Skip to main content
Springer logoLink to Springer
. 2026 Jan 10;399(6):8693–8707. doi: 10.1007/s00210-025-04920-3

Praziquantel ameliorates leflunomide-induced nephrotoxicity in mice: a novel therapeutic approach targeting TGF-β/Smad/Wnt/β-catenin/NF-κB/PPAR-γ signaling and Nrf-2

Weam A Elkady 1, Safaa A Faheem 1,, Reem M Hazem 2, Naglaa F El-Orabi 2
PMCID: PMC13086702  PMID: 41513895

Abstract

Leflunomide (LF), an essential immunomodulator for autoimmune disorders, poses a risk of nephrotoxicity. This work was designed to examine the possible mechanisms of LF nephrotoxicity and to investigate the potential protective role of praziquantel (PZQ), an anti-helminthic drug, against LF-induced nephrotoxicity in mice. Forty male albino mice were randomly allocated into four groups. Group one acted as the control. Group two received LF at (10 mg/kg, P.O.). The third group was given both LF (10 mg/kg, P.O.) and PZQ (300 mg/kg, P.O.). Finally, the fourth group was given PZQ (300 mg/kg, P.O.). After eight weeks, the mice were euthanized following anesthesia, and their kidneys were extracted for biochemical and histopathological analysis. Leflunomide (LF) significantly increased serum creatinine (0.88 ± 0.01 mg/dL vs. 0.16 ± 0.01 mg/dL, p < 0.05) and BUN levels (69.15 ± 3.73 mg/dL vs. 32.52 ± 1.18 mg/dL, p < 0.05), while reducing albumin levels by 27.26%. Co-treatment with praziquantel (PZQ) markedly restored renal function, decreasing creatinine and BUN by 71.6% and 34.2%, respectively (p < 0.05), and increasing albumin by 1.2-fold. PZQ also significantly reduced oxidative stress markers (MDA 56.98%, p < 0.05) and pro-inflammatory cytokines (IL-6 − 73.69%, p < 0.05), while upregulating antioxidant (Nrf-2 + 6.7-fold) and anti-inflammatory (PPAR-γ + 3.1-fold) pathways. These statistically significant improvements confirm the nephroprotective efficacy of PZQ against LF-induced nephrotoxicity through modulation of TGF-β/Smad, Wnt/β-catenin, NF-κB, Nrf-2, and PPAR-γ signaling pathways.

Keywords: Leflunomide, Nephrotoxicity, Praziquantel, TGF-β/SMAD signaling, Wnt/β-catenin signaling, PPAR-γ

Introduction

Leflunomide (LF), a synthetic isoxazole derivative, was introduced in late 1998 as a member of a new class of inhibitors targeting dihydroorotate dehydrogenase (DHODH), an enzyme critical for the de novo biosynthesis of pyrimidine nucleotides (Zheng et al. 2023). By non-competitive suppression of pyrimidine synthesis, LF effectively inhibits the proliferation of mitogen-stimulated lymphocytes (Alamri et al. 2021; Jiang et al. 2024). Due to its specific mechanism of action, LF has been approved as an alternative treatment option for patients with refractory rheumatoid arthritis. The FDA recommended precautionary liver function monitoring during LF therapy in the early 2000 s (Alfaro-Lara et al. 2019). In 2010, a black box warning was issued as a result of the potential for severe liver injury (Elshaer et al. 2019). Recently, LF was shown to induce dose-dependent renal injury, characterized by leukocyte infiltration, glomerular and tubular degeneration, and fibrosis (Aljohani et al. 2022).

Nephrotoxicity is a rapid deterioration of renal function caused by the harmful effects of pharmaceuticals or chemicals, such as immunosuppressive agents, frequently employed in treating various diseases (Al-Naimi et al. 2019; Wu and Huang 2018). It occurs by multiple mechanisms involving growth factors, cytokines, toxins, and stress chemicals, which activate particular signaling pathways (Rivera 2022).

Transforming growth factor-β (TGF-β) is a pivotal cytokine in nephrotoxicity, vital for normal development and tissue regeneration; however, its overexpression significantly contributes to renal injury (Meng et al. 2016). In the canonical Smad-dependent TGF-β signaling pathway, Smad proteins are classified as receptor-regulated Smads (Smad2–Smad3), common mediator Smads (Smad4), and inhibitory Smads (Smad7). Smad3 induces pro-fibrotic effects, whereas Smad2 and Smad7 confer renal protection (Cutroneo and Phan 2003; Lan 2012). Smad4 demonstrates dual functions, amplifying Smad3-induced fibrosis and mitigating inflammation (Lan 2011). In pathological conditions, the expression of Smad2 and Smad3 is elevated, whereas the expression of Smad7 is reduced, enhancing pro-fibrotic signaling (Chen et al. 2018).

Transforming growth factor-β interacts with various signaling pathways, including Wnt/β-catenin and Peroxisome proliferator-activated receptor gamma (PPAR-γ), significantly affecting the advancement of nephrotoxicity (Meng et al. 2016; Kökény et al. 2021). The Wnt/β-catenin signaling system is essential for human health, as it governs embryogenesis by coordinating tissue organization and maintaining tissue integrity throughout life. However, dysregulation of Wnt/β-catenin signaling is implicated in various clinical disorders (Faheem et al. 2022), including renal damage (Feng et al. 2018). β-catenin serves as both a structural protein and a transcription factor, with its function being influenced by Wnt ligand presence and its cellular localization (Huffstater et al. 2020), thereby promoting Wnt-dependent gene expression, including c-myc and cyclin D1(Schunk et al. 2021).

The interaction between the Wnt/β-catenin and TGF-β/Smad pathways in kidney damage is multifaceted. Components of the Wnt pathway, such as the Wnt3a ligand and the c-myc target gene, can stimulate the TGF-β/Smad pathway. At the same time, TGF-β simultaneously augments Wnt/β-catenin signaling by interacting with the E3 ubiquitin ligase Beta-transducin repeats-containing proteins (β-TrCP), which suppresses the ubiquitination of β-catenin and facilitates its stability. This demonstrates their interaction’s context-dependent and dynamically evolving nature (Askari 2017; Vallée et al. 2017; Dao et al. 2007).

Peroxisome proliferator-activated receptor gamma, a nuclear hormone receptor superfamily member, was initially recognized in adipocytes and is considered a key regulator of adipogenesis. PPAR-γ is essential for regulating various cell functions, such as proliferation, apoptosis, and differentiation, as well as inflammation, angiogenesis, and immune response processes (Zheng et al. 2002). It also exhibits anti-inflammatory and anti-oxidant effects by modulating the NLRP3 inflammasome, one of the most extensively studied inflammasome complexes, reducing superoxide production and alleviating mitochondrial dysfunction (Li et al. 2023; Sharma and Patial 2022). Several inflammatory cytokines and intracellular signaling pathways, such as TGF-β1, the canonical Wnt/β-catenin pathway and NFκB signaling, reduce PPAR-γ expression. TGF-β1 interacts with the Wnt/β-catenin signaling cascade, typically producing effects that oppose those of PPAR-γ in various pathologies. In liver fibrosis, the TGF-β/Smad and canonical Wnt pathways mutually stimulate each other and downregulate PPAR-γ expression at the transcriptional level. Conversely, PPAR-γ agonists activate Smad7, Glycogen synthase kinase-3 beta (GSK-3β), Dickkopf-1 (DKK) and IκB which inhibit TGF-β, Wnt/β-catenin and NFκB signaling (Vallée et al. 2017; Lakshmi et al. 2017).

