ZnO@Carvacrol nanoparticles effectively suppress biofilm and quorum-sensing mechanisms in MDR Acinetobacter baumannii

Abstract

Background

Multidrug-resistant (MDR) Acinetobacter baumannii (A. baumannii) is a serious public health concern. This is mainly due to its strong biofilm formation and quorum-sensing (QS) systems, which contribute to increased antibiotic resistance. This study aimed to evaluate the inhibitory effects of zinc oxide-carvacrol nanoparticles (ZnO@Carvacrol NPs) on biofilm formation and QS gene expression in MDR A. baumannii isolates.

Methods

ZnO@Carvacrol NPs were synthesized using a green technique and characterized by Fourier-transform infrared spectroscopy, scanning electron microscopy, X-ray diffraction, and energy-dispersive X-ray spectroscopy. Clinical isolates of A. baumannii were identified and tested for antimicrobial susceptibility. Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of carvacrol and ZnO@Carvacrol NPs were determined. Biofilm formation ability was assessed using the crystal violet microtiter assay. Minimum biofilm inhibitory concentration (MBIC) and minimum biofilm eradication concentration (MBEC) were determined. The expression of biofilm- and QS–related genes, including bap, abaI, and abaR, in four clinical isolates and the ATCC BAA-747 was analyzed using qRT-PCR.

Results

The synthesized nanoparticles featured a ZnO wurtzite crystal core, surface functional groups associated with carvacrol, and a nanoscale agglomerated morphology (50–100 nm). ZnO@Carvacrol NPs showed a high carbon content, with signals for zinc and oxygen, thereby confirming the successful production and surface modification. ZnO@Carvacrol NPs, with MIC and MBC values of 1.6 mg/mL, demonstrated greater effectiveness in inhibiting A. baumannii than carvacrol alone (MIC = 3.2 mg/mL and MBC = 6.4 mg/mL). ZnO@Carvacrol NPs decreased biofilm biomass (MBIC = 0.2 mg/mL and MBEC = 0.4 mg/mL), whereas carvacrol showed MBIC and MBEC values of 0.8 and 1.6 mg/mL, respectively. Carvacrol reduced abaI expression by 50%, while ZnO@Carvacrol decreased it by approximately 70% (P < 0.01). abaR expression decreased by 40% with carvacrol and 70% with ZnO@Carvacrol NPs (P < 0.01). The bap gene showed a 60% reduction with carvacrol and an 80% reduction with ZnO@Carvacrol NPs (P < 0.001).

Conclusion

The anti-biofilm and anti-QS properties of ZnO@Carvacrol NPs against MDR A. baumannii showed promise. These findings suggest that ZnO@Carvacrol NPs have the potential to serve as an adjuvant in combating antibiotic resistance in A. baumannii.

Graphical Abstract

Introduction

One of the typical sources of hospital infections is the resistant and opportunistic bacterium Acinetobacter baumannii (A. baumannii) [1]. This Gram-negative bacterium can cause severe diseases, including pneumonia, sepsis, bacteremia, and surgical site infections, in patients with compromised immune systems [2]. A. baumannii’s significant resistance to antibiotics, particularly carbapenems, has led to its designation as a critical priority pathogen by the World Health Organization [3]. A. baumannii can be multidrug-resistant (MDR) due to several mechanisms, including the increased activity of efflux pumps, the development of antibiotic-hydrolyzing enzymes (such as carbapenemases and β-lactamases), biofilm formation, and the transfer of resistance genes from plasmids. These factors have made the treatment of infections caused by A. baumannii a significant challenge in the medical field, contributing to higher mortality rates in specific patient populations [3–6]. Since MDR A. baumannii is resistant to many antibiotics, identifying compounds with antibacterial activity against this pathogen appears essential. Furthermore, biofilm formation is one of the most critical factors in invasive bacteria’s ability to resist antibiotics and evade the host immune response [7, 8]. Consequently, the identification of compounds possessing both antimicrobial and anti-biofilm activities is of significant importance.

Bacterial biofilms are complex protective structures that contribute to bacterial antibiotic resistance and modulate the host’s immune response. The quorum-sensing (QS) system of A. baumannii influences both the formation and regulation of biofilm. The QS system comprises two key genes, abaI and abaR [9–11]. The abaI gene activates signaling molecules (autoinducers) when bacterial density increases, triggering a bacterial response. These molecules bind to the abaR receptors and act as transcriptional regulators, stimulating the expression of genes related to pathogenicity and biofilm formation [12–14]. The bap gene encodes the biofilm-associated protein involved in bacterial attachment to surfaces and the development of the extracellular matrix [11, 15]. In demanding hospital settings, including variations in iron concentration and antibiotic use, the dynamic interactions among the genes abaI, abaR, and bap contribute to an integrated regulatory network that enhances bacterial survival under certain conditions. Studies suggest that targeted suppression of these genes could reduce antibiotic resistance and promote biofilm disintegration [10, 12, 16–19]. These findings suggest that biofilm formation constitutes a critical mechanism for antibiotic resistance and the defense of pathogenic bacteria, including A. baumannii, against the immune system. Therefore, finding compounds that possess both antimicrobial properties and the ability to modulate biofilm formation could be more effective in combating this group of pathogenic bacteria.

