The association of VDR gene polymorphisms with serum vitamin D levels and injury predisposition in elite athletes of Kazakhstan

Abstract

Purpose

This study aimed to investigate the association between VDR gene polymorphisms and serum vitamin D levels, as well as injury predisposition, in elite athletes from Kazakhstan.

Methods

We recruited 137 elite athletes from Kazakhstan across nine different sports. Serum vitamin D levels were measured by Access 25(OH)D Vitamin D Total assay. The VDR gene polymorphisms were identified using quantitative PCR (qPCR). The association between VDR gene polymorphisms and serum vitamin D levels, as well as injury predisposition, was assessed using statistical methods.

Results

Over 60% of the athletes had vitamin D insufficiency, and 30% were deficient. We found a statistically significant association between vitamin D status and ethnicity (χ² = 10.66, p < 0.01) and age (χ² = 7.40, p < 0.05). G/G genotype of VDR TaqI polymorphism showed a statistically significant association with vitamin D inadequacy in Asians (A/A-A/G vs. G/G, OR = 6.23, 95% CI 1.65–23.43, p < 0.01). The same G/G genotype of VDR TaqI polymorphism showed a statistically significant association with increased risk (A/A-AG vs G/G, OR = 5.56, 95% CI 1.41–21.91, p < 0.01) of injuries in athletes of Asian origin.

Conclusion

A high prevalence of insufficient 25-(OH)D levels was observed. Vitamin D insufficiency was associated with ethnicity and age. G/G genotype of VDR TaqI polymorphism is associated with vitamin D insufficiency and increased risk of injuries in athletes of an Asian cohort. These findings may be useful for the development of personalized targeted approaches for diagnostics, nutrition, and injury prevention strategies.

Introduction

Vitamin D is a fat-soluble vitamin that plays an essential role in bone health by regulating calcium and phosphorus metabolism (Reijven et al. 2020; Bikle et al. 2014). Vitamin D deficiency is a global health issue, and over a billion people are affected by it (Holick. 2008). The primary causes of vitamin D deficiency are season, diet, latitude, air pollution, use of sun protectors, skin color, urbanization, and genetics (Cashman et al. 2019; Arabi et al. 2010). The levels of vitamin D vary greatly seasonally, with a lower concentration during late winter and early spring, especially in the northern hemisphere (Shen et al. 2020; Bozkurt et al. 2014; Kull et al. 2009), and even in populations living in the subtropical and tropical regions of the world (Fontanive et al. 2020; Md Isa et al. 2022). According to the data, up to 80% of vitamin D is synthesized endogenously when the skin is exposed to ultraviolet (UV) B rays (Nikooyeh et al. 2021). Dietary intake accounts for up to one-fifth of vitamin D, as it is naturally found in a limited number of food sources. However, it is no less important. The natural intake of vitamin D through the diet is inadequate to fulfill the required amount of vitamin D. The likelihood of meeting the vitamin D requirements varies by country and dietary habits. For example, countries with traditional diets that include high seafood intake and direct access to the ocean, such as those in Scandinavia and Japan, may naturally have higher vitamin D levels (Granlund et al. 2015). Therefore, dietary supplementation is strongly recommended. The recommended intake set by the European Food Safety Authority (EFSA) for infants aged from 7 to 11 months is 10 µg/day (400 IU/day), and for children aged 1–17 years and adults, recommendations are set at 15 µg/day (600 IU/day) (Bresson et al. 2016).

Since vitamin D was identified in numerous cell types, research on it has grown at an accelerating pace. Many studies have reported an association between its deficiency and infectious diseases, cancers, cardiovascular diseases, hypertension, diabetes, metabolic syndrome, mood disorders, muscle weakness, and bone fractures (Cui et al. 2023; Ismailova et al. 2022; Bouillon et al. 2019).

The status of vitamin D in the body is typically determined by measuring the circulating concentration of total serum 25-hydroxyvitamin D (25-(OH)D). According to the Consensus Statement on vitamin D status for the general population, the designated thresholds of serum 25-(OH)D concentration are as follows: severe deficiency at 10 ng/mL, deficiency at 20 ng/mL, insufficiency at 20–30 ng/mL, and sufficiency at 30 ng/mL. Concentrations exceeding 250 nmol/L (> 100 ng/mL) are considered toxic (Holick et al. 2012). Currently, there is no threshold specifically designated for athletes; therefore, the threshold for vitamin D levels in athletes is based on a concentration of 30 ng/mL, which serves as an indicator separating sufficiency from insufficiency. According to these threshold parameters, numerous research studies have demonstrated that many athletes are vitamin D deficient (Bezuglov et al. 2019; Bikle et al. 2020; Farrokhyar et al. 2017; Grieshober et al. 2018; Koundourakis et al. 2016; Larson-Meyer et al. 2010). Since vitamin D is found in many body tissues (such as bone and muscles) and is involved in its regulatory and metabolic functions, athletes may require more vitamin D than non-athletes. This question has been the target of many research investigations in the last two decades (Angeline et al. 2013; Bezuglov et al. 2019; Farrokhyar et al. 2015, 2017; Grieshober et al. 2018; Koundourakis et al. 2016; Larson-Meyer et al. 2010).

Vitamin D is known to have a hormone-like mechanism of action. Metabolic pathway of vitamin D includes its endogenous production during skin exposure to UVB rays in sunlight by a photochemical process (Klein et al. 2004), binding to vitamin D-binding protein (VDPB) and transport to the tissues, and then entering the cells by mediation of its receptor (VDR) (Pop et al. 2022). The VDR is a nuclear hormone receptor that has a high degree of affinity to vitamin D, and this affinity is much stronger than it is binding to vitamin D-binding protein (VDBP), which carries one-time hydroxylated pre-vitamin D in the bloodstream (Holick 2007). When vitamin D enters the cell nucleus, it interacts with DNA and regulates the expression of almost a thousand genes (Voltan et al. 2023).

When VDR was found in almost every body tissue and its function as a transcriptional modulator was discovered, researchers worldwide started to study the genetics of the VDR gene. Human VDR gene spanned for 75 kb distance on chromosome 12 (12q13.11) and contains 11 exons, three of which are located in the 5’-untranslated region (UTR), and the eight additional exons encode the structural component of the VDR (Miyamoto et al. 1997). The first found and most extensively studied ones are Apal (rs7975232), BsmI (rs1544410), Taql (rs731236), and Fokl (rs10735810). First three polymorphisms are silent genetic variants located at the 3’-UTR and can affect the mRNA stability. The latter, FokI, is located on exon 2 and causes the start codon shift at the 5’-UTR of VDR, resulting in the production of a shortened protein (Uitterlinden et al 2004). However, currently, more than 900 allelic variants in the VDR locus have been reported (Usategui-Martín et al 2022). Many investigators have examined the potential role of VDR gene polymorphisms in various diseases, including hypertension, obesity, diabetes, cancer, infectious diseases, and others (Berretta et al. 2022; Voltan et al. 2023).

Every athlete and sports medicine specialist aim for high-performance levels and are concerned about potential injuries. The vital role of vitamin D in the body, its widespread insufficiency in the general population, and its extensive metabolic functions have drawn significant attention to vitamin D deficiency among athletes, making it a focal point for researchers in sports medicine and sports nutrition (Ghazzawi et al. 2023; Şenışık et al. 2021; Yague et al. 2020). Low levels of vitamin D increase the expression of parathyroid hormone (PTH), which compensates for the body’s demand for calcium through bone resorption, thereby increasing the risk of bone injuries such as stress fractures, which are common in athletes (Lappe et al. 2008). In muscle tissue, it is suggested that vitamin D regulates calcium transport to enhance muscle contractions (Ceglia et al. 2012). Like vitamin D status, the association between single-nucleotide polymorphisms (SNPs) of the VDR gene is extensively studied in athletes. Many research works investigated the association of VDR SNPs with injuries and performance in athletes (Baumert et al. 2016; Bouillon et al. 2019; Bulgay et al. 2023; Koundourakis et al. 2016; Larson-Meyer et al. 2010; Marques et al. 2024; Massida et al. 2015; Varley et al. 2018; Voltan et al. 2023).

