Skip to main content
NCBI home page
Scientific Data logoLink to Scientific Data
. 2026 Feb 26;13:544. doi: 10.1038/s41597-026-06915-y

Chromosome-level haplotype-resolved genome assemblies and annotations of Apios americana and Apios priceana

Hyun-oh Lee 1, Hallie C Wright 2, Brandon D Jordan 1, Vikas Belamkar 3, Jugpreet Singh 4, Scott R Kalberer 5, Josh Clevenger 2, Steven B Cannon 5,✉
PMCID: PMC13061880  PMID: 41748593

Abstract

Apios americana and Apios priceana are tuber-forming legumes native to North America with ecological value and agricultural potential. The lack of genomic resources has limited comparative studies and crop improvement for these species. Here, we report high-quality, haplotype-resolved, chromosome-level genome assemblies for both the species. The assemblies were generated from high-fidelity long-read data, and the primary assemblies were scaffolded using Omni-C chromatin conformation maps. The genome sizes of the primary haplotype assemblies were 1.53 Gb for A. americana and 1.85 Gb for A. priceana, each represented by 11 pseudochromosomes. The BUSCO completeness scores ranged from 98.6% to 99.0%. Approximately 26,000 predicted genes (30,000–33,000 predicted mRNA transcripts) were identified per haplotype in A. americana and A. priceana, respectively. Repeat annotation revealed that over 80% of both genomes consist of interspersed repetitive elements, with the most abundant being long terminal repeat (LTR) retrotransposons. These genomic resources will support trait mapping and structural variation analyses in Apios, and more broadly, comparative genomics within the legume family.

Subject terms: Genome informatics, Plant domestication, Evolutionary genetics

Background & Summary

The legume genus Apios comprises seven species distributed across the Himalayas, Indochina, China, Korea, Japan, eastern Canada, and the eastern and central USA1. These herbaceous perennial plants produce vines that display climbing or sprawling forms of growth2. Two species of Apios, A. americana Medikus and A. priceana Robinson, are indigenous to North America3. The perennating organ in these Nearctic species ranges from a single, irregularly spheroidal tuber (A. priceana) to multiple monoliform tubers spread along the length of subterranean stolons (A. americana)3. The tubers of A. fortunei Maximowicz of eastern Asia are intermediate in size and number although resembling A. americana, whereas tubers are not produced at all by A. carnea (Wallich) Bentham ex Baker3,4. Many Apios species are remarkable with regards to their dual capacity to produce edible stem-tubers important to asexual reproduction and to host a nitrogen-fixing symbiosis. Due to their palatability, extended shelf life, and their relatively high protein concentration (11–14% by dry weight)5, they have been evaluated for use as perennial crops6,7. Cytogenetic studies have revealed that Apios americana occurs in both diploid (2n = 22) and triploid (2n = 33) forms, with the triploid type being prevalent in northern populations. Conversely, Apios priceana was found to be uniformly diploid8.

In recent years, researchers have obtained chromosome-scale genomes for notable crops within Phaseoleae, including Glycine max9, Phaseolus vulgaris10, and Vigna unguiculata11. Genome assemblies for increasing numbers of non-crop species in the Phaseoleae, such as Amphicarpaea edgeworthii12 and Spatholobus suberectus13, have contributed to a broader understanding of evolution of this clade. Phylogenetic analyses indicate that A. americana diverged from other species in Phaseoleae early in the clade’s evolutionary history14. The position of Apios as sister to the remainder of the main phaseoloid group (Fig. S1) is in agreement with its placement in the pastid-based phylogenies of Stefanović et al.14, Wojciechowski et al.15, and Lavin et al.16. The Apios genomes exhibit chromosomal similarities with those of cultivated legumes such as G. max, P. vulgaris, and various Vigna species – for example, they have 11 chromosomes (1n), in common with most other species in the clade17. It is noteworthy that Apios is recognized as a monophyletic group within the Phaseoloid clade, with North American species forming a distinct clade from their Asian counterparts4.

Several characteristics provide motivation for developing genomic resources for the genus Apios: the perennial crop potential of species in the genus, the developmental and anatomical features of storage-roots and tubers, and the basal phylogenetic placement within a clade containing many important crop legumes. Considering this, genomic studies have yielded a transcriptome assembly and single-nucleotide polymorphism (SNP) markers for A. americana, identifying among the evaluated accessions six genotypic clusters and marker-trait associations for various traits7,14. Phenotypic evaluation of an A. americana collection identified four distinct genotype clusters and high-yielding genotypes, with below-ground tuber yield positively correlated with other phenological traits15. The long-read genome assemblies presented here will permit much higher-resolution identification of genetic variation.