Carvacrol is a phenolic compound with a monoterpenoid structure, primarily found in thyme and oregano. It has been examined regarding its capacity to eradicate bacteria and inhibit biofilm development [20]. Carvacrol has shown promising antibacterial activity against both Gram-positive and Gram-negative bacteria, as well as other pathogens, making it a candidate for further research as an alternative to conventional antibiotics [21–23]. Carvacrol in nanoparticles enhances stability, bioavailability, and controlled release, reducing solubility issues and disintegration. Encapsulation enhances antibacterial efficacy, accelerates biofilm inhibition, and enables targeted treatment for recurrent infections. Combining carvacrol with nanoparticle tech could be a promising strategy against antibiotic-resistant infections and for therapy [24–26]. A suitable nanoparticle for combination with carvacrol could be zinc oxide nanoparticles (ZnO NPs). These nanoparticles have garnered significant attention in recent years owing to their distinctive properties, including antibacterial activity, optical and electrical characteristics, and chemical stability. Research has demonstrated that loading compounds such as quercetin and rutin within ZnO NPs can exert antibacterial and anti-biofilm effects against pathogenic bacteria [27, 28]. Therefore, in the present study, we investigated the simultaneous use of carvacrol and ZnO NPs against MDR A. baumannii.

Previous studies have demonstrated that carvacrol and ZnO NPs can inhibit the proliferation of resistant bacteria and prevent biofilm formation by pathogenic microorganisms. However, the antimicrobial and biofilm-inhibitory efficacy of ZnO NPs functionalized with covercrol (ZnO@Carvacrol NPs) against MDR A. baumannii has not yet been explored. Furthermore, it is reasonable to anticipate that loading carvacrol onto ZnO nanoparticles may yield superior results compared to using either component independently. In this study, we conducted, for the first time, an assessment of the bactericidal and biofilm-inhibitory effects of ZnO@Carvacrol NPs on MDR A. baumannii. Additionally, we evaluated the impact of the synthesized nanoparticles on biofilm formation and degradation, as well as on gene expression changes associated with biofilm development. Specifically, the expression levels of the abaI, abaR, and bap genes in MDR A. baumannii in response to ZnO@Carvacrol NPs were analyzed. The results of this research may contribute to the development of combinatorial strategies to combat antibiotic resistance.

Materials and methods

MDR A. baumannii strains and maintenance

Four MDR A. baumannii clinical isolates (AB1-AB4) were obtained from Motahari Hospital in Gonbad-e Kavus, Iran. Species ID used phenotypic and biochemical methods, including Gram staining, catalase, and oxidase tests, characteristic of A. baumannii. Further biochemical testing of the ACB complex involved growth at 44 °C and citrate utilization [29, 30]. A. baumannii grows at 44 °C and is citrate-positive, unlike other ACB members like A. calcoaceticus. These tests align with clinical microbiology identification methods [31]. Isolate AB1 was conclusively identified at the species level by 16 S rRNA gene sequencing, confirming it as A. baumannii (NCBI accession number OR037510). The remaining clinical isolates (AB2, AB3, AB4) displayed a biochemical profile identical to the molecularly confirmed AB1 strain. Given their identical phenotypic profile and shared spatiotemporal origin with AB1, they were confidently assigned to the same species for this study. Antibiotic susceptibility testing was performed according to the CLSI standards (2025) at Motahari Hospital. For colistin, MIC was determined by broth dilution in Mueller-Hinton broth (MHB). The zone diameter breakpoints and MIC breakpoints for defining isolates as susceptible, intermediate, or resistant were based on the CLSI guidelines [32]. Obtained from the Iranian Biological Resource Center (IBRC) under catalog number 10,654, the reference strain A. baumannii ATCC BAA-747 was utilized as a control strain in all assessments. All strains were subcultured on Trypticase Soy Agar (TSA) for long-term preservation and storage. Subsequently, they were frozen at -80 °C with 25% glycerol.

Synthesis of ZnO@Carvacrol NPs

To carry out the coating of ZnO NPs, some ZnO NPs (CAS No: 1314-13-2, ZnO, 99%, 10–30 nm) that US Research Nanomaterials provided, and 0.5 g of d-glucose were kept in suspension in deionized water. Then, the mixture was sonicated for 30 min, followed by heating at 180 °C for 3 h. Then ZnO-Glu NPs were precipitated, collected, centrifuged (6000 RPM), washed, and dried at 60 °C for 5 h. Pure carvacrol (CAS No: W224502, > 98%) was purchased from Sigma. The conjugation of ZnO-Glu to carvacrol was carried out as follows: 1 g of ZnO-Glu and 0.1 g of carvacrol were mixed in deionized water, and the mixture was shaken for 24 h. Then, the ZnO@Carvacrol NPs were collected, washed, and freeze-dried. The chemical precipitation process was performed using the ZnO NPs. Zn was obtained as runoff from a 0.1 M zinc nitrate solution injected into the deionized water. To make carvacrol work as a stabilizing agent at a specific ratio, NaOH was used to regulate the system’s pH to 10–12. The process was carried out at 60–70 °C under continuous stirring. The precipitation was filtered, dried at 80 °C, and subsequently used as the final sample [33–35].

