Abstract
Background
Glioblastoma (GBM), the most common and aggressive subtype of glioma, currently lacks effective therapeutic targets. This study aimed to elucidate the role of chitinase-3-like protein 2 (CHI3L2) and its underlying mechanism in GBM cell proliferation and migration.
Methods
Gene Expression Profiling Interactive Analysis 2 (GEPIA2) and Chinese Glioma Genome Atlas (CGGA) databases were used to analyze the messenger RNA (mRNA) expression level of CHI3L2 and its prognostic significance in different grades of glioma patients. Western blotting was performed to determine the protein levels of CHI3L2 in different GBM cell lines. The efficiency of lentivirus-mediated CHI3L2 knockdown or overexpression was tested by real-time quantitative polymerase chain reaction (RT-qPCR) and Western blotting in LN-229 and U251 cells. Cell proliferation was determined by cell counting kit-8 (CCK-8) and 5-ethynyl-2'-deoxyuridine (EdU) assays. Cell migration was detected by the wound healing assay. Cell cycle distribution was analyzed by flow cytometry. Protein levels of key cell cycle-related regulators (e.g., c-MYC, CDK2, CDK4) and migration-related regulators (e.g., E-cadherin, N-cadherin, MMP2, MMP9) were measured by Western blotting.
Results
Integrated bioinformatics analysis demonstrated that high CHI3L2 expression was correlated with shortened overall survival (OS) and disease-free survival (DFS) in GBM patients. CHI3L2 knockdown significantly suppressed cell proliferation, G1/S transition, and cell migration in LN-229 and U251 cells; conversely, CHI3L2 overexpression facilitated these cellular processes. Furthermore, CHI3L2 knockdown markedly reduced the protein levels of c-MYC, CDK2, CDK4, N-cadherin, MMP2, and MMP9 but increased E-cadherin.
Conclusions
Elevated CHI3L2 expression drives GBM cell proliferation and migration, suggesting that CHI3L2 is a promising therapeutic target for GBM.
Keywords: Glioblastoma (GBM), chitinase-3-like protein 2 (CHI3L2), cell proliferation, cell migration, epithelial-mesenchymal transition (EMT)
Highlight box.
Key findings
• High chitinase-3-like protein 2 (CHI3L2) expression is associated with poor prognosis in glioblastoma (GBM) patients.
• CHI3L2 promotes GBM cell proliferation and migration.
What is known and what is new?
• GBM is an aggressive subtype of glioma but currently lacks effective therapeutic targets.
• This study identifies CHI3L2 as a key driver in GBM and a promising therapeutic target.
What is the implication, and what should change now?
• Targeting CHI3L2 may provide a novel therapeutic strategy against GBM. Further exploration is required to unravel the mechanism by which CHI3L2 regulates cell cycle and epithelial-mesenchymal transition progression.
Introduction
Gliomas are common primary intracranial tumors in adults, accounting for approximately 30% of primary brain tumors (1-3). Based on their originating glial cells, gliomas are broadly categorized into astrocytomas, ependymomas, and oligodendrogliomas (4). Additionally, according to histopathological features, the World Health Organization (WHO) classifies gliomas into four grades: WHO I, WHO II, WHO III, and WHO IV. Notably, higher grades indicate greater aggressiveness and poorer prognosis (5,6). Glioblastoma (GBM), a WHO IV astrocytoma accounting for over 50% of all gliomas, is characterized by its extreme aggressiveness and almost inevitable recurrence (7). Currently, the standard treatment for GBM involves maximal safe surgical resection, followed by radiotherapy and chemotherapy (e.g., temozolomide) (7,8). However, due to the aggressive growth pattern of GBM, complete surgical resection is rarely achievable; consequently, the median survival for GBM patients is less than 15 months (8,9). Therefore, elucidating the molecular mechanisms underlying GBM pathogenesis and identifying novel therapeutic targets are essential to improve GBM clinical outcomes.
Numerous studies have shown that chitinase-3-like protein 1 (CHI3L1), also known as YKL40, is overexpressed in various cancers, including breast, lung, colorectal cancers, as well as GBM (10-12). CHI3L1 serves as a critical mediator of tumor cell proliferation, invasion, chemoresistance, and immune evasion through multiple mechanisms (10,12-14). Interestingly, despite 51% sequence homology to the well-studied CHI3L1, CHI3L2 remains poorly investigated in cancer research (14). Specifically, the function and molecular mechanisms of CHI3L2 in GBM are not yet fully understood.