Praziquantel (PZQ), a schistosomicide that has been in use for more than three decades, is prominent for its safety, efficacy, and mild adverse effects. Long-term use may induce antifibrotic effects in liver disease, according to previous studies. The underlying mechanism involves the induction of Smad7 expression, which blocks the TGF-β/Smad signaling pathway and subsequently lowers the transcription of pro-fibrotic genes. (Liu et al. 2019; Niu et al. 2022).

From this point, this study subsequently explored the possible nephroprotective effects of PZQ as a Smad7 inducer against LF-induced nephrotoxicity in mice. Specifically, it examines whether PZQ can activate Smad7 and modulate the TGF-β/Smad/Wnt/β-catenin/NF-κB/Nrf-2 and PPAR-γ signaling pathways to reduce kidney damage.

Materials and methods

Drugs and chemicals

Leflunomide, PZQ, and carboxymethyl cellulose were supplied by Sigma-Aldrich (St. Louis, MO, USA) following a purchase request.

Animals

Forty male Swiss albino mice, 6 weeks of age, weighing between 20 and 30 g, were procured from VACCERA (Egypt’s Holding Company for Biological Products and Vaccines). The animals were in stainless steel cages lined with hardwood bedding under controlled laboratory conditions (25 ± 1 °C; 12-h light/dark cycle). The mice had free access to food and water and were fed a standard rodent pellet diet (El-Nasr Company, Abou-Zaabal, Cairo, Egypt) containing 20% protein, 5% fat, 5% fiber, 55% carbohydrates, and essential vitamins and minerals. Before the start of the experiment, the mice were allowed to acclimate to the laboratory conditions for one week. All experimental procedures were conducted in accordance with the standards of Suez Canal University’s Research Ethics Committee (protocol serial number 202311MA2).

Experimental design

Forty male mice were allocated at random into four groups of ten. Group 1, the control group, received 1% CMC (10 ml/kg every 48 h, p.o.) for eight weeks. Group 2, the LF group, received LF (10 mg/kg/every 48 h, p.o.) (Aljohani et al. 2022) for eight weeks. Group 3, the LF/PZQ group, received LF (10 mg/kg every 48 h, p.o.) and PZQ (300 mg/kg/day, p.o.) (Liu et al. 2019) for eight weeks. Group 4, the PZQ group, received PZQ (300 mg/kg/day, p.o.) simultaneously.

Sample collection

At the conclusion of the experiment, blood samples were collected from the orbital sinus of mice under anesthesia induced by thiopental sodium (50 mg/kg) (Hazem et al. 2022). The collected blood was centrifuged to obtain serum, which was stored at − 80 °C for subsequent biochemical and ELISA assays. Each experimental group consisted of ten mice: six were used for biochemical and ELISA analyses, while from the remaining four, the right kidneys were fixed in 10% buffered formalin for histopathological and immunohistochemical examinations. The left kidneys from three of these animals were preserved at − 80 °C for molecular (RT-qPCR) analysis.

Colorimetric assessment of serum creatinine, urea, and albumin

Serum creatinine was measured utilizing a commercial assay kit (Cat. No. CR1250; Biodiagnostics, Giza, Egypt), blood urea nitrogen (BUN) was determined using a kit (Cat. No. EIABUN; Thermo Fisher Scientific, MA, USA), and albumin levels were assessed with a kit (Catalog No. AB1010; Biodiagnostics, Giza, Egypt). All procedures followed the manufacturer’s instructions, with results expressed in mg/dL for creatinine and BUN, and in g/dL for albumin.

Histopathological examination

Renal tissue specimens were preserved in 10% neutral-buffered formalin for 72 h, dehydrated in ethanol, cleansed with xylene, and embedded in paraffin wax. The rotary microtome was employed to produce sections of 4 μm thickness, which were then affixed to glass slides, stained with Hematoxylin and Eosin following the Bancroft et al. protocol, and analyzed under a light microscope for morphological characterization (Suvarna et al. 2012).

Enzyme-linked immunosorbent assay (ELISA)

Assessment of oxidative stress and anti-oxidant parameters: MDA, CAT, SOD, GSH, Nrf-2, and HO-1

Renal malondialdehyde (MDA) levels were quantified with a commercial ELISA kit (Cat. No: MBS269473, MyBioSource, San Diego, California, USA) following the manufacturer’s guidelines. The anti-oxidants activity was evaluated by quantifying catalase (CAT), superoxide dismutase (SOD) and glutathione (GSH) activities and Nuclear factor erythroid 2-related factor 2 (Nrf-2) utilizing ELISA kits (Cat. No: MBS9307246, MBS265351, MBS267424 and MBS2516218, respectively, MyBioSource, San Diego, California, USA) in accordance with the manufacturer’s instructions. Meanwhile, heme oxygenase 1 (HO-1) (Cat. No: E4524-100, Biovision, Milpitas, CA, USA). The results of MDA and GSH were expressed as nmol/mg protein. While the results of CAT and SOD were expressed as u/mg protein. Finally, the results of Nrf-2 and HO-1 were expressed as ng/mg protein.

Assessment of TNF-α, IL-1 β, IL-6, NF-κB, and PPAR-γ

The levels of tumor necrosis factor-alpha (TNF-α), interleukin-1β (IL-1β), interleukin-6 (IL-6), nuclear factor kappa B (NF-κB), and PPAR-γ in kidney homogenates were measured, adhering to the manufacturer’s instructions. TNF-α, IL-6, and IL-1β were quantified in pg/mg of protein, with TNF-α and IL-6 sourced from Cusabio (Cat no. CSB-E04741m and CSB-E04639m, respectively, Wuhan, China) and IL-1β from Mybiosource (Cat no. MBS175967, San Diego, CA, USA). PPAR-γ and NF-κB were measured in ng/mg, obtained from MyBioSource (Cat no. MBS2501353 and MBS2708370, respectively, San Diego, CA, USA).

Real-time polymerase chain reaction for Wnt/β-catenin and TGF-β signaling genes expression

Kidney tissue was homogenized, and total RNA for Wnt3a, β-catenin, FZD7, c-Myc, Smad2, Smad3, and Smad7 analysis was extracted using the RNeasy Mini Kit (Qiagen, Venlo, Netherlands). RNA purity was assessed spectrophotometrically by the A260/280 ratio. One microgram of RNA was reverse-transcribed to cDNA with the Reverse Transcription System (Promega, Leiden, Netherlands) following the manufacturer’s instructions. Quantitative RT-PCR for Wnt3a, β-catenin, FZD7, c-Myc, Smad2, Smad3, and Smad7 was performed using SYBR Green Master Mix (Applied Biosystems, CA, USA). Each 25 µL reaction contained 5 µL cDNA, 12.5 µL SYBR Green master mix, 5.5 µL RNase-free water, and 2 µL of each primer. Amplification consisted of 40 cycles of 95 °C for 15 s (denaturation), 60 °C for 60 s (annealing), and 72 °C for 60 s (extension). Relative gene expression was calculated by the 2^ − ΔΔCt method after normalization to β-actin (Livak and Schmittgen 2001). The primer sequences used for parameter amplification are detailed in Table 1.