Characterization tests of NPs

X-ray diffraction (XRD) was performed over an angular range of 10–80 degrees at a scan rate of 0.02 degrees per second to examine the crystalline structure of the ZnO@Carvacrol NPs. The Scherrer equation is used to determine the crystallite size; the analysis was carried out at a current of 30 mA and a voltage of 30 kV. Recordings of Fourier Transform Infrared Spectroscopy (FTIR) in the 400–4000 cm ¹ range helped identify functional groups and investigate the interaction between ZnO NPs and carvacrol. For the FTIR test, samples were mixed with potassium bromide (KBr) and placed under vacuum to remove air. Zeta potential measurements on ZnO@Carvacrol NPs suspension were done at its natural pH post-synthesis. The stability of these NPs was assessed in water at their natural pH medium. The ZnO@Carvacrol NPs were dispersed in 50% glycerol, sonicated, transferred to a zeta potential cell, and measured at 3.4 V. Zeta potential measurements were performed to assess the colloidal stability of the nanoparticle suspension, which helps evaluate its dispersion in biological environments. Scanning electron microscopy (SEM) images enable the investigation of the size and shape of ZnO@Carvacrol NPs. The particle size distribution was examined using software. Energy-dispersive X-ray spectroscopy (EDS) was also employed to analyze the elemental composition of ZnO@Carvacrol NPs, confirming the presence of Zn and O and calculating their weight and atomic percentages [36].

Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) assay

The minimum inhibitory concentration (MIC) was determined by standard broth microdilution (following CLSI M07 guidelines). We prepared a 0.5 McFarland suspension of each strain (≈ 1–2 × 10^⁸ CFU/mL) and diluted it ~ 1:200 in TSB to achieve a final inoculum of ~ 5 × 10^⁶ CFU/mL per well. Then 100 µL of this inoculum was added to each well of a 96‑well plate containing 100 µL of serially diluted carvacrol or ZnO@Carvacrol NPs (range 6.4 − 0.05 mg/mL). Sterile TSB (200 µL) served as a negative control, and TSB with inoculum alone (no agent) was the growth control. Plates were incubated at 37 °C for 24 h. Growth was assessed by measuring OD at 600 nm. Each agent concentration was tested in triplicate to ensure reproducibility, and the MIC was defined as the lowest concentration at which no visible growth was observed. The bacterial growth inhibition percentage in the MIC tests was determined by measuring the reduction in optical density between the growth control (C) and test wells (T), as described in Eq. 1.

1

To determine the minimum bactericidal concentration (MBC), aliquots from wells showing the MIC were subcultured at 2- and 4-fold concentrations above the MIC. Each sample was then diluted 1:10 in TSB, and 10 µL of each diluted sample (in triplicate) was plated onto drug-free agar. The plates were incubated at 37 °C for 24 h, after which colonies were enumerated. The CFU/mL was calculated by dividing the number of colonies by the dilution factor multiplied by the volume plated. The MBC was defined as the lowest concentration that reduced the initial inoculum by ≥ 99.9% [37].

Minimum biofilm inhibitory concentration (MBIC) and minimum biofilm eradication concentration (MBEC) assay

The MBIC and MBEC assays were performed using TSBSY medium (TSB supplemented with 1% sucrose and 0.5% yeast extract) for biofilm formation and challenge, ensuring consistency across all assays. The MBIC, defined as the lowest concentration that prevents biofilm formation, was determined as follows. Two-fold serial dilutions of Carvacrol and ZnO@Carvacrol NPs (ranging from 6.4 to 0.05 mg/mL) were prepared in TSBSY medium. The wells were then inoculated with A. baumannii strains adjusted to a 0.5 McFarland standard. The plates were incubated statically for 48 h at 37 °C to allow biofilm formation in the presence of the compounds. Following incubation, the planktonic cells were removed by gently washing the wells with phosphate-buffered saline. The adherent biofilms were stained with 0.1% crystal violet for 15 min. The dye was removed by inverting the plates again and rinsing with saline. Bound dye in the biomass was extracted with 200 µL of 96% v/v ethanol. Finally, the OD of the released crystal violet was measured using an ELISA reader at 570 nm [21–23].

The MBEC, defined as the lowest concentration that eradicates a pre-established biofilm, was determined using a separate protocol. Biofilms were pre-formed by inoculating wells with the bacterial suspension in TSBSY medium and incubating them statically for 48 h at 37 °C. After this formation period, the spent medium containing non-adherent cells was carefully aspirated. The mature biofilms were then challenged by adding fresh TSBSY medium containing two-fold serial dilutions of the carvacrol and ZnO@Carvacrol NPs (range 6.4 − 0.05 mg/mL). The plates were incubated for a further 24 h at 37 °C. Residual viable biofilms were quantified using the crystal violet staining and destaining protocol described for the MBIC assay [32]. For both assays, including MBIC and MBEC, each plate included a positive control (biofilm grown in TSBSY medium without any antimicrobial agent) and a negative control (sterile TSBSY medium only). The MBIC and MBEC values were defined as the lowest concentrations of the compound that resulted in ≥ 90% reduction in OD at 570 nm compared to the untreated positive control.