In this study, we found that high CHI3L2 expression was associated with poor prognosis in GBM patients. Critically, lentiviral-mediated gain- and loss-of-function experiments in LN-229 and U251 cells established that CHI3L2 promoted GBM cell proliferation and migration. Collectively, these findings indicate that CHI3L2 may serve as a novel poor prognostic biomarker and/or therapeutic target in GBM. We present this article in accordance with the MDAR reporting checklist (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2353/rc).
Methods
Bioinformatics analysis
The online database Gene Expression Profiling Interactive Analysis 2 (GEPIA2) (http://gepia2.cancer-pku.cn/#index) with default parameters was used to identify differentially expressed genes in GBM (P<0.05), as well as to analyze the overall survival (OS) and disease-free survival (DFS) of GBM patients (15). In the GEPIA2 database (163 GBM vs. 207 normal samples), survival analysis is evaluated using the log-rank test, also known as the Mantel-Cox test (15,16). The online database Chinese Glioma Genome Atlas (CGGA) (http://www.cgga.org.cn/) with default parameters was employed to examine gene expression in various glioma grades and the survival outcomes of the patients (2). The CGGA dataset consists of messenger RNA (mRNA) sequencing data from 325 samples, which were performed on the Illumina HiSeq 2000 or 2500 platform (2). This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments.
Cell culture
Normal human astrocytes (NHA), GBM cell lines (SHG44, U87, A172, U251, and LN-229), and HEK293T cells were cultured in Dulbecco’s modified Eagle medium (DMEM; Gibco, Waltham, MA, USA; C11995500BT) supplemented with 10% fetal bovine serum (FBS; VivaCell, Shanghai, China; C04001-050X10) and 1% penicillin-streptomycin (VivaCell; C3420-0100). Cells were maintained in a humidified incubator at 37 ℃ with 5% CO2.
Real-time quantitative polymerase chain reaction (RT-qPCR) assay
Total RNA was extracted from U251 or LN-229 cells using TRIzol reagent (Invitrogen, Waltham, MA, USA; 15596018CN) following the manufacturer’s protocol. Total RNA was dissolved in RNase-free water, and its purity and concentration were measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA; 840-317500). 1 µg of total RNA was reverse transcribed into complementary DNA (cDNA) using a PrimeScript RT Reagent Kit (TaKaRa, Tokyo, Japan; RR047A). RT-qPCR was performed using Hieff® qPCR SYBR® Green Master Mix (Yeasen, Shanghai, China; 11201ES08) on a real-time PCR system (Bio-Rad, Hercules, CA, USA; CFX Duet). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal reference control. Relative gene expression was calculated using the 2−ΔΔCT method, and all RT-qPCR assays were biologically replicated at least three times. The primer sequences were listed in Table 1.
Table 1. RT-qPCR primer sequences.
| Gene | Forward primer (5'-3') | Reverse primer (5'-3') |
|---|---|---|
| GAPDH | GGTGAAGGTCGGAGTCAACG | TGGGTGGAATCATATTGGAACA |
| CHI3L2 | ATCACAGAGTCTTCAGGCTTCC | TCTTCACATCATCATAGCCCAC |
CHI3L2, chitinase-3-like protein 2; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; RT-qPCR, real-time quantitative polymerase chain reaction.
Lentivirus production
Plasmid DNA was transfected using Lipofectamine® 2000 Reagent (Invitrogen; 11668-019) according to the manufacturer’s instructions. For knockdown experiments, lentiviruses were generated using pLKO.1-puro and packaging plasmids (psPAX2 and pMD2.G) in HEK293T cells. The short hairpin RNA (shRNA) sequences targeting CHI3L2 were listed in Table 2. For overexpression experiments, the CDS sequence of CHI3L2 was cloned into the pCDH-CMV-MCS-puro vector with EcoRI and NotI restriction enzymes. Lentiviruses were generated using pCDH-CMV-CHI3L2 and packaging plasmids (pMDL, VSVG, and REV) in HEK293T cells. Lentiviruses were harvested at 48 and 72 h post-transfection, respectively, and stored at −80 ℃ until use.
Table 2. shRNA sequences.
| shRNAs | Sequence (5'-3') |
|---|---|
| sh-NC | CCTAAGGTTAAGTCGCCCTCG |
| shCHI3L2-1# | AGGGAGGCAAATGATTGATAA |
| shCHI3L2-2# | ATCACGCTTGGAATTCATTAA |
CHI3L2, chitinase-3-like protein 2; shCHI3L2, shRNA CHI3L2; shNC, shRNA negative control; shRNA, short hairpin RNA.