Table 1.

Primer used for RT-qPCR analysis

mRNA species Accession Number Primer sequence (5'–3')
β-actin NM-007393.5

F: GAGACCTTCAACACCCCAGC

R: ATGTCACGCACGATTTCCC

Smad2 NM_010754

F: AGAGAGTTGAGACACCAGTTTTGC

R: ATAGTCATCCAG AGGCGGAAGTT

Smad3 NM_016769

F: CTCTCCAATGTCAACAGGAATG

R: AACTGGTAGACAGCCTCAAAGC

Smad7 Mm00484742_m1

F: AGAGGCTGTGTTGCTGTGAATC

R: GCAGAGTCGGCTAAGGTGATG

Wnt3a NM_009522

F: TCTGCAGGAACTACGTGGAGATCA

R: TCCCGAGAGACCATTCCTCCAAAT

β -Catenin MP200631

F: TTCTGGTGCCACTACCACAGC

R: TGCATGCCCTCATCTAATGTC

FZD7 NM_008057

F: CCGTACCACGGAGAGAAGG

R: GCGGAGTTCGGGAGAACAC

c-myc NM_001177354

F: GTCTTCCCCTACCCGCTC

R: CTGTCCAACTTGGCCCTC

Immunohistochemistry

Serial sections were subjected to deparaffinization, hydration, and antigen retrieval using EDTA (pH 8). TGF-β1 antibody (GTX45121, 1:200, GeneTex, Irvine, CA, USA) was applied to slides after 12 min of incubation with 0.3% hydrogen peroxide and maintained at 4 °C for 12 h. Secondary antibodies were administered for an hour following three phosphate-buffered saline washes. Mayer’s hematoxylin was employed as a counterstain, and the color development was achieved using Power-Stain™ 1.0 Poly HRP with 3,3'-diaminobenzidine (Genemed Biotechnologies, South San Francisco, CA, USA). Under a light microscope, the stained sections were evaluated and quantified using ImageJ (NIH, Bethesda, MD, USA).

Statistical analysis

Results are reported as the mean ± S.D. Biochemical assay results were evaluated using one-way ANOVA followed by Tukey’s multiple comparisons test. GraphPad Prism version 9.3.1 (GraphPad Software, San Diego, CA) was utilized for all statistical analyses. Inflammation scores from histopathological samples are expressed using the Kruskal–Wallis test for non-parametric one-way analysis of variance, followed by Dunn’s multiple comparison test. A p-value of < 0.05 was considered indicative of statistical significance across all group comparisons.

Results

PZQ co-treatment mitigates LF-induced nephrotoxicity

LF-induced nephrotoxicity caused a 5.5-fold increase in serum creatinine and a 2.1-fold increase in BUN, while albumin levels decreased by 27.3% compared to the control group. Co-treatment with PZQ significantly improved these parameters, reducing serum creatinine and BUN by 71.6% and 34.2%, respectively, and increasing albumin levels 1.2-fold relative to the LF group. However, compared to controls, serum creatinine and BUN remained elevated by 1.56- and 1.4-fold, respectively, and albumin was still reduced by 13% (Table 2).

Table 2.

The effect of LF (10 mg/kg/48 h, p.o.) and PZQ (300 mg/kg/day, p.o) co-treatment for 8 weeks on serum creatinine, blood urea nitrogen, and albumin

Groups Serum creatinine (mg/dl) BUN (mg/dl) Albumin (g/dl)
Control 0.16 ± 0.01 32.52 ± 1.18 3.8 ± 0.23
LF 0.88 ± 0.01a 69.15 ± 3.73a 2.77 ± 0.14a
LF + PZQ 0.25 ± 0.02ab 45.48 ± 1.49ab 3.31 ± 0.18ab
PZQ 0.15 ± 0.01b 34.2 ± 2.17b 3.68 ± 0.22b

Mean ± S.D. (n = 6) is how the data are presented. a, b: Statistically distinct from the control and LF groups, respectively, at P < 0.05, as determined by ANOVA with subsequent Tukey–Kramer post-hoc analysis

LF Leflunomide, PZQ Praziquantel, BUN Blood Urea Nitrogen

PZQ co-treatment effect on histopathological changes

In control mice, the renal corpuscle consists of the glomerulus and Bowman’s capsule. Bowman’s capsule is incomplete at the urinary pole, with simple squamous epithelium transitioning to cuboidal epithelium in the proximal convoluted tubules (Fig. 1a). Similarly, kidneys from the PZQ-only treated group displayed typical structural arrangements consistent with the control (Fig. 1d). However, in the LF group, the kidney cortex exhibited glomerular atrophy, characterized by shrinkage of the glomerular tuft and increased capsular space. In some cases, the glomeruli showed marked hypercellularity due to endothelial cell proliferation, accompanied by diffuse eosinophilic sclerosis that obliterated Bowman’s capsule and capillary lumens, with areas of adhesion to a fibrosed Bowman’s capsule. Renal tubules displayed loss of brush borders, degenerative changes progressing to necrosis in some cases, and leukocyte infiltration. (Fig. 1 b).

Fig. 1.

Fig. 1

Representative histopathological examination of renal tissue sections stained with hematoxylin and eosin (X400). (a and d) Kidney tissues from the control and PZQ-only groups show typical kidney structure. (b) Kidney tissues from the LF group showing glomerular atrophy (stars) with increased capsular space (green arrows), glomeruli adherent to Bowman’s capsule (red arrow), severe degenerative changes, necrosis of tubular epithelia, and infiltration by massive leukocytes (black arrow). (c) Kidney tissues from mice receiving LF and cotreated with PZQ showing a slight increase in Bowman’s capsule (green arrow), with hydropic degeneration of tubular epithelium (red arrows). (e) Inflammation was scored based on the following criteria: ≤ 0.5 indicates no inflammation, 0.5–1 indicates mild inflammation, 2–3 indicates moderate inflammation, and 4–5 indicates severe inflammation. A Kruskal–Wallis one-way analysis of variance on ranks was used, with Dunn’s multiple comparisons test to identify group differences. Significance was defined as p < 0.05. (a) refers to a statistically significant difference compared with the control group, and (b) points to a significant difference from the LF group

Meanwhile, the kidney of the LF/PZQ group displays standard renal tissue architecture. A slight increase in Bowman’s capsule size and congestion of glomerular capillaries and intertubular blood vessels are observed in some instances. Additionally, there is mild hydropic degeneration of regenerated tubular epithelium with a loss of brush borders (Fig. 1c).

