Summary
Skeletal muscle satellite cells (SCs) reside between the myofiber sarcolemma and basal lamina, where extracellular matrix (ECM) interactions maintain stemness and regenerative function. Here, we identify chondrolectin (CHODL), a type I transmembrane protein with a C-type lectin domain, as a critical regulator of SC biology. Single-cell RNA-seq analysis reveals that Chodl is highly enriched in quiescent SCs but downregulated in proliferating myoblasts. The conditional deletion of Chodl in embryonic myoblasts (ChodlMKO) or adult SCs (ChodlPKO) leaves muscle development intact yet delays injury-induced regeneration in young and aged mice. Chodl-deficient SCs exhibit reduced self-renewal and diminished proliferation, leading to defective myofiber repair. In silico network perturbation further predicts disrupted ECM-ligand interactions and Notch signaling, consistent with SC mislocalization outside the basal lamina and precocious activation in ChodlPKO muscle. Together, these findings establish CHODL as a determinant of SC niche localization and function, linking ECM interactions to muscle stem cell maintenance and repair.
Subject areas: Molecular biology, Cell biology, Organizational aspects of cell biology
Graphical abstract

Highlights
-
•
Chondrolectin (CHODL) is enriched in quiescent muscle satellite cells (SCs)
-
•
Loss of CHODL impairs SC self-renewal and proliferation
-
•
CHODL is required for SC sublaminar localization and pool maintenance
-
•
CHODL deficiency triggers SC precocious activation and delays muscle regeneration
Molecular biology; Cell biology; Organizational aspects of cell biology
Introduction
Tissue-resident adult stem cells possess a remarkable ability to continuously regenerate local tissues. Satellite cells (SCs), the resident stem cells of adult skeletal muscle, play a critical role in muscle regeneration. Residing beneath the basal lamina in close association with myofibers, SCs maintain a quiescent (QSC) state under homeostatic conditions.1,2 Upon muscle injury or other stimuli, SCs exit quiescence, re-enter the cell cycle, and undergo metabolic and transcriptional remodeling that enables their migration and proliferation.3,4,5,6 These expanded SCs either fuse to repair damaged fibers or self-renew to replenish the stem cell pool.5 The transitions between these fates, quiescence, activation, differentiation, and self-renewal, are tightly regulated by various intrinsic programs and extrinsic signals from the surrounding microenvironment.7,8,9
Niche regulation of muscle stem cell function is influenced by the composition and architecture of the extracellular matrix (ECM).9 Following muscle injury, SCs remain encased within the residual basal lamina, referred to as a “ghost fiber,” which serves as a structural scaffold for regeneration.10,11 However, the disruption of this basal lamina can lead to disorganized myofiber regeneration, misdirected SC migration, and abnormal myotube formation.10,12 Recent studies have reported that ECM components, including laminin, collagen, integrin, and fibronectin, and so forth, are key in regulating SC fate in a cell-autonomous manner.12,13,14,15,16,17,18 Laminin, a key component of the basal lamina, directly interacts with integrins and other SC surface receptors to regulate adhesion, polarity, and fate decisions.12,14 Similarly, collagen not only provides structural support but also modulates SC behavior by influencing stiffness and mechanical signaling.15,16 Additionally, ECM remodeling enzymes actively reshape the basal lamina during repair, modifying the physical and biochemical environment of SCs.19,20 These ECM components actively instruct SC function, highlighting the niche as a dynamic regulator of muscle regeneration, though the precise molecular mediators and underlying mechanisms remain incompletely understood.
Chondrolectin (CHODL) is a type I transmembrane protein with a poorly understood cellular function.21 CHODL harbors a C-type lectin domain, which is responsible for recognizing and binding to carbohydrates, and proteins with C-type lectin domains have diverse functions, including cell-cell adhesion, ligand binding, and immune responses to pathogens.22,23 Recent studies have shown that the extracellular domain of CHODL interacts with collagen components in the ECM and plays important roles in the regulation of motor neuron functions, promoting cell survival and neurite outgrowth.24,25 Using in situ hybridization on E15 mouse embryos, it was revealed that CHODL is highly expressed in muscle cells of various organs.21,26 Although CHODL was shown to ameliorate motor neuron outgrowth defects in a zebrafish model of spinal muscular atrophy,27 its role in SCs has not yet been defined.
