCAAATACAACC	174 bp
CADM3-R	TGGGTCAGGTAGGTACCTTTG
COL6A6-F	TGAATATGGCTTGAGGATCCACCT	189 bp
COL6A6-R	CAGTCGTCCCAGTAGGAGAG
FGF18-F	GTACCACAACTTCCAGCGGT	210 bp
FGF18-R	TCCTCGGCAACAAACATCTGTA
ND1-F	TCCTCCTTCTATCCTCCGGC	110 bp
ND1-R	GGCTAGTGTGAGGGGTAGGA
GNG4-F	GCTGCAGCAGATTTATTGGCA	101 bp
GNG4-R	AGTTTCTTCTCCCTGAAGGGATTT
NR4A3-F	TCGTCGGAAAGAGATATGCCC	253 bp
NR4A3-R	GGTAGAGGCAGGAAGGCTTG

Western blotting

Total proteins were extracted from fibroblasts (OE and C) and oviduct tissue (laying and ceasing laying). Cells were lysed on ice for 30 min with RIPA Lysis Buffer (P0013B, Beyotime, China) supplemented with PMSF (ST505, Beyotime, China), with occasional vortexing to ensure complete lysis. After lysis, cell lysates were centrifuged at 12,000 × g for 15 min at 4°C to remove cell debris, and the supernatant (total protein extract) was collected.

Protein concentration was determined using the BCA Protein Assay Kit (MA0082, Meilunbio, China) method following the manufacturer’s instructions, with bovine serum albumin (BSA) as the standard. Equal amounts of protein were mixed with 5 × SDS-PAGE Loading Buffer (20315ES05, YEASEN, China), boiled at 95°C for 5 min to denature proteins, then loaded onto 10% separating gels and 5% stacking gels. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed at 220 V for ∼45 min until the bromophenol blue dye front reached the bottom of the gel.

Proteins were electrotransferred to a 0.45 μm polyvinylidene difluoride (PVDF) membrane (IPVH00010, Millipore, USA) after activating the membrane with methanol for 10 s. Electrotransfer was conducted at 250 mA for 45 min on ice to prevent membrane overheating. After electrotransfer, the PVDF membrane was blocked with 5% (w/v) non-fat milk in 1 × TBST at room temperature (RT) for 1.5 h to block non-specific binding sites.

The membrane was then incubated overnight at 4°C with the following primary antibodies diluted in Primary Antibody Dilution Buffer (P0023A, Beyotime, China): RBPJ (mouse monoclonal antibody, 1:2000, 66132-1-Ig, Proteintech, China), glyceraldehyde-3-phosphate dehydrogenase (GAPDH, rabbit polyclonal antibody, 1:1000, 10494-1-AP, Proteintech, China) and β-tubulin (mouse monoclonal antibody,1:10000, 66240-1-Ig, Proteintech, China) (GAPDH and β-tubulin was used as the internal reference gene for normalization).

After primary antibody incubation, the membrane was washed three times with 1 × TBST for 10 min each. Subsequently, the membrane was incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (1:10000 dilution, SA00001-2, Proteintech, China) or HRP-conjugated goat anti-mouse IgG (1:10000 dilution, SA00001-1, Proteintech, China) at RT for 1 h, depending on the host species of the primary antibody. The membrane was then washed three times with 1 × TBST for 10 min each to remove unbound secondary antibodies.

Immunoreactive bands were detected using ECL Chemiluminescent Substrate (WBKLS0500, Millipore, USA) and visualized with a Tanon 4600 Imaging System (Tanon, China). Each group was analyzed in three biological replicates (n = 3). Band intensities were quantified using ImageJ software (Version 1.8.0), and the relative protein expression levels of RBPJ were normalized to GAPDH or β-tubulin.

Cell proliferation detection

EdU incorporation assay

Fibroblasts of OE and C groups were seeded into 12-well plates at a density of 5 × 10⁴ cells per well and cultured at 37°C in a humidified 5% CO₂ incubator until 24 h post-transfection. The EdU incorporation assay was conducted using the BeyoClick™ EdU-594 kit (C0078S, Beyotime, China) according to the manufacturer’s instructions. Briefly, cells were incubated with 10 μmol/L EdU reagent for 2 h at 37°C to label proliferating cells (DNA synthesis phase). Then, cells were fixed with 4% (w/v) PFA for 30 min at RT, followed by three washes with 1 × PBS. Cells were then permeabilized with 0.1% (v/v) Triton X-100 for 15 min at RT and washed three times with 1 × PBS. Subsequently, cells were incubated with the BeyoClick™ reaction mixture (containing azide-conjugated fluorescent dye) for 30 min at RT in the dark to detect EdU-incorporated DNA.