In this study, we report the sequencing, assembly, and annotation of A. americana and A. priceana. The assemblies are high-quality, haplotype-resolved, chromosome-level genomes. The assembly for A. americana was based on long-read PacBio sequencing (181.7 Gb, ~118.8× coverage) and Omni-C chromatin conformation capture data (136.1 Gb, ~89.0× coverage). A similar strategy was employed for A. priceana (65.8 Gb, ~35.6× coverage long-read PacBio sequencing and 133.4 Gb, ~72.2× coverage Omni-c chromatin conformation capture data), yielding comparable coverage statistics. The final assembled genome sizes were 1.53 gigabase pairs (Gb) and 1.85 Gb for A. americana and A. priceana, respectively. Previous genome size estimates based on flow cytometry were 1.64 Gb for A. americana and 2.10 Gb for A. priceana7. For each of the identified haplotypes, we generated 11 pseudochromosomes, thereby anchoring over 98% of the total assembled sequence to chromosomes (Figs. 1 and 2a–d). The contig N50 sizes were 98.4–101.7 Mb for A. americana haplotypes and 82.3–87.7 Mb for A. priceana haplotypes, with GC contents of approximately 34.5% and 34.8%, respectively (Table 1). The total number of protein-coding genes predicted across the assemblies ranged from 25,667 to 27,151 (Table 2). Repeat annotation revealed that more than 80% of the genome consists of repetitive elements, predominantly long terminal repeat (LTR) retrotransposons (Table 3). The BUSCO completeness scores ranged from 98.6% to 99.0% across the four haplotypes (Table 4). The kmer completeness by Merqury demonstrated that A. americana haplotypes 1 and 2 were 82.2 and 81.9% complete, respectively, with an overall completeness for both haplotypes of 99.1%. The kmer completeness for the A. priceana haplotypes 1 and 2 were 92.8 and 92.9% complete, respectively, with an overall completeness for both haplotypes of 97.8%. The sequence error based on QV score for the A. americana haplotypes 1 and 2 were 38.7 and 38.6, respectively, with an overall score of 38.6. The QV score for the A. priceana haplotypes 1 and 2 were 56.9 and 59.4, respectively, with an overall score of 58.0.

Fig. 1.

Fig. 1

Open in a new tab

Synteny and genomic features of haplotype-resolved genomes in Apios. (a) A. americana haplotypes 1 and 2. (b) A. priceana haplotypes 1 and 2. Five tracks were plotted using a 1 Mb sliding window and visualized with Circos. Tracks from innermost to outermost: Track i, syntenic links between haplotypes; Track ii, GC content; Track iii, gene density; Track iv, repeat density; Track v, chromosome length.

Fig. 2.

Fig. 2

Open in a new tab

Omni-C contact maps of phased genome assemblies in Apios americana and Apios priceana. Omni-C data were used to visualize chromosome-scale interaction patterns for each haplotype assembly. (a) A. americana haplotype 1, (b) A. americana haplotype 2, (c) A. priceana haplotype 1, and (d) A. priceana haplotype 2.

Table 1.

Genome Assembly Statistics of Apios americana and Apios priceana.

Genomes A. americana Hap1 A. americana Hap2 A. priceana Hap1 A. priceana Hap2
Number of chromosomes 11 11 11 11
Assembled genome size (bp) 1,532,055,155 1,525,637,481 1,849,252,086 1,853,686,847
Min. chromosomes length (bp) 101,712,484 102,237,627 115,831,762 116,303,351
Max. chromosomes length (bp) 216,066,426 213,872,031 266,515,275 266,428,680
Min. contigs length (bp) 50,016 50,138 50,000 50,196
Max. contigs length (bp) 208,837,625 201,537,613 254,088,091 218,953,962
Average contigs length (bp) 8,659,725.0 12,374,531.4 4,906,134.3 6,656,601.2
N50 of contigs (bp) 101,712,484 101,546,880 82,267,928 87,690,639
N90 of contigs (bp) 23,020,139 24,427,629 19,250,405 16,383,316
L50 of contigs 6 6 8 8
L90 of contigs 15 17 28 25
GC Ratio (%) 34.45 34.52 34.81 34.79
bases masked (bp) 1,236,248,685 1,229,712,864 1,592,272,662 1,595,340,935
bases masked (%) 80.69% 80.60% 86.10% 86.06%
Open in a new tab

Table 2.

Gene annotation statistics for Apios americana and Apios priceana.

Genomes A. americana Hap1 A. americana Hap2 A. priceana Hap1 A. priceana Hap2
Number of protein-coding genes 25,641 25,754 26,867 26,942
Number of transcripts (mRNAs) 29,879 29,949 33,413 33,561
Number of exons 169,139 169,795 193,094 193,649
Number of introns 139,260 139,846 159,681 160,088
Mean transcripts per gene 1.2 1.2 1.2 1.2
Mean exons per transcript 5.7 5.7 5.8 5.8
Mean gene length (bp) 4,241 4,270 4,632 4,690
Mean CDS length (bp) 1,315 1,315 1,320 1,321
Shortest gene (bp) 114 120 120 120
Open in a new tab

Statistics are based on complete protein-coding models (with both start and stop codons, CDS ≥ 90 bp, and length in multiples of three).

Table 3.

Classification of repetitive elements in the Apios americana and Apios priceana genomes.

