TRPV4 mediates macrophage polarization involved in inflammatory root resorption induced by mechanical pressure

ABSTRACT

In clinical orthodontic treatment, mechanical pressure applied to the tooth root triggers orthodontically induced inflammatory root resorption (OIIRR). An elevated M1/M2 macrophage polarization ratio is a key factor in OIIRR on the pressure side. However, the pathways through which macrophages perceive mechanical pressure stimuli remain unclear. The transient receptor potential vanilloid 4 channel, which is upregulated on the pressure side during orthodontic treatment, is a mechanically sensitive calcium ion channel protein that may play a crucial role in orthodontic periodontal mechanical signal transduction. Nevertheless, whether TRPV4 is involved in macrophage perception of and response to orthodontic force under mechanical pressure, thereby influencing macrophage polarization, requires further investigation. This study aims to explore the mechanism by which TRPV4 mediates mechanical pressure in regulating macrophage polarization, with the objective of providing new insights and strategies for mitigating OIIRR in clinical orthodontic practice. Studies have shown that resorption lacunae are present on the compressed root surface, with macrophages localized at the sites of root resorption. Mechanical pressure significantly upregulated intracellular Ca²⁺ concentration and macrophage expression levels of TRPV4, iNos, and CD86, while significantly downregulating the expression levels of Arg-1 and CD206. Treatment with the TRPV4 inhibitor GSK2193874 resulted in a significant downregulation of intracellular Ca²⁺ concentration and expression levels of iNos and CD86, and a significant upregulation of Arg-1 and CD206 expression levels. Therefore, our study demonstrates that TRPV4 senses mechanical pressure by promoting Ca²⁺ influx and upregulates the M1/M2 macrophage polarization ratio. In conclusion, our findings indicate that TRPV4 serves as a critical mediator in mechanical pressure-regulated macrophage polarization during OIIRR.

Introduction

Inflammatory root resorption, primarily caused by orthodontic treatment, periodontitis, and periapical diseases, is currently one of the most common types of root resorption. Orthodontically induced inflammatory root resorption (OIIRR) stands as a severe complication in clinical orthodontic treatment, with approximately 90% of orthodontic patients experiencing some degree of root resorption. While most cases are minor and do not affect tooth stability [1,2], severe resorption in some patients can lead to tooth loosening or even loss, significantly impacting the quality of orthodontic treatment. In recent years, the widespread application of new technologies such as cone-beam computed tomography in oral clinical treatment has led to the detection of numerous cases of root resorption. This underscores the importance of effectively avoiding and controlling root resorption during clinical treatment. However, the specific molecular biological mechanisms underlying inflammatory root resorption remain incompletely understood. Exploring the mechanisms through which orthodontic forces act on periodontal tissue-related cells to trigger OIIRR is particularly crucial.

Macrophages, characterized by their high plasticity, are key effector cells in periodontal tissue remodeling during orthodontic treatment [3]. Macrophages can polarize into distinct phenotypes in response to external stimuli. Generally, M1 macrophages are considered pro-inflammatory [4], whereas M2 macrophages exhibit anti-inflammatory properties [5]. An upregulated M1/M2 macrophage polarization ratio is recognized as a key physiological effect in OIIRR, which can regulate OIIRR by modulating the secretion of pro-inflammatory cytokines and influencing osteoclast formation [5].

How then does mechanical pressure regulate macrophage polarization and ultimately lead to OIIRR? Studies have shown that periodontal ligament cells (PDLCs) [6] and periodontal ligament stem cells (PDLSCs) [7] can perceive mechanical pressure and indirectly upregulate the M1/M2 macrophage polarization ratio, thereby inducing OIIRR [8]. Can macrophages directly sense and respond to mechanical pressure? Evidence indicates that macrophages are mechanosensitive [9], and mechanical pressure can directly trigger inflammatory responses in macrophages via Piezo1 [10]. However, whether mechanical pressure directly regulates macrophage polarization remains unknown.