RNA extraction, cDNA synthesis, and RT-qPCR

Standard and clinical strains of A. baumannii were divided into treatment and control groups. The treatment groups were exposed to ZnO@Carvacrol NPs (0.05 mg/mL) and carvacrol alone (0.1 mg/mL), while the control group received no treatment. The concentrations mentioned were chosen because, based on MIC results, this subinhibitory level can inhibit the QS system and virulence pathways without affecting bacterial growth. These concentrations ensure that any changes in candidate gene expression are due to signaling effects and not bacteriostatic or bactericidal effects. Each strain was cultured by inoculating 1% (v/v) of an overnight culture into 5 mL TSB medium in a Falcon tube. Cultures were incubated at 37 °C with shaking (200 rpm) for 6 h to generate sufficient planktonic biomass. Cells were then harvested by centrifugation. The bacterial pellet was resuspended in 200 µL of 10 mM Tris-HCl (pH 8.0) and treated with 25 µL of lysozyme (50 mg/mL). Total RNA was extracted using TRIzol reagent (Genius Gene, Iran) following the manufacturer’s protocol. RNA was extracted in triplicate for each strain to ensure consistency, and the quality was assessed using a NanoDrop spectrophotometer (A260/280 and A260/230 ratios). Samples were treated with DNase I (SinaColon, Iran) to remove any genomic DNA. cDNA was synthesized using a reverse transcription kit (Verner, Iran); each reaction contained dNTPs, random hexamer primers, and reverse transcriptase, as per the kit instructions.

Primers for target genes and the reference gene are listed in Table 1. Primer efficiencies were determined using standard dilution curves and ranged from 95% to 105%. RT-qPCR was performed on a Rotor-Gene Q real-time PCR cycler (Qiagen) using a SYBR Green master mix (Verner, Iran). Each 20 µL reaction contained ~ 100 ng of cDNA and 0.3 µM of each primer. Cycling conditions were 95 °C for 5 min, then 40 cycles of 95 °C for 10 s, 55 °C for 30 s, and 72 °C for 30 s. A melting curve from 65 °C to 95 °C (0.5 °C increments) was included to verify amplicon specificity. No-template controls and no-RT controls were included for every primer pair and showed no amplification. The housekeeping gene rpoB was used as the internal reference. Relative expression levels were calculated using the 2^-ΔΔCt method. The expression of each gene in each sample was measured in triplicate, and the average Ct across the three replicates was used for analysis.

Table 1.

List of primers used in this study

Gene Name	Forward (5’ to 3’)	Reverse (5’ to 3’)	Tm	Product length (bp)
rpoB	GAGTCTAATGGCGGTGGTTC	ATTGCTTCATCTGCTGGTTG	55 °C	110
abaI	TGTGCCAGACTACTACCCAC	TGCTAGAGGAAGGCGGATTT	55 °C	151
abaR	TTGGTCGAGTCAATCTGCAA	CTCGGGTCCCAATAAAATCA	55 °C	116
bap	ACTGGACCGATGAGAGTGGA	TTGCCCACTTATCACGCCAT	55 °C	188

Statistical analysis

Each experiment was performed in triplicate, and the results are presented as mean ± standard deviation (SD). One-way analysis of variance (ANOVA) was used to assess differences in gene expression between groups. Subsequent comparisons were performed using the Bonferroni method to identify which groups differed significantly. The data were assumed to be normally distributed and to have equal variances; a parametric test was used. A significance level of p < 0.05 was considered statistically significant. All statistical analyses were performed using GraphPad Prism (version 8.4), and exact p values ​​or ranges are reported where appropriate.

Results

The clinical isolates of A. baumannii exhibited broad-spectrum resistance to common antibiotics

The clinical A. baumannii strains showed resistance to several common antibiotics, namely piperacillin (PIP, ≤ 17 mm inhibition zone), ceftazidime (CAZ, ≤ 14 mm), cefepime (FEP, ≤ 14 mm), cefotaxime (CTX, ≤ 14 mm), ceftriaxone (CRO, ≤ 13 mm), imipenem (IPM, ≤ 18 mm), meropenem (MEM, ≤ 14 mm), gentamicin (GM, ≤ 12 mm), amikacin (AN, ≤ 14 mm), ciprofloxacin (CIP, ≤ 15 mm), levofloxacin (LVX, ≤ 13 mm), and trimethoprim-sulfamethoxazole (SXT, ≤ 10 mm). In contrast, all isolates were susceptible to colistin, with MICs ≤ 1 µg/mL determined by broth microdilution according to the CLSI guidelines (Table 2). Species-level identification of all isolates was performed using a combination of phenotypic and molecular methods. All clinical isolates (AB1-AB4) and the reference strain were subjected to standard biochemical testing. All isolates were Gram-negative coccobacilli, catalase-positive, oxidase-negative, and Simmons citrate-positive. Furthermore, all isolates grew at 44 °C, a key characteristic supporting their placement within the A. baumannii species. Therefore, the isolates were identified as extensively drug-resistant (XDR) since they showed resistance against carbapenems (imipenem, meropenem), cephalosporins (ceftazidime, cefepime, cefotaxime, ceftriaxone), fluoroquinolones (ciprofloxacin, levofloxacin), and aminoglycosides (amikacin, gentamicin), while maintaining susceptibility only to colistin [38]. In general, XDR A. baumannii strains are defined as being resistant to all antibiotic classes except for two.

Table 2.