Cell nuclei were stained with Hoechst 33342 (1:10000 dilution, 14533, Merck, Germany) for 10 min at RT to visualize total cells. Fluorescence images were captured using a Nikon ECLIPSE Ts2R-FL fluorescence microscope (Nikon, Japan). Six random fields were imaged per well, with three wells analyzed per group (n = 3).

EdU-positive cells (proliferating cells) and total Hoechst 33342-stained cells were counted using ImageJ software (Version 1.8.0). The proliferation rate was calculated as:

Proliferation rate (%) = (Number of EdU-positive cells / Total number of Hoechst 33342-stained cells) × 100%

CCK-8 assay

Fibroblasts were seeded into 96-well plates at a density of 2 × 10³ cells per well (100 μL complete culture medium per well) to ensure logarithmic growth during the detection period. After overnight attachment, cells were transfected with either pcDNA3.1+ or pcDNA3.1-RBPJ plasmid.

Cell viability and proliferation kinetics were evaluated using the Enhanced Cell Counting Kit-8 (CCK-8, C0041, Beyotime, China) at 0 h, 12 h, 24 h, 36 h, 48 h, 60 h, and 72 h post-transfection. At each time point, 10 μL of CCK-8 reagent was added to each well, and the plate was incubated at 37°C in a humidified 5% CO₂ incubator for 3 h. A blank control well (100 μL complete medium + 10 μL CCK-8 reagent, no cells) was included to subtract background absorbance.

The absorbance at 450 nm was measured using a Microplate Reader (iMark™, Bio-Rad, USA). Each group was set with six technical replicates per time point (n = 6) to reduce experimental error.

RNA Sequencing analysis

Five biological replicates of each group were used for RNA-seq. Total RNA (A260/A280 = 1.8–2.0, RIN ≥ 8.0) was enriched for mRNA via oligo (dT) magnetic beads (61006, Thermo Fisher Scientific, USA), thermally fragmented (94°C, 8 min), and reverse-transcribed into cDNA. Double-stranded cDNA underwent end repair, A-tailing, and indexed adapter ligation, followed by 150–300 bp fragment selection with Hieff NGS® beads. Libraries were amplified by PCR, quality-checked (≥ 10 ng/μL, main peak 150–300 bp), and sequenced on an Illumina NovaSeq X Plus (PE150, ≥ 6 Gb/sample).

Raw reads were filtered using Fastp software (Version 0.23.2) to remove adapter sequences, low-quality reads (Q30 < 80%), and reads containing > 5% unknown bases (N). Clean reads were aligned to the duck reference genome (GCA_047663525.1; NCBI RefSeq) using HISAT2 software (v2.2.1) for genome mapping and annotation. Differentially expressed genes (DEGs) were identified with DESeq2 package (v1.38.3) under the criteria: |log₂ Fold Change| ≥ 1 and P < 0.05. Functional annotation and pathway enrichment analysis of DEGs were performed using the Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases, with statistical significance defined as P < 0.05.

DIA-quantitative proteomics analysis

Five biological replicates of OE and EV fibroblasts (P2) were subjected to DIA proteomics. Total protein was extracted with lysis buffer (8 M urea, 1 mM PMSF, and 2 mM EDTA), ultrasonicated (300 W, 3 s/5 s work/interval) on ice for 5 min, and centrifuged (15,000 × g, 4°C, 10 min) to collect supernatants. Protein concentration was determined by BCA assay. 100 μg protein (200 μL) was reduced with 5 mM DTT (37°C, 45 min), alkylated with 11 mM iodoacetamide (RT, 15 min, dark), then digested with trypsin (1:50 w/w, V5280, Promega, USA) at 37°C overnight. Peptides (pH 2–3 adjusted with 20% TFA) were desalted via C18 SPE columns, quantified with Pierce™ kit (26148, Thermo Fisher Scientific, USA), and analyzed by LC-MS/MS (Orbitrap Astral, Thermo Fisher Scientific, USA) with C18 column and gradient elution (5%–35% B, 60 min). Raw DIA proteomic data were processed with Spectronaut 15 software (Biognosys, Switzerland) for protein identification and quantification, using the duck reference proteome (GCA_047663525.1; NCBI RefSeq) as the database. Differentially expressed groups (DEPs) were screened with the criteria: |Fold Change| ≥ 1.5 and P-value < 0.05. Functional annotation and pathway enrichment analysis of DEPs were performed following the methods described in the RNA Sequencing section.