The transient receptor potential vanilloid 4 channel (TRPV4) is a mechanosensitive cation channel [11] that senses and responds to mechanical pressure and is upregulated on the pressure side during orthodontic treatment [7]. Studies have revealed interactions between TRPV4 and various mechanically sensitive receptors such as Piezo1, YAP/TAZ, and integrins, suggesting that it may be a crucial target for orthodontic periodontal mechanical signal transduction and adaptive remodeling of periodontal tissue [12–14]. TRPV4 has also been found to participate in matrix stiffness-induced macrophage polarization [15]. However, whether TRPV4 is involved in the direct sensing and response of macrophages to orthodontic force and influences macrophage polarization remains to be further elucidated. In this study, an in vivo pressure model will be established to analyze the presence of macrophages at root resorption sites under mechanical pressure. Additionally, an in vitro mechanical pressure model will be constructed to investigate the direct regulatory role of the TRPV4 channel in macrophage polarization under mechanical pressure.

Materials and methods

Materials

RAW264.7 (Procell, China), RAW264.7-specific culture medium (Hycyte, China), CCK-8 kit (Glpbio, USA), Calcein-AM/PI live/dead cell double staining kit (Yeasen, China), Fluo-4 calcium detection kit (Beyotime, China), GSK2193874 (Glpbio, USA), Anti-CD68 Rabbit pAb (Servicebio, China), PAGE gel rapid preparation kit (Shanghai Epizyme, China), Mannose Receptor (CD206) antibody (Abmart, China), Anti-iNos Rabbit pAb (Servicebio, China), TrpV4 Rabbit pAb (zenbio, China), CD86 Recombinant Rabbit Monoclonal Antibody (Huabio, China), Anti-GAPDH Rabbit pAb (Servicebio, China), Anti-Arginase 1 Rabbit pAb (Servicebio, China), and HRP-conjugated Goat Anti-Rabbit IgG (H+L) (proteintech, USA).

Animals

All animal experiments involved in this study have been approved by the Animal Ethics Committee of Kunming Medical University (Approval Number: no.KMMUD2025048). All experimental procedures were conducted following the procedures and principles approved by the Animal Ethics Committee of Kunming Medical University. The Laboratory Animal Centre at Kunming Medical University provided specific-pathogen-free, 8-week-old, healthy male Sprague – Dawley rats. The rats were maintained in a barrier environment throughout the experiments and fed conventional food and water. These rats were selected and randomly divided into the Con group and the Press group. The testing was conducted in accordance with the ARRIVE recommendations, the U.K. Animals (Scientific Procedures) Act, 1986 and related regulations, EU Directive 2010/63/EU for animal experiments, or the National Institutes of Health’s manual for the use and care of laboratory animals (NIH Publications No. 8023, revised 1978).

Construction of in vivo pressure model

An SD rat molar tooth pressure model was constructed to simulate tooth root pressure. The rats were anesthetized by intraperitoneal injection of 3% pentobarbital sodium solution (0.1 ml/100 g). A 0.2 mm nickel-titanium wire was passed through the interproximal space between the first and second maxillary molars on the left side of the rat’s maxilla. The nickel-titanium wire was ligated to the mesial neck of the first molar, leaving a 2 mm loop of wire extending back to the occlusal surface. The wire was etched for 30 seconds, washed, and dried, then coated with adhesive and light-cured for 15 seconds. A 1 mm resin buildup was applied and light-cured for 1 minute. After the procedure, the rats were allowed to eat freely, and their vital signs were observed daily to check the stability of the resin fixation. If the resin was damaged or fell off, it was repaired using the same method. In the control group, a 0.2 mm nickel-titanium wire was similarly passed through the interproximal space between the first and second maxillary molars on the left side and ligated at the mesial cervical region of the first molar. The nickel-titanium wire was used to provide retention for the resin and enhance its stability. It was wrapped around the dental crown without exerting any mechanical force on the dental elements.