Western blotting assay
U251 or LN-229 cells were collected and lysed in ice-cold RIPA buffer (NCM Biotech, Suzhou, China; WB3100) supplemented with 1× protease inhibitor cocktail (MCE, HY-K0010) for 30 min on ice. Lysates were centrifuged at 12,000 ×g for 10 min at 4 ℃, and the protein supernatant was collected. Protein concentrations were determined using the bicinchoninic acid (BCA) kit (Beyotime, P0010). Proteins were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels and then transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica, MA, USA; IPVH00010). The membranes were blocked with 5% non-fat milk in 1× phosphate-buffered saline (PBS) with 0.1% Tween-20 (PBST) for 1 h at room temperature. Primary antibodies (Table 3) were incubated overnight at 4 ℃. After the membranes were washed three times with PBST, secondary antibodies (horseradish peroxidase-conjugated) were incubated for 1 h at room temperature. Finally, the targeted protein bands were visualized using an enhanced chemiluminescence (ECL) reagent (NCM Biotech; P10300) and an imaging system (Tanon, Shanghai, China; 4600).
Table 3. Antibodies for Western blotting.
| Antibody | No. of catalogue | Supplier |
|---|---|---|
| CHI3L2 | 27363-1-AP | Proteintech |
| c-MYC | 10828-1-AP | Proteintech |
| CDK2 | 10122-1-AP | Proteintech |
| CDK4 | 11026-1-AP | Proteintech |
| MMP2 | 10373-2-AP | Proteintech |
| MMP9 | 10375-2-AP | Proteintech |
| N-cadherin | 22018-1-AP | Proteintech |
| E-cadherin | 20874-1-AP | Proteintech |
| Tubulin | 2148 | CST |
CHI3L2, chitinase-3-like protein 2; MMP, matrix metalloproteinase; No., number.
Cell counting kit-8 (CCK-8) assay
Cell proliferation was assessed using the CCK-8 kit (APExBIO, Houston, TX, USA; K1018) according to the manufacturer’s instructions. Briefly, U251 and LN-229 cells were seeded in 96-well plates at 2.5×103 cells/well. After the appropriate incubation period, the medium was discarded and replaced with 110 µL of fresh medium containing CCK-8 reagent (diluted 10:1). Plates were then incubated for 2 h at 37 ℃ in the dark. The optical density (OD) at 450 nm was measured using a microplate reader (Bio-Tek, Winooski, VT, USA; Synergy H1).
5-ethynyl-2'-deoxyuridine (EdU) assay
Cell proliferation was assessed using an EdU assay kit (US Everbright, Suzhou, China; C6043M) following the manufacturer’s protocol. Briefly, cells were seeded into 24-well plates at (2–3)×104 cells/well. After the appropriate incubation period, the medium was discarded and replaced with 10 µM EdU working solution, followed by incubation at 37 ℃ with 5% CO2 for 2 h for EdU labeling. Subsequently, cells were fixed with 4% paraformaldehyde (PFA) for 30 min and stained with Hoechst at room temperature for 30 min in the dark. Images were captured using a fluorescence microscope (Nikon, Tokyo, Japan; Eclipse Ts2R). Finally, the percentage of EdU-positive cells relative to the total number of cells was calculated.
Cell cycle analysis
Cell cycle analysis was performed using a cell cycle assay kit (4A Biotech, Beijing, China; FXP0211-100) according to the manufacturer’s instructions. Briefly, harvested cells were washed with twice with ice-cold 1× PBS, then fixed in 75% ethanol at 4 ℃ for 12 h at least. After discarding the supernatant at 500 ×g for 5 min at 4 ℃, the cell pellet was resuspended in 400 µL of cell cycle staining solution containing propidium iodide (PI) and RNase A at room temperature in the dark for 30 min. Subsequently, cells were washed twice with ice-cold 1× PBS and resuspended in 500 µL 1× PBS. Finally, samples were analyzed using a flow cytometer (Beckman Coulter, Brea, CA, USA; CytoFLEX LX). Cell cycle distribution was quantified using FlowJo software.
Wound healing assay
LN-229 or U251 cells were seeded in six-well plates at a density of (3–4)×104 cells/well. When the cells reached near 100% confluence, a linear wound was generated using a sterile yellow 200 µL pipette tip. Subsequently, the medium was replaced with serum-free DMEM. Wound images were captured at 0 and 24 h after the wounds were generated using a microscope (Nikon; Eclipse Ts2R). The cell migration rate was calculated as follows: migration rate (%) = [(initial wound width − final wound width)/initial wound width] × 100%.
Statistical analysis
All experimental data in this study were systematically analyzed using GraphPad Prism software version 9.0 (GraphPad Software, San Diego, CA, USA). All quantitative data are presented as mean ± standard deviation (SD). Differences between experimental groups were assessed via independent samples t-tests (two groups) or one-way analysis of variance (ANOVA) (≥3 groups). All assays were biologically replicated at least three times. A P value <0.05 was considered to indicate a statistically significant difference between groups.