While many studies have explored the association between vitamin D and injury risk in athletes (Angeline et al. 2013; Barsan et al. 2023; Bolland et al. 2018), no such study has been conducted on the athletes of Kazakhstan. Kazakhstan is located in the heart of Central Asia and has a unique genetic landscape influenced by ancestral lineages. Considering all the above information, the alarming rates of vitamin D deficiency worldwide, and the growing evidence of its role in athletic performance and susceptibility to injuries, our research aimed to investigate the association between VDR gene polymorphisms and serum vitamin D levels, as well as injury predisposition, in elite athletes from Kazakhstan.

Materials and methods

Study subjects

We recruited active athletes who were included in the main and reserve National Olympic Team of Kazakhstan in various sports. After explaining the study's aim and protocol, all subjects were given an informed consent form for review. We proceeded to interviews and blood sampling only after signing the informed consent.

The study excluded individuals who had taken supplements containing vitamin D or its combinations (including multivitamins) within the 6 months preceding recruitment to avoid influencing serum vitamin D levels. Since seasonal serum vitamin D levels can vary greatly, recruitment was conducted during the cold season, from November 2023 to February 2024. At this time of the season, the temperature in most parts of Kazakhstan's territory is cold, making it impossible to train outdoors; thus, athletes train mostly indoors.

Eligible participants filled out structured sociodemographic and clinical questionnaires during an in-person interview. Anthropometric measurements, including height, weight, and body mass index (BMI), were taken during an interview. The dietary intake data were taken from the dietary protocol of the National Olympic Committee of Kazakhstan for the year. Ancestral pedigree was obtained by a self-filled block in the questionnaire. Injury data and other medical information were taken from the medical records of the National Center for Sports Medicine and Rehabilitation (Almaty, Kazakhstan) and the Center for Sports Medicine and Rehabilitation “ProSport” (Astana, Kazakhstan). Both medical organizations are affiliated with the National Olympic Committee of Kazakhstan.

The study was conducted in accordance with the Declaration of Helsinki and approved by the Local Ethics Committee of the Private Institution “National Laboratory Astana” (Protocol N05-2022, November 21, 2022; Protocol N03-2024, October 2, 2024; Protocol N02-2024, May 20, 2024). All subjects signed a written informed consent form.

Blood sampling

Blood sampling was performed between 8:00 and 10:00 a.m. after 12 h of fasting in the “KDL OLYMP” laboratories. “KDL OLYMP” laboratories are one of the largest laboratory networks of Kazakhstan. Athletes were asked to skip morning training sessions to avoid deviations in biochemical indicators. Blood was drawn into a blood collection tube containing K₂EDTA for DNA isolation (BD, NJ, USA), and into a blood collection tube coated with micronized silica particles to accelerate clotting and containing a polymer gel for serum separation (BD, NJ, USA) for serum collection. The blood collection tubes were centrifuged for 10 min at 2000 rpm, and the serum was aliquoted into 500 µl per tube, was frozen at -20 °C for 24 h, and then stored at − 80 °C until used for analysis.

Biochemical analysis

All serum samples passed one freeze–thaw cycle before measuring the serum 25-(OH)D levels. Concentrations of serum 25-(OH)D were measured with Access 25(OH) Vitamin D Total Assay on Unicel Dxl 800 Access Immunoassay System (Beckman Coulter, Brea, CA, USA). Access 25(OH) Vitamin D Total assay (Beckman Coulter, Brea, CA, USA) is a solid phase Enzyme Linked Immunosorbent Assay performed on specific monoclonal antibodies-linked microtiter plates. The amount of substrate turnover is determined by measuring the absorbance, which is inversely proportional to the total 25-(OH)D concentration.

External and internal quality control procedures for analyzing 25-(OH)D levels

“KDL OLYMP” laboratories utilize Vitamin D Standardization Program (VDSP), which was established in 2010 by the National Institutes of Health Office of Dietary Supplements, Centers for Disease Control and Prevention (CDC), National Institute of Standards and Technology (NIST), and Ghent University (Ozcan et al., 2015). The traceability and harmonization of Access 25-(OH)D Vitamin D Total assay is performed according to the SRM 2972, and has total imprecision ≤ 10.0% CV at concentrations > 15.0 ng/mL (37.5 nmol/L), and standard deviation (SD) ≤ 1.5 ng/mL (3.8 nmol/L) at concentrations ≤ 15.0 ng/mL.

Unicel Dxl 800 Access Immunoassay System (Beckman Coulter, Brea, CA, USA) passes calibration using Access 25(OH) Vitamin D Total Calibrators (A98856, Beckman Coulter, Brea, CA, USA) every 24 h, and service procedures and maintenance according to the schedule or as needed. Since “KDL OLYMP” laboratories provide services to many medical organizations, their compliance with ICH GCP and GLP standards is strictly controlled by Ministry of Healthcare of the Republic of Kazakhstan.

DNA isolation

DNA was extracted from 250 μl of whole blood using the Illustra Blood Genomic Prep Spin Kit (Cytivia, USA), according to the manufacturer’s instructions for DNA purification from whole blood, and stored at − 20 °C. The assessment of quality and quantity of extracted gDNA was carried out by the spectrophotometric method using the NanoDrop 2000 UV spectrophotometer (ThermoFisher Scientific, Waltham, MA, USA) and fluorometric assay using Qubit BR Assay Kit (ThermoFisher Scientific, Waltham, MA, USA) on a Qubit v2.0 fluorometer. DNA integrity was tested on 1% agarose gel electrophoresis. DNA was stored at −20 °C in the Laboratory Biobank.

Genotyping

The VDR gene has many polymorphisms. In this study, due to financial constraints, we were limited in the number of SNPs we could choose. We have chosen the four most extensively researched gene polymorphisms: ApaI (rs7975232), BsmI (rs1544410), FokI (rs2228570), and TaqI (rs731236). Selected polymorphisms are located in the regulatory regions of the VDR gene and can affect its function and expression levels by controlling its mRNA stability (Table 1).

Table 1.

Selected polymorphisms of the VDR gene

Gene	Name	Reference number	Context sequence
VDR	FokI	rs2228570	GGAAGTGCTGGCCGCCATTGCCTCC[A/G] TCCCTGTAAGAACAGCAAGCAGGCC
	TaqI	rs731236	TGGACAGGCGGTCCTGGATGGCCTC[A/G] ATCAGCGCGGCGTCCTGCACCCCAG
	BsmI	rs1544410	GAGCAGAGCCTGAGTATTGGGAATG[T/C] GCAGGCCTGTCTGTGGCCCCAGGAA
	ApaI	rs7975232	AAGGCACAGGAGCTCTCAGCTGGGC[A/C] CCTCACTGCTCAATCCCACCACCCC

VDR vitamin D receptor

The gene polymorphisms were determined by real-time polymerase chain reaction (PCR) allelic discrimination assay using TaqMan™ probes (Applied Biosystems, Foster City, CA, USA) on 7900 HT Fast Real-Time PCR System following the manufacturer’s protocol. 10 uL reaction mixture consisted of 5 uL of 2 × TaqMan™ Genotyping master mix (Applied Biosystems, Foster City, CA, USA), 0.25 uL of 40 × (catalog number: 4351379, Applied Biosystems, Foster City, CA, USA), or 0.5 uL of 20 × (catalog number: 4331349, Applied Biosystems, Foster City, CA, USA) TaqMan™ Probe, and 10 ng of genomic DNA.

The genotype distribution was analyzed using SDS v2.4 software (Applied Biosystems, Foster City, CA, USA). Each genotyping was repeated three times to avoid mistakes during software distribution. Minor allele frequencies (MAF) of less than 0.05 were considered rare, and MAF under 0.01 was considered very rare.

Statistical analysis

Quantitative variables were expressed as a result (± standard deviation) with normal distribution. We applied the Hardy–Weinberg equilibrium test for all subjects for each comparison. 2 × 2 or 3 × 2 associations between vitamin D status and epidemiological indicators were analyzed using the Pearson χ2 test. Sample size and a post hoc power analysis were performed using an online calculator at https://clincalc.com (accessed on June 26, 2025). For the association between studied polymorphisms and the vitamin D status and injury predisposition was evaluated using multimodal (genotypic, dominant, recessive, and overdominant) logistic regression and assessed with the ORs and their corresponding 95% CIs. Logistic regression models for vitamin D status were adjusted for age, sex, BMI, and sports experience, and we added vitamin D level as covariate to injury predisposition model. Other potentially important covariates like training load and competition frequency were not included due to the diversity of sport types with varying training regimens and demands, which gives the heterogeneity in sport-specific routines and there is no standardized method for quantifying these variables across disciplines. Bonferroni correction was applied for association of SNPs between multiple comparisons. We defined the models as follows: genotypic (AA vs. Aa vs. aa), dominant (AA + Aa vs. aa), recessive (AA vs. Aa + aa), and overdominant (AA + aa vs. Aa), where the major and the minor alleles are A and a, respectively. All the tests were 2-sided, with a significance level of p < 0.05, and were estimated using SPSS 25 (IBM, Armonk, NY, USA) software.