Statistical analysis

All raw data is processed using Excel 2021. Results were presented as mean ± S.E.M with at least three replications. Significance analysis between the two groups was preformed using TTEST (*P < 0.05, **P < 0.01, ***P < 0.001) by SPSS 26. Graphpad Prism 10.1.2 and Image J (Fiji Is Just) were used for making statistical charts.

Results

Cell immunofluorescence identification

As shown in Fig. 1A, immunofluorescence results demonstrated that the isolated primary duck fibroblasts displayed positive signals for the fibroblast markers Vimentin and Decorin. With Hoechst 33342 staining for cell nuclei, these data confirmed the fibroblast identity of the isolated cells.

Fig. 1.

Identification of duck embryo fibroblasts and the effects of RBPJ overexpression on proliferation. (A) Immunofluorescence identification of decorin and vimentin in duck embryo fibroblasts. Target proteins (red, Alexa Fluor 488), nuclei (blue, Hochest 33342). Scale bar =100 μm. (B) Relative expression level of RBPJ mRNA, plot with Control as 1. (C) GAPDH and RBPJ protein band diagrams. (D) Quantified relative protein bands, plot with Control as 1. (E) Cell viability curve after RBPJ overexpression. (F) Staining maps of Group C and OE. (G) Quantitative plot of the proportion of EdU positive cells in two groups. pCD3.1 is the plasmid of group C and pCD3.1-RBPJ is the plasmid of group OE of RBPJ (^⁎⁎P < 0.01; ^⁎⁎⁎P < 0.001; ^⁎⁎⁎⁎P < 0.0001).

The efficiency of RBPJ overexpression and its effect on cell proliferation

RBPJ overexpression of was confirmed by qPCR and Western Blotting. mRNA expression was upregulated by ∼38-fold (Fig. 1B, P < 0.01) and protein expression by ∼5-fold (Fig. 1C–D, P < 0.0001) compared to the C group.

CCK8 assay showed that the cell viability in the OE group at 12 h and 24 h post-transfection showed a significant increase (Fig. 1E, P < 0.001). At 72 h, there was a significant difference (P < 0.01) between the OE group and the C group, manifested as a decrease in the OE group. EdU incorporation assay reveled a significant increase in proliferation rate after 24 h (Fig. 1G, P < 0.01). Together, these data demonstrate that RBPJ overexpression promotes duck fibroblast proliferation.

RNA sequencing analysis

Principal component analysis (PCA) of RNA-Seq data revealed distinct, compact clustering between the OE and C groups, with low intra-group variability and clear inter-group separation (Fig. 2A). A total of 21,670 genes were detected (Table S1), and 130 DEGs were identified (Fig. 2B, Table S2), including 35 were upregulated and 95 were downregulated.

Fig. 2.

Information of the mRNA sequencing of duck embryo fibroblasts after RBPJ overexpression. (A) Principal Component Analysis of Samples. (B) Volcano plots of DEGs. (C) GO functional enrichment analysis of DEGs. Biological Process (BP), Molecular Function (MF) and Cellular Component (CC). (D) KEGG pathway analysis of DEGs.