The antibiogram results for clinically obtained specimens are summarized below

Antibiotics Name	Disk Content (ug)	Zone Diameter (≤)	statue
Piperacillin	100	17	Resistance
Ceftazidime	30	14	Resistance
Cefepime	30	14	Resistance
Cefotaxime	30	14	Resistance
Ceftriaxone	30	13	Resistance
Imipenem	10	18	Resistance
Meropenem	10	14	Resistance
Gentamicin	10	12	Resistance
Amikacin	30	14	Resistance
Ciprofloxacin	5	15	Resistance
Levofloxacin	5	13	Resistance
Trimethoprim-sulfamethoxazole	1.25/23.75	10	Resistance
Colistin	-	-	sensitive

FTIR spectra confirmed the successful functionalization of ZnO nanoparticles with carvacrol

FTIR study of pure carvacrol, ZnO NPs, and ZnO@Carvacrol NPs confirmed the effective production of nanoparticles. In all three samples, absorption peaks between 3600 and 3200 cm ¹ correspond to O–H stretching vibrations (Fig. 1A–C). Phenolic O–H groups in surface-adsorbed water on ZnO NPs could be responsible for these peaks in carvacrol (Fig. 1A–C). Firm peaks in the range of 2960–2870 cm⁻¹ were also seen in every sample, suggesting the existence of C–H stretching bonds (Fig. 1A–C). Due to its aliphatic chains, this is expected in carvacrol; in bare ZnO NPs, it may arise from surface organic contamination. A clear peak around 1620 cm⁻¹ in carvacrol is attributed to C = C stretching from the aromatic ring; its presence in the ZnO@Carvacrol NPs indicates effective conjugation of carvacrol to the ZnO NPs surface (Fig. 1A, C). Further corroborating the functionalization was the peak near 1420 cm⁻¹, associated with the C–C stretching of the methyl (CH₃) group, which was also observed in the ZnO@Carvacrol NPs (Fig. 1A, C). Peaks in the range of 1150–950 cm⁻¹ match C–O stretching, most likely from the phenolic group in carvacrol, and were similarly seen in the ZnO@Carvacrol NPs spectra (Fig. 1A, C). At last, a peak close to 480 cm⁻¹ in both ZnO NPs and ZnO@Carvacrol NPs samples is assigned to Zn–O stretching, therefore verifying the existence of zinc oxide structure. These results, taken together, suggest the successful production and surface modification of ZnO NPs using carvacrol.

Fig. 1.

FTIR results for ZnO@Carvacrol NPs confirmed the presence of carvacrol and zinc. A-C The peaks corresponding to carvacrol, ZnO NPs, and ZnO@Carvacrol NPs were identified from the FTIR results. The results in the set indicated the proper combination of carvacrol with the ZnO NPs

XRD patterns revealed the crystalline wurtzite structure of ZnO was preserved after functionalization

The crystalline form and structure of ZnO NPs and ZnO@Carvacrol NPs were determined through XRD analysis. Corresponding to the (100), (002), (101), (102), (110), (103), and (112) crystal planes, respectively, the diffraction pattern revealed typical peaks at approximately 31.7°, 34.4°, 36.2°, 47.5°, 56.6°, 62.9°, and 68.0°, respectively, in agreement with the JCPDS standard No. 36-1451. These peaks validate the hexagonal wurtzite crystalline form of ZnO@Carvacrol NPs (Fig. 2A, B). No additional peaks were observed, suggesting that the surface modification process either occurred only on the nanoparticle surface or did not alter the crystalline structure of ZnO@Carvacrol NPs.

Fig. 2.

Illustrates the characterization of ZnO@Carvacrol NPs, confirming successful synthesis. A, B XRD results are presented for ZnO NPs and ZnO@Carvacrol NPs. C SEM images show the synthesized nanoparticles, indicating their size falls within the expected nanoparticle range. D The ZnO@Carvacrol NPs size distribution is provided based on SEM results

SEM images showed irregular aggregated nanoparticles with sizes ranging from 37 to 88 nm

SEM imaging enabled the investigation of the size and shape of ZnO@Carvacrol NPs. The images revealed aggregated, oddly shaped nanoparticles, most likely resulting from surface contacts and particle agglomeration. The image analysis revealed that the nanoparticles fell within the expected nanometer range, 50–100 nm (Fig. 2C). The size-abundance of ZnO@Carvacrol NPs is also shown graphically in Fig. 2D, indicating a greater abundance in the 50–100 nm range. Surface functionalization with glucose and carvacrol enhances interparticle interactions, potentially leading to non-uniform structures and aggregation. SEM data support the successful production of nanostructured particles.

EDS results confirmed the presence of Zn, O, and high carbon content, indicating effective surface functionalization

Elemental composition information for ZnO@Carvacrol NPs came from EDS analysis. Clear peaks corresponding to carbon (C) were observed; the atomic and weight percentages were 71.58% and 53.99%, respectively, likely due to the presence of glucose and carvacrol on the ZnO@Carvacrol NPs surface (Fig. 3A). Atomic percentages of 5.63% and 22.79% for zinc (Zn) and oxygen (O), respectively, were also observed; the corresponding weight percentages were 23.11% and 22.9%, respectively (Fig. 3A). These findings support the presence of ZnO in the sample. The effective surface functionalization and successful production of high-purity Zn-to-O nanoparticles depend on a balanced Zn-to-O ratio and a notable carbon content.

Fig. 3.

Presence of high levels of zinc and carbon elements in the synthesized nanoparticles. A EDS analysis of ZnO@Carvacrol NPs composition reveals the presence of zinc-related elements and components of carvacrol. B Zeta potential measurements for ZnO@Carvacrol are also provided

Zeta potential data demonstrated good colloidal stability of ZnO@Carvacrol NPs in aqueous suspension

Zeta potential analysis was conducted to gain insight into the electrostatic properties and surface charges of the ZnO@Carvacrol NPs. Initially, the zeta potential was profoundly negative (-450 mV), then slowly increased, resulting in more positive values (Fig. 3B). The signal reached its maximum at the zeta potential interval of -48 to + 10 mV (Fig. 3B). Considering these outcomes, it can be suggested that the colloidal stability is adequate, and ZnO@Carvacrol NPs exhibit a suitable surface charge for dispersion in eco-friendly aqueous solutions.