Results
Expression and clinical significance of CHI3L2 in GBM
To identify differentially expressed genes in GBM, we analyzed data from the GEPIA2 database (163 GBM vs. 207 normal samples) and found that among the top 10 most highly expressed genes, only the elevated CHI3L2 mRNA level was significantly associated with reduced OS and DFS in GBM patients (Figure 1A-1D). Compared with lower-grade glioma, CHI3L2 mRNA expression was the highest in WHO IV gliomas (predominantly GBM) and significantly correlated with poor OS in these patients (Figure 1E,1F). Additionally, CHI3L2 mRNA expression was markedly higher in isocitrate dehydrogenase (IDH) wild-type WHO IV gliomas than in IDH-mutant (Figure 1G). Compared with NHA, CHI3L2 was highly expressed in these GBM cell lines: A172, U251, and LN-229 (Figure 1H).
Figure 1.
Expression and clinical significance of CHI3L2 in GBM. (A) The flowchart to identify clinically relevant genes in GBM via GEPIA2 database analysis. (B) The GEPIA2 database was used to analyze CHI3L2 mRNA level in normal brain tissues (n=207) and GBM tissues (n=163). (C,D) High CHI3L2 mRNA level significantly correlated with reduced OS and DFS in GBM, as validated via GEPIA2 database. (E) CHI3L2 mRNA level was up-regulated in WHO IV gliomas via CGGA database analysis. (F) High expression of CHI3L2 was correlated with poor survival in WHO IV gliomas via CGGA database analysis. (G) CHI3L2 was up-regulated in IDH-wildtype gliomas compared to IDH-mutant gliomas in WHO IV gliomas via CGGA database analysis. (H) Western blotting assay showing the CHI3L2 protein expression in NHA and glioma cell lines. *, P<0.05. ANOVA, analysis of variance; CGGA, Chinese Glioma Genome Atlas; CHI3L2, chitinase-3-like protein 2; DFS, disease-free survival; GBM, glioblastoma; GEPIA2, Gene Expression Profiling Interactive Analysis 2; IDH, isocitrate dehydrogenase; mRNA, messenger RNA; NHA, normal human astrocytes; OS, overall survival; TCGA, The Cancer Genome Atlas; WHO, World Health Organization.
CHI3L2 knockdown inhibits GBM cell proliferation
To investigate the function of CHI3L2, lentivirus-mediated CHI3L2 knockdown was performed in LN-229 and U251 cells, and the knockdown efficiency was assessed by RT-qPCR and Western blotting, respectively (Figure 2A-2D). Subsequently, CCK-8 (Figure 2E,2F) and EdU (Figure 2G-2J) assays demonstrated that CHI3L2 knockdown significantly inhibited cell proliferation of LN-229 and U251 cells compared with the shRNA negative control (shNC) group. Together, these findings indicate that CHI3L2 knockdown suppresses GBM cell proliferation.
Figure 2.
CHI3L2 knockdown inhibits GBM cell proliferation. (A,B) The knockdown efficiency of CHI3L2 in LN-229 was assessed by RT-qPCR and Western blotting, respectively. (C,D) The knockdown efficiency of CHI3L2 in U251 cells was assessed by RT-qPCR and Western blotting, respectively. (E,F) CCK-8 assays showed that CHI3L2 knockdown inhibited LN-229 and U251 cell proliferation. (G-J) EdU assays showed that CHI3L2 knockdown inhibited LN-229 and U251 cell proliferation. ***, P<0.001. CCK-8, cell counting kit-8; CHI3L2, chitinase-3-like protein 2; EdU, 5-ethynyl-2'-deoxyuridine; GBM, glioblastoma; OD, optical density; RT-qPCR, real-time quantitative polymerase chain reaction; shCHI3L2, shRNA CHI3L2; shNC, shRNA negative control; shRNA, short hairpin RNA.
CHI3L2 knockdown arrests cell cycle G1/S phase transition in GBM cells
Given that dysregulated cell proliferation is closely linked to cell cycle disturbance, cell cycle analysis was subsequently performed. Flow cytometry analysis revealed that CHI3L2 knockdown led to an increased proportion of cells in the G1 phase and a decreased proportion in the S phase, indicating an inhibition of the G1/S phase transition (Figure 3A-3D). Furthermore, Western blotting analysis demonstrated that CHI3L2 knockdown markedly inhibited the expression of cell cycle-related regulators c-MYC, CDK2, and CDK4 in LN-229 and U251 cells (Figure 3E-3H).
Figure 3.