Repeat category A. americana Hap1 (bp/%) A. americana Hap2 (bp/%) A. priceana Hap1 (bp/%) A. priceana Hap2 (bp/%)
Total repetitive sequence 1,236,248,685 (80.7%) 1,229,712,864 (80.6%) 1,592,272,662 (82.8%) 1,595,340,935 (83.6%)
LTR retrotransposons (Ty1/Copia + Gypsy/DIRS1) 465,744,395 (30.4%) 470,561,244 (30.8%) 634,490,470 (33.0%) 647,844,864 (33.9%)
LINEs 7,115,667 (0.46%) 4,240,789 (0.28%) 6,593,538 (0.34%) 12,312,686 (0.65%)
SINEs 24,783 (0.00%) 272,140 (0.02%) 6,193,155 (0.32%) 4,007,540 (0.21%)
DNA transposons 73,531,634 (4.8%) 68,622,745 (4.5%) 76,738,266 (4.0%) 92,484,018 (4.8%)
Rolling-circle elements 3,141,872 (0.21%) 3,664,012 (0.24%) 7,470,444 (0.39%) 4,387,365 (0.23%)
Unclassified sequences 656,806,832 (42.9%) 639,704,718 (41.9%) 790,872,301 (41.2%) 771,818,916 (40.4%)
Open in a new tab

Table 4.

BUSCO Assessment of haplotype-resolved assemblies of Apios americana and Apios priceana.

BUSCO categories Metric A. americana Hap1 A. americana Hap2 A. priceana Hap1 A. priceana Hap2
Genomes Complete BUSCOs 5,302 (98.8%) 5,302 (98.6%) 5,302 (98.7%) 5,302 (98.7%)
Single-copy 5,114 (95.3%) 5,114 (95.0%) 5,114 (95.3%) 5,114 (95.2%)
Duplicated 188 (3.5%) 188 (3.6%) 188 (3.4%) 188 (3.5%)
Fragmented BUSCOs 11 (0.2%) 11 (0.2%) 11 (0.1%) 11 (0.1%)
Missing BUSCOs 54 (1.0%) 54 (1.2%) 54 (1.2%) 54 (1.2%)
Annotations Complete BUSCOs 5,238 (97.6%) 5,238 (97.3%) 5,238 (98.3%) 5,238 (98.4%)
Single-copy 5,050 (94.1%) 5,050 (93.3%) 5,050 (94.7%) 5,050 (94.6%)
Duplicated 188 (3.5%) 188 (4.0%) 188 (3.6%) 188 (3.8%)
Fragmented BUSCOs 17 (0.3%) 17 (0.3%) 17 (0.1%) 17 (0.2%)
Missing BUSCOs 113 (2.1%) 113 (2.4%) 113 (1.6%) 113 (1.4%)
Total BUSCOs searched 5,366 5,366 5,366 5,366
Open in a new tab

Genomic comparisons among all four haplotypes (A. americana H1 & H2 and A. priceana H1 & H2) identify generally clear synteny among the 11 corresponding chromosomes, but with multi-megabase inversions on five chromosomes (Fig. 3), the largest comprising more than 82 Mbp (more than half) of chromosome 4 in the comparison between the two species. These inversions are present irrespective of the haplotype, supporting (along with the Omni-C maps) that the structural differences are features of the chromosomes rather than assembly artifacts.

Fig. 3.

Fig. 3

Open in a new tab

Syntenic dot plot between Apios americana haplotype 1 (x-axis) and Apios priceana haplotype 1 (y-axis). Purple dots represent forward (same-strand) syntenic blocks, while blue dots indicate inverted (reverse-strand) syntenic blocks.

The A. priceana genome is approximately 20% larger than that of A. americana (Table 1). The size differences appear due primarily to the greater repetitive content in A. priceana, which is approximately 86.1% repetitive compared with 80.7% in A. americana (Table 1). Excluding masked repetitive elements, the two genomes are approximately 94.2% identical.

Based on analysis of Ks peaks and reported fossil-calibrated divergence times in the legumes, we estimate that A. americana and A. priceana diverged ~2.23 Mya. Specifically, assuming similar average rates of change in Apios as in Glycine back to the shared papilionoid whole genome duplication approximately 58 Myr ago9,16, and based on a strong Ks peak of 0.025 between A. americana and A. priceana and in the Glycine self-comparison of 0.65 for the papilionoid WGD: 58 Mya * (0.025 Ks)/(0.65 Ks) = 2.23 Mya. See the species Ks plot at Fig. S2. A similar divergence age (2.5 Mya) results from using branch lengths in the consensus species phylogeny (Fig. S1) and an estimate of 10 Mya for the Glycine WGD9: ((10 Mya)/0.32) * 0.008 = 2.5 Mya.

Potential centromeric satellites were present on all eleven chromosomes of both Apios species (Fig. 4). The most frequent candidate centromeric repeats in both species were 193 bp, with some variation within and between the two species, but with sequence identities generally within 85%, and with a consensus sequence of AAAAATATTTAAATTATTATAACCAAGGTAGTACAGTTTTCCAAAATTATAAAANCAGTTCCACAGCATAAAGTTTCAGAATTTCAGCATACTAAATCTGTGTTAAGAAATATATTAAAAATAGTAAACGAAGTCATAAAATAACTTATTATATGTCAAATTAAAGCTTAGTATGTCTATTTTATTTTTATGT.