In this study, we analyzed published single-cell RNA-seq (scRNA-seq) datasets and found that CHODL is highly expressed in QSC SCs compared with activated and differentiated SCs. We hypothesized that CHODL may contribute to muscle development or regeneration. To test this, we generated a conditional knockout (KO) mouse model using MyoDCre mice to specifically delete the Chodl gene in embryonic myoblasts (ChodlMKO mice). While ChodlMKO mice showed normal muscle growth and myofiber formation, Chodl KO SCs displayed altered behaviors during muscle development. ChodlMKO muscles exhibited compromised regeneration capacity in young and aged mice. To specifically study the effect of CHODL in SCs, we crossed Pax7CreER mice with Chodlflox/flox mice and generated tamoxifen (TMX)-inducible SC-specific Chodl KO mice (ChodlPKO mice). ChodlPKO mice exhibited a diminished number of SCs, increased SC detachment from myofibers, and impaired muscle regeneration. Collectively, our study demonstrates a critical role for CHODL in SC biology in regulating muscle homeostasis and regeneration.
Results
CHODL is abundantly expressed in quiescent SCs
To gain insight into the expression pattern of Chodl across various tissues, we conducted a comprehensive analysis using the scRNA-seq data publicly available from Tabula Muris,28 Our analysis revealed that Chodl mRNA was mainly enriched in SCs, bladder cells, and a non-annotated cell population, while not detected in other cell types, including fibro-adipogenic progenitors (FAPs) (Figures 1A and 1B). Moreover, we analyzed our previously published scRNA-seq data29 to pinpoint the expression of Chodl in subsets of myogenic cells isolated from non-injured and regenerating muscles at 5 and 10 days post injury (dpi). UMAP revealed a similar expression pattern between Chodl and Pax7, moderate levels of Chodl in proliferating (MKi67+) cells, but mutually exclusive expression patterns between Chodl and Myog (Figure 1C). Consistently, violin plots showed that Chodl transcripts were predominantly detected in QSC and self-renewal (SSC) SCs, moderately detected in activated (ASC) and proliferating (PSC) SCs, but absent in committed (CSC) and differentiating (DSC) SCs (Figure 1D).
Figure 1.
Chodl mRNA is highly expressed in quiescent SCs
(A) Chodl gene expression in various cell types in the mouse. Data were explored through the Tabula Muris data portal.
(B) Relative expression of the Chodl gene in SCs, bladder cells, and a non-annotated cell population in (A).
(C) UMAP-embedding of the scRNA-seq data on SCs isolated from non-injured muscles and injured muscles at 5 dpi in 2-month-old mice.
(D) Violin plots show subcluster-specific gene expression (Pax7, Myog, Mki67) and enrichment of Chodl in the QSCs and ASCs. Colored by cluster identity. Abbreviations: QSC, quiescent SCs; SSC, self-renewal SCs; ASC, activated SCs; PSC, proliferating SCs; CSC, committed SCs; DSC, differentiating SCs.
(E) qRT-PCR analysis of Chodl expression level in mouse QSC, ASC, and myoblast. n = 3 mice.
(F) Immunoblot analysis showing CHODL expression in mouse myoblasts during myogenic differentiation. Relative band densitometry was calculated using ImageJ.
(G) qRT-PCR analysis of Chodl in TA muscles post CTX injury in the mouse. n = 4 mice.
Data are represented as mean ± SEM. The p values in E and G were analyzed using one-way ANOVA and Tukey post hoc test; ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001.