PZQ co-treatment alleviates LF oxidative stress

Assessment of oxidative stress revealed that renal MDA levels were elevated 3.1-fold in the LF group compared to the control. Co-treatment with PZQ significantly reduced MDA by 56.98% relative to the LF group, although levels remained 1.33-fold higher than in controls. In the LF group, antioxidant markers SOD, CAT, GSH, Nrf-2, and HO-1 were markedly decreased by 66.9%, 58.0%, 77.3%, 89.1%, and 66.1%, respectively, compared to controls. The LF-PZQ group substantially restored these antioxidants, with increases of 2.5-, 2.2-, 3.7-, 6.7-, and 2.5-fold relative to the LF group, while remaining slightly below control levels (decreased by 18%, 9%, 15.5%, 26.6%, and 15.1%, respectively) (Fig. 2).

Fig. 2.

Fig. 2

Effect of LF (10 mg/kg/48 h, p.o.) and PZQ (300 mg/kg/day, p.o.) co-treatment for 8 weeks on the oxidative stress markers. (a) MDA levels in mice administered LF alone and in combination with PZQ. (b) SOD levels in mice receiving LF, with or without PZQ co-administration. (c) CAT levels in mice administered LF alone and in combination with PZQ. (d) GSH levels in mice receiving LF, with or without PZQ co-administration. (e) Nrf-2 levels in mice administered LF alone and in combination with PZQ. (f) HO-1 levels in mice receiving LF, with or without PZQ co-administration. Results are expressed as mean ± standard deviation (n = 6). (a) signifies a statistically significant difference relative to the control group, and (b) indicates a significant difference compared to the LF group. Statistical analysis was conducted using one-way ANOVA, followed by the Tukey–Kramer post hoc test. A p-value of less than 0.05 was considered statistically significant

PZQ co-treatment improves renal inflammation

Inflammation is a key feature of LF-induced nephrotoxicity. LF treatment significantly elevated TNF-α, IL-1β, IL-6, and NF-κB levels by 2.97-, 3.9-, 7.8-, and 7.8-fold, respectively, compared to the control group, confirming an inflammatory response. Co-treatment with PZQ markedly reduced these levels by 49.2%, 63%, 73.7%, and 66.3%, respectively, relative to the LF group, although they remained elevated at 1.5-, 1.4-, 2-, and 2.6-fold, respectively, compared to the control (Fig. 3).

Fig. 3.

Fig. 3

Effect of LF (10 mg/kg/48 h, p.o.) and PZQ (300 mg/kg/day, p.o.) co-treatment for 8 weeks on the inflammatory markers. (a) TNF-α levels in mice administered LF alone and in combination with PZQ. (b) IL-1β levels in mice receiving LF, with or without PZQ co-administration. (c) IL-6 levels in mice administered LF alone and in combination with PZQ. (d) NF-κB levels in mice receiving LF, with or without PZQ co-administration. Results are expressed as mean ± standard deviation (n = 6). (a) signifies a statistically significant difference relative to the control group, and (b) indicates a significant difference compared to the LF group. Statistical analysis was conducted using one-way ANOVA, followed by the Tukey–Kramer post hoc test. A p-value of less than 0.05 was considered statistically significant

PZQ co-treatment effect on renal PPAR-γ level

PPAR-γ levels were markedly decreased in the LF group, showing a 73.5% reduction compared to the control. Co-treatment with PZQ significantly alleviated this suppression, increasing PPAR-γ levels 3.1-fold relative to the LF group, although they remained 17.95% lower than in the control group (Fig. 4).

Fig. 4.

Fig. 4

Effect of LF (10 mg/kg/48 h, p.o.) and PZQ (300 mg/kg/day, p.o.) co-treatment for 8 weeks on PPAR-γ expression. Data are expressed as mean ± S.D. (n = 6). (a) denotes a statistically significant difference compared to the control group, while (b) represents a significant difference relative to the LF group. Statistical comparisons were conducted using one-way ANOVA followed by Tukey–Kramer post hoc analysis, with a significance threshold set at p < 0.05. PPAR-γ, peroxisome proliferator-activated receptor-γ

PZQ co-treatment effect on Wnt/β-catenin signaling genes expression

The Wnt/β-catenin signaling pathway was examined, revealing that LF-induced nephrotoxicity significantly upregulated the expression of Wnt3a, β-catenin, FZD7, and c-myc by 4.9-, 7-, 6.3-, and 5.6-fold, respectively, compared to the control group. Co-treatment with PZQ markedly reduced their expression by 59.4%, 52.5%, 44.1%, and 54.8%, respectively, relative to the LF group, although levels remained elevated at 2-, 3.33-, 3.57-, and 2.57-fold, respectively, compared to the control (Fig. 5).

Fig. 5.

Fig. 5

Effect of LF (10 mg/kg/48 h, p.o.) and PZQ (300 mg/kg/day, p.o.) co-treatment for 8 weeks on Wnt3a, β-catenin, FZD7, and c-myc gene expression. (a) Quantitative evaluation of Wnt3a gene expression in mice treated with LF and co-treated with PZQ. (b) Quantification of β-catenin gene expression in mice treated with LF and co-treated with PZQ. (c) Analysis of FZD7 gene expression in mice treated with LF and co-treated with PZQ. (d) Evaluation of c-myc gene expression in mice treated with LF and co-treated with PZQ. Results are expressed as the mean ± S.D. (n = 3). (a) Indicates a statistically significant difference compared to the control group, while (b) Denotes a significant difference from the LF group. Statistical analysis was performed using one-way ANOVA followed by the Tukey–Kramer test, with a significance level set at p < 0.05

PZQ co-treatment effect on TGF-β signaling genes expression

The expression of Smad2, Smad3, and Smad7, key mediators of TGF-β signaling, was evaluated. LF treatment significantly increased Smad2 and Smad3 expression by 5.8-fold and 6.1-fold, respectively, while Smad7 expression decreased by 60% compared to the control group. Co-treatment with LF/PZQ reduced Smad2 and Smad3 expression by 57.8% and 55%, respectively, and upregulated Smad7 approximately twofold relative to the LF-treated group. Compared with the control group, the LF/PZQ group still showed moderate increases in Smad2 and Smad3 (2.4-fold and 2.8-fold, respectively) and a slight decrease in Smad7 expression (19.5%) (Fig. 6).

Fig. 6.

Fig. 6

Effect of LF (10 mg/kg/48 h, p.o.) and PZQ (300 mg/kg/day, p.o.) co-treatment for 8 weeks on Smad2, Smad3, and Smad7 gene expression. (a) Represent Smad2 gene expression in mice treated with LF and cotreated with PZQ. (b) Analysis of Smad3 gene expression in mice treated with LF and co-treated with PZQ. (c) Evaluation of Smad7 gene expression in mice treated with LF and co-treated with PZQ. Data are presented as mean ± S.D. (n = 3). (a) Indicates a significant difference compared to the control group, while (b) denotes a significant difference compared to the LF group. A one-way ANOVA was applied to determine statistical significance, followed by the Tukey–Kramer test. A threshold of p < 0.05 indicated significant differences

In parallel, TGF-β1 expression was markedly elevated, showing an 8.5-fold increase in the LF group compared to the control. Co-treatment with PZQ significantly reduced this rise by 69.9% relative to the LF group, although TGF-β1 levels remained 2.6-fold higher than in the control group (Fig. 7).