Fig. 4.

Fig. 4

Open in a new tab

The chromosome-wise distribution of 193 bp tandem repeats (candidates for centromeric satellite repeats) in Apios: (a) A. americana and (b) A. priceana. Dots above each chromosome indicate densities of blastn (BLAST + with e-value of 1e-50) matches from a consensus 193 bp query. The vertical placement of the dots in the jitter plot is random; only the horizontal placement is significant.

In A. americana, these satellite repeats ranged from 22 Kb to 4 Mb in length and cumulatively spanned ~14 Mb (0.92%) of the genome, with the largest arrays found on chromosomes 4, 7, and 9. In A. priceana, the arrays were significantly larger and more numerous, ranging from 3.8 Mb to 5 Mb and collectively covering ~39 Mb (2.11%) of the genome, with the largest arrays on chromosomes 2, 6, and 7.

These genome assemblies provide a valuable resource for comparative and evolutionary studies in legumes, particularly for understanding genome diversification, structural variation, and the genomic basis of perennial growth traits and tuber and storage-root development in Phaseoleae.

Methods

Plant sample and DNA preparation

Apios americana strain LA2127 was selected by Drs. Bill Blackmon and Mr. Berthal Reynolds in the late 1980s, from crosses derived from wild A. americana accessions collected from the southern U.S. (primarily Louisiana). This accession is described in Belamkar et al.18 and Belamkar et al.7.

Apios priceana strain MO19963523 is from a tuber grown from seed from an accession from the Missouri Botanic Garden, which in turn was grown from seed from a plant collected by Dr. George Rogers on October 13th, 1987 (1987–3021) in Lee County Mississippi.

For both A. americana and A. priceana, tissue for genomic sequencing was from etiolated young shoots from a clean tuber.

High molecular weight (HMW) DNA was extracted using the Takara Nucleobond® HMW DNA extraction kit. DNA quantity was assessed using the Qubit™ dsDNA High Sensitivity kit, and DNA quality was assessed with the Femto Pulse gDNA 165 kb analysis kit.

PacBio and omni-C sequencing

Short DNA fragments were removed from the genomic DNA with the PacBio Short Read Eliminator (SRE) kit, and DNA was sheared using repeated pipetting cycles with the Hamilton Microlab Prep workstation. DNA was cleaned with PacBio SMRTbell® cleanup beads, and libraries were generated using the PacBio HiFi SMRTbell® library kit under manufacturer conditions. The libraries were sequenced at HudsonAlpha Institute for Biotechnology (Huntsville, AL).

Omni-C libraries were both constructed using the Dovetail® Omni-C® Kit and sequenced by the HudsonAlpha Institute for Biotechnology Genome Sequencing Center (GSC) (Huntsville, AL). A total of 450,801,658 and 441,811,210 initial read pairs for A. americana and A. priceana, respectively, were generated from the Omni-C libraries.

Genome assembly of Apios americana and apios priceana

A genome survey using the long reads was conducted using JellyFish (version 2.3.1)19 and GenomeScope (version 2)20 to estimate the genome size, heterozygosity, and repeat content for both A. americana and A. priceana (Fig. 5). The k-mer distribution map with k = 21 estimated the haploid genome sizes of A. americana and A. priceana to be 1.15 Gb and 1.46 Gb, respectively, with estimated heterozygosity rates of 1.67% and 0.34%, respectively. The repeat sequence content was estimated as 54.4% and 60.7% for A. americana and A. priceana, respectively. The main assembly consisted of 14,099,941 CCS PACBIO sequences for A. americana and 3,502,247 for A. priceana (12,885.1 and 18,788.7 bp average read size, respectively), assembled using HiFiAsm (version 0.19.8) with Hi-C integration21 under default parameters. Contigs less than 50 Kb were filtered out. QUAST (version 5.2.0)22 was utilized to assess genome assembly completeness (Table 1). Kmer completeness was assessed with Merqury (version 1.3)23, using an initial Meryl database for each genome’s HiFi reads containing 21-mers that occur more than once. The resulting sequence was polished using RACON (1.4.3)24. The final assemblies were assessed once more with Omni-C data to confirm the conformation integrity was intact in the final assemblies (Fig. 2A–D).

Fig. 5.

Fig. 5

Open in a new tab

Estimation of genome size and heterozygosity using k-mer (k = 21) accessibility analysis. The k-mer frequency distributions for Apios americana (a) and Apios priceana (b) were analysed using GenomeScope. The blue areas represent the observed k-mer distributions, while the black lines indicate the best-fitting model. The yellow lines show the distribution of unique sequences and the red lines show the k-mer frequency associated with sequencing errors.