Results

Study group

A hundred and forty-two active athletes who were included in the main and reserve National Olympic Team of Kazakhstan in various sports types were recruited between November 2023 and February 2024. The recruitment took place in the training camps Jaksy-2 (Borovoe, Northern Kazakhstan) and AIBA (Almaty region, South-East Kazakhstan). Due to the refusal to participate in the study, one athlete was excluded from the study group. Due to low serum quality, samples of three participants were excluded from serum 25-(OH)D level measurements. We were able to isolate DNA from these three samples, since we could draw blood samples into blood collection tubes containing K2EDTA. However, since statistical analysis included adjustment for vitamin D levels, these three samples were excluded from the study group. One sample showed a concentration of 25-(OH)D 153 ng/ml. The replication measurement showed the same indicator. His biochemical analysis results were sent to the team doctor, and it was confirmed that the athlete had vitamin D supplements due to a viral infection. This athlete was excluded from the analysis. The final study group for association analysis involving serum 25-(OH)D levels and injury predisposition consisted of 137 participants. Out of 137 samples, 109 were from Asians and 28 were from Caucasian individuals. The ancestral pedigree of participants was confirmed by a self-completed genealogical tree block in the questionnaire, which contains information for at least three grandfathers from both paternal and maternal sides. The filled data for Asians were checked in “Shezhire”, a historical database, representing the tribal organization of Kazakhs. At least three grandfathers and grandmothers of Asian participants lived in the territory of Kazakhstan. The ancestral pedigree of Caucasians could not be verified. However, ancestors of all Caucasian participants lived in the former Soviet Union territory for at least three generations, primarily in Northern Kazakhstan and the southern part of the Russian Federation. The study design is presented in Fig. 1.

Fig. 1.

Illustration of the study design

All athletes were at least candidates for the Master of Sports or the Master of Sports of International Class. Many of them are champions of the World, Europe and Asia. Recruited athletes represented the following sports types: boxing (32), taekwondo (15), freestyle wrestling (17), Greco-Roman wrestling (10), judo (23), weightlifting (17), and jiu-jitsu (1). Triathletes (10), and skaters (12) represented endurance sports. All athletes represent individual sports types.

During the active training periods (11 months per year), elite athletes are located in the training camps. According to the dietary and training recommendations of the Ministry of Tourism and Sports of the Republic of Kazakhstan, the diet of all elite athletes is standardized and includes the consumption of oily fish at least once a week to maintain a balanced diet. There were no deviations in the frequency of dietary intake of vitamin D-rich products.

Due to Kazakhstan's climatic conditions, outdoor training for indicated sport types lasts up to 1 h during the warm periods from May to October. The only exception is for triathlon athletes, who require longer outdoor training for cycling and running. The rest of the time, training takes place indoors, as the temperature drops to as low as −15 °C during fall and −40 °C during winter.

The mean age was 23.7 ± 4.3 years; 121 (86.4%) were males, and almost four-fifths were Asians (78.7%). The median height was 176 ± 9.3 cm, the mean weight was 79.7 ± 22.2 kg, and the average BMI was 25.5 ± 5.8 kg/m². The mean sporting experience was 12.5 ± 4.5 years, and over 60% of participants trained for over 10 years. We collected injury data from medical cards. Medical cards have data for moderate and severe injuries that require admission to the medical organization and sideline an athlete for more than a month. Team doctors handle minor injuries during training camps. Of 137 elite athletes, 49 (35%) had moderate or severe injuries that sidelined them for a month or more. According to the questionnaire and obtained injury history, lower limb injuries are the most prevalent among athletes, especially knee injuries. Demographic and epidemiological data of study participants are shown in Table 2.

Table 2.

Demographic and epidemiological data of study participants (n = 137)

Details	All (n = 137)
Age, mean ± SD, years	23.7 ± 4.3
Age, years, n (%)
< 24	79 (57.8)
≥ 24	58 (42.2)
Sex, n (%)  Male  Female	120 (87.6) 17 (12.4)
Nationality, n (%)  Asian  Caucasian	109 (79.6) 28 (20.4)
Weight, mean ± SD, kg	80.4 ± 22.2
Height, mean ± SD, cm	176 ± 9.3
BMI, mean ± SD, kg/m2	25.6 ± 5.8
BMI, underweight vs. normal vs. overweight/obese, n (%)
< 18.5	6 (4.3)
18.5 ≥  < 25	69 (50.4)
≥ 25	62 (45.3)
Sports experience, mean ± SD, years	12.5 ± 4.5
Sports experience, years, n (%)
< 10	53 (38.7)
≥ 10	84 (61.3)
Sport types
Boxing	32
Taekwondo	15
Freestyle Wrestling	17
Greco-Roman Wrestling	10
Judo	23
Brazilian Jiu-jitsu	1
Weightlifting	17
Triathlon	10
Speed Skating	12
Injuries
Yes	52 (38)
No	85 (62)

BMI body mass index, SD standard deviation

Vitamin D levels

Overall, 137 samples were sent to identify serum 25-(OH)D levels. The mean serum 25-(OH)D level of the study group was 26.8 ± 10.9 ng/ml. The distribution of vitamin D status by sports type is presented in Fig. 2. Male athletes in judo and Greco-Roman wrestling have a relatively lower median of 25-(OH)D in serum, while groups like triathlons and speed skating showed higher median levels.

Fig. 2.

The vitamin D status of study participants by sport types (n = 137). The threshold is presented by a red dot line and set for 30 ng/mL

Almost 30% of study participants had vitamin D deficiency, and participants with vitamin D insufficiency and sufficiency were evenly distributed (48 vs. 49, respectively). According to the biochemical results, only slightly over a third (35.8%) of study participants had sufficient serum 25-(OH)D levels. A post hoc power analysis for vitamin D deficiency/insufficiency vs. sufficiency with incidence 64.2% and 35.8%, respectively, showed 90.1% (0.91) of power, and deficiency vs. insufficiency/sufficiency with incidence 29.2% and 70.8%, respectively, showed 99.7% (0.99) of power and an alpha value of 0.05. A sample size analysis required 47 participants in each group. The vitamin D status of study participants is shown in Table 3.

Table 3.

The vitamin D status of study participants (n = 137)

Details	All (n = 137)	Asians (n = 109)	Caucasians (n = 28)
Serum 25-(OH)D, mean ± SD, ng/mL	26.8 ± 10.9	25.8 ± 12.7	33.5 ± 10.8
Serum 25-(OH)D, deficiency vs. insufficiency vs. sufficiency, ng/ml	n (%)	n (%)	n (%)
< 20	40 (29.2)	37 (33.9)	3 (10.7)
20 ≥  < 30	48 (35)	40 (36.7)	8 (28.6)
≥ 30	49 (35.8)	32 (29.4)	17 (60.7)
Serum 25-(OH)D, deficiency/insufficiency vs. sufficiency, ng/ml	n (%)	n (%)	n (%)
< 30	88 (64.2)	77 (70.6)	11 (39.3)
≥ 30	49 (35.8)	32 (29.4)	17 (60.7)
Serum 25-(OH)D, deficiency vs. insufficiency/sufficiency, ng/ml	n (%)	n (%)	n (%)
< 20	40 (29.2)	37 (33.9)	3 (10.7)
≥ 20	97 (70.8)	72 (66.1)	25 (90.3)

SD standard deviation

Association of vitamin D status with epidemiological data of study participants

We assessed the association of vitamin D deficiency, insufficiency, and sufficiency with epidemiological data, such as sex, ethnicity, age, injury status, and experience. Sex, injury status, and sports experience did not show a statistically significant association with vitamin D status in our study cohort of athletes. However, there was a statistically significant association between vitamin D status and ethnicity (χ² = 10.66, p < 0.01) and age (χ² = 7.40, p < 0.05) of study participants. Results indicate that ethnicity and age can affect the vitamin D status in our cohort. The association of vitamin D status with epidemiological data of study participants is presented in Table 4.