Histological analysis

Seven days after model establishment, the maxilla and teeth were removed and fixed in a 4% formaldehyde solution for 24 hours. The rat maxilla was then soaked in a 10% EDTA solution for decalcification, with the solution being replaced every three days. After 21–28 days, the completion of decalcification was indicated by the ability to insert a needle into the tissue without significant resistance. The tissues were then dehydrated with ethanol and embedded in paraffin. Paraffin sections of 4 μm thickness were taken for Hematoxylin-Eosin (HE) staining and Giemsa staining. For HE staining, after dewaxing and dehydration, the sections were rinsed with distilled water, stained with hematoxylin for 15 minutes, rinsed with tap water, fractionated with 1% hydrochloric acid alcohol for 2 seconds, rinsed, washed with PBS, stained with eosin for 30 seconds, dehydrated, air-dried, and mounted with gum. For Giemsa staining, after dewaxing and dehydration, the sections were washed with distilled water, stained with Giemsa stain for 20 minutes, washed, dehydrated, air-dried, and mounted with gum.

Immunohistochemistry

After dewaxing and dehydration, the EDTA-treated samples were placed in a 100-degree oven for antigen heat repair for 40 minutes. The sections were blocked with 3% hydrogen peroxide for 10 minutes and then blocked with goat serum for 45 minutes. The sections were incubated with CD68 primary antibody at 4 degrees overnight for about 10 hours. After washing the sections with PBS, the secondary antibody was incubated at 37 degrees for 15 minutes. The nuclei were restained with hematoxylin for 30 seconds, dehydrated, and mounted with gum. The average optical density (AOD) of CD68 in the stained tissue was calculated using Image J-Pro plus 6.0 (National Institutes of Health, Bethesda, MD). AOD = (Integrated Optical Density) / Area.

Culture of RAW264.7 cells

Mouse monocyte/macrophage RAW264.7 cells were cultured in RAW264.7-specific culture medium (37°C, 5% CO2), and the medium was changed every 1–2 days. Cells in logarithmic growth phase were used for passaging and experimentation.

Construction of an in vitro pressure loading model

For the establishment of the in vitro pressure-loading model, we referred to the studies by Agnes Schröder et al. [9,10]. RAW264.7 cells in good condition were seeded into a 6-well plate at 1 × 10⁶ cells per well. When the cell confluence reached 80%, pressure loading was applied. Pressure loading was achieved by placing a transparent glass plate of 33 mm diameter and different weights evenly on the cell layer, allowing uniform contact with the cell layer and thus exerting a mechanical pressure of a corresponding duration and magnitude on the cells.

Calcein-AM/PI live/dead cell staining

RAW264.7 cells were seeded in 6-well plates at a density of 1 × 10⁶ cells per well and subjected to mechanical pressures of 0 g/cm²(Con), 1 g/cm², 2 g/cm², 4 g/cm², and 8 g/cm² for 12 h, 24 h, and 48 h, respectively. After the pressure loading was completed, 500 μL of the prepared staining solution was added to each well and incubated at 37°C in the dark for 30 minutes. Following incubation, the cells were washed with PBS and observed under an inverted fluorescence microscope to assess cell survival. In the assay, green fluorescence represents live cells, while red fluorescence represents dead cells. The numbers of green and red cells were quantified using ImageJ. Cell viability was calculated as follows: Cell viability = number of green cells / (number of green cells + number of red cells).

TRPV4 inhibitor treatment

GSK2193874, an orally active TRPV4 channel inhibitor, was diluted to a 5 mM stock solution using DMSO. Cells were treated with GSK2193874 at a reported molar concentration of 10 μM [16] 2 hours before pressure loading.

Fluo-4 AM assay

Fluo-4 AM is hydrolyzed upon entering cells, and the resulting Fluo-4 can bind to Ca²⁺, emitting green fluorescence. The relative intracellular Ca²⁺ concentration in each group can be determined by comparing the average fluorescence intensity. RAW264.7 cells in good condition were seeded in 6-well plates at a density of 1 × 10⁶ cells per well. After treatment, 500 μL of the prepared staining solution was added to each well and incubated at 37°C in the dark for 30 minutes. The cells were then washed with PBS. Observations and imaging were performed using an inverted fluorescence microscope. The average fluorescence intensity of the images from each group was analyzed using ImageJ software.