Omni-C Samples were processed using the Dovetail® Omni-C® processing guidelines (https://github.com/dovetail-genomics/Omni-C). Briefly, Burrows Wheeler Aligner-Maximal Exact Match (BWA-MEM, version 0.7.17)25 was used to align the paired-end Omni-C reads to the initial Hi-C integrated-Hifiasm assemblies, and Paritools26 was utilized to identify ligation events, sort the read pairs, and remove PCR duplicates. The final BAM file was used as input for scaffolding the contigs as described below.

Contigs for both species and haplotypes were then oriented, ordered, and joined into chromosomes using the JUICER pipeline27. Chromosome-scale scaffolding was performed in 2022 with 3D-DNA28 (version 180922) for A. priceana, and chromosome-scale scaffolding was performed in 2024 for A. Americana with YaHS29 using the final BAM files generated from the Omni-C analysis as input. Contigs containing significant telomeric sequences were properly oriented in the assembly. For A. americana, a total of 27 contig joins were made for HAP1 and 20 contig joins were made for HAP2 to form the final assemblies, each consisting of 11 chromosomes. For A. priceana, a total of 89 joins were applied to the HAP1 assembly, and 128 joins for the HAP2 assembly. A total of 98.2% of the assembled sequence is contained in the chromosomes for A. Americana HAP1 and 99.4% of the assembled bases is contained in A. americana HAP2. For A. priceana a total of 99.8% and 99.8% of assembled bases integrated into the respective HAP1 and HAP2 chromosomes. For each assembly, chromosomes were numbered to be consistent with the first haplotype, and the resulting sequence was screened for retained vector and/or contaminants. Heterozygous SNP/indel phasing errors were identified and corrected in both A. americana and A. priceana in the aligned CCS data using Illumina reads (2 × 150, 400 bp inserts) by aligning the reads using BWA-MEM25 and identifying homozygous SNPs and INDELs with the GATK’s UnifiedGenotyper tool30.

Repetitive elements and centromeric region characterization

Repeat annotation was performed using both de novo and homology-based approaches. For each genome assembly, a species-specific repeat library was first constructed using RepeatModeler31 (version 2.0.4) to detect long terminal repeat (LTR) retrotransposons. The resulting consensus libraries were then utilized in conjunction with a legume repeat database (legume.TE_lib_2024, comprised of 1438 repeat sequences identified in 15 diverse legume species, available at https://data.legumeinfo.org/LEGUMES/Fabaceae/repeats/TE_lib_2024.rpt.6WVT/)to annotate repetitive elements employing RepeatMasker32 (version 4.1.5). RepeatMasker was executed independently on each haplotype assembly of A, americana and A. priceana. The classification of repeats was conducted into the following major categories: LTR retrotransposons (Ty1/Copia and Gypsy/DIRS1), LINEs, SINEs, DNA transposons, rolling-circle elements, and unclassified sequences. The total repeat content ranged from 80.6% to 83.58% across assemblies, with LTR elements accounting for over 30% of each genome (Table 3).

Tandem repeats in A. americana and A. priceana were identified using ULTRA (version 0.1.0)33. Repeats with lengths ≥90 bp were evaluated for abundance, chromosomal position, and array size. Based on these characteristics, a collection of similar ~193 bp repeats were identified in both species, which had positional and clustering characteristics consistent with centromeric repeats. These were clustered, aligned, and used to derive a consensus sequence, which was used as a query in BLAST searches against both genome assemblies. BLAST hits were filtered for ≥90% sequence identity, and their genomic coordinates were merged using the bedtools merge function34, with a merge distance of 100 kb to define putative centromeric arrays.

To refine the locations of centromeric regions and to discriminate between ancestral and putative neocentromeres, we used RepeatObserver (https://github.com/celphin/RepeatOBserverV1). This tool calculates repeat density and coverage metrics that allow high-resolution mapping of tandem repeat clusters. For chromosomes with multiple centromeric repeat loci, the region with the highest repeat content was assumed to represent the ancestral centromere, following the reasoning that older centromeres have had more time to accumulate and homogenize satellite arrays. Conversely, smaller or spatially disjunct repeat clusters were interpreted as candidate neocentromeres.

Genome annotation

The BRAKER3 pipeline35 was used to generate annotations for A. americana and A. priceana (two haplotypes for each). The pipeline was applied to repeat-masked assemblies, masked with the constructed species-specific repeat libraries that were used to soft-mask the respective genomes with RepeatMasker32. For the homology-based modeling using orthologous proteins, we used a set of legume-focused gene families constructed with the Pandagma gene family workflow36. These gene families included protein sequences of 36 legume species in 21 genera and four legume subfamilies, as well as four nonlegume outgroup genera (Table S1). For A. americana transcript alignments, we used 27 transcript read libraries from varied shoot, root, and tuber tissues (GenBank accessions SRR3224371-SRR3224384 (14 samples), SRR20018817, SRR20018820, SRR20018828, SRR20018831, SRR20018834, SRR20018835, SRR20018838, SRR20018841, SRR20018844, SRR20018848, SRR20018851, SRR20018854, SRR20018858). For A. priceana transcript alignments, we used 18 transcript read libraries from mixed shoot, root, and tuber tissues37. The busco_lineage parameter was set as fabales_odb10.