ZnO@Carvacrol NPs exhibited antimicrobial activity

The MIC assay was conducted to evaluate the antimicrobial activity of carvacrol and ZnO@Carvacrol NPs against candidate A. baumannii strains (AB1-AB4 and ATCC). Carvacrol showed an MIC of 3.2 mg/mL, whereas ZnO@Carvacrol NPs demonstrated enhanced efficacy with an MIC of 1.6 mg/mL (Fig. 4A, E). These findings indicated that ZnO@Carvacrol NPs enhanced carvacrol’s inhibitory potency. As shown in Fig. 4, no reduction in bacterial growth was observed after the mentioned concentrations. MBC results for carvacrol were 6.4 mg/mL or higher, while for ZnO@Carvacrol NPs, they were 1.6 mg/mL or higher. These results suggest that the antibacterial effect of ZnO@Carvacrol NPs may be greater than that of carvacrol at lower concentrations.

Fig. 4.

ZnO@Carvacrol NPs show significantly improved antibacterial activity compared to pure carvacrol against MDR A. baumannii clinical isolates. A–E Display MIC results for pure carvacrol and ZnO@Carvacrol NPs against clinical isolates AB1–AB4 and the ATCC reference strain of A. baumannii. Bacterial viability was measured at various concentrations. Data represent mean ± SD from three independent experiments

ZnO@Carvacrol NPs showed anti-biofilm activity

Microbes form protective and adhesive layers called biofilms to resist antibiotics. We used MBIC and MBEC assays to evaluate the effectiveness of ZnO@Carvacrol NPs against these biofilms. Carvacrol had an MBIC value of 0.8 mg/mL, while ZnO@Carvacrol NPs showed greater activity with an MBIC of 0.2 µg/mL (Fig. 5A, E). In the MBEC assay, carvacrol and ZnO@Carvacrol NPs eradicated pre-formed biofilms at concentrations of 1.6 mg/mL and 0.4 mg/mL, respectively (Fig. 6A, E). These results confirmed that ZnO@Carvacrol NPs could exhibit more potent antibiofilm properties than pure carvacrol. The improved efficacy may be due to better penetration, altered bioavailability, and potentially more effective disruption of mature biofilm structures by the nanoparticles.

Fig. 5.

ZnO@Carvacrol NPs reduced biofilm biomass of clinical and reference A. baumannii strains at lower concentrations. A–E Represent the results of the MBIC assay for five different A. baumannii isolates, including four clinical isolates (AB1–AB4) and one standard strain (ATCC). Biofilm development was measured at different concentrations. Data are mean ± SD from three experiments. The arrow indicates the concentration of carvacrol and ZnO@Carvacrol NPs, after which the OD value did not change and remained constant

Fig. 6.

The eradication effect of carvacrol and ZnO@Carvacrol NPs on biofilm formation in A. baumannii. A–E The impact of carvacrol and ZnO@Carvacrol NPs on biofilm development of A. baumannii using the MBEC assay. The biofilm formation was measured at different concentrations. Data are presented as mean ± standard deviation from three independent experiments. The arrow indicates the concentration of carvacrol and ZnO@Carvacrol NPs, beyond which the OD value did not change and remained constant

ZnO@Carvacrol NPs downregulated the expression of virulence-related genes in A. baumannii

The transcriptional levels of bap and QS genes (abaI and abaR) were examined in A. baumannii strains treated with carvacrol and ZnO@Carvacrol NPs. Both treatments resulted in a significant downregulation of abaI expression compared with the control group, with the ZnO@Carvacrol NPs exhibiting a greater reduction. The expression level of abaI in response to carvacrol decreased by 50%, while ZnO@Carvacrol NPs samples showed a nearly 70% decrease (Fig. 7A, P < 0.001). Similarly, abaR expression was markedly reduced in treated strains, with ZnO@Carvacrol NPs again showing the greatest reduction. The expression level of abaR in strains treated with carvacrol decreased by approximately 40%, whereas treatment with ZnO@Carvacrol NPs decreased it by approximately 70% (Fig. 7B, P < 0.001). The most notable transcriptional change was observed in the bap gene, which showed a significant decrease in expression following treatment, particularly with ZnO@Carvacrol NPs. Corvacrol reduced the expression level of bap by nearly 60%, while ZnO@Carvacrol NPs reduced its expression level by 80% (Fig. 7C, P < 0.0001). These findings suggest that ZnO@Carvacrol NPs could be more effective than carvacrol in disrupting key virulence pathways, including QS and biofilm formation.

Fig. 7.