GO enrichment analysis demonstrated significant enrichment of terms associated with cytoskeletal and muscle-related biological processes, covering Myosin filament, Myofibril, Contractile fiber, Myosin Ⅱ complex, Actin binding, Microfilament motor activity, and Muscle system process (Fig. 2C, Table S3). KEGG pathway enrichment analysis indicated significant enrichment in “Cytoskeleton in muscle cells”, “Cell adhesion molecules”, “Calcium signaling pathway”, and “Arginine biosynthesis”, with the Notch signaling pathway also enriched (Fig. 2D, Table S4). Notably, key genes in these pathways showed significantly differential expression: with “Cytoskeleton in muscle cells”, such as actinin alpha 2 (ACTN2), myopalladin (MYPN), myomesin 1 (MYOM1), myotilin (MYOT) and collagen type VI alpha 6 chain (COL6A6) were down regulated; in “Cell adhesion molecules”, cell adhesion molecule 3 (CADM3) was down regulated; in “Arginine biosynthesis”, nitric oxide synthase 2 (NOS2) was down regulated; and in “Calcium signaling pathway”, fibroblast Growth Factor 18 (FGF18) was up regulated while epidermal Growth Factor (EGF) was down regulated (Table S4). These results suggest that RBPJ overexpression primarily regulates genes involved in cytoskeleton organization, muscle function, cell adhesion, and calcium signaling in duck oviduct fibroblasts.

Proteome analysis

PCA of proteomic data revealed distinct, compact clustering between the OE and C groups, with minimal intra-group variability and clear inter-group separation (Fig. 3A). A total of 6,364 proteins were identified (Table S5), among which 569 DEPs (Fig. 3B, Table S6) were screened, including 104 upregulated and 465 downregulated.

Fig. 3.

Information of the proteome analysis of duck embryo fibroblasts after RBPJ overexpression. (A) Principal Component Analysis of Samples. (B) Volcano plots of DEPs. (C) GO functional enrichment analysis of DEPs. Biological Process (BP), Molecular Function (MF) and Cellular Component (CC). (D) KEGG pathway analysis of DEPs.

GO enrichment analysis identified the top 20 enriched terms (Fig. 3C, Table S7). For the Cellular Component (CC) category, “Cellular anatomical entity” contained the largest number of DEPs; in the Molecular Function (MF) category, “Binding” and “Catalytic activity” were the major enriched terms; and in the Biological Process (BP) category, “Cellular process” exhibited the highest number of enriched DEPs (Fig. 3C).

KEGG pathway enrichment analysis demonstrated that “N-Glycan biosynthesis” was the most significantly enriched pathway (Fig. 3D). Other significantly enriched pathways included “Protein processing in endoplasmic reticulum”, “ECM-receptor interaction”, “Calcium signaling pathway”, and “Cytoskeleton in muscle cells” (Table S8). These results indicate that RBPJ overexpression extensively regulates proteins involved in glycan biosynthesis, protein processing, ECM-receptor interaction, and calcium signaling in duck oviduct fibroblasts.

Integrated analysis of DEGs and DEPs

Fig. 4A presents a Venn diagram depicting the overlap of significantly differential molecules between DEGs (RNA-seq) and DEPs (proteomics), identifying 5 common differential molecules. Two of these have official gene symbols: RBPJ and Ring finger protein 213 (RNF213). A nine-quadrant plot further analyze the expression correlation of all detected genes and proteins (Fig. 4B), revealing 12 molecules with concurrent expression changes at both levels (9 with official gene symbols). Notably, 7 molecules exhibited concordant expression patterns (i.e., mRNA and protein both upregulated or downregulated): EGF, Collagen type XXI alpha 1 chain (COL21A1), MYPN, RBPJ etc. (Quadrants 3 and 7; blue and red). In contrast, 2 molecules showed discordant expression patterns (C1S [complement component 1] and ACTN2, Quadrants 1 and 9; yellow), with inconsistent mRNA and protein abundances.

Fig. 4.

Conjoint analysis of DEGs and DEPs. (A) Quantitative Venn diagrams of the transcriptome and proteome in two groups. (B) The nine-quadrant plot of gene–protein different expression. (C) KEGG pathway analysis based on the conjoint analysis of DEGs and DEPs.

KEGG pathway enrichment analysis of the overlapping DEGs/DEPs (Fig. 4C) showed that these molecules were primarily enriched in “Cytoskeleton in muscle cells” (including MYPN [concordant] and ACTN2 [discordant]), “Focal adhesion”, “MAPK signaling pathway”, “Gap junctions”, “FoxO signaling pathway”, “Notch signaling pathway”, and “ECM–receptor interaction”. Key molecules mediating these pathways included EGF, RBPJ and COL21A1. Detailed information is provided in Table S9.