Real-time PCR

After appropriate cell treatments, total RNA was extracted using a Fast RNA Extraction Kit (Accurate biology, China) according to the manufacturer’s instructions. RNA concentration was determined using a micro-spectrophotometer (Allsheng, China). RNA was reverse transcribed into cDNA using the Evo M-MLV Reverse Transcription Premix Kit (Accurate biology, China) in a 20 μL reaction system according to the manufacturer’s protocol, incubating at 37°C for 15 minutes and then at 85°C for 5 seconds. RT-qPCR was performed using the SYBR Green Pro Taq Hs qPCR Kit(Accurate biology, China) on a real-time PCR system (Thermo Fisher, USA). The RT-qPCR conditions included initial denaturation at 95°C for 30 seconds, followed by 40 cycles of denaturation at 95°C for 5 seconds and annealing at 60°C for 30 seconds. The expression levels of mRNAs for each gene were normalized to HPRT and calculated using the 2^-∆∆CT method. All primers for qRT-PCR were purchased from Tsingke, China, Primer sequences are shown in Table 1.

Table 1.

Primer sequences for HPRT, TRPV4, iNOS, CD86, Arg-1, and CD206.

Target	Upstream/Forward primer	Downstream/Reversed primer
HPRT	CCTAAGATGAGCGCAAGTTGAA	CCACAGGACTAGAACACCTGCTAA
TRPV4	TGGAACCAGAACTTGGGCAT	GGACCAACGATCCCTACGAA
iNos	CGGCAAACATGACTTCAGGC	GCACATCAAAGCGGCCATAG
CD86	TGTGATCTTCGGGAATGCTGC	TCTCCACGGAAACAGCATCTGAG
Arg-1	TTGGCTTGCGAGACGTAGAC	CATCACCTTGCCAATCCCCA
CD206	ACGAGCAGGTGCAGTTTACA	ACATCCCATAAGCCACCTGC

Western blot

After appropriate treatment of the cells, the culture medium was removed, and the cells were washed three times with PBS. Total protein was then extracted using RIPA lysis buffer containing 1% phosphatase inhibitor. The protein content of each group was measured using a BCA protein assay kit, and all protein samples were adjusted to the same concentration. Proteins of different molecular weights were separated by 10% polyacrylamide gel electrophoresis and transferred to a PVDF membrane. After blocking with a TBST solution containing 5% skim milk at room temperature for 1 hour, the membrane was incubated with primary antibodies against TRPV4 (zenbio, 1:500, Cat #252146), iNOS (Servicebio, 1:1000, Cat #GB115703), CD86 (Huabio, 1:10000, Cat #ET1606), Arg-1 (Servicebio, 1:2500, Cat #GB115724), CD206 (Abmart, 1:2000, Cat #TU313804), and GAPDH (Servicebio, 1:5000, Cat #GB11002) at 4°C overnight. The following day, the membrane was incubated with secondary antibodies at room temperature for 1 hour. The PVDF membrane was then soaked in a chromogenic solution, exposed using an imager, and the images were saved. Image grayscale value analysis was performed using Image J software.

Immunofluorescence staining

Cells were seeded onto cell slides and treated accordingly. After fixation, permeabilization, and blocking, the cells were incubated with primary antibodies against TRPV4 (zenbio, 1:200, Cat #252146), iNOS (Servicebio, 1:500, Cat #GB115703), CD86 (Huabio, 1:500, Cat #ET1606), Arg-1 (Servicebio, 1:500, Cat #GB115724), and CD206 (Abmart, 1:500, Cat #TU313804) at 4°C for 1 hour, followed by incubation with secondary antibodies at room temperature for 1 hour. The cell nuclei were stained with DAPI, and the slides were mounted with gum. The cells were observed and photographed under an inverted fluorescence microscope. The positive cell rates of TRPV4, iNOS, CD86, Arg-1, and CD206 in each group were calculated. The positive cell rate was defined as the number of green fluorescent cells divided by the number of blue fluorescent (DAPI-stained) cells.

Statistical analysis

Statistical analysis was performed using GraphPad Prism 9 software. Differences between two groups were compared using the t-test, and differences among multiple groups were analyzed using one-way ANOVA. A p-value < 0.05 was considered statistically significant.