To validate these findings, we performed qPCR analysis of Chodl mRNA levels among distinct SC populations, including QSCs (FACS-isolated from uninjured muscles), ASCs (FACS-isolated from muscles at 3.5 dpi), and cultured primary myoblasts. Chodl was highly expressed in QSCs and moderately expressed in ASCs but was nearly undetectable in cultured myoblasts (Figure 1E). To further profile CHODL expression during later stages of myogenesis, we differentiated primary myoblasts for 3 days. Immunoblotting analysis indicated that CHODL protein levels increased during myoblast differentiation (Figure 1F). In addition, we examined Chodl mRNA in skeletal muscles at various time points after cardiotoxin (CTX)-induced muscle injury (Figure 1G). We found that Chodl mRNA was diminished at 3 dpi, and levels gradually returned to uninjured levels by 14 dpi. These data collectively demonstrate that Chodl is highly expressed in SCs and differentiated myofibers in the skeletal muscle.
Myogenic lineage-specific ablation of Chodl does not affect muscle development
To directly examine the physiological role of CHODL in SCs, we generated an embryonic myogenic progenitor-specific Chodl KO mouse (ChodlMKO) by crossing Chodlflox/flox mice with MyoDCre mice expressing Cre recombinase driven by the endogenous Myod1 gene promoter (Figure 2A). A previous study has demonstrated that MyoDCre selectively targets embryonic myogenic progenitors that subsequently differentiate into postnatal SC and myofibers.30 In this mouse model, the deletion of exons 2, 3, and 4 in the Chodl gene in myogenic lineage cells induces a frameshift and generates a premature stop codon, leading to the production of truncated proteins lacking the functional C-type lectin (CLEC) domain (Figure 2A). We confirmed the effective ablation of CHODL at both protein and mRNA levels in skeletal muscles of ChodlMKO mice (Figures 2B and 2C).
Figure 2.
Chodl is dispensable for postnatal muscle development
(A) Gene targeting strategy for generating Chodlf/f and ChodlMKO mice. Two-month-old control (Ctrl) and ChodlMKO mice were used for analysis.
(B and C) Western blot (B) and qPCR (C) analysis of tibialis anterior (TA) muscle samples from young adult Ctrl and ChodlMKO mice. Ctrl, n = 4 mice; ChodlMKO, n = 5 mice.
(D) Body weight. n = 5 mice per group.
(E) Representative images of tibialis anterior (TA) and soleus (SOL) muscles.
(F) Skeletal muscle tissue weight. n = 5 mice per group.
(G) H&E staining of TA muscle cross-sections. Scale bars, 50 μm.
(H) Average myofiber cross-sectional area (CSA) of the TA muscle section. n = 5 mice per group.
(I) Representative fiber-typing images of soleus muscles. Scale bars, 200 μm.
(J) Average myofiber CSA of soleus muscle cross-sections. n = 5 mice per group.
(K) Abundancy of type I, type IIa, and type IIb myofibers in soleus muscles. n = 5 mice per group. Data are represented as mean ± SEM; unpaired Student’s t test; ∗∗∗p < 0.001.
The ChodlMKO mice were born at the expected Mendelian ratio and exhibited the same growth rate as their control (Chodlflox/flox) littermates (Figure 2D). The morphology and weight of skeletal muscles were indistinguishable between adult control and ChodlMKO mice (Figures 2E and 2F). Histologically, control and ChodlMKO tibialis anterior (TA) muscles exhibited similar myofiber size with no difference in the cross-sectional area (CSA) (Figures 2G and 2H). As CHODL is also abundantly expressed in myofibers, we evaluated myofiber composition in the soleus muscles utilizing immunofluorescent staining of myosin heavy chain isoforms (Figure 2I). We found that myofiber size and fiber type distribution in soleus muscles were comparable between the control and ChodlMKO mice (Figures 2J and 2K). Collectively, these observations suggest that CHODL in myogenic progenitors is dispensable for maintaining muscle growth and fiber composition under homeostatic conditions.