Quantitative analysis of genes and proteins in oviduct tissue

We conducted a quantitative analysis of the mRNAs and proteins of RBPJ in oviduct. The results indicated that the expression levels of RBPJ mRNA and protein in the oviduct of cease laying ducks were significantly lower than those in laying ducks (P < 0.05, Fig. 5A–5C). Subsequently, we focused on the key genes in four signaling pathways identified from the transcriptome: "Cytoskeleton in muscle cells", "Cell adhesion molecules", "Calcium signaling pathway", and "Arginine biosynthesis." qRT-PCR was performed and the results demonstrated that the expression patterns of these 12 genes were consistent with the fibroblast transcriptome data, with COL6A6, FGF18, EGF, GNG4, ND1, CADM3, and NR4A3 exhibiting significant differences (P < 0.05, Fig. 5D).

Fig. 5.

Analysis of gene and protein expression in laying ducks and cease laying ducks. (A) β-tubulin and RBPJ protein band diagrams. (B) Quantified relative protein bands, plot with laying as 1. (C) Relative expression level of RBPJ mRNA, plot with laying as 1. (D) The qRT-PCR used β-actin for each sample as an endogenous control. Three independent biologicals and 3 technical replicates were employed. Data were presented as means ± SEM. *P < 0.05, ^⁎⁎P < 0.01, ^⁎⁎⁎P < 0.001 as indicated by TTEST.

Discussion

RBPJ, the principal effector of notch signaling pathway, have been widely implicated in the regulation of proliferation and maintenance of progenitor cell states across multiple systems (Zhou, et al., 2022). The morphological maintenance and functional integrity of the oviduct are significantly reliant on the supportive role of mesenchymal cells. As the primary cellular component of the lamina propria within the oviduct mucosa, mesenchymal cells not only provide physical support for epithelial cells but also create an appropriate microenvironment by secreting extracellular matrix components and paracrine factors. This activity plays a crucial role in the dynamic remodeling of the oviduct throughout the egg-laying cycle (Plikus, et al., 2021). However, the role of RBPJ in avian oviduct fibroblasts—particularly its regulation of stromal matrix remodeling and mechanical programs relevant to oviduct physiology—remains unexplored. Here, we combined RBPJ overexpression with multi-omics analysis to dissect its function in duck embryonic fibroblasts, filling this critical knowledge gap.

First, we successfully established a RBPJ-overexpressing duck fibroblast model, validated by immunofluorescence staining of fibroblast-specific markers (vimentin and decorin). In cytotaxonomy, fibroblasts represent the predominant type of mesenchymal cells, with their most distinctive molecular characteristic being the extensive expression of the intermediate filament protein vimentin. Vimentin serves as a specific marker for mesenchymal-derived cells and provides the structural foundation for fibroblasts to maintain mechanical tension, regulate signal transduction, and execute secretory functions (Ostrowska-Podhorodecka, et al., 2021). Given this biological context, the duck leg muscle fibroblasts selected for this study exhibit a high degree of homology with the fibroblasts of the oviducts regarding cell identity. Our immunofluorescence experiments demonstrated that leg muscle fibroblasts exhibited strong expression of Vimentin, along with the secretion of the matrix protein Decorin. This finding indicates that the cell model maintains the typical phenotype of fibroblasts. On the other hand, due to the inadequate development of the oviduct during the embryonic stage, it is hard to obtain fibroblasts sourced from the oviduct. Given that Vimentin-positive fibroblasts perform analogous matrix construction functions across various tissues, and considering RBPJ as a conserved effector of the Notch pathway, its regulatory mechanisms governing mesenchymal cell proliferation and homeostasis are applicable across different anatomical sites. Therefore, employing Vimentin-positive duck embryo leg muscle fibroblasts as an in vitro model can effectively replicate the biological performance of oviduct fibroblasts under RBPJ regulation, thereby providing a reliable foundation for elucidating the molecular mechanisms underlying oviduct function. Compared with the empty vector control, RBPJ mRNA expression in the OE group was upregulated by ∼38-folds and protein expression by 5-folds, confirming efficient overexpression. This proves that we have successfully established the RBPJ overexpression model, which provides a research basis for subsequent research.