Results

Mechanical pressure induces root resorption in rats, and macrophages are present in the resorption lacunae and adjacent areas

The characteristic manifestation of OIIRR is the appearance of resorption lacunae. To examine tooth root resorption in rats 7 days after surgery, we constructed an in vivo pressure model (Figure 1(A)). HE staining revealed the presence of resorption lacunae on the surface of compressed tooth roots in the Press group compared to the Con group (Figure 1(B)). Giemsa staining, which stains monocytes/macrophages blue-purple, and CD68 immunohistochemical staining, a marker for monocyte/macrophage surface antigens, were performed to detect macrophage distribution in and around the resorption lacunae (Figure 1(C,D)). The results showed positive cell recruitment in and around the resorption lacunae, and the expression level of CD68 was higher in the Press group than in the Con group (p < 0.05) (Figure 1(E)). Studies have shown that macrophages are present around root resorption lacunae on the root surface subjected to orthodontic pressure, indicating the presence of macrophages in the mechanical pressure microenvironment. The direct regulation of macrophages by mechanical pressure is one of the causes of OIIRR.

Figure 1.

Mechanical pressure induces root resorption in rats, and macrophages are present in the resorption lacunae and adjacent areas. (A) Schematic diagram of in vivo pressure model. (B) Two groups of he staining: tr root, PDL periodontal ligament, AB alveolar bone. Scale: 100 μm. The large frame area is shown as a local magnified view of the small frame area. The arrows indicate the root resorption pits. (C) Two groups of Giemsa staining: TR root, PDL periodontal ligament, AB alveolar bone.Scale:100 μm. The large frame area is shown as a local magnified view of the small frame area. (D，E) Immunohistochemical analysis of CD68 expression levels in the compressed root under mechanical pressure. AOD cumulative optical density value/area; N = 3; data are mean ± SD; *p < .05.

Effects of different pressure stimuli on the survival rate of RAW264.7 cells

The application of mechanical pressure downregulated the survival rate of RAW264.7 cells. To determine the optimal force value and duration that maximized cell survival, we constructed an in vitro pressure loading model (Figure 2). Using the Calcein-AM/PI live/dead cell staining, we examined the survival rate of RAW264.7 cells under different force values (0 g/cm², 1 g/cm², 2 g/cm², 4 g/cm², 8 g/cm²) and durations of force application (12 h, 24 h, 48 h) (Figure 3(A,B)). The results indicated that a mechanical pressure of 2 g/cm² applied for 12 hours had the minimal impact on RAW264.7 cell viability. Therefore, in subsequent experiments, we consistently used a mechanical pressure of 2 g/cm² applied for 12 hours.

Figure 2.

Schematic diagram of the in vitro pressure loading model.

Figure 3.

The effect of different pressure stimuli on the survival rate of RAW264.7 cells. (A) The representative images of live/dead cell staining images of RAW264.7 after mechanical pressure loading of 0 g/cm² (Con), 1 g/cm², 2 g/cm², 4 g/cm², and 8 g/cm² for 12 h, 24 h, and 48 h. (B) The cell survival rate of each group with Calcein-AM/PI live/dead cell staining. N = 3; data are mean ± SD; *p < .0001, ****p < .05, *p < .01.

Mechanical pressure promotes Ca²⁺ influx and upregulates TRPV4 expression

Fluo-4 AM is a dye that emits green fluorescence when bound to Ca²⁺. By staining cells in both the Con and Press groups with Fluo-4 AM, we observed a significant increase in green fluorescence intensity in cells after the application of mechanical pressure (p < 0.05) (Figure 4(A,B)). TRPV4, a mechanically sensitive nonselective cation channel with high permeability to Ca²⁺, showed significantly higher mRNA expression levels in the Press group compared to the Con group (p < 0.01) (Figure 4(C)). Western blot analysis determined the protein expression levels of TRPV4 in both groups, revealing a notably higher expression in the Press group than in the Con group (p < 0.0001) (Figure 4(D,E)). This finding was further corroborated by immunofluorescence staining (p < 0.0001) (Figure 4(F,G)). In conclusion, mechanical pressure facilitates Ca²⁺ influx and elevates TRPV4 expression.

Figure 4.