The ZnO@Carvacrol NPs downregulated QS and biofilm-associated gene expression in A. baumannii. A-C The relative gene expression levels of abaI, abaR, and bap in A. baumannii strains under different treatment conditions were measured by real-time PCR. The gene expression was normalized to rpoB as the reference gene. Expression analysis was performed in each group across three technical replicates, and changes in candidate gene expression were calculated relative to the control using the 2^-∆∆Ct method. Statistical significance is indicated by asterisks (****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05)

Discussion

The emergence of antibiotic-resistant A. baumannii strains is a significant problem in the hospital environment [39, 40]. This is essentially the case because they can produce a biofilm that is not only tough but also uses QS systems to control virulence, in addition to numerous patient body infections [40–45]. These practices significantly contribute to increased antibiotic resistance and reduced treatment effectiveness for patients [41–44]. Therefore, inhibiting this pathway could serve as an effective therapeutic strategy. Also, comprehensive research indicates that integrating nanoparticles with antibacterial agents can substantially enhance therapeutic effectiveness and reduce treatment resistance [46, 47]. This study examines the integration of nanoparticle technology with natural antibacterial agents, such as carvacrol, to evaluate their effectiveness against MDR A. baumannii and to highlight their antibacterial and anti-biofilm properties. To the best of our knowledge, no prior research has explored the concurrent impact of combining carvacrol with zinc oxide nanoparticles and their associated antibacterial and anti-biofilm activities in MDR A. baumannii. Consequently, the findings may offer valuable insights into the antimicrobial efficacy of carvacrol and its potential synergistic effects when combined with nanoparticles.

Our clinical isolates of A. baumannii reflect the increasing prevalence of MDR strains, as they were resistant to most standard antibiotics. This resistance most likely results from a combination of different processes, including decreased membrane permeability, efflux systems, enzyme synthesis, and biofilm formation. Previous studies have also indicated that A. baumannii has used such techniques, especially in a nosocomial management environment, to evade the effects of antibiotics. These findings support the rationale for using alternative treatments, such as nanomaterials, which may offer enhanced antibacterial and antivirulence characteristics against MDR strains still prevalent in the research area [5, 48]. Various studies have also shown that the use of nanoparticles and their functionalization with antibacterial compounds can have very significant effects on treatment-resistant pathogen species [49–51]. Therefore, it is important to study nanoparticles that have therapeutic potential.

Although our results have limitations, the findings of this study may help identify new treatments for MRD A. baumannii in the future. The most important results are mentioned and discussed below.

Structural characterization verified that the ZnO@Carvacrol NPs displayed a stable wurtzite crystalline phase (XRD), active functional groups on the surface (FTIR), nanoscale aggregated morphology (SEM), and strong colloidal stability in aqueous suspension (zeta potential). Furthermore, elemental composition was confirmed by EDS, which revealed notable signals for zinc, oxygen, and a high carbon content indicative of successful surface functionalization with carvacrol. The improved antibacterial and antibiofilm performance observed is correlated with these physicochemical properties [52, 53]. These findings, in conjunction with the known characteristics of ZnO-based nanostructures that disrupt bacterial membranes and efficiently infiltrate the biofilm matrix, are consistent with previous studies [20, 54]. Other studies have also shown that the use of ZnO NPs functionalized with natural antibacterial compounds (Quercetin and Rutin) can provide significant effectiveness against bacterial pathogen species. As shown, ZnO NPs in combination with antibacterial substances can significantly modulate biofilm formation and its associated genes [27, 28]. By modulating quorum-sensing signals and reducing the expression of key adhesion genes, phenolic compounds such as carvacrol have also been extensively reported to enhance these effects [55, 56]. In summary, these findings suggest that ZnO@Carvacrol NPs demonstrate the necessary structural integrity and surface chemistry to serve as prospective anti-pathogenic and antibacterial agents against MDR organisms. Additionally, our overall results indicate that the antibacterial and anti-biofilm-forming efficacy of ZnO@Carvacrol NPs may surpass that of carvacrol against MDR A. baumannii.

In antimicrobial assays, the ZnO@Carvacrol NPs inhibited bacterial growth at roughly half the concentration required for free carvacrol. This enhanced potency may reflect synergistic interactions between zinc oxide and carvacrol. ZnO NPs are known to disrupt bacterial membranes (via Zn²⁺ release and the generation of reactive oxygen species). At the same time, carvacrol is lipophilic and readily inserts into lipid bilayers, increasing permeability and depolarizing the cytoplasmic membrane [52, 54, 57]. According to these studies, it can be suggested that nanoparticle ZnO@Carvacrol NPs may have greater potency than carvacrol in inhibiting growth and biofilm formation in MDR A. baumannii. It has also been shown in Escherichia coli and Staphylococcus aureus-resistant strains that combining zinc oxide nanoparticles with natural compounds can enhance antimicrobial activity [58].

Interestingly, ZnO@Carvacrol NPs demonstrated higher antibiofilm activity than carvacrol alone. This enhanced efficacy may be attributed to their dual mechanism of action, contributing to prolonged biofilm inhibition. First, ZnO NPs can infiltrate and disrupt the extracellular polymeric substance matrix, while carvacrol interferes with cell-to-cell adhesion within the biofilm [38]. A secondary, yet critical, mechanism involves regulatory interference. Studies have shown that carvacrol can suppress the expression of genes for both the autoinducible enzyme synthase (abaI) and its receptor (abaR), which are key components of the QS system in A. baumannii [18]. Since the abaI/abaR QS system governs high-level biofilm formation and contributes to the development of antibiotic resistance, its inhibition by ZnO@Carvacrol NPs not only impairs intercellular signaling but also effectively prevents biofilm maturation and stability [39–41]. Our findings indicate that ZnO@Carvacrol NPs inhibit biofilm formation in MDR A. baumannii at lower concentrations than carvacrol. Additionally, ZnO@Carvacrol NPs more effectively reduced the expression of biofilm-associated genes, such as bap, abaI, and abaR, at these lower concentrations.