CHI3L2 knockdown arrests cell cycle G1/S phase transition in GBM cells. (A-D) Cell cycle distribution in LN-229 and U251 cells following CHI3L2 knockdown. (E-H) Western blotting analysis and corresponding quantitative results of c-MYC, CDK2, and CDK4 expression in LN-229 and U251 cells following CHI3L2 knockdown. **, P<0.01; ***, P<0.001. CHI3L2, chitinase-3-like protein 2; GBM, glioblastoma; PI, propidium iodide; shCHI3L2, shRNA CHI3L2; shNC, shRNA negative control; shRNA, short hairpin RNA.
CHI3L2 knockdown impairs GBM cell migration
As invasive growth is a hallmark characteristic of GBM, a wound healing assay was performed to assess cell migration ability in LN-229 and U251 cells. These results indicated that CHI3L2 knockdown significantly inhibited the migration ability of LN-229 and U251 cells (Figure 4A,4B). Moreover, CHI3L2 knockdown suppressed the protein expression levels of epithelial-mesenchymal transition (EMT)-related regulators N-cadherin, MMP9, and MMP2 in LN-229 and U251 cells, but promoted the protein expression of E-cadherin (Figure 4C-4F).
Figure 4.
CHI3L2 knockdown impairs GBM cell migration. (A,B) The ability of cell migration was assessed by wound healing assay in LN-229 and U251 cells following CHI3L2 knockdown. (C-F) Western blotting analysis and corresponding quantitative results of N-cadherin, E-cadherin, MMP2 and MMP9 expression in LN-229 and U251 cells following CHI3L2 knockdown. **, P<0.01; ***, P<0.001. CHI3L2, chitinase-3-like protein 2; GBM, glioblastoma; shCHI3L2, shRNA CHI3L2; shNC, shRNA negative control; shRNA, short hairpin RNA.
CHI3L2 overexpression promotes GBM cell proliferation and G1/S phase transition
Additionally, lentivirus-mediated CHI3L2 overexpression was also performed, and the overexpression efficiency was assessed by RT-qPCR and Western blotting, respectively (Figure 5A-5C). Consistently, CCK-8 (Figure 5D,5E) and EdU (Figure 5F,5G) assays demonstrated that CHI3L2 overexpression significantly enhanced the proliferation of LN-229 and U251 cells. Flow cytometry analysis revealed that CHI3L2 overexpression promoted the G1/S phase transition in LN-229 and U251 cells, evidenced by a decreased proportion of cells in the G1 phase and an increased proportion in the S phase (Figure 5H-5K).
Figure 5.
CHI3L2 overexpression promotes cell proliferation and G1/S phase transition in GBM. (A-C) The overexpression efficiency of CHI3L2 in LN-229 and U251 was assessed by Western blotting and RT-qPCR assay, respectively. (D,E) CCK-8 assays showed that CHI3L2 overexpression promoted LN-229 and U251 cell proliferation. (F,G) EdU assays showed that CHI3L2 overexpression promoted LN-229 and U251 cell proliferation. (H-K) Cell cycle distribution in LN-229 and U251 cells following CHI3L2 overexpression. **, P<0.01; ***, P<0.001. CCK-8, cell counting kit-8; CHI3L2, chitinase-3-like protein 2; EdU, 5-ethynyl-2'-deoxyuridine; GBM, glioblastoma; OD, optical density; PI, propidium iodide; RT-qPCR, real-time quantitative polymerase chain reaction.
CHI3L2 overexpression facilitates GBM cell migration
We have confirmed that CHI3L2 knockdown inhibits GBM cell migration (Figure 4); therefore, we hypothesized that its overexpression may promote migration. To test this, we overexpressed CHI3L2 in LN-229 and U251 cells using a lentiviral system and then performed a wound healing assay. Consistent with our hypothesis, compared with the control group (vector group), CHI3L2 overexpression significantly promoted the migration of LN-229 and U251 cells (Figure 6A,6B). Collectively, our loss- and gain-of-function experiments demonstrate that CHI3L2 plays a crucial role in promoting GBM cell migration.
Figure 6.
CHI3L2 overexpression facilitates GBM cell migration. (A) The ability of cell migration was assessed by wound healing assay in LN-229 cells following CHI3L2 overexpression. (B) The ability of cell migration was assessed by wound healing assay in U251 cells following CHI3L2 overexpression. (C) Schematic diagram depicting the role of CHI3L2 in GBM progression. ***, P<0.001. CHI3L2, chitinase-3-like protein 2; EMT, epithelial-mesenchymal transition; GBM, glioblastoma.