Mechanical pressure promotes Ca²⁺ influx and upregulates the expression of TRPV4. (A) Representative images of Fluo-4 AM fluorescence in the Con group and Press group. (B) Analysis of the average fluorescence intensity of Fluo-4 AM fluorescence images in each group. N = 3; data are mean ± SD; *p < .05. (C) qRT-PCR detection of TRPV4 expression in the Con group and Press group. N = 3; data are mean ± sd; ****p < .01. (D, E) Representative Western images and semi-quantitative analysis of TRPV4 expression in the Con group and Press group. N = 3; data are mean ± SD; *p < .001. (F, G) Representative images of TRPV4 immunofluorescence staining and analysis of positive cell rate in the Con group and Press group. N = 3; data are mean ± SD; **p < .0001.

Mechanical pressure promotes M1 polarization and inhibits M2 polarization in RAW264.7 cells

To investigate the effects of mechanical pressure on macrophage polarization, we examined the expression levels of M1 macrophage markers (iNOS and CD86) and M2 macrophage markers (CD206 and Arg-1) in the Con and Press groups using qRT-PCR. Compared to the Con group, the expression levels of iNOS and CD86 were significantly higher in the Press group, while the expression levels of CD206 and Arg-1 were significantly lower (Figure 5(A)). Western blot analysis further confirmed these findings, showing increased expression of iNOS and CD86 and decreased expression of CD206 and Arg-1 in the Press group compared to the Con group (Figures 5(B,C)). Immunofluorescence staining also supported these observations (p < 0.0001) (Figures 5(D,E)). These results indicate that mechanical pressure promotes M1 polarization and inhibits M2 polarization in macrophages.

Figure 5.

(A) qRT-PCR analysis of iNos, CD206, arg-1 and CD206 expressions in the Con group and the Press group. N = 3; data are mean ± SD; *p < .0001, ****p < .01. (B,C) Representative Western blot images and semi-quantitative analysis of iNos, CD206, CD206 and Arg-1 in cells from the Con group and the Press group. N = 3; data are mean ± SD; *p < .05, **p < .0001, *p < .01. (D, E) Representative immunofluorescence staining images and analysis of positive cell rates of iNos, CD86, Arg-1 and CD206 in the Con group and the Press group. N = 3; data are mean ± SD; **p < .0001.

Inhibition of TRPV4 downregulates the promotive effect of mechanical pressure on Ca²⁺ concentration

We treated the Con+GSK2193874 and Press+GSK2193874 groups with the TRPV4 channel inhibitor GSK2193874. The expression levels of TRPV4 in the Con, Con+GSK2193874, Press, and Press+GSK2193874 groups were analyzed using qRT-PCR, Western blot, and immunofluorescence staining. We found that GSK2193874 significantly reduced the expression of TRPV4 in RAW264.7 cells under pressure loading (Figures 6(A-E)). Additionally, we stained the cells in the Con, Con+GSK2193874, Press, and Press+GSK2193874 groups using Fluo-4 AM. The results showed that GSK2193874 had no significant effect on the Ca²⁺ concentration in the Con+GSK2193874 group but had a significant impact on the Ca²⁺ concentration in cells under mechanical pressure loading (Figure 6(F,G)). This indicates that inhibition of TRPV4 downregulates the promotive effect of mechanical pressure on Ca²⁺ concentration.

Figure 6.

GSK2193874 inhibits the expression of TRPV4 and reduces the concentration of Ca²⁺. (A) qRT-PCR detects the expression of TRPV4 in the Con group, Con+GSK2193874 group, Press group, and Press+GSK2193874 group. N = 3; data are mean ± SD; *p < .01. (B,C)representative images and semi-quantitative analysis of TRPV4 expression in the Con group, Con+GSK2193874 group, Press group, and Press+GSK2193874 group by Western blot. N = 3; data are mean ± SD; ****p < .01, *p < .05. (D, E) Representative images and analysis of positive cell rate of TRPV4 immunofluorescence staining in the Con group, Con+GSK2193874 group, Press group, and Press+GSK2193874 group. data are mean ± SD, **p < .05, *p < .0001. (F, G) Representative Fluo-4 AM fluorescence images and average fluorescence intensity analysis of the Con group, Con+GSK2193874 group, Press group, and Press+GSK2193874 group. N = 3; data are mean ± SD, **p < .01, ***p < .05.