Table 4.

Association of vitamin D status with epidemiological data of study participants (n = 137)

Variables	Indicators	Serum 25-(OH)D levels, ng/ml			χ2	p value
		< 20 (n = 40)	20 ≥  < 30 (n = 48)	≥ 30 (n = 49)
		n (%)	n (%)	n (%)
Sex	Female	7 (41.2)	7 (41.2)	3 (17.6)	2.94	0.23
	Male	33 (28)	41 (34)	46 (38)
Ethnicity	Asian	37 (33.9)	40 (36.7)	32 (29.4)	10.66	< 0.01
	Caucasian	3 (10.7)	8 (28.6)	17 (60.7)
Age, years	< 24 ≥ 24	29 (72.5)	28 (58.3)	21 (44.9)	7.40	< 0.05
		11 (27.5)	20 (41.7)	27 (55.1)
Injuries	Yes	16 (40.0)	16 (31.2)	20 (40.8)	0.68	0.71
	No	24 (60.0)	32 (68.8)	29 (59.2)
Experience, years	< 10	21 (52.5)	18 (37.5)	16 (36.7)	3.37	0.19
	≥ 10	19 (47.5)	30 (62.5)	31 (63.3)

Bold values indicate the statistically significant associations

Furthermore, we examined the association between vitamin D deficiency, insufficiency, and sufficiency using epidemiological data in the following manner: deficiency/insufficiency versus sufficiency, and deficiency versus insufficiency/sufficiency. Epidemiological indicators, such as sex, injury status, and sports experience, did not show a statistically significant association with vitamin D status in the deficiency/insufficiency versus sufficiency model. Ethnicity (χ² = 9.53, p < 0.01) and age (χ² = 5.61, p = 0.02) demonstrated a statistically significant association in the study group. Similar results were obtained in the deficiency vs. insufficiency/sufficiency model. We found a statistically significant association of vitamin D status with ethnicity (χ² = 5.82, p = 0.02) and age (χ² = 5.1, p = 0.03). It means Asians under the age of 24 are more likely to have vitamin D inadequacy. The association between vitamin D deficiency and insufficiency/sufficiency, as well as deficiency/insufficiency and sufficiency, in relation to epidemiological data from study participants is shown in Table 5.

Table 5.

The association between vitamin D deficiency and insufficiency/sufficiency, and deficiency/insufficiency and sufficiency, as determined by epidemiological data from study participants (n = 137)

Variables	Indicators	Serum 25-(OH)D levels, ng/ml		χ2	p value	Serum 25-(OH)D levels, ng/ml		χ2	p value
		< 30 (n = 88)	≥ 30 (n = 49)			< 20 (n = 40)	≥ 20 (n = 97)
		n (%)	n (%)			n (%)	n (%)
Sex	Female	14 (15.9)	3 (17.6)	2.77	0.1	7 (41.2)	10 (10.3)	1.35	0.3
	Male	74 (84.1)	46 (38)			33 (28)	87 (89.7)
Ethnicity	Asian	77 (87.5)	32 (65.3)	9.53	< 0.01	37 (92.5)	72 (74.2)	5.82	0.02
	Caucasian	11 (12.5)	17 (34.7)			3 (7.5)	25 (25.8)
Age, years	< 24 ≥ 24	57 (64.8)	21 (44.9)	5.61	0.02	29 (72.5)	50 (51.6)	5.1	0.03
		31 (35.2)	27 (55.1)			11 (27.5)	47 (48.4)
Injuries	Yes	32 (36.4)	20 (40.8)	0.3	0.6	16 (40.0)	34 (35.1)	0.02	0.9
	No	56 (63.6)	29 (59.2)			24 (60.0)	63 (64.9)
Experience, years	< 10	37 (42.0)	16 (36.7)	0.82	0.4	21 (52.5)	34 (35.1)	3.59	0.058
	≥ 10	51 (58.0)	31 (63.3)			19 (47.5)	63 (64.9)

Bold values indicate the statistically significant associations

Genotyping samples for polymorphisms of the VDR gene

We successfully genotyped all 137 samples for all four polymorphisms. Each polymorphism's minor allele frequency (MAF) was over 5%, and their occurrence was considered normal. The observed genotype frequencies did not deviate from the expected frequency values according to the Hardy–Weinberg equilibrium test for each comparison (for total observation and groups separately). We observed some differences in the distribution of genotypes between Asians and Caucasians. There is a high possibility of genotype distribution phenomena, since all VDR polymorphisms are present in reverse proportions. However, due to the small sample size of Caucasians, it is unclear whether the distribution changes or remains the same for the larger Caucasian population of Kazakhstan. Further genetic association analysis were performed separately for Asians and Caucasians. Genotyping results on polymorphisms of selected genes are presented in Table 6.

Table 6.

Genotyping results on polymorphisms of selected genes (n = 137)

Gene	Polymorphism	Reference number	Genotype	Total (n = 137)	Asians (n = 109)	Caucasians (n = 28)
				n (%)	n (%)	n (%)
VDR	ApaI	rs7975232	C/C	40 (29.2)	37 (33.6)	3 (10.7)
			C/A	78 (56.9)	60 (55.5)	18 (64.3)
			A/A	19 (13.9)	12 (10.9)	7 (25.0)
	BsmI	rs1544410	G/G	73 (53.3)	66 (60.5)	7 (25.0)
			G/A	53 (38.7)	38 (34.9)	15 (53.6)
			A/A	11 (8.0)	5 (4.6)	6 (21.4)
	FokI	rs2228570	G/G	55 (40.1)	50 (45.9)	5 (17.9)
			A/G	59 (43.1)	44 (40.4)	15 (53.6)
			A/A	23 (16.8)	15 (13.7)	8 (28.6)
	TaqI	rs731236	A/A	65 (47.4)	55 (50.5)	10 (35.7)
			A/G	54 (39.4)	42 (38.5)	12 (42.9)
			G/G	18 (13.2)	12 (11.0)	6 (21.4)

VDR vitamin D receptor

Genetic association between polymorphisms of the VDR gene and vitamin D status

The genetic association between VDR gene polymorphisms and vitamin D status was evaluated through various analytical models: genotypic or codominant, dominant, recessive, and overdominant, with no adjustment and adjusted by sex, age, BMI, and sporting experience (years). None of the polymorphisms of the VDR gene showed a statistically significant association with vitamin D deficiency in both Asians and Caucasians (data not shown). None of the polymorphisms of the VDR gene showed a statistically significant association with vitamin D insufficiency in Caucasians in the unadjusted model. In the adjusted model, the C/C genotype of VDR ApaI showed statistical significance in the codominant model (A/A vs. A/C vs. C/C, OR = 3.55, 95% CI 0.02–637.09, p = 0.04) in Caucasians, but its significance exceeded the p value after correction (p_Bon = 0.01). FokI, ApaI, and BsmI did not show a statistically significant association with vitamin D insufficiency in Asians. G/G genotype of VDR TaqI polymorphism showed a statistically significant association with vitamin D deficiency/insufficiency in the Asians in codominant (A/A vs. A/G vs. G/G, OR = 6.46, 95% CI 1.67–24.97, p = 0.02) and recessive (A/A-A/G vs. G/G, OR = 6.08, 95% CI 1.68–22.01, p < 0.01) models. After adjustment, both codominant (A/A vs. A/G vs. G/G, OR = 6.05, 95% CI 1.49–24.62, p = 0.02) and recessive (A/A-A/G vs. G/G, OR = 6.23, 95% CI 1.65–23.43, p < 0.01) models remained statistically significant. However, after correction, only the recessive model was found to be significantly associated with vitamin D deficiency/insufficiency according to the Bonferroni correction analysis (p < 0.01). The G/G genotype of the VDR TaqI polymorphism may increase the risk of vitamin D inadequacy in Asians by nearly sixfold. The heterozygous A/G genotype of VDR TaqI polymorphism was significantly associated with a lower risk of vitamin D deficiency/insufficiency, showing a protective effect (A/A vs. A/G vs. G/G, OR = 0.94, 95% CI 0.36–2.48, p = 0.02). The genetic association of polymorphisms of the VDR gene with vitamin D deficiency/insufficiency vs. sufficiency in Asians and Caucasians is presented in Table 7.

Table 7.