Discussion
GBM is a highly aggressive and lethal primary central nervous system (CNS) tumor, characterized by invasive growth and poor prognosis. Despite significant progress in the current treatment of GBM, the median survival for GBM patients remains under 15 months (8,9). Hence, it is imperative to discover novel treatment approaches and therapeutic targets for GBM patients.
CHI3L2, also known as YKL39, belongs to evolutionarily conserved glycoside hydrolase family 18 (GH18) (14). Through analysis of the Tumor Immune Estimation Resource (TIMER) database (17,18). Liu et al. found that CHI3L2 expression is closely associated with tumor-infiltrating immune cells, including monocytes, M1/M2 macrophages, and tumor-associated macrophages (TAMs) (19). These findings indicate a potential immunomodulatory role for CHI3L2 in GBM, but its precise regulatory functions and underlying molecular mechanisms require further investigation. While current research on CHI3L2 in oncology is limited, emerging evidence suggests its oncogenic functions. For example, CHI3L2 has been reported to act as an oncogene in T-cell acute lymphoblastic leukemia (T-ALL), where its knockdown inhibited T-ALL cell proliferation and promoted apoptosis (19). However, the function and molecular mechanisms of CHI3L2 in GBM remain unclear.
In this study, we confirmed that high CHI3L2 expression in GBM was correlated with unfavorable OS and DFS in GBM patients (Figure 1). It is reported that over 90% of GBMs are IDH-wildtype tumors, which are more aggressive and associated with a poorer prognosis than IDH-mutant tumors (1,8,20). Consistently, analysis of the CGGA database confirmed that CHI3L2 was up-regulated in IDH-wildtype WHO IV gliomas compared to IDH-mutant tumors (Figure 1G). We also found that CHI3L2 was highly expressed in the GBM cell lines compared with NHA cells (Figure 1H). Overall, these data indicate that the high CHI3L2 expression may be an unfavorable prognostic marker for GBM patients.
Given that invasive growth is a key hallmark of GBM (7,8), we assessed the effects of lentivirus-mediated CHI3L2 knockdown and overexpression on cell proliferation and migration of GBM. CCK-8 and EdU assays demonstrated that CHI3L2 knockdown significantly inhibited the proliferation of LN-229 and U251 cells (Figure 2), whereas CHI3L2 overexpression markedly promoted their proliferation (Figure 5A-5G). Cell cycle analysis further revealed that the G1/S phase transition was arrested in LN-229 and U251 cells upon CHI3L2 knockdown (Figure 3A-3D). Conversely, CHI3L2 overexpression accelerated the G1/S phase progression (Figure 5H-5K). It has been reported that c-MYC, CDK2, and CDK4 are key regulators regulating cell proliferation and the G1/S phase transition (21-24). Our study also found that CHI3L2 knockdown significantly downregulated the protein levels of c-MYC, CDK2, and CDK4 in LN-229 and U251 cells (Figure 3E-3H). However, the precise molecular mechanisms by which CHI3L2 regulates the cell cycle-related regulators require further exploration. Collectively, these findings indicate that CHI3L2 knockdown suppresses GBM cell proliferation.
EMT is an important biological process enabling tumor cells to acquire invasive and migratory capabilities, characterized by downregulation of epithelial markers (e.g., E-cadherin), upregulation of mesenchymal markers (e.g., N-cadherin), and matrix metalloproteinases (MMPs; e.g., MMP2, MMP9) (25,26). E-cadherin, encoded by the CDH1 gene, is a key transmembrane glycoprotein that mediates epithelial cell adhesion at adheres junctions (27). Notably, its loss or downregulation is a hallmark of tumorigenesis and metastasis (27,28). N-cadherin, encoded by the CDH2 gene, is also a transmembrane glycoprotein that plays a fundamental role in calcium-dependent cell-cell adhesion (29). Interestingly, its elevated expression has been linked to enhanced tumor aggressiveness and poorer patient prognosis (29). It is also noteworthy that MMPs are a family of enzymes whose overexpression often drive cancer progression, primarily by degrading and remodeling the extracellular matrix (ECM), thereby enabling tumor invasion, angiogenesis, and metastasis (26,30). In this study, wound healing assays showed that CHI3L2 knockdown inhibited cell migration (Figure 4A,4B), while CHI3L2 overexpression promoted it (Figure 6A,6B). Subsequent Western blotting results indicated that CHI3L2 knockdown significantly decreased N-cadherin, MMP2, and MMP9 expression while increased E-cadherin expression (Figure 4C-4F), suggesting that CHI3L2 drives EMT-mediated migration in GBM cells. Future studies will be required to explore the specific molecular mechanisms by which CHI3L2 regulates the EMT-related regulators.