Fig. 7.

Fig. 7

Effect of LF (10 mg/kg/48 h, p.o.) and PZQ (300 mg/kg/day, p.o.) co-treatment for 8 weeks on TGF-β1 expression. Based on Immunohistochemical Staining. (a, d) Kidney tissues from control and PZQ-only groups show low TGF-β1 expression in renal tissue. (b) Kidney tissues from the LF group exhibit severe TGF-β1 expression (brown staining). (c) Kidney tissues from the LF/PZQ-treated group display mild TGF-β1 expression (brown staining). All sections were observed at a magnification of X400. (e) Quantitative image analysis is expressed as the region’s percentage with an immunopositive reaction. Data are presented as mean ± S.D. (n = 4). (a) Indicates significant differences compared to the control group, and (b) indicates significant differences compared to the LF group. The study employed a one-way ANOVA for data analysis, with the Tukey–Kramer test used for post hoc comparisons. Statistical significance was set at p < 0.05

Discussion

The current work studied the possible nephroprotective role of PZQ against LF-induced nephrotoxicity in a mouse model. This result is confirmed by various reported effects, including the inhibition of the TGF-β/Smad/Wnt/β-catenin/NF-κB signaling pathway, a decrease in inflammatory markers (TNF α, IL-6, NF-κB, and IL-1β), mitigation of oxidative stress, and an elevation in the levels of the anti-inflammatory, anti-oxidant PPAR-γ and Nrf-2.

The immunosuppressant LF is linked to significant unfavorable effects affecting the hepatic, immunological, hematological, and respiratory systems (El-Sherbiny et al. 2021). The nephrotoxicity of LF has been reported in several case studies showing kidney dysfunction and severe interstitial nephritis as significant adverse effects(Nakafero et al. 2021; Hurtado Uriarte et al. 2016; Pinto et al. 2013). Aljohani et al. confirmed LF’s nephrotoxicity in mice at the recommended therapeutic levels, especially at 10 mg/kg (Aljohani et al. 2022). From this point, the current study explored the cellular mechanisms of LF-induced nephrotoxicity.

Impairment of renal function is a significant indicator of drug-induced nephrotoxicity (Kim and Moon 2012). The current investigation findings demonstrated that LF significantly impaired renal function, as evidenced by increased serum creatinine and BUN levels and decreased albumin levels. These results align with an earlier study, where LF caused a significant impairment of kidney function (Aljohani et al. 2022). On the contrary, as anticipated, PZQ appears to mitigate LF-induced nephrotoxicity, as indicated by improved renal function.

Leflunomide-induced nephrotoxicity was further confirmed through histopathological examination, which revealed glomerular atrophy, increased capsular space, and a significant increase in cellularity due to endothelial cell proliferation. Degenerative changes were observed in the renal tubules, progressing to widespread necrosis, in the LF group. These findings are consistent with those reported in previous studies (Aljohani et al. 2022). PZQ mitigated these histopathological changes, as evidenced by a marked reduction in pathological alterations, with only mild tubular degeneration and occasional congested blood vessels observed in some cases.

Elevated kidney marker levels and decreased anti-oxidant levels due to oxidative damage are critical indicators of nephrotoxicity (Kim and Moon 2012). In the same context, numerous studies have indicated increased oxidative stress in kidney disease, which is closely linked to drug-induced nephrotoxicity (Azırak and Özgöçmen 2023; Piko et al. 2023). Previous studies have demonstrated that Nrf-2, known for its anti-oxidant and anti-inflammatory properties, can alleviate oxidative stress by neutralizing reactive oxygen species (ROS) and promoting the synthesis of anti-oxidant and anti-inflammatory enzymes (Satta et al. 2017). In the current study, administration of LF severely disrupted redox equilibrium, as reflected by a substantial rise in MDA levels and a marked decline in CAT, GSH, SOD, HO-1, and Nrf-2 levels. These results correspond with a prior study, demonstrating that LF causes oxidative damage in a liver model (Lodhi et al. 2013). On the contrary, in the current study, PZQ exhibited notable anti-oxidant effects, evidenced by a significant increase in Nrf-2 activity and enhanced anti-oxidant enzyme levels (SOD, GSH, and CAT and HO-1).

Additionally, PZQ treatment was associated with reduced MDA concentrations. Collectively, the observed elevation in Nrf-2 and anti-oxidant enzyme activities following PZQ administration underscores its protective role against nephrotoxicity induced by oxidative stress. This finding is consistent with earlier studies on hepatic and muscular tissues in fish models (Zuskova et al. 2018).

Oxidative stress and inflammation are intrinsically connected pathophysiological phenomena (Biswas 2016). The development of nephrotoxicity is heavily influenced by inflammation. In the present study, elevated kidney levels of TNF-α, IL-6, NF-κB and IL-1β showed a significant pro-inflammatory response in the LF group. These results support earlier studies suggesting that chronic use of LF induces an inflammatory response in liver and lung models (Elshaer et al. 2019; El-Sherbiny et al. 2021). Previous studies identified LF as an immunosuppressant and anti-inflammatory agent, attributing its effects to TNF-α downregulation. However, another study suggests this does not contradict our findings, proposing that chronic LF use may lead to inflammatory and cytotoxic effects (Elshaer et al. 2019).

Co-administration of PZQ promoted a significant reduction in the levels of renal inflammatory mediators, possibly due to its ability to suppress NF-κB activity (Qing et al. 2016). In parallel, up-regulation of Nrf-2 expression could be another reason for decreasing IL-1β, IL-6 and TNF-α. The anti-inflammatory effect of PZQ is consistent with a previous study, which demonstrated that PZQ targets Smad7, inhibiting the NLRP3 inflammasome in Schistosoma japonicum Infection (Kong et al. 2019).

Progressive nephrotoxicity is a complex process influenced by various factors, including growth factors, cytokines, metabolic pollutants, and stress-related molecules. One of the primary mediators in this pathogenesis is TGF-β1 (Gu et al. 2020). The present investigation revealed that LF markedly elevated kidney TGF-β and Smad2/3 complex levels while markedly suppressing Smad7, signifying persistent stimulation of the TGF-β/Smad signaling pathway and leading to nephrotoxicity. This aligns with Previous studies that have reported that LF significantly increases renal and hepatic TGF-β levels in mice (Elshaer et al. 2019; Aljohani et al. 2022). TGF-β is a multifunctional cytokine that controls a diverse array of cellular functions, such as growth, differentiation, apoptosis, wound repair, and the development of fibrosis (Chen et al. 2018). The TGF-β/Smad signaling pathway is initiated when TGF-β binds to TβR2, which then recruits TβR1 to activate Smad2/3. The Smad2/3 complex binds with Smad4 and migrates to the nucleus to commence the transcription of specific genes. Smad3 facilitates renal fibrosis and inflammation, whereas Smad7 has renoprotective benefits by obstructing Smad3’s interaction with active TβR1, thus diminishing TGF-β/Smad signaling (Lan 2011; Troncone 2018). From this point, nephrotoxicity arises from the imbalance between the activation of pro-fibrotic Smad3 and the suppression of antifibrotic Smad7 (Meng et al. 2016). Interestingly, co-treatment with PZQ resulted in a notable reduction in the expression of TGF-β and Smad2/3 and a significant increase in Smad7 in the LF/PZQ group. These findings are consistent with earlier investigations in which PZQ exhibited antifibrotic effects by increasing Smad7 expression in a liver fibrosis model. The increased Smad7 expression inhibited Smad2/3 phosphorylation, suppressing TGF-β/Smad signaling and mitigating fibrosis(Liu et al. 2019).