Loss of Chodl reduces muscle SC pool and delays muscle regeneration in young adult mice
Given the high expression of Chodl in SCs, we sought to examine whether loss of Chodl alters the SC compartment in adult mice. Immunofluorescence staining of PAX7 and laminin revealed significantly fewer PAX7+ SCs observed in TA muscles of ChodlMKO mice compared to WT mice at 2-month-old (Figure 3A). Specifically, the number of PAX7+ SCs per TA area was reduced by 52% (2.3 versus 4.8 SCs per TA area) (Figure 3B). These findings suggest that CHODL plays an important role in maintaining the SC pool.
Figure 3.
Loss of Chodl reduces SC number and delays muscle regeneration in young adult mice
(A) Immunofluorescence of PAX7 and laminin on TA muscle cross-sections from young adult control (Ctrl) and ChodlMKO mice (2- to 3-month-old). White arrows indicate PAX7+ SCs. Scale bars, 50 μm.
(B) Quantification of PAX7+ cells per area as shown in (A), n = 4 mice per group.
(C) Schematics show experimental design involving cardiotoxin (CTX)-induced muscle regeneration in young adult mice.
(D) TA muscle recovery rate calculated by the ratio of injured to uninjured TA muscle weight at 7 and 21 days post injury (dpi). n = 3 mice per group.
(E) H&E staining of Ctrl and ChodlMKO mice TA muscle cross-sections at 7 and 21 dpi. Scale bars, 50 μm.
(F) Immunofluorescence of laminin on Ctrl and ChodlMKO TA muscle cross-sections at 7 and 21 dpi. Scale bars, 50 μm.
(G) Average myofiber cross-sectional area (CSA) of TA muscle cross-sections. n = 3 mice per group.
(H) Immunofluorescence of PAX7 and laminin on Ctrl and ChodlMKO TA muscle cross-sections at 7 and 21 dpi. Scale bars, 50 μm.
(I and J) Quantification of PAX7+ cell number per area at 7 (I) and 21 dpi (J). as shown in (H). For 7 dpi, n = 5 mice each group; For 21 dpi, n = 3 mice per group. Data are represented as mean ± SEM; unpaired Student’s t test; ∗p < 0.05 and ∗∗p < 0.01.
To investigate the physiological function of CHODL in SCs during muscle repair, we assessed regeneration following CTX-induced injury of TA muscles in young adult ChodlMKO mice (Figure 3C). Compared with controls, ChodlMKO mice exhibited a significantly reduced muscle recovery rate, as determined by the ratio of injured to uninjured TA muscle mass, at 21 dpi, whereas recovery was comparable to controls at 7 dpi (Figure 3D). Histological H&E staining showed that the ChodlMKO muscles contained smaller centrally nucleated myofibers at both 7 and 21 dpi, compared with the well-regenerated control muscles (Figure 3E). Consistently, immunofluorescence staining of laminin showed that ChodlMKO myofibers were significantly smaller than controls at 7 dpi, with a trend toward reduction at 21 dpi (Figures 3F and 3G). These results suggest that the deletion of Chodl in embryonic myoblasts results in delayed muscle regeneration. We further performed immunofluorescence staining of PAX7 and found a significant reduction in the number of PAX7+ SCs in the ChodlMKO muscles compared to controls at 7 dpi (Figures 3H and 3I). Remarkably, the number of PAX7+ cells was reduced by 70% in ChodlMKO mice at 21 dpi, when the muscle regeneration was completed, and self-renewed SCs have returned to a QSC state in control mice (Figures 3H and 3J). Together, these findings indicate an impairment in the self-renewal and regenerative capacity of Chodl-deficient SCs.
Chodl KO compromises SC maintenance and muscle regeneration in aged mice
Given the observation of the reduced self-renewal potential of Chodl-deficient SCs, we next examined the number of SCs in aged mice. At 20 to 22 months of age, a significant decrease in SC abundance was observed in the TA muscles of ChodlMKO mice compared to those of control mice (Figures 4A and 4B). Similarly, freshly isolated single myofibers from ChodlMKO mice contained fewer SCs than those from control mice (Figures 4C and 4D), suggesting that Chodl-deficient SCs fail to maintain the SC pool during aging. However, a comparison of SC numbers in young and aged ChodlMKO mice indicated that SC numbers remain stable, whereas control mice showed a reduction with age (Figures 3B and 4B), suggesting a baseline genotype effect that was maintained in old age.