Genetic association of polymorphisms of the VDR gene with vitamin D inadequacy in Asians (n = 109) and Caucasians (n = 28)

Polymorphisms	Model	Genotype	Serum 25-(OH)D, ng/ml		C-OR (95% CI)	p value	A-OR (95% CI)*	p value
			< 30	≥ 30
Asians (n = 109)			(n = 77)	(n = 32)
VDR FokI	CD	G/G	32 (41.6)	18 (56.2)	1.00	0.19	1.00	0.08
		A/G	32 (41.6)	12 (37.5)	0.67 (0.28–1.61)		0.59 (0.24–1.48)
		A/A	13 (16.9)	2 (6.2)	0.27 (0.06–1.35)		0.20 (0.04–1.01)
	Dom	G/G	32 (41.6)	18 (56.2)	1.00	0.16	1.00	0.08
		A/G-A/A	45 (58.4)	14 (43.8)	0.55 (0.24–1.27)		0.47 (0.20–1.12)
	Rec	G/G-A/G	64 (83.1)	30 (93.8)	1.00	0.12	1.00	0.05
		A/A	13 (16.9)	2 (6.2)	0.33 (0.07–1.55)		0.25 (0.05–1.22)
	OD	G/G-A/A	45 (58.4)	20 (62.5)	1.00	0.69	1.00	0.67
		A/G	32 (41.6)	12 (37.5)	0.84 (0.36–1.97)		0.83 (0.35–1.97)
VDR TaqI	CD	A/A	42 (54.5)	13 (40.6)	1.00	< 0.02	1.00	0.02
		A/G	31 (40.3)	11 (34.4)	1.15 (0.45–2.90)		0.94 (0.36–2.48)
		G/G	4 (5.2)	8 (25)	6.46 (1.67–24.97)		6.05 (1.49–24.62)
	DOM	A/A	42 (54.5)	13 (40.6)	1.00	0.18	1.00	0.38
		A/G-G/G	35 (45.5)	19 (59.4)	1.75 (0.76–4.05)		1.48 (0.61–3.55)
	Rec	A/A-A/G	73 (94.8)	24 (75)	1.00	< 0.01	1.00	< 0.01
		G/G	4 (5.2)	8 (25)	6.08 (1.68–22.01)		6.23 (1.65–23.43)
	OD	A/A-G/G	46 (59.7)	21 (65.6)	1.00	0.56	1.00	0.29
		A/G	31 (40.3)	11 (34.4)	0.78 (0.33–1.84)		0.62 (0.26–1.52)
VDR BsmI	CD	G/G	44 (57.1)	22 (68.8)	1.00	0.35	1.00	0.24
		G/A	30 (39)	8 (25)	0.53 (0.21–1.36)		0.46 (0.17–1.19)
		A/A	3 (3.9)	2 (6.2)	1.33 (0.21–8.57)		1.09 (0.16–7.30)
	DOM	G/G	44 (57.1)	22 (68.8)	1.00	0.25	1.00	0.14
		G/A-A/A	33 (42.9)	10 (31.2)	0.61 (0.25–1.45)		0.51 (0.21–1.26)
	Rec	G/G-G/A	74 (96.1)	30 (93.8)	1.00	0.6	1.00	0.71
		A/A	3 (3.9)	2 (6.2)	1.64 (0.26–10.34)		1.44 (0.22–9.42)
	OD	G/G-A/A	47 (61)	24 (75)	1.00	0.16	1.00	0.09
		G/A	30 (39)	8 (25)	0.52 (0.21–1.31)		0.45 (0.18–1.16)
VDR ApaI	CD	C/C	24 (31.2)	13 (40.6)	1.00	0.64	1.00	0.49
		A/C	44 (57.1)	16 (50)	0.67 (0.28–1.63)		0.60 (0.24–1.48)
		A/A	9 (11.7)	3 (9.4)	0.62 (0.14–2.68)		0.53 (0.12–2.43)
	DOM	C/C	24 (31.2)	13 (40.6)	1.00	0.35	1.00	0.24
		A/C-A/A	53 (68.8)	19 (59.4)	0.66 (0.28–1.56)		0.58 (0.24–1.42)
	Rec	C/C-A/C	68 (88.3)	29 (90.6)	1.00	0.72	1.00	0.66
		A/A	9 (11.7)	3 (9.4)	0.78 (0.20–3.10)		0.73 (0.18–3.00)
	OD	C/C-A/A	33 (42.9)	16 (50)	1.00	0.5	1.00	0.39
		A/C	44 (57.1)	16 (50)	0.75 (0.33–1.71)		0.69 (0.29–1.61)

Caucasians (n = 28)			(n = 11)	(n = 17)
VDR FokI	CD	A/A	4 (36.4)	4 (23.5)	1.00	0.89	1.00	0.87
		G/A	5 (45.5)	10 (58.8)	1.25 (0.16–9.77)		2.21 (0.11–44.20)
		G/G	2 (18.2)	3 (17.6)	0.75 (0.06–8.83)		1.62 (0.01–211.69)
	Dom	A/A	4 (36.4)	4 (23.5)	1.00	0.94	1.00	0.61
		G/A-G/G	7 (63.6)	13 (76.5)	1.08 (0.15–7.64)		2.13 (0.11–40.24)
	Rec	A/A-G/A	9 (81.8)	14 (82.3)	1.00	0.67	1.00	0.98
		G/G	2 (18.2)	3 (17.6)	0.64 (0.08–4.89)		0.95 (0.02–59.64)
	OD	A/A-G/G	6 (54.5)	7 (41.2)	1.00	0.68	1.00	0.63
		G/A	5 (45.5)	10 (58.8)	1.43 (0.26–7.74)		1.97 (0.12–32.11)
VDR TaqI	CD	A/A	4 (36.4)	6 (35.3)	1.00	0.6	1.00	0.07
		A/G	6 (54.5)	6 (35.3)	0.75 (0.11–4.90)		0.11 (0.00–6.64)
		G/G	1 (9.1)	5 (29.4)	2.50 (0.19–32.20)		8.56 (0.14–540.94)
	DOM	A/A	4 (36.4)	6 (35.3)	1.00	0.91	1.00	0.94
		A/G-G/G	7 (63.6)	11 (64.7)	1.10 (0.19–6.29)		0.90 (0.07–11.81)
	Rec	A/A-A/G	10 (90.9)	12 (70.6)	1.00	0.34	1.00	0.05
		G/G	1 (9.1)	5 (29.4)	2.92 (0.28–30.30)		24.11 (0.51-NA)
	OD	A/A-G/G	5 (45.5)	11 (64.7)	1.00	0.49	1.00	< 0.05
		A/G	6 (54.5)	6 (35.3)	0.55 (0.10–3.00)		0.04 (0.00–1.92)
VDR BsmI	CD	A/A	2 (18.2)	5 (29.4)	1.00	0.27	1.00	0.03
		A/G	8 (72.7)	7 (41.2)	0.23 (0.02–2.59)		0.00 (0.00–34.68)
		G/G	1 (9.1)	5 (29.4)	1.00 (0.05–20.83)		0.69 (0.00–151.00)
	DOM	A/A	2 (18.2)	5 (29.4)	1.00	0.34	1.00	0.37
		A/G-G/G	9 (81.8)	12 (70.6)	0.34 (0.03–3.56)		0.21 (0.00–8.70)
	Rec	A/A-A/G	10 (90.9)	12 (70.6)	1.00	0.34	1.00	0.05
		G/G	1 (9.1)	5 (29.4)	2.92 (0.28–30.30)		24.34 (0.50-NA)
	OD	A/A-G/G	3 (27.3)	10 (58.8)	1.00	0.11	1.00	< 0.01
		A/G	8 (72.7)	7 (41.2)	0.23 (0.04–1.51)		0.01 (0.00–2.88)
VDR ApaI	CD	A/A	2 (18.2)	5 (29.4)	1.00	0.62	1.00	0.04
		A/C	8 (72.7)	10 (58.8)	0.33 (0.03–3.58)		0.00 (0.00–4.46)
		C/C	1 (9.1)	2 (11.8)	0.40 (0.02–10.02)		3.55 (0.02–637.09)
	DOM	A/A	2 (18.2)	5 (29.4)	1.00	0.34	1.00	0.12
		A/C–C/C	9 (81.8)	12 (70.6)	0.34 (0.03–3.56)		0.08 (0.00–3.30)
	Rec	A/A-A/C	10 (90.9)	15 (88.2)	1.00	0.96	1.00	0.43
		C/C	1 (9.1)	2 (11.8)	0.93 (0.07–12.11)		5.06 (0.07–371.17)
	OD	A/A-C/C	3 (27.3)	7 (41.2)	1.00	0.42	1.00	0.02
		A/C	8 (72.7)	10 (58.8)	0.48 (0.07–3.09)		0.00 (0.00–2.67)