GSK2193874 suppresses the effects of mechanical pressure on macrophage polarization

To investigate the role of TRPV4 in macrophage polarization mediated by mechanical pressure, we treated the Con+GSK2193874 and Press+GSK2193874 groups with GSK2193874, a TRPV4 channel inhibitor. We then assayed the expression levels of M1 macrophage markers (iNOS, CD86) and M2 macrophage markers (CD206, Arg-1) in the Con, Con+GSK2193874, Press, and Press+GSK2193874 cell groups using qRT-PCR, Western blot, and immunofluorescence staining. The results indicated that GSK2193874 significantly affected the polarization level of cells subjected to mechanical pressure, suppressing the effects of mechanical pressure on macrophage polarization (Figure 7). In summary, TRPV4 can affect OIIRR by promoting intracellular calcium influx and upregulating the M1/M2 polarization ratio of macrophages (Figure 8).

Figure 7.

GSK2193874 inhibits the effect of mechanical pressure on macrophage polarization. (a) qRT-PCR was used to detect the expression of iNos, CD86, CD206 and Arg-1 in the Con group, Con+GSK2193874 group, Press group and Press+GSK2193874 group. N = 3; data are mean ± SD; *p < 0.0001, ****p < 0.01. (b, C) Representative Western blot images and semi-quantitative analysis of iNos, CD86, CD206 and Arg-1 in cells of the Con group, Con+GSK2193874 group, Press group and Press+GSK2193874 group. N = 3; data are mean ± SD; *p < 0.01, **p < 0.001, *p < 0.05. (d, e) Representative images of immunofluorescence staining and positive cell rate analysis of iNos, CD86, Arg-1 and CD206 in the Con group, Con+GSK2193874 group, Press group and Press+GSK2193874 group. N = 3; data are mean ± SD; **p < 0.0001, ***p < 0.01.

Figure 8.

A schematic diagram illustrating the mechanism by which mechanical pressure regulates macrophage polarization via TRPV4 to participate in OIIRR.

Discussion

OIIRR represents one of the most common iatrogenic complications during orthodontic treatment, and severe cases can lead to tooth loosening and even tooth loss [17]. OIIRR significantly impacts the quality of orthodontic treatment for patients. The etiology of OIIRR remains unclear, but it is currently believed to be associated with factors such as the magnitude of orthodontic force, duration of orthodontic treatment, patient age, history of dental trauma, root morphology, and individual susceptibility [18–20].

Orthodontic treatment disrupts the biomechanical balance of the tooth-periodontal ligament-alveolar bone complex through the application of orthodontic force. Cells perceive and respond to mechanical stress through mechanosensitive receptors and other mechanotransducers, leading to adaptive remodeling of the periodontal ligament, alveolar bone, and cementum. This process ultimately induces orthodontic tooth movement (OTM) [21]. Notably, the application of orthodontic force triggers a sterile inflammatory response around the orthodontically moved teeth [19,22–24]. Research has revealed high expression levels of various inflammatory mediators during OTM. Furthermore, many of these inflammatory mediators, including interleukin (IL)-1β, IL-6, IL-8, IL-17, IL-34, receptor activator of nuclear factor-κB ligand (RANKL)/receptor activator of nuclear factor-κB (RANK), osteoprotegerin (OPG), and tumor necrosis factor (TNF)-α, have been shown to play crucial roles in OIIRR [6,25–35]. This suggests a close association between the occurrence of OIIRR and inflammatory responses.

The alveolar bone resorption and root resorption effects observed on the pressure side during orthodontics are primarily attributed to the action of osteoclasts [36–38]. Osteoclasts originate from the monocyte/macrophage system and are deeply involved in the regulation of bone and cementum remodeling [38,39]. Macrophages can be classified into M1 and M2 phenotypes, which exert their functions through the secretion of cytokines and chemokines. Generally, M1 macrophages are considered to have proinflammatory effects, while M2 macrophages exhibit anti-inflammatory properties. Macrophages, which exhibit high plasticity, can respond to various microenvironmental signals and polarize into different phenotypes [40]. Studies have found that macrophages primarily polarize toward M1 on the pressure side during orthodontics [41]. There is also evidence suggesting that M2 macrophages may be involved in bone remodeling on the tensile side during orthodontic treatment.