Similarly, treatment with ZnO@Carvacrol NPs also significantly reduced the expression of the biofilm-associated protein gene bap in MDR A. baumannii. Bap encodes a surface adhesin required for initial attachment and the formation of a three-dimensional biofilm matrix. Its repression, therefore, undermines the structural foundation of biofilms. Together, the reduced QS gene expression and bap expression explain the significant biofilm inhibition [59]. Similar downregulation of abaI, abaR, and bap has been reported with other antivirulence agents (e.g., natural extracts) that disrupt A. baumannii QS and adhesion. For example, plant-derived QS inhibitors can suppress AHL synthase and regulator genes, thereby attenuating the production of virulence factors [56, 59]. Our findings align with this paradigm, suggesting that ZnO@Carvacrol NPs can target both signaling and adhesion pathways.

The multifunctional action of the ZnO@Carvacrol NPs is reminiscent of reports on other nanoparticle systems. Silver nanoparticles (AgNPs) have been shown to bind and inhibit AHL synthases and receptors in Pseudomonas aeruginosa, effectively blocking QS and downstream virulence gene expression [60]. Similarly, ZnO NPs are known to induce oxidative stress and damage bacterial membranes, leading to cell death. Carvacrol’s established mechanism, including its disruption of the cytoplasmic membrane potential and its increase in permeability, would enhance these effects [55, 57]. In our system, the combination of ZnO NPs and carvacrol may produce additive membrane damage, releasing intracellular contents and facilitating the ingress of nanoparticles. Concurrently, this physical assault may disable QS circuitry by preventing autoinducer retention or enzyme function.

In summary, it appears that ZnO@Carvacrol NPs may exert antimicrobial properties in A. baumannii through two mechanisms: initially, by directly disrupting the membrane, and subsequently, by specifically downregulating QS and biofilm-associated genes, thereby enhancing anti-biofilm and anti-pathogenic efficacy. This finding is consistent with other nanomaterial studies, which show that combined physicochemical and molecular interference can significantly attenuate MDR pathogens [53, 61–66]. Despite the promising findings of this study, several limitations must be acknowledged. First, only a limited number of clinical isolates and a single reference strain were tested. Therefore, to generalize the results to other A. baumannii genotypes, further studies involving a broader range of isolates from different geographical regions are needed. Additionally, while genetic data and assays related to biofilm and QS features showed significant effects of ZnO@Carvacrol NPs, ultrastructural evidence, such as SEM imaging of nanoparticle-biofilm interactions, was not obtained. Such evidence could provide deeper insight into the precise mechanisms underlying the anti-biofilm and anti-pathogenic effects. The use of docking and molecular dynamics in bioinformatics can help investigate the interactions of carvacrol with biofilms and QS proteins. Moreover, this study did not assess cytotoxicity or therapeutic efficacy in animal infection models, which are essential for evaluating safety and therapeutic potential in physiological and clinical settings. Ultimately, future studies should incorporate long-term evaluations, detailed microscopic analyses, and in vivo validation to more effectively confirm the clinical applications of these nanomaterials.

Conclusion

ZnO@Carvacrol NPs enhanced carvacrol’s antimicrobial effects against MDR A. baumannii. ZnO@Carvacrol NPs not only reduced the MIC concentration compared to carvacrol alone, but also inhibited biofilm formation and the expression of QS-related genes (abaI, abaR, bap). These findings suggest that disrupting A. baumannii QS and adhesion via such nanomaterials can be an effective strategy to curb resistance and infection. However, translation of this approach will require further optimization and validation in the physiological system.

Abbreviations

MDR

Multidrug-resistant

A. baumannii

Acinetobacter baumannii

QS

Quorum sensing

ZnO@Carvacrol NPs

Zinc oxide–carvacrol nanoparticles

FTIR

Fourier-transform infrared spectroscopy

SEM

Scanning electron microscopy

EDS

Energy-Dispersive X-ray Spectroscopy

XRD

X-ray diffraction

MIC

Minimum inhibitory concentration

MBC

Minimum bactericidal concentration

MBIC

Minimum biofilm inhibitory concentration

MBEC

Minimum biofilm eradication concentration

QRT-PCR

Quantitative real-time polymerase chain reaction

Authors’ contributions

M.H.M., A.Z., and M.M. conceived and designed the study. N.J., M.M.A.N., A.J.K., M.M.G., and M.H.M. did data analysis and experiments. M.H.M., A.Z., and M.M. performed the data interpretation. N.J. and M.M.A.N. performed manuscript writing. A.Z. and M.M. finally approved the manuscript.

Funding

Not available.

Data availability

Supporting and raw data are available upon a reasonable request to the corresponding author.

Declarations

Ethical approval and consent to participate

Clinical isolates were obtained from the laboratory of Motahari Hospital in Gonbad-e Kavus, Iran. No access to patient data or direct patient contact was permitted, and we obtained samples as anonymized bacteria on agar medium. Therefore, humans did not directly participate in this study, and the Ethics Committee of Gambad University waived the requirement to obtain informed consent. This study involves no human participants, data, or tissue. All ethical issues were reviewed by the Ethics Committee of Gambad University and approved with the accession number IR.GOUMS.REC.1402.370. However, our study complies with Helsinki’s Ethical Principles for Medical Research.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.