Other genomic analyses

Synteny analyses and genomic alignments were conducted with MUMmer438. Rates of synonymous-site changes per synonymous site (Ks values) between A. americana, A. priceana, and G. max were calculated using Pandagma (the “family” workflow)36, with the underlying Ks gene-pair calculations handled by PAML39.

Data Records

A. americana haplotype assemblies for isolate LA2127 are registered at NCBI under Bioprojects PRJNA125154340 and PRJNA125154241 (Haplotypes 1 and 2 respectively), under umbrella project PRJNA1251034. The whole genome shotgun sequencing projects have been deposited at DDBJ/ENA/GenBank under the accessions JBPVNU00000000042 and JBPVNT00000000043. The respective versions described in this paper are JBPVNU000000000.1 and JBPVNT000000000.1. The raw PacBio and Omni-C data have been deposited under SRR3716273844 and SRR3716273545, respectively.

A. priceana haplotype assemblies for isolate MO19963523 are registered at NCBI under Bioprojects PRJNA125103846 and PRJNA125208447 (Haplotypes 1 and 2 respectively), under umbrella project PRJNA1252165. The whole genome shotgun sequencing projects have been deposited at DDBJ/ENA/GenBank under the accessions JBNFDG00000000048 and JBNFDF00000000049. The respective versions described in this paper are JBNFDG000000000.1 and JBNFDF000000000.1. The raw PacBio and Omni-C data have been deposited under SRR3716273650 and SRR3716273751, respectively.

Genome assemblies and annotations are also available at the Legume Information System Datastore: https://data.legumeinfo.org/Apios/americana/ and https://data.legumeinfo.org/Apios/priceana/52.

Annotations are also available at the Ag Data Commons under DOI 10.15482/USDA.ADC/2927484853.

Technical Validation

The completeness of the haplotype-resolved genome assemblies for A. americana and A. priceana was assessed using BUSCO (version 5.4.3) with the fabales_odb10 lineage dataset (n = 5,366 orthologs). All four assemblies demonstrated high levels of completeness, with BUSCO scores ranging from 98.6% to 98.8% (Table 4). Among these, over 95% of BUSCO genes were identified as single-copy, while duplicated BUSCOs accounted for approximately 3.4–3.6%. The presence of fragmented and missing BUSCOs ranged from 1.0% to 1.2%.

The annotations also show complete BUSCO scores, with 97.3% to 98.4% recovery of 5,366 orthologs from the fabales_odb10 dataset (Table 4). Among these, 93.3% to 94.7% of BUSCO genes were identified as single-copy, while duplicated BUSCOs accounted for approximately 3.5 to 3.8%. The presence of fragmented and missing BUSCOs ranged from 1.4% to 2.4%.

Supplementary information

41597_2026_6915_MOESM1_ESM.docx (39.3KB, docx)

Supplementary data and analysis for: Chromosome-level haplotype-resolved genome assemblies and annotations of Apios americana and Apios priceana

Acknowledgements

The authors are thankful to the late Gautam Bhattacharya for his enthusiastic efforts to restart research into Apios in the U.S., and for pioneering breeding work in the 1980s with Apios americana by Berthal D. Reynolds and William J. Blackmon. This work was supported by the United States Department of Agriculture, Agricultural Research Service (USDA-ARS) CRIS Project 5030-21000-071-000D. This research used resources provided by the SCINet project and/or the AI Center of Excellence of the USDA Agricultural Research Service, ARS project numbers 0201-88888-003-000D and 0201-88888-002-000D. This research was supported in part by an appointment to the Agricultural Research Service (ARS) Postdoctoral Research Program administered by the Oak Ridge Institute for Science and Education (ORISE) through an interagency agreement between the U.S. Department of Energy (DOE) and the U.S. Department of Agriculture (USDA). The USDA is an equal opportunity provider and employer. Mention of trade names or commercial products in this article is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture.

Author contributions

H.L. and S.B.C. conducted primary analyses including genome annotation, drafted the manuscript, and managed project data. H.C.W. and J.C. assembled the genome sequences, including quality control and correction steps. B.D.J. conducted analysis of tandem and centromeric repeats. V.B. and J.S. collected and prepared tissue for RNA sequencing from A. americana and A. priceana, and conducted work to characterize the sequenced accessions. S.K. managed field plots, planting, and harvests. All authors approved the final draft.

Code availability

All code used for analysis in this work was from published bioinformatics tools, with software and versions indicated under Methods.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

The online version contains supplementary material available at 10.1038/s41597-026-06915-y.