*Adjusted by sex, age, BMI, and experience in sports

A-OR adjusted odds ratio, C-OR crude odds ratio, CD codominant, Dom dominant, OD overdominant, Rec recessive, VDR vitamin D receptor. Bold values indicate the statistically significant associations

Genetic association of polymorphisms of the VDR gene with injury predisposition in recruited athletes

No polymorphisms of the VDR gene were found to have a statistically significant association with injuries in Caucasians (data not shown). FokI, BsmI, and ApaI polymorphisms of the VDR gene did not show any statistically significant association with injuries in Asians. VDR TaqI polymorphism showed a statistically significant association with injuries in Asians. In the codominant model, its homozygous G/G genotype was significantly associated with increased risk (G/G vs. A/G vs. AA, OR = 5.25, 95% CI 1.27–21.66, p < 0.03), and heterozygous A/G genotype was significantly associated with decreased risk (G/G vs. A/G vs. AA, OR = 0.88, 95% CI 0.38–2.04, p < 0.03) of injuries in athletes of Asian origin in unadjusted model. Significance level of both remained after adjustment by sex, age, BMI, experience in sports, and vitamin D levels (G/G vs. A/G vs. AA, OR = 4.54, 95% CI 1.03–20.0; OR = 0.71, 95% CI 0.29–1.75, p < 0.04), but exceeded Bonferroni correction analysis value (p < 0.01). Further analysis revealed a statistically significant association of VDR TaqI G/G genotype with an increased risk of injuries among Asian athletes in the recessive model (A/A-AG vs G/G, OR = 5.56, 95% CI 1.41–21.91, p < 0.01). According to the Bonferroni correction analysis, the recessive model remained significant. G/G genotype of VDR TaqI polymorphism might increase the injury susceptibility more than fivefold. The results of the genetic association of polymorphisms of the VDR gene with injury predisposition in recruited athletes of Asian origin are presented in Table 8.

Table 8.

Genetic association of polymorphisms of the VDR gene with injuries in Asians (n = 109)

Polymorphisms	Model	Genotype	Injuries		C-OR (95% CI)	p value	A-OR (95% CI)*	p value
			No	Yes
VDR FokI	CD	G/G	27 (40.9)	23 (53.5)	1.00	0.34	1.00	0.24
		A/G	28 (42.4)	16 (37.2)	0.67 (0.29–1.54)		0.57 (0.23–1.39)
		A/A	11 (16.7)	4 (9.3)	0.43 (0.12–1.52)		0.37 (0.10–1.43)
	Dom	G/G	27 (40.9)	23 (53.5)	1.00	0.2	1.00	0.12
		A/G-A/A	39 (59.1)	20 (46.5)	0.60 (0.28–1.31)		0.51 (0.22–1.19)
	Rec	G/G-A/G	55 (83.3)	39 (90.7)	1.00	0.26	1.00	0.26
		A/A	11 (16.7)	4 (9.3)	0.51 (0.15–1.73)		0.50 (0.14–1.76)
	OD	G/G-A/A	38 (57.6)	27 (62.8)	1.00	0.59	1.00	0.43
		A/G	28 (42.4)	16 (37.2)	0.80 (0.37–1.77)		0.71 (0.31–1.65)
VDR TaqI	CD	A/A	35 (53)	20 (46.5)	1.00	< 0.03	1.00	0.04
		A/G	28 (42.4)	14 (32.6)	0.88 (0.38–2.04)		0.71 (0.29–1.75)
		G/G	3 (4.5)	9 (20.9)	5.25 (1.27–21.66)		4.54 (1.03–20.00)
	DOM	A/A	35 (53)	20 (46.5)	1.00	0.51	1.00	0.85
		A/G-G/G	31 (47)	23 (53.5)	1.30 (0.60–2.80)		1.08 (0.48–2.45)
	Rec	A/A-A/G	63 (95.5)	34 (79.1)	1.00	< 0.01	1.00	< 0.01
		G/G	3 (4.5)	9 (20.9)	5.56 (1.41–21.91)		5.25 (1.25–22.00)
	OD	A/A-G/G	38 (57.6)	29 (67.4)	1.00	0.3	1.00	0.16
		A/G	28 (42.4)	14 (32.6)	0.66 (0.29–1.46)		0.55 (0.23–1.28)
VDR BsmI	CD	G/G	39 (59.1)	27 (62.8)	1.00	0.51	1.00	0.46
		G/A	25 (37.9)	13 (30.2)	0.75 (0.33–1.72)		0.66 (0.28–1.58)
		A/A	2 (3)	3 (7)	2.17 (0.34–13.85)		1.88 (0.28–12.63)
	DOM	G/G	39 (59.1)	27 (62.8)	1.00	0.7	1.00	0.51
		G/A-A/A	27 (40.9)	16 (37.2)	0.86 (0.39–1.88)		0.76 (0.33–1.73)
	Rec	G/G-G/A	64 (97)	40 (93)	1.00	0.34	1.00	0.41
		A/A	2 (3)	3 (7)	2.40 (0.38–15.00)		2.18 (0.33–14.30)
	OD	G/G-A/A	41 (62.1)	30 (69.8)	1.00	0.41	1.00	0.29
		G/A	25 (37.9)	13 (30.2)	0.71 (0.31–1.61)		0.63 (0.27–1.49)
VDR ApaI	CD	C/C	20 (30.3)	17 (39.5)	1.00	0.52	1.00	0.58
		A/C	38 (57.6)	20 (46.5)	0.62 (0.27–1.44)		0.62 (0.26–1.51)
		A/A	8 (12.1)	6 (13.9)	0.88 (0.26–3.05)		0.78 (0.22–2.79)
	DOM	C/C	20 (30.3)	17 (39.5)	1.00	0.32	1.00	0.32
		A/C-A/A	46 (69.7)	26 (60.5)	0.66 (0.30–1.49)		0.65 (0.28–1.51)
	Rec	C/C-A/C	58 (87.9)	37 (86)	1.00	0.78	1.00	0.98
		A/A	8 (12.1)	6 (13.9)	1.18 (0.38–3.66)		1.02 (0.31–3.31)
	OD	C/C-A/A	28 (42.4)	23 (53.5)	1.00	0.26	1.00	0.33
		A/C	38 (57.6)	20 (46.5)	0.64 (0.30–1.39)		0.67 (0.29–1.51)
		A/C	8 (72.7)	10 (58.8)	0.48 (0.07–3.09)		0.00 (0.00–2.67)

*Adjusted by sex, age, BMI, experience in sports, and vitamin D levels

A-OR adjusted odds ratio; C-OR crude odds ratio; CD codominant; Dom dominant; OD overdominant; Rec recessive; VDR vitamin D receptor. Bold values indicate the statistically significant associations

Discussion

Vitamin D is one of the most essential biomolecules in the human body. The prevalence of vitamin D deficiency is increasing worldwide, and it is approaching pandemic levels. Many research works have been reported for its deficiency in a global healthy population (Arabi et al. 2010; Bikle et al. 2014; Cashman et al. 2019; Holick 2008) and a wide range of diseases (Autier et al. 2014; Costenbader 2022; Pereira et al. 2020; Zhou et al. 2022).

Vitamin D deficiency is very high in Kazakhstan. One reason may lie in geographical peculiarities. Kazakhstan, the ninth largest country in the world by surface area, is located right in the heart of Eurasia between 40’ and 60’ latitude of the northern hemisphere, with almost 6 months of cold, limited sunlight periods, and has no direct connection to the sea. However, the Caspian Sea, which is the largest lake on Earth (since it is not directly connected to the ocean), has salty oceanic water and a variety of oceanic animals and fish species (Yerezhepov et al. 2024), including oily fish. Most seafood products are imported, and the majority of the population cannot afford to eat oily fish even once a week due to insufficient income. There is a low number of research works on vitamin D status in the Kazakhstani population. Gromova et al. reported a high prevalence of vitamin D deficiency among the healthy population of Kazakhstan (Gromova et al. 2020). In our previous tuberculosis case–control study, we found a high prevalence of vitamin D deficiency among a group of healthy controls recruited between May and October (Yerezhepov et al. 2024).