In sites of OIIRR, osteoclast recruitment occurs, leading to the formation of cementum resorption lacunae [27,42]. Macrophages, as precursor cells of osteoclasts, are primarily present in the early stages of root resorption [5]. D. He and colleagues discovered that the application of orthodontic pressure upregulates the M1/M2 macrophage ratio on the compressed side, and inflammatory root resorption in rats increases with an elevated M1/M2 ratio [5]. According to Zhang Jie’s research, inflammatory root resorption on the pressure side during orthodontics may be attributed to macrophage polarization toward M1. This process upregulates IL-1β expression through the NLRP3/Caspase-1 pathway in the early stages of orthodontic force application [6]. These findings suggest that the M1/M2 polarization balance of macrophages may play a critical role in OIIRR.

However, it remains poorly understood how macrophages perceive and respond to mechanical pressure in OIIRR, leading to disruption of the M1/M2 polarization balance and influencing OIIRR progression. Currently, more studies have focused on how other periodontal cells sense mechanical pressure and indirectly regulate macrophage polarization. Mechanical pressure can regulate IL-6 expression via the Notch signaling pathway [30]. Under stress, PDLCs promote the recruitment of M1 macrophages around the compressed root via IL-6-dependent Piezo1 activation and the CXCL12/CXCR4 axis, upregulating the M1/M2 macrophage polarization ratio and ultimately triggering OIIRR [8]. Meanwhile, orthodontic pressure can stimulate PDLSCs to secrete H₂S, which promotes macrophage M1 polarization through the STAT1 pathway [7]. Pressure stimulation can also induce pyroptosis in PDLCs, leading to the secretion of pro-inflammatory mediators such as IL-18 and IL-1β, thereby promoting macrophage M1 polarization [6]. Nevertheless, whether direct mechanosensing by macrophages is involved in the regulation of macrophage polarization by mechanical pressure and its impact on OIIRR remains unknown.

The TRPV4 is a mechanically sensitive calcium ion channel protein with complex mechanisms and multiple functions [43,44]. On the pressure side during orthodontic treatment, TRPV4 expression is upregulated. Periodontal ligament stem cells can regulate the RANKL/OPG system via the mechanical pressure-TRPV4-ERK axis, thereby influencing osteoclast differentiation [45]. It may play a crucial role in orthodontic periodontal mechanical signal transduction and periodontal tissue adaptive remodeling [45]. However, whether macrophages perceive and respond to mechanical pressure through TRPV4 activation and participate in OIIRR remains unclear. Although our study confirmed the role of TRPV4 in the direct response of macrophages to mechanical pressure, research indicates that other candidate molecules such as Piezo1 and YAP/TAZ also exhibit mechanosensitivity [8,46,47]. Whether the biological effects induced by TRPV4 under mechanical pressure are independent, or whether they involve collaborative regulation or upstream/downstream modulation by other mechanosensitive channels or molecules, remains unknown. Investigating the specific signal perception and transduction pathways of mechanical pressure, particularly the interrelationship mechanisms among different mechanosensitive channels or molecules, represents a key focus for future research. Furthermore, considering that this research was conducted in vitro, although the simplified pressure-loading method facilitated direct exploration of the regulatory effect of TRPV4 on macrophage polarization under mechanical pressure, it differed from the actual pressure conditions experienced by cells in the human body.

In summary, this study demonstrates that macrophages perceive mechanical pressure via TRPV4-mediated Ca²⁺ influx, leading to an increased M1/M2 polarization ratio. These findings provide molecular insights for the clinical prevention of OIIRR during orthodontic treatment and offer a rationale for targeting TRPV4 as an adjunctive strategy to mitigate OIIRR.

Funding Statement

This work was supported by the National Natural Science Foundation of China [Grant No. 82460194], the Key Project of Yunnan Provincial Science and Technology Department-Kunming Medical University Applied Basic Research Joint Special Funds [Grant No. 202301AY070001-010], the National College Students’ Innovation and Entrepreneurship Training Program [Grant No. 202310678040, 202510678014], the First-Class Discipline Team of Kunming Medical University [Grant No. 2024XKTDTS08], and the Xingdian Talents Support Program [Grant No. XDYC-YLWS-2023–0048].

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

Available on request from the corresponding author.