References

  • 1.Govaerts, R. WCVP: World Checklist of Vascular Plants. Facilitated by the Royal Botanic Gardens, Kew (2024).
  • 2.Kalberer, S., Belamkar, V., Singh, J. & Cannon, S. Apios americana: natural history and ethnobotany. LEGUME29 (2020).
  • 3.Woods, M. A revision of the North American species of Apios (Fabaceae). Castanea70, 85–100 (2005). [Google Scholar]
  • 4.Li, J. et al. Phylogenetics and biogeography of Apios (Fabaceae) inferred from sequences of nuclear and plastid genes. Int. J. Plant Sci.175, 764–780 (2014). [Google Scholar]
  • 5.Yangcheng, H., Gong, L., Zhang, Y. & Jane, J. Pysicochemical properties of Tibetan hull-less barley starch. Carbohydr. Polym.137, 525–531 (2016). [DOI] [PubMed] [Google Scholar]
  • 6.Blackmon, W. & Reynolds, B. The crop potential of Apios americana—preliminary evaluations. HortScience21, 1334–1336 (1986). [Google Scholar]
  • 7.Belamkar, V. et al. Genomics-assisted characterization of a breeding collection of Apios americana, an edible tuberous legume. Sci. Rep.6, 34908 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Seabrook, J. A. & Dionne, L. A. Studies on the genus Apios. I. Chromosome number and distribution of Apios americana and A. priceana. Can. J. Bot.54, 2567–2572 (1976). [Google Scholar]
  • 9.Schmutz, J. et al. Genome sequence of the palaeopolyploid soybean. nature463, 178–183 (2010). [DOI] [PubMed] [Google Scholar]
  • 10.Schmutz, J. et al. A reference genome for common bean and genome-wide analysis of dual domestications. Nat. Genet.46, 707–713 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Lonardi, S. et al. The genome of cowpea (Vigna unguiculata [L.] Walp.). Plant J.98, 767–782 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Song, T. et al. Chromosome-Scale reference genome of Amphicarpaea edgeworthii: A new resource for amphicarpic plants research and complex flowering pattern. Front. Plant Sci.12, 770660 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Qin, S. et al. A draft genome for Spatholobus suberectus. Sci. Data6, 113 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Stefanović, S., Pfeil, B. E., Palmer, J. D. & Doyle, J. J. Relationships among phaseoloid legumes based on sequences from eight chloroplast regions. Syst. Bot.34, 115–128 (2009). [Google Scholar]
  • 15.Wojciechowski, M. F., Lavin, M. & Sanderson, M. J. A phylogeny of legumes (Leguminosae) based on analysis of the plastid matK gene resolves many well‐supported subclades within the family. Am. J. Bot.91, 1846–1862 (2004). [DOI] [PubMed] [Google Scholar]
  • 16.Lavin, M., Herendeen, P. S. & Wojciechowski, M. F. Evolutionary rates analysis of Leguminosae implicates a rapid diversification of lineages during the tertiary. Syst. Biol.54, 575–594 (2005). [DOI] [PubMed] [Google Scholar]
  • 17.Ren, L., Huang, W. & Cannon, S. B. Reconstruction of ancestral genome reveals chromosome evolution history for selected legume species. New Phytol.223, 2090–2103 (2019). [DOI] [PubMed] [Google Scholar]
  • 18.Belamkar, V. et al. Evaluation of phenotypic variation in a collection of Apios americana: an edible tuberous legume. Crop Sci.55, 712–726 (2015). [Google Scholar]
  • 19.Marçais, G. & Kingsford, C. A fast, lock-free approach for efficient parallel counting of occurrences of k-mers. Bioinformatics27, 764–770 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ranallo-Benavidez, T. R., Jaron, K. S. & Schatz, M. C. GenomeScope 2.0 and Smudgeplot for reference-free profiling of polyploid genomes. Nat. Commun.11, 1432 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Cheng, Y., Liu, M., Hu, M. & Wang, S. TAD-like single-cell domain structures exist on both active and inactive X chromosomes and persist under epigenetic perturbations. Genome Biol.22, 1–26 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Gurevich, A., Saveliev, V., Vyahhi, N. & Tesler, G. QUAST: quality assessment tool for genome assemblies. Bioinformatics29, 1072–1075 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Rhie, A., Walenz, B. P., Koren, S. & Phillippy, A. M. Merqury: reference-free quality, completeness, and phasing assessment for genome assemblies. Genome Biol.21, 245 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Vaser, R., Sović, I., Nagarajan, N. & Šikić, M. Fast and accurate de novo genome assembly from long uncorrected reads. Genome Res.27, 737–746 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Li, H. Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. ArXiv Prepr. ArXiv13033997 (2013).
  • 26.Open2C. et al. Pairtools: from sequencing data to chromosome contacts. PLOS Comput. Biol.20, e1012164 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Durand, N. C. et al. Juicer provides a one-click system for analyzing loop-resolution Hi-C experiments. Cell Syst.3, 95–98 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Dudchenko, O. et al. De novo assembly of the Aedes aegypti genome using Hi-C yields chromosome-length scaffolds. Science356, 92–95 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Zhou, C., McCarthy, S. A. & Durbin, R. YaHS: yet another Hi-C scaffolding tool. Bioinformatics39, btac808 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.McKenna, A. et al. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res.20, 1297–1303 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Flynn, J. M. et al. RepeatModeler2 for automated genomic discovery of transposable element families. Proc. Natl Acad. Sci.117, 9451–9457 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Smit, A., Hubley, R. & Green, P. RepeatMasker Open-4.0. 2013–2015. (2015).
  • 33.Olson, D. R. & Wheeler, T. J. ULTRA-effective labeling of tandem repeats in genomic sequence. Bioinforma. Adv.4, vbae149 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Quinlan, A. R. & Hall, I. M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics26, 841–842 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Gabriel, L. et al. BRAKER3: Fully automated genome annotation using RNA-seq and protein evidence with GeneMark-ETP, AUGUSTUS, and TSEBRA. Genome Res.34, 769–777 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Cannon, S. B., Lee, H.-O., Weeks, N. T. & Berendzen, J. Pandagma: a tool for identifying pan-gene sets and gene families at desired evolutionary depths and accommodating whole-genome duplications. Bioinformatics40, btae526 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Singh, J. et al. A transcriptome-SNP-derived linkage map of Apios americana (potato bean) provides insights about genome re-organization and synteny conservation in the phaseoloid legumes. Theor. Appl. Genet.131, 333–351 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Marçais, G. et al. MUMmer4: A fast and versatile genome alignment system. PLoS Comput. Biol.14, e1005944 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Yang, Z. PAML 4: phylogenetic analysis by maximum likelihood. Mol. Biol. Evol.24, 1586–1591 (2007). [DOI] [PubMed] [Google Scholar]
  • 40.NCBI BioProject: Apios americana (BioProject PRJNA1251543). https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1251543/ (2025).
  • 41.NCBI BioProject: Apios americana (BioProject PRJNA1251542). https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1251542/ (2025).
  • 42.GenBank: Apios americana whole genome shotgun sequencing projects.https://identifiers.org/ncbi/insdc:JBPVNU000000000 (2025).
  • 43.GenBank: Apios americana whole genome shotgun sequencing projects.https://identifiers.org/ncbi/insdc:JBPVNT000000000 (2025).
  • 44.NCBI Sequence Read Archivehttps://identifiers.org/ncbi/insdc.sra:SRR37162738 (2026).
  • 45.NCBI Sequence Read Archivehttps://identifiers.org/ncbi/insdc.sra:SRR37162735 (2026).
  • 46.NCBI BioProject: Apios priceana (BioProject PRJNA1251038).https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1251038 (2025).
  • 47.NCBI BioProject: Apios priceana (BioProject PRJNA1252084).https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1252084 (2025).
  • 48.GenBank: Apios priceana whole genome shotgun sequencing projects.https://identifiers.org/ncbi/insdc:JBNFDG000000000 (2025).
  • 49.GenBank: Apios priceana whole genome shotgun sequencing projects.https://identifiers.org/ncbi/insdc:JBNFDF000000000 (2025).
  • 50.NCBI Sequence Read Archivehttps://identifiers.org/ncbi/insdc.sra:SRR37162736 (2026).
  • 51.NCBI Sequence Read Archivehttps://identifiers.org/ncbi/insdc.sra:SRR37162737 (2026).
  • 52.Legume Information System Datastore. Apios americana and Apios priceana genome assemblies and annotations. https://data.legumeinfo.org/Apios/ (2025).
  • 53.Cannon, S. B. et al. Data from: Chromosome-level haplotype-resolved genome assemblies and annotations of Apios americana and Apios priceana. Ag Data Commons. Dataset.10.15482/USDA.ADC/29274848.v1 (2025). [DOI] [PMC free article] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Citations