To explore the functional consequences of RBPJ overexpression, CCK8 and EdU assays demonstrated significantly enhanced cell proliferation. This phenotype differs from RBPJ’s inhibitory role in tumor cell growth (Xie, et al., 2016), likely due to the distinct microenvironments of normal tissues versus tumors—fibroblasts require proliferation to support tissue development (Sun, et al., 2023). Consistent with this, RBPJ has been shown to regulate cell cycle-related genes (Xue, et al., 2015), a conjecture supported by our GO enrichment analysis linking RBPJ to cytoskeleton and cell proliferation pathways.

To dissect the underlying molecular mechanisms, multi-omics analyses were performed. Transcriptome GO enrichment identified top terms related to cytoskeleton organization and muscle-related components, such as myosin filaments and myofibrils. While the definitive conversion to a myofibroblast phenotype typically requires the classical marker α-SMA (Younesi, et al., 2021), the significant upregulation of structural genes such as ACTN2 and MYPN in our RBPJ-overexpression model suggests a notable shift toward a more contractile and structurally active state. This transition is consistent with the enhanced ECM remodeling programs observed in our data, including the upregulation of COL6A6 and COL21A1. Given that myofibroblast-like features are critical for tissue tension and ECM integrity (Hinz, 2010), we speculate that RBPJ may promote a specialized structural remodeling phenotype in duck oviduct fibroblasts. This adaptation likely supports the mechanical demands and structural plasticity required for oviductal function during the laying cycle. These data indicate that RBPJ acts as a modulator of fibroblasts behavior and matrix-related programs in our RBPJ overexpression model. KEGG pathway enrichment revealed significant enrichment in ECM-receptor interaction, Calcium signaling pathway, and Cytoskeleton in muscle cells. Such pathways known to regulate fibroblast activation, contractility, and myofibroblasts conversion (Rinne and Pluteanu, 2024). Notably, the Notch signaling pathway (canonical for RBPJ) was also enriched, indicating RBPJ may act through both canonical and non-canonical pathways.

Proteomic analysis confirmed substantial overlap with transcriptome-enriched pathways (e.g., ECM–receptor interaction, Calcium signaling pathway), supporting multi-level regulation of fibroblast structural and signaling networks by RBPJ. Meanwhile, proteome-level responses commonly diverge from transcriptome changes, as post-transcriptional regulation, translation efficiency, and protein turnover collectively shape steady-state protein abundance (Cambridge, et al., 2011)

Integrated DEG/DEP analysis identified key molecules with concordant (e.g., EGF, COL21A1, MYPN) or discordant (e.g., ACTN2, C1S) expression patterns. Growth factor EGF is well-documented regulator of cell proliferation (Zhou, et al., 2024). Research has demonstrated that treatment of lung cancer cells with epidermal growth factor receptor (EGFR) kinase inhibitors triggers an adaptive survival program. Notably, the expression of epidermal growth factor-like domain protein 7 (EGFL7) is upregulated in response to drug-induced stress, which subsequently activates NOTCH signaling (Wang, et al., 2022). This activation ultimately mitigates the reduction in c-Myc levels associated with EGFR inhibition, thereby enhancing the survival of cancer cells under drug stress. This suggesting they may act as upstream effectors of RBPJ in promoting cell proliferation. ECM components COL21A1 (concordant expression) is a member of the FACIT collagen family and serves to maintain ECM integrity, while cytoskeleton-related genes MYPN (concordant) and ACTN2 (discordant) regulate mechanosensing (Wang, et al., 2023), collectively supporting fibroblast phenotypic conversion. Such mRNA-protein discordance is common (Sidhaye, et al., 2023) and warrants further mechanistic investigation. Enrichment of ECM-receptor interaction, Muscle/cytoskeletal components, and Calcium signaling pathway, combined with gene-protein expression profiling, revealed that RBPJ overexpression not only regulates canonical proliferative processes but also modifies fibroblasts matrix composition and function. As previously documented, these alterations are known to influence tissue functionality in the reproductive tract (Zhou, et al., 2022; Zhu, et al., 2021).