To achieve and maintain physical form and succeed as an athlete, they must undergo training loads for several hours several times a day, several days a week. Such loads are resource-intensive and require a significant amount of energy and nutritional sources regularly. Regarding the involvement of vitamin D in many processes, including bone health, muscle resistance, repair, and remodeling, athletes may require higher vitamin D levels than non-athletes (Ip et al. 2022). However, there is no explicit threshold designated for athletes, so sufficiency, insufficiency, and deficiency are identified in the same manner as for the general population (Yoon et al. 2021; Ip et al. 2022; Hacker et al. 2025). Our study is the first research done on vitamin D levels in elite athletes from Kazakhstan. In our study cohort, approximately 30% of athletes were vitamin D deficient, 35% had insufficient levels, and only 36% had sufficient levels. Many research studies have reported a high prevalence of vitamin D deficiency among athletes (Grieshober et al. 2018; Hamilton et al. 2014; Bezuglov et al. 2019; Yague et al. 2020; Hacker et al. 2025). Grieshober et al. demonstrated that over 30% of National Basketball Association players were vitamin D deficient, and approximately 40% had insufficient levels (Grieshober et al. 2018). Hamilton et al. reported that 84% of professional football players of different origins had vitamin D deficiency (Hamilton et al. 2014). Bezuglov et al. found that more than 40% of 131 young Russian male footballers had inadequate vitamin D levels (Bezuglov et al. 2019). Hacker et al. demonstrated that 55.5% of 474 German athletes had insufficient and 16% deficient serum 25-(OH)D levels (Hacker et al. 2025). Several factors, including latitude, air pollution, season, race or ethnicity, training environment, and age, influence serum vitamin D levels (Cashman et al. 2019; Arabi et al. 2010). In our study, triathletes had the highest median values of vitamin D concentrations (41.5 ng/ml in males and 33.95 ng/ml in females). This is possibly due to the specificity of the training program, as triathletes tend to train outdoors longer during the warm seasons than athletes of other sports types. Numerous studies have been performed on the effect of the training environment (outdoor vs. indoor) on total vitamin D concentrations. Some studies suggest that outdoor training affects vitamin D concentration in athletes, showing the highest mean vitamin D values compared to indoor training athletes (Constantini et al. 2010; Valtuena et al. 2014, 2021). A meta-analysis by Barsan et al. investigated the impact of indoor and outdoor training on vitamin D levels. The study observed a significant difference in vitamin D levels between individuals who trained indoors and those who trained outdoors. However, numerically, the difference is not statistically significant. Additionally, it is overshadowed by confounding factors, such as season and race (Barsan et al. 2023), with greater mean concentrations observed in autumn after a sunny summer and lower levels in spring after a wintertime (Constantini et al. 2010; Pfeifer et al. 2002). Nevertheless, our study cohort consists of only ten triathletes, and therefore, a higher number of participants is required to conclude the influence of outdoor and indoor training on total vitamin D concentrations in athletes. Also, we found a statistically significant association between vitamin D status and ethnicity (χ² = 10.66, p < 0.01). Inadequate levels of vitamin D were observed predominantly in Asians (70.6%). Out of 28 Caucasian athletes, 17 had vitamin D sufficiency, which constitutes over 60% of the Caucasian athletes in our study. These findings confirm the results of Mehran et al. In their study, the authors reported only 13% of insufficiency and 0% of deficiency of vitamin D levels in hockey players. However, 96.2% of participants in their study were Caucasians (Mehran et al. 2016).

Vitamin D deficiency can impact an athlete’s performance and predisposition to injury, as it plays a crucial role in bone health, muscle composition, and strength. Many research studies have reported an association between vitamin D deficiency, performance and injuries (Angeline et al. 2013; Grieshober et al. 2018; Koundourakis et al. 2016; Şenışık et al. 2021). Smith et al. (2014) reported the prevalence of vitamin D deficiency in athletes with foot or ankle injuries (Smith et al. 2014). Ammerman et al. found a correlation between low vitamin D levels in female athletes with lower extremity injuries (Ammerman et al. 2021). Millward et al. (2020) and Knechtle et al. (2021) reported that low vitamin D levels are associated with an increased rate of stress fractures in athletes (Millward et al. 2020; Knechtle et al. 2021). However, we did not find a statistically significant association between vitamin D status and the incidence of injuries (p > 0.05). The reason may lie in the type of injuries. Unfortunately, we were unable to obtain sufficient information for classifying injuries using the Orchard Sports Injury Classification System (OSICS). We obtained information on the presence of injury in the athlete's medical card and the length of recovery. This is the main limitation regarding injury information.

Maintaining a sufficient level of vitamin D is very important. Physicians recommend approximately 30 min of safe daily exposure to sunlight and the use of vitamin D-rich dietary sources (Owens et al. 2018). Natural dietary sources of vitamin D can increase endogenously synthesized vitamin D levels, such as oily sea fish and cod liver oil. However, they can contribute only up to 20% to vitamin D levels (Reijven et al. 2020). The pandemic rates of vitamin D deficiency show the need for additional sources of vitamin D. Such sources can be found in the form of supplements. Nowadays, an enormous number of supplements offer a wide range of components and concentrations in one pill. Our results demonstrate that participants in our study require vitamin D supplementation to raise their vitamin D levels to the level of sufficiency and maintain this level. Vitamin D supplementation showed beneficial effects in many studies for the general population (Bolland et al. 2018; Bouillon et al. 2019; Zhang et al. 2020) and athletes (Schwalfenberg 2007; Shuler et al. 2012; Jung et al. 2018; Williams et al. 2020; Żebrowska et al., 2020). Żebrowska et al. reported that 3 weeks of vitamin D supplementation had a positive effect on serum 25-(OH)D levels in endurance-trained runners, and it caused a marked decrease in post-exercise biomarker levels (Żebrowska et al. 2020). Williams et al. demonstrated a significant decrease in stress fracture rate (more than 6%) in high-risk collegiate athletes (Williams et al. 2020). A group of researchers reported that vitamin D supplementation reduces the symptoms of upper respiratory tract infection during winter training in taekwondo athletes (Jung et al. 2018). Shuler et al. reported a minimal concentration of 40 ng/mL for reducing stress fractures (Shuler et al. 2012). However, the intake of vitamin D supplements and serum vitamin D levels must be closely monitored by sports nutritionists and physicians, as concentrations exceeding 150 ng/mL can lead to intoxication (Ogan et al. 2013; Ip et al. 2022).

The production of vitamin D is genetically regulated and influenced. The vitamin D pathway is a complex network of interrelated genes that regulate circulating concentrations of vitamin D and its metabolites (Jolliffe et al. 2016; Orton et al. 2008; Hibler et al. 2010; Wist et al. 2007; Sepulveda-Villegas et al. 2020). Jolliffe et al. reported statistically significant associations of 55 SNPs in 11 vitamin D pathway genes with circulating levels of 25-(OH)D (Jolliffe et al. 2016). Orton et al. demonstrated the genetic contribution to 25-(OH)D concentrations in twins with multiple sclerosis (Orton et al. 2008). Hibler et al. investigated the association between polymorphic variation in VDR and RXRA and circulating levels of vitamin D metabolites. They found an association between genetic variation in RXRA and serum concentrations of 1,25-(OH)2D (Hibler et al. 2010). Wjst et al. found that only serum calcidiol level is a heritable trait in asthma families (Wjst et al. 2007). Sepulveda-Villegas et al. identified and analyzed 35 genes associated with vitamin D deficiency (Sepulveda-Villegas et al. 2020).