Although the key cancer-promoting function of CHI3L2 has been clarified here, the limitations of this study are outlined below. First, the precise molecular mechanisms by which CHI3L2 regulates the cell cycle- and EMT-related regulators require further exploration. Performing RNA-seq analysis after CHI3L2 knockdown in the further could serve as an effective strategy for elucidating its downstream regulatory networks, including target genes and signaling pathways. Second, it is still unclear why CHI3L2 is highly expressed in GBM, thus warranting further investigation. In addition, the correlation between CHI3L2 expression and GBM patient outcomes requires further validation in larger clinical cohorts.
Conclusions
Taken together, our study revealed that high CHI3L2 expression is associated with unfavorable prognosis in GBM patients and the significant role of CHI3L2 in promoting GBM cell proliferation and migration (Figure 6C), suggesting that CHI3L2 may serve as a potential novel poor prognostic biomarker and/or therapeutic target for GBM.
Supplementary
The article’s supplementary files as
Acknowledgments
We are grateful to Dr. Wenjin Qiu (The Affiliated Hospital of Guizhou Medical University) for kindly providing the human glioma cell lines A172, LN-229, and U251.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments.
Footnotes
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2353/rc
Funding: This study was supported by the National Natural Science Foundation of China (No. 82160151), the Science and Technology Fund Project of Guizhou Provincial Health Commission (Nos. gzwkj2022-086 and gzwkj2024-068), the Science and Technology Foundation of Guizhou Province (No. Qiankehejichu-ZK[2024] Key Project 050), the Cultivation Project of National Natural Science Foundation of Guizhou Medical University (Nos. gyfynsfc[2022]-38 and 22QNRC07), the Guizhou Provincial Education Department Young Science and Technology Talent Development Project (Qianjiaoji [2022] No. 197), The Affiliated Hospital of Guizhou Medical University Postdoctoral Start-Up Fund Project (No. BSH-Q-2023-11), and the High-Level Talents of Guizhou Medical University Scientific Research Start-Up Fund Project (XiaoboheJzi [2022] No. 067).
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2353/coif). The authors have no conflicts of interest to declare.
Data Sharing Statement
Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2353/dss
References
- 1.Schaff LR, Mellinghoff IK. Glioblastoma and Other Primary Brain Malignancies in Adults: A Review. JAMA 2023;329:574-87. 10.1001/jama.2023.0023 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Zhao Z, Zhang KN, Wang Q, et al. Chinese Glioma Genome Atlas (CGGA): A Comprehensive Resource with Functional Genomic Data from Chinese Glioma Patients. Genomics Proteomics Bioinformatics 2021;19:1-12. 10.1016/j.gpb.2020.10.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Wang L, Gu M, Zhang X, et al. Recent Advances in Nanoenzymes Based Therapies for Glioblastoma: Overcoming Barriers and Enhancing Targeted Treatment. Adv Sci (Weinh) 2025;12:e2413367 . 10.1002/advs.202413367 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Gritsch S, Batchelor TT, Gonzalez Castro LN. Diagnostic, therapeutic, and prognostic implications of the 2021 World Health Organization classification of tumors of the central nervous system. Cancer 2022;128:47-58. 10.1002/cncr.33918 [DOI] [PubMed] [Google Scholar]
- 5.Yang K, Wu Z, Zhang H, et al. Glioma targeted therapy: insight into future of molecular approaches. Mol Cancer 2022;21:39 . 10.1186/s12943-022-01513-z [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Jiang T, Nam DH, Ram Z, et al. Clinical practice guidelines for the management of adult diffuse gliomas. Cancer Lett 2021;499:60-72. 10.1016/j.canlet.2020.10.050 [DOI] [PubMed] [Google Scholar]