To bridge the gap between our in vitro overexpression model and physiological conditions, we characterized the expression of RBPJ in vivo. Our data indicated that RBPJ expression is significantly higher in the oviducts of laying ducks both in mRNA and protein levels compared to ceased laying ducks, positively correlating with the organ's functional activity. Furthermore, the in vivo validation of downstream genes, such as COL6A6 and ACTN2, confirms that the RBPJ-regulated network identified in our cell model is biologically conserved in oviduct tissue. The rapid morphological transformation of the avian oviduct during the laying cycle represents a complex biological process that requires precise coordination of cell proliferation and structural reorganization. Our findings, which demonstrate that RBPJ regulates fibroblast activity and ECM components, including COL6A6 and COL21A1, align with recent single-cell transcriptomic evidence in ducks. This evidence identified a specialized cluster of ECM-producing fibroblasts as key drivers of oviductal structural integrity (Du et al., 2022). Furthermore, while previous bulk transcriptomic analyses of duck oviducts under varying physiological states have highlighted the enrichment of Focal Adhesion and ECM-receptor interaction pathways (Pu et al., 2022), the specific upstream regulators have remained elusive. Our study elucidates a novel mechanism by identifying RBPJ as a principal transcriptional regulator of these pathways. This finding is particularly pertinent to avian oviducts, which must endure significant mechanical expansion and contraction daily. Our joint analysis indicates that the expression of RBPJ-dependent structural proteins, such as ACTN2 and MYPN, may enhance the mechanical elasticity of the ECM, a physiological necessity proposed prior to the degradation and rejuvenation of the hen oviduct (Sah, et al., 2021). By integrating our molecular data with established avian frameworks, we demonstrate that RBPJ serves as an evolutionarily conserved regulator, aligning with the high metabolic intensity and structural demands of the duck breeding cycle.

While our conclusions are primarily derived from an overexpression model, we acknowledge the absence of complementary loss-of-function or rescue experiments as a limitation of this study. We have tried the RNAi-mediated knockdown of RBPJ, but the interference effect is very limited. Nevertheless, the in vivo characterization of RBPJ expression—showing its significant correlation with the laying status of duck oviducts—and the robust validation of downstream DEGs via qRT-PCR provide a strong physiological basis for our findings.

Conclusion

In conclusion, RBPJ overexpression promotes duck oviduct fibroblast proliferation and drives myofibroblast-like phenotypic conversion by regulating growth factors, ECM components, and cytoskeleton-related pathways (Fig. 6). Within these pathways, EGF, ACTN2, MYPN, and COL21A1 emerge as potential candidate genes. These findings provide novel insights into oviduct stromal remodeling and highlight RBPJ as a potential target for improving poultry reproductive performance.

Fig. 6.

Schematic of the RBPJ-centered regulatory landscape. RBPJ and NR4A3 act as core transcriptional regulators that integrate extracellular signals, including growth factors (EGF, FGF18), complement proteins (C1S, CFD), and ECM components (COL6A6, COL21A1). These signals are transduced via membrane receptors (PTGFRN, GNG4) and adhesion molecules (CADM3) to the nucleus. Downstream, RBPJ drives specific effector programs: (1) cytoskeletal reorganization and contractility via ACTN2 and MYPN; (2) energy metabolism and redox homeostasis via ND1, NOS2, RNF213, and CARNS1. This integrated network coordinates fibroblast proliferation and matrix remodeling during the physiological cycle of the duck oviduct.

Acknowledgements

This research was funded by the National Natural Science Foundation of China (32402739) and the National College Students Innovative Entrepreneurial Training Program (202410341011).

CRediT authorship contribution statement

Yuling Niu: Writing – review & editing, Writing – original draft, Formal analysis. Yujie Zhang: Validation, Investigation. Chunmei Fa: Software, Formal analysis. Xintong Qian: Investigation, Formal analysis. Zhijun Wang: Writing – review & editing, Supervision. Xiaolong Zhou: Writing – review & editing, Supervision. Hui Yu: Resources. Ayong Zhao: Supervision, Resources, Project administration. Xue Du: Writing – review & editing, Supervision, Resources, Funding acquisition, Conceptualization.

Disclosures

There is no conflict of interest associated with this manuscript.

Appendix. Supplementary materials

Table S1: Details of all genes between C and OE group.

Table S2: Details of all DEGs between C and OE group.

Table S3: Significantly enriched GO terms of DEGs.

Table S4: All enriched KEGG pathways of DEGs.

Table S5: Details of all proteins between C and OE group.

Table S6: Details of all DEPs between C and OE group.

Table S7: Significantly enriched GO terms of DEPs.

Table S8: All enriched KEGG pathways of DEPs.

Table S9: All enriched KEGG pathways of conjoint analysis.