In our study, we selected the most extensively studied polymorphisms of the VDR gene: Apal (rs7975232), BsmI (rs1544410), Taql (rs731236), and FokI (rs10735810). All four polymorphisms are located in the regulatory regions of the VDR gene and can affect the stability of its mRNA, cause alternative splicing, or result in the production of a shortened version of mRNA (Annalora et al. 2019). The evidence that the VDR gene is one of the 12 genes directly involved in vitamin D metabolism supports our choice (Jolliffe et al. 2016; Krasniqi et al. 2021). A meta-analysis by Krasniqi et al. indicates that the association between VDR gene polymorphisms and serum vitamin D levels has been reported in several studies (Krasniqi et al. 2021). Gaffney-Stomberg et al. reported that BsmI (rs1544410) polymorphism of the VDR gene was associated with a higher circulating 25-(OH)D concentration (Gaffney-Stomberg et al. 2017). Sadat-Ali et al. found that SNP rs2228570 of the VDR gene was associated with vitamin D deficiency in Saudi Arabians (Sadat-Ali et al. 2016). Tanabe et al. reported a positive association of VDR FokI (rs2228570) polymorphism and serum 25-(OH)D levels in the Japanese population (Tanabe et al. 2015). Lazaro et al. (2025) found that individuals carrying the homozygous biallele GG compared to AA for SNP r2228570 in the VDR gene showed significant differences (p < 0.05) in circulating 25-(OH)D levels (Lazaro et al. 2025). AbdElneam et al. found that increased serum vitamin D levels are associated with the TaqI genotype in patients with mild-to-moderate psoriasis vulgaris (AbdElneam et al. 2022). In our study, we found a statistically significant association of VDR TaqI polymorphism with inadequate levels of vitamin D in Asians (A/A vs. A/G vs. G/G, OR = 6.05, 95% CI 1.49–24.62, p < 0.02, and A/A-A/G vs. G/G, OR = 6.23, 95% CI 1.65–23.43, p < 0.01). Carriers of the G/G VDR TaqI genotype of Asian origin have a sixfold higher risk of vitamin D insufficiency but not deficiency. TaqI polymorphism is located in the 3’-UTR of the VDR gene and can affect the binding patterns between 25-(OH)D and retinoid X receptor α (RXRα), all participants of the trimeric complex, responsible for the modulation of gene expression (Bollen et al. 2023).

“Injury” is the word that any athlete or trainer is terrified to hear. Injuries can range from minor to severe, and in some cases, even career-ending. Injuries can occur at any time, anywhere, and often in unexpected situations. Several factors contribute to the occurrence of injuries. Training load, duration, and frequency all affect muscle health. The training process can lead to temporary overtraining, which is necessary to increase an athlete’s muscle mass and its properties. This increase is achieved during the resting period, which is mandatory for appropriate recovery. If the resting period is not long enough for full recovery, an athlete may accumulate muscle fatigue, which can lead to overtraining syndrome and increase their susceptibility to injuries. Another risk factor is limited or imbalanced nutrition. The nutritional demands of the body that intensively trains regularly are tremendous, since most athletes engage in sports at a very young age, which itself has a faster metabolism and elevated nutritional requirements. Bone health, which depends on calcium and phosphorus metabolism, plays a major role in skeletal injuries (Angeline et al. 2013; Grieshober et al. 2018; Koundourakis et al. 2016; Knechtle et al. 2021; Millward et al. 2020; Şenışık et al. 2021). Alteration of any link in calcium and phosphorus metabolism can disrupt the chain. Vitamin D plays an essential role in both bone health and muscle function, since VDRs are found in almost every tissue type. The VDR gene has many variations or polymorphisms (Orton et al. 2008). These genetic variations in the VDR gene may be associated with muscle cell properties, as muscle cells and adipocytes respond to vitamin D (Janssen et al. 2002). Several studies have investigated the association between VDR gene polymorphisms and muscle mass development (Flore et al. 2024), bone tissue condition (Jówko et al. 2023), and injuries (Varley et al. 2018; Massidda et al. 2015; Cauci et al. 2017). In our study, we found a statistically significant association between VDR TaqI polymorphism and injuries in Asians. Homozygous G/G genotype of VDR TaqI polymorphism was significantly associated with increased risk (A/A-AG vs G/G, OR = 5.24, 95% CI 1.26–21.73, p < 0.05), and heterozygous A/G genotype was significantly associated with decreased risk (G/G vs. A/G vs. AA, OR = 0.76, 95% CI 0.31–1.82, p = 0.045). Varley et al. reported an association between VDR SNPs rs10735810 and rs731236 and stress fractures (Varley et al. 2018). Massidda et al. (2015) found that VDR ApaI polymorphism was associated with the severity of muscle injury in top-level football players (Massidda et al. 2015). Cauci et al. investigated the VDR FokI polymorphism in relation to lower back pain in athletes. They reported an association between VDR FokI and lower back pain in Italian athletes (Cauci et al. 2017). However, Marques et al. did not find a statistically significant association between genetic variations of the VDR gene and traumatic muscle injuries and muscle pain among Brazilian high-performance athletes (Marques et al. 2024). Considering the importance of vitamin D and its regulation, future studies with a larger cohort size and more genetic variations of other genes involved in the vitamin D pathway are needed to unravel the intricate mechanism of predisposition to injuries in athletes.

Limitations

This study has some limitations that need to be addressed. First, the sample size is relatively small, particularly for subgroup analyses by ethnicity and sport type. In Kazakhstan, with population little over 20 million people, the number of officially registered professional athletes engaged in Olympic sport disciplines is limited. Our study cohort represents a significant proportion of this elite group. Nonetheless, the modest sample size restricts statistical power for detecting small effect sizes and limits the generalizability of the findings to other athletic or general populations. Second, although self-reported ethnic background was collected via detailed questionnaires and partially validated using historical databases (only for Asian participants), genetic ancestry markers were not included. Therefore, potential population stratification remains a source of residual confounding, especially in the absence of adjustment for genetic structure. Third, blood samples were collected during the winter months (November–February) at one time point, and may not reflect year-round status. We acknowledged that the lack of longitudinal follow-up restricts interpretation. Fourth, dietary intake of vitamin D. Although all participants adhered to a standardized athlete diet, the absence of formal nutritional data prevents adjustment for dietary variability. Fifth, injuries were defined based on medical record documentation of moderate or severe cases that required medical attention. We were unable to capture data on minor musculoskeletal complaints, including their frequency and number, prior to moderate or severe injury, as they were often managed informally during training camps. We did not have enough data to accurately classify injuries according to the injury classification system, which limits the comparability of our findings with other cohorts.

Conclusions

Our study reveals a significant prevalence of vitamin D deficiency and insufficiency among elite athletes in Kazakhstan. Findings on vitamin D status and its association with age and ethnicity show that personalized targeted approaches must be addressed, especially in young Asian athletes, who are at a higher risk of vitamin D insufficiency. G/G genotype of VDR TaqI polymorphism can be used as a potential biomarker for vitamin D inadequacy and injury predisposition in athletes of Central Asian origin.

Abbreviations

25-(OH)D

25-Hydroxylated vitamin D

AIBA

Amateur International Boxing Association

BMI

Body mass index

DNA

Deoxyribonucleic acid

EDTA

Ethylenediaminetetraacetic acid

EFSA

European Food Safety Authority

gDNA

Genomic deoxyribonucleic acid

IU

International unit

MAF

Minor allele frequencies

PTH

Parathyroid hormone

qPCR

Quantitative PCR

SNP

Single-nucleotide polymorphism

SD

Standard deviation

UTR

Untranslated region

UV

Ultraviolet

VDBP

Vitamin D-binding protein

VDR

Vitamin D receptor

χ2

Pearson’s chi-square

Author contributions

AG, UK, SR, DY, and AA performed the conceptualization of the study. AG, DY, AY, KA, UK, SA, and AA: methodology and experiments. AG, SA, AY, KA, UK, SR, UK, DY, and AA curated the data and performed formal analysis. AG and DY wrote the original draft. AG, AY, UK, SR, YK, DY, and AA reviewed and edited the paper. DY acquired the research funding. All authors read and approved of the final manuscript.

Funding

This research has been funded by the Science Committee of the Ministry of Science and Higher Education of the Republic of Kazakhstan (Grant Nos. AP19680003, BR27199879, BR24993023, and BR24992841).

Data availability

The data presented in this study are available on request from the corresponding author. The data are not publicly available due to ethical and privacy restrictions indicated in informed consent.

Declarations

Conflict of interest

The authors declare no conflicts of interest.

Institutional review board

The study was conducted in accordance with the Declaration of Helsinki and approved by the Local Ethics Committee of the Private Institution “National Laboratory Astana” (Protocol N05-2022, November 21, 2022; Protocol N03-2024, October 2, 2024; Protocol N02-2024, May 20, 2024). All subjects signed a written informed consent form.

Informed consent

Informed consent was obtained from all subjects involved in the study.