This study revealed that LF markedly enhanced renal Wnt/β-catenin signaling and the expression of its target gene c-myc. Wnt/β-catenin signaling, essential for embryonic development and physiological growth, is reactivated in response to kidney injury. While transient activation facilitates repair and regeneration, sustained and uncontrolled activation contributes to renal fibrosis. In the canonical Wnt signaling pathway, β-catenin is typically phosphorylated by the destruction complex, leading to its ubiquitination by E3 ubiquitin ligase β-TrCP and degradation by proteasomes. However, when Wnt ligands bind to FZD receptors and LRP5/6, they recruit DVL protein, which inhibits the destruction complex. This disrupts β-catenin degradation, enabling it to accumulate and translocate to the nucleus. In the nucleus, β-catenin binds to TCF/LEF co-transcription factors, stimulating the expression of Wnt target genes, such as c-myc (Schunk et al. 2021). The versatile transcription factor c-myc governs critical cellular activities, including proliferation, differentiation, and apoptosis. The overexpression of c-myc exacerbates renal fibrosis by activating the TGF-β pathway (Zhou et al. 2020; Shen et al. 2017).

The cross-talk linking the Wnt/β-catenin and TGF-β/Smad pathways was previously demonstrated in a chondrocyte model, revealing that Smad3 associates with the E3 ubiquitin ligase β-TrCP, thereby inhibiting β-catenin ubiquitination and indirectly enhancing the Wnt/β-catenin pathway (Dao et al. 2007; Li et al. 2006). Conversely, PZQ significantly diminished the expression of Wnt/β-catenin signaling and its target gene c-myc, thereby providing evidence for the interaction linking the Wnt/β-catenin and TGF-β/Smad signaling pathways. In the same context, Wnt/β-catenin signaling and NF-κB are linked through positive cross-talk. Activating the Wnt/β-catenin pathway enhances NF-κB activity, whereas nuclear β-catenin binds to NF- κB p65 subunit and increases the transcription activity of NF-κB, and increases the inflammation process (Kim et al. 2024). From this point, activation of TGF-β signaling stimulates the Wnt/β-catenin pathway by promoting β-catenin nuclear translocation. This activation enhances cross-talk with the NF-κB signaling cascade. As a result, pro-inflammatory and fibrotic gene expression is increased. Consequently, renal fibrosis and inflammation are intensified, and disease progression is promoted.

In parallel, in this study, LF resulted in a significant decrease in renal PPAR-γ expression, attributed to the overexpression of TGF-β. This finding aligns with previous studies demonstrating TGF-β-induced downregulation of PPAR-γ expression in lung fibrosis models (Lakshmi et al. 2017). PPAR-γ is a ligand-activated transcription factor crucial for controlling glucose and lipid metabolism, and also plays a significant role in regulating immune function and inflammatory responses (Vallée and Lecarpentier 2018). PPAR-γ agonists activate Smad7, inhibiting TGF-β signaling and promoting their antifibrotic properties (Vallée et al. 2017). Conversely, TGF-β1 drives myofibroblast differentiation by suppressing PPAR-γ, both directly at the transcriptional level through a Smad repressor complex that targets the TGF‐β inhibitory element and to Smad‐binding elements sequences in the PPAR-γ promoter and indirectly by increasing β-catenin levels (Lakshmi et al. 2017; Vallée and Lecarpentier 2018), respectively. These opposing biological effects draw attention to the intricate balance and complex cross-talk between PPAR γ and TGF-β. In contrast, PZQ resulted in a marked increase in renal PPAR-γ levels by reducing TGF-β levels. This also supports the potential anti-oxidant and anti-inflammatory effects of PZQ, as PPAR-γ is known to exert such effects by reducing oxidative stress-induced MDA formation and lowering pro-inflammatory cytokine levels (Muzio et al. 2021; Kim and Yang 2013).

Furthermore, the Wnt/β-catenin pathway and PPAR-γ are linked through negative cross-talk. Suppressing the Wnt/β-catenin pathway enhances PPAR-γ activity, whereas activating PPAR-γ leads to decreased β-catenin levels across several cellular systems (Vallée and Lecarpentier 2018). PPAR-γ agonists stimulate DKK and Smad7, inhibiting the Wnt/β-catenin pathway and facilitating β-catenin degradation via the proteasome degradation. In contrast, Wnt ligands suppress GSK-3β, resulting in the cytosolic accumulation of β-catenin. Accumulated β-catenin migrates into the nucleus, interacting with TCF/LEF transcription factors, ultimately inhibiting PPAR-γ expression (Vallée et al. 2017).

Collectively, our study depicts how Activation of TGF-β signaling leads to the stimulation of the canonical Wnt/β-catenin pathway through several mechanisms, including the suppression of Wnt antagonists (E3 ubiquitin ligase β-TrCP) and the promotion of β-catenin nuclear translocation. Once activated, Wnt/β-catenin signaling causes two major downstream effects. First, it suppresses the expression of PPARγ, which in turn increases oxidative stress, inflammation, and fibrotic processes within the kidney tissue. Second, it simultaneously activates NF-κB signaling, thereby intensifying renal inflammation. Notably, therapeutic intervention with PZQ has been shown to counteract these pathological mechanisms, alleviating both the oxidative, fibrotic and inflammatory consequences induced by the cross-talk between these signaling pathways as illustrated in Fig. 8 (the mechanistic Figure).

Fig. 8.

Fig. 8

The mechansistic figure illustrating the crosstalk between TGF-β/Smad, Wnt/β-catenin, NF-κB, and PPAR-γ signaling, and the modulating effects of PZQ. (1) indicates that LF increases oxidative stress, leading to overexpression of TGF-β, which activates the TGF-β/Smad signaling pathway. (2) shows that upon TGF-β binding to TβR2, TβR1 is recruited, resulting in Smad2/3 activation. The Smad2/3 complex is associated with Smad4 and translocates to the nucleus to initiate transcription of target genes. (3) illustrates Smad3 interaction with the E3 ubiquitin ligase β-TrCP, inhibiting β-catenin ubiquitination and thereby enhancing Wnt/β-catenin signaling, demonstrating the crosstalk between TGF-β/Smad and Wnt/β-catenin pathways. (4) shows the positive regulation of β-catenin to NF-κB. (5) shows nuclear translocation of β-catenin, which binds to TCF/LEF transcription factors, suppressing PPAR-γ expression. (6) indicates that activation of TGF-β/Smad and Wnt/β-catenin signaling, along with PPAR-γ inhibition, exacerbates oxidative stress and inflammation, further amplifying TGF-β signaling and pathway crosstalk. (7) highlights PZQ-mediated activation of Smad7, which inhibits Smad2/3 phosphorylation, thereby attenuating TGF-β/Smad signaling and its associated crosstalk

Conclusion

This study is the first to reveal the role of TGF-β/Smad/Wnt/β-Catenin/NF-κB/Nrf-2 signaling pathway inhibition and upregulation of PPAR-γ in the nephroprotective effect of PZQ against LF-induced nephrotoxicity. Reduced renal markers levels evidence this protective effect, decreased renal oxidative stress, improved inflammatory status, downregulation of TGF-β/Smad/Wnt/β-Catenin/NF-κB signaling pathway, and increased anti-oxidant, anti-inflammatory PPAR-γ and Nrf-2 expression. Collectively, these outcomes suggest a new potential application for anthelmintic drugs in treating nephrotoxicity.