- 7.Li J, Feng L, Lu Y. Glioblastoma multiforme: Diagnosis, treatment, and invasion. J Biomed Res 2022;37:47-58. 10.7555/JBR.36.20220156 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Sipos D, Raposa BL, Freihat O, et al. Glioblastoma: Clinical Presentation, Multidisciplinary Management, and Long-Term Outcomes. Cancers (Basel) 2025;17:146 . 10.3390/cancers17010146 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Erices JI, Bizama C, Niechi I, et al. Glioblastoma Microenvironment and Invasiveness: New Insights and Therapeutic Targets. Int J Mol Sci 2023;24:7047 . 10.3390/ijms24087047 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Zhao T, Su Z, Li Y, et al. Chitinase-3 like-protein-1 function and its role in diseases. Signal Transduct Target Ther 2020;5:201 . 10.1038/s41392-020-00303-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Guetta-Terrier C, Karambizi D, Akosman B, et al. Chi3l1 Is a Modulator of Glioma Stem Cell States and a Therapeutic Target in Glioblastoma. Cancer Res 2023;83:1984-99. 10.1158/0008-5472.CAN-21-3629 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Zhao T, Zeng J, Xu Y, et al. Chitinase-3 like-protein-1 promotes glioma progression via the NF-κB signaling pathway and tumor microenvironment reprogramming. Theranostics 2022;12:6989-7008. 10.7150/thno.75069 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Ma B, Akosman B, Kamle S, et al. CHI3L1 regulates PD-L1 and anti-CHI3L1-PD-1 antibody elicits synergistic antitumor responses. J Clin Invest 2021;131:e137750 . 10.1172/JCI137750 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Chen W, Jiang X, Yang Q. Glycoside hydrolase family 18 chitinases: The known and the unknown. Biotechnol Adv 2020;43:107553 . 10.1016/j.biotechadv.2020.107553 [DOI] [PubMed] [Google Scholar]
- 15.Tang Z, Kang B, Li C, et al. GEPIA2: an enhanced web server for large-scale expression profiling and interactive analysis. Nucleic Acids Res 2019;47:W556-60. 10.1093/nar/gkz430 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Tang Z, Li C, Kang B, et al. GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res 2017;45:W98-W102. 10.1093/nar/gkx247 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Li T, Fan J, Wang B, et al. TIMER: A Web Server for Comprehensive Analysis of Tumor-Infiltrating Immune Cells. Cancer Res 2017;77:e108-10. 10.1158/0008-5472.CAN-17-0307 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Li T, Fu J, Zeng Z, et al. TIMER2.0 for analysis of tumor-infiltrating immune cells. Nucleic Acids Res 2020;48:W509-14. 10.1093/nar/gkaa407 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Liu L, Yang Y, Duan H, et al. CHI3L2 Is a Novel Prognostic Biomarker and Correlated With Immune Infiltrates in Gliomas. Front Oncol 2021;11:611038 . 10.3389/fonc.2021.611038 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Le Rhun E, Preusser M, Roth P, et al. Molecular targeted therapy of glioblastoma. Cancer Treat Rev 2019;80:101896 . 10.1016/j.ctrv.2019.101896 [DOI] [PubMed] [Google Scholar]
- 21.Llombart V, Mansour MR. Therapeutic targeting of "undruggable" MYC. EBioMedicine 2022;75:103756 . 10.1016/j.ebiom.2021.103756 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Rubin SM, Sage J, Skotheim JM. Integrating Old and New Paradigms of G1/S Control. Mol Cell 2020;80:183-92. 10.1016/j.molcel.2020.08.020 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Matthews HK, Bertoli C, de Bruin RAM. Cell cycle control in cancer. Nat Rev Mol Cell Biol 2022;23:74-88. 10.1038/s41580-021-00404-3 [DOI] [PubMed] [Google Scholar]
- 24.García-Gutiérrez L, Delgado MD, León J. MYC Oncogene Contributions to Release of Cell Cycle Brakes. Genes (Basel) 2019;10:244 . 10.3390/genes10030244 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Bakir B, Chiarella AM, Pitarresi JR, et al. EMT, MET, Plasticity, and Tumor Metastasis. Trends Cell Biol 2020;30:764-76. 10.1016/j.tcb.2020.07.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.de Almeida LGN, Thode H, Eslambolchi Y, et al. Matrix Metalloproteinases: From Molecular Mechanisms to Physiology, Pathophysiology, and Pharmacology. Pharmacol Rev 2022;74:712-68. 10.1124/pharmrev.121.000349 [DOI] [PubMed] [Google Scholar]
- 27.Wong SHM, Fang CM, Chuah LH, et al. E-cadherin: Its dysregulation in carcinogenesis and clinical implications. Crit Rev Oncol Hematol 2018;121:11-22. 10.1016/j.critrevonc.2017.11.010 [DOI] [PubMed] [Google Scholar]
- 28.Pastushenko I, Blanpain C. EMT Transition States during Tumor Progression and Metastasis. Trends Cell Biol 2019;29:212-26. 10.1016/j.tcb.2018.12.001 [DOI] [PubMed] [Google Scholar]
- 29.Cao ZQ, Wang Z, Leng P. Aberrant N-cadherin expression in cancer. Biomed Pharmacother 2019;118:109320 . 10.1016/j.biopha.2019.109320 [DOI] [PubMed] [Google Scholar]
- 30.Jiang H, Li H. Prognostic values of tumoral MMP2 and MMP9 overexpression in breast cancer: a systematic review and meta-analysis. BMC Cancer 2021;21:149 . 10.1186/s12885-021-07860-2 [DOI] [PMC free article] [PubMed] [Google Scholar]