  1. GenBank: Apios americana whole genome shotgun sequencing projects.https://identifiers.org/ncbi/insdc:JBPVNU000000000 (2025).
  2. GenBank: Apios americana whole genome shotgun sequencing projects.https://identifiers.org/ncbi/insdc:JBPVNT000000000 (2025).
  3. NCBI Sequence Read Archivehttps://identifiers.org/ncbi/insdc.sra:SRR37162738 (2026).
  4. NCBI Sequence Read Archivehttps://identifiers.org/ncbi/insdc.sra:SRR37162735 (2026).
  5. NCBI Sequence Read Archivehttps://identifiers.org/ncbi/insdc.sra:SRR37162736 (2026).
  6. NCBI Sequence Read Archivehttps://identifiers.org/ncbi/insdc.sra:SRR37162737 (2026).
  7. Cannon, S. B. et al. Data from: Chromosome-level haplotype-resolved genome assemblies and annotations of Apios americana and Apios priceana. Ag Data Commons. Dataset.10.15482/USDA.ADC/29274848.v1 (2025). [DOI] [PMC free article] [PubMed]

Supplementary Materials

41597_2026_6915_MOESM1_ESM.docx (39.3KB, docx)

Supplementary data and analysis for: Chromosome-level haplotype-resolved genome assemblies and annotations of Apios americana and Apios priceana

Data Availability Statement

All code used for analysis in this work was from published bioinformatics tools, with software and versions indicated under Methods.

Articles from Scientific Data are provided here courtesy of Nature Publishing Group

RESOURCES