Acknowledgements

The authors acknowledge Dr. Ahmed Amer Elkady, Health Radiation Research Department, National Center for Radiation Research and Technology (NCRRT), Egyptian Atomic Energy Authority (EAEA), Cairo, Egypt, for his contribution to the histopathological and immunohistochemical examinations.

Abbreviations

LF

Leflunomide

DHODH

Dihydroorotate dehydrogenase

FZD

Frizzled

LRP5/6

Low-density lipoprotein receptor-related proteins 5 and 6

GSK-3

Glycogen synthetase kinase

Dvl

Disheveled

TCF/LEF

T cell factor/lymphoid enhancing factor

DKK

Dickkopf-1

PPAR-γ

Peroxisome proliferator-activated receptor-γ

PZQ

Praziquantel

TGF-β1

Transforming growth factor-β1

TβR2

TGF-β receptor 2

TβR1

TGF-β receptor 1

β-TrCP

Beta-transducin repeats-containing proteins

BUN

Blood urea nitrogen

MDA

Malondialdehyde

SOD

Superoxide dismutase

GSH

Glutathione

CAT

Catalase

TNF-α

Tumor necrosis factor –alpha

IL-1β

Interleukin-1β

IL-6

Interleukin-6

Nrf-2

Nuclear factor erythroid 2-related factor 2

HO-1

Heme oxygenase 1

SDS

Sodium dodecyl sulfate

HRP

Horseradish peroxidase

ECL

Luminol- based chemiluminescent

TBS

Tris-buffered saline

H&E

Hematoxylin and eosin

ANOVA

One-way analysis of variance

ELISA

Enzyme-linked immunosorbent assay

Authors contributions

Weam A. Elkady: Investigation, Data analysis, Software, and writing original draft, Safaa A Faheem: Conceptualization, Visualization, Supervision, Investigation, formal analysis, data curation, writing—review and editing, Reem M. Hazem: Supervision, writing—review and editing, and Naglaa F. El-Orabi: Supervision, writing—review and editing. The authors declare that all data were generated in-house and that no paper mill was used.

Funding

Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB). This study received no specific support from public, commercial, or non-profit funding entities.

Data availability

All datasets used and/or analyzed during the current study will be made available by the corresponding author upon request.

Declarations

Ethics approval

All experiments were performed following relevant guidelines and regulations. Moreover, all experimental procedures were conducted in accordance with the standards of Suez Canal University’s Research Ethics Committee (protocol serial number 202311MA2).

Consent to participate

Not applicable.

Consent to publish

Not applicable.

Conflict of interest

The authors declare no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Alamri RD et al (2021) Leflunomide an immunomodulator with antineoplastic and antiviral potentials but drug-induced liver injury: a comprehensive review. Int Immunopharmacol 93:107398 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Alfaro-Lara R, Espinosa-Ortega HF, Arce-Salinas CA (2019) Systematic review and meta-analysis of the efficacy and safety of leflunomide and methotrexate in the treatment of rheumatoid arthritis. Reumatol Clin (Engl Ed) 15(3):133–139 [DOI] [PubMed] [Google Scholar]
  3. Aljohani AA et al (2022) The anti-rheumatic drug, leflunomide, induces nephrotoxicity in mice via upregulation of TGFβ-mediated p53/Smad2/3 signaling. Toxics. 10.3390/toxics10050274 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Al-Naimi MS et al (2019) Nephrotoxicity: role and significance of renal biomarkers in the early detection of acute renal injury. J Adv Pharm Technol Res 10(3):95–99 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Askari H et al (2017) Molecular mechanisms underlying the nephrotoxicity of cisplatin, lead acetate and cyclosporine: key roles of Myc and Smad4. Biol Syst Open Access 06
  6. Azırak S, Özgöçmen M (2023) Linalool prevents kidney damage by inhibiting rifampicin-induced oxidative stress and apoptosis. Tissue Cell 82:102097 [DOI] [PubMed] [Google Scholar]
  7. Biswas SK (2016) Does the interdependence between oxidative stress and inflammation explain the antioxidant paradox? Oxid Med Cell Longev 2016(1):5698931 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chen L et al (2018) Central role of dysregulation of TGF-β/Smad in CKD progression and potential targets of its treatment. Biomed Pharmacother 101:670–681 [DOI] [PubMed] [Google Scholar]
  9. Cutroneo KR, Phan SH (2003) TGF-beta1-induced Smad 3 binding to the Smad 7 gene: knockout of Smad 7 gene transcription by sense phosphorothioate oligos, autoregulation, and effect on TGF-beta1 secretion: bleomycin acts through TGF-beta1. J Cell Biochem 89(3):474–483 [DOI] [PubMed] [Google Scholar]
  10. Dao DY et al (2007) Axin1 and Axin2 are regulated by TGF- and mediate cross-talk between TGF- and Wnt signaling pathways. Ann N Y Acad Sci 1116:82–99 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Elshaer RE et al (2019) Leflunomide-induced liver injury in mice: involvement of TLR4 mediated activation of PI3K/mTOR/NFκB pathway. Life Sci 235:116824 [DOI] [PubMed] [Google Scholar]
  12. El-Sherbiny M et al (2021) Leflunomide induces dose-dependent lung injury in mice via stimulating vimentin and NLRP3 inflammasome production. Front Pharmacol 12:631216 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Faheem SA et al (2022) Pyrvinium pamoate ameliorates cyclosporin A- induced hepatotoxicity via the modulation of Wnt/β-catenin signaling and upregulation of PPAR-γ. Int Immunopharmacol 104:108538 [DOI] [PubMed] [Google Scholar]
  14. Feng Y et al (2018) Wnt/β-catenin-promoted macrophage alternative activation contributes to kidney fibrosis. J Am Soc Nephrol 29(1):182–193 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gu YY et al (2020) Diverse role of TGF-β in kidney disease. Front Cell Dev Biol 8:123 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hazem RM et al (2022) Pirfenidone and vitamin D mitigate renal fibrosis induced by doxorubicin in mice with Ehrlich solid tumor. Life Sci 288:120185 [DOI] [PubMed] [Google Scholar]
  17. Huffstater T, Merryman WD, Gewin LS (2020) Wnt/β-catenin in acute kidney injury and progression to chronic kidney disease. Semin Nephrol 40(2):126–137 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hurtado Uriarte M, Silva O, Santacruz F (2016) Nephritis tubule interstitial for leflunomide. Rev Colomb Nefrol 3:132–136 [Google Scholar]
  19. Jiang X et al (2024) Antirheumatic drug leflunomide attenuates atherosclerosis by regulating lipid metabolism and endothelial dysfunction via DHODH/AMPK signaling pathway. Int J Biol Sci 20(10):3725–3741 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kim SY, Moon A (2012) Drug-induced nephrotoxicity and its biomarkers. Biomol Ther Seoul 20(3):268–272 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kim T, Yang Q (2013) Peroxisome-proliferator-activated receptors regulate redox signaling in the cardiovascular system. World J Cardiol 5(6):164–174 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kim JY et al (2024) NF-κB p65 and TCF-4 interactions are associated with LPS-stimulated IL-6 secretion of macrophages. Biochem Biophys Rep 38:101659 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kökény G, Calvier L, Hansmann G (2021) PPARγ and TGFβ—major regulators of metabolism, inflammation, and fibrosis in the lungs and kidneys. Int J Mol Sci 22(19):10431 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kong D et al (2019) Microrna-21 mediates the inhibiting effect of praziquantel on NLRP3 inflammasome in Schistosoma japonicum infection. Front Vet Sci 6:517 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lakshmi SP, Reddy AT, Reddy RC (2017) Transforming growth factor β suppresses peroxisome proliferator-activated receptor γ expression via both SMAD binding and novel TGF-β inhibitory elements. Biochem J 474(9):1531–1546 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lan HY (2011) Diverse roles of TGF-β/Smads in renal fibrosis and inflammation. Int J Biol Sci 7(7):1056–1067 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lan HY (2012) Transforming growth factor-β/Smad signalling in diabetic nephropathy. Clin Exp Pharmacol Physiol. 10.1111/j.1440-1681.2011.05663.x [DOI] [PubMed] [Google Scholar]
  28. Li TF et al (2006) Transforming growth factor-beta stimulates cyclin D1 expression through activation of beta-catenin signaling in chondrocytes. J Biol Chem 281(30):21296–21304 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Li J et al (2023) Effect of rosiglitazone, the peroxisome proliferator-activated receptor (PPAR)-γ agonist, on apoptosis, inflammatory cytokines and oxidative stress in pentylenetetrazole-induced seizures in kindled mice. Neurochem Res 48(9):2870–2880 [DOI] [PubMed] [Google Scholar]
  30. Liu J et al (2019) Praziquantel ameliorates CCl(4) -induced liver fibrosis in mice by inhibiting TGF-β/Smad signalling via up-regulating Smad7 in hepatic stellate cells. Br J Pharmacol 176(24):4666–4680 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25(4):402–408 [DOI] [PubMed] [Google Scholar]
  32. Lodhi RL et al (2013) Evaluation of mechanism of hepatotoxicity of leflunomide using albino wistar rats. Afr J Pharm Pharmacol 7(24):1625–1631 [Google Scholar]
  33. Meng XM, Nikolic-Paterson DJ, Lan HY (2016) TGF-β: the master regulator of fibrosis. Nat Rev Nephrol 12(6):325–338 [DOI] [PubMed] [Google Scholar]
  34. Muzio G, Barrera G, Pizzimenti S (2021) Peroxisome proliferator-activated receptors (PPARs) and oxidative stress in physiological conditions and in cancer. Antioxidants. 10.3390/antiox10111734 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Nakafero G et al (2021) What is the incidence of methotrexate or leflunomide discontinuation related to cytopenia, liver enzyme elevation or kidney function decline? Rheumatology 60(12):5785–5794 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Niu X et al (2022) The role of praziquantel in the prevention and treatment of fibrosis associated with schistosomiasis: a review. J Trop Med 2022:1413711 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Piko N et al (2023) The role of oxidative stress in kidney injury. Antioxidants. 10.3390/antiox12091772 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Pinto B et al (2013) Leflunomide-induced DRESS syndrome with renal involvement and vasculitis. Clin Rheumatol 32(5):689–693 [DOI] [PubMed] [Google Scholar]
  39. Qing K et al (2016) Synergistic effect of oridonin and a PI3K/mTOR inhibitor on the non-germinal center B cell-like subtype of diffuse large B cell lymphoma. J Hematol Oncol 9(1):72 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Rivera S (2022) Principles for the prevention of medication-induced nephrotoxicity. Crit Care Nurs Clin North Am 34(4):361–371 [DOI] [PubMed] [Google Scholar]
  41. Satta S et al (2017) The role of Nrf2 in cardiovascular function and disease. Oxid Med Cell Longev 2017:9237263 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Schunk SJ et al (2021) WNT-β-catenin signalling - a versatile player in kidney injury and repair. Nat Rev Nephrol 17(3):172–184 [DOI] [PubMed] [Google Scholar]
  43. Sharma V, Patial V (2022) Peroxisome proliferator-activated receptor gamma and its natural agonists in the treatment of kidney diseases. Front Pharmacol 13:2022 [Google Scholar]
  44. Shen Y et al (2017) C-Myc promotes renal fibrosis by inducing integrin αv-mediated transforming growth factor-β signaling. Kidney Int 92(4):888–899 [DOI] [PubMed] [Google Scholar]
  45. Suvarna KS, Layton C, Bancroft JD (2012) Bancroft's theory and practice of histological techniques E-book. Elsevier Health Sciences
  46. Troncone E et al (2018) Transforming growth factor-β1/Smad7 in intestinal immunity, inflammation, and cancer. Front Immunol 9:2018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Vallée A, Lecarpentier Y (2018) Crosstalk between peroxisome proliferator-activated receptor gamma and the canonical WNT/β-catenin pathway in chronic inflammation and oxidative stress during carcinogenesis. Front Immunol 9:745 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Vallée A et al (2017) Interactions between TGF-β1, canonical WNT/β-catenin pathway and PPAR γ in radiation-induced fibrosis. Oncotarget 8(52):90579–90604 [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Wu H, Huang J (2018) Drug-induced nephrotoxicity: pathogenic mechanisms, biomarkers and prevention strategies. Curr Drug Metab 19(7):559–567 [DOI] [PubMed] [Google Scholar]
  50. Zheng F et al (2002) Upregulation of type I collagen by TGF-beta in mesangial cells is blocked by PPARgamma activation. Am J Physiol Renal Physiol 282(4):F639–F648 [DOI] [PubMed] [Google Scholar]
  51. Zheng K et al (2023) Leflunomide: traditional immunosuppressant with concurrent antiviral effects. Int J Rheum Dis 26(2):195–209 [DOI] [PubMed] [Google Scholar]
  52. Zhou Z et al (2020) RIG-I aggravates interstitial fibrosis via c-Myc-mediated fibroblast activation in UUO mice. J Mol Med 98:527–540 [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Zuskova E et al (2018) Efficacy and toxicity of praziquantel in helminth-infected barbel (Barbus barbus L.). J Fish Dis 41(4):643–649 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All datasets used and/or analyzed during the current study will be made available by the corresponding author upon request.


Articles from Naunyn-Schmiedeberg's Archives of Pharmacology are provided here courtesy of Springer

RESOURCES