Figure 4.
Chodl is necessary for SC maintenance and muscle regeneration in aging
(A) Immunofluorescence of PAX7 and laminin on TA muscle cross-sections from old control (Ctrl) and ChodlMKO mice (20- to 22-month-old). White arrows indicate PAX7+ SCs. Scale bars, 50 μm.
(B) Quantification of PAX7+ cells per area as shown in (A), n = 3 mice in each group.
(C) Immunofluorescence of PAX7, laminin on freshly isolated myofibers from old Ctrl and ChodlMKO mice extensor digitorum longus (EDL) muscle. Scale bars, 20 μm.
(D) Quantification of PAX7+ cells on myofibers as shown in (C). n = 3 mice, each group, 20–25 myofibers per mice.
(E) Schematics show experimental design involving cardiotoxin (CTX)-induced muscle regeneration on old mice (20- to 22-month-old).
(F) Representative images of TA muscles at 5 dpi in old Ctrl and ChodlMKO mice.
(G) TA muscle recovery rate calculated by the ratio of injured to non-injured TA muscle weight in old Ctrl and ChodlMKO mice. Ctrl, n = 5 mice; ChodlMKO, n = 4 mice.
(H) H&E staining of TA muscle cross-sections of old Ctrl and ChodlMKO mice at 5 dpi. Scale bars, 500 μm for the upper panel, 50 μm for the bottom panel.
(I and J) Relative frequency of myofiber cross-sectional area (CSA) (I) and dot plot of average myofiber CSA (J). n = 4 mice in each group.
(K and L) Immunofluorescence of PAX7, laminin (K), and quantification of PAX7+ cell number (L) on TA muscle cross-sections. Ctrl, n = 5 mice; ChodlMKO, n = 4 mice. Scale bars, 50 μm.
(M and N) Immunofluorescence of MyoG, laminin (M), and quantification of MyoG+ cell number (N) on TA muscle cross-sections. Ctrl, n = 5 mice; ChodlMKO, n = 4 mice. Scale bars, 50 μm. Data are represented as mean ± SEM; Student’s t test; ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001.
To further assess the role of CHODL in SC function and muscle regeneration in aged mice, we analyzed TA muscles at 5 dpi following CTX-induced muscle injury in aged control and ChodlMKO mice (Figure 4E). Compared with aged control mice, aged ChodlMKO mice exhibited a decrease in TA muscle size after injury with markedly reduced muscle recovery rate (Figures 4F and 4G). Histological analyses revealed fewer centrally nucleated myofibers in ChodlMKO TA muscles, indicating impaired muscle regeneration (Figure 4H). Specifically, the distribution of myofiber CSA displayed a clear left shift in ChodlMKO TA muscles, with a significant decrease in average CSA (Figures 4I and 4J). Moreover, immunofluorescence for PAX7 revealed a 37% reduction in the number of PAX7+ cells per TA muscle area in aged ChodlMKO mice compared with aged control mice (Figures 4K, 4L). Additionally, we performed MyoG immunofluorescence on TA muscle cross-sections to examine the number of differentiating SCs. A significant reduction in MyoG+ cells was observed in aged ChodlMKO mice, with a 20% decrease compared with aged control mice (Figures 4M, 4N), which might be due to the decrease of PAX7+ SCs, instead of the direct effect of differentiation. Together, these results suggest that the deletion of Chodl in SCs reduces SC numbers, diminishes SC differentiation, and impairs muscle regenerative capacity in aged mice.
Inducible Chodl deletion in adult SCs decreases proliferation and impedes muscle regeneration
As the regenerative and SC defects in the ChodlMKO mice may be due to the concomitant loss of CHODL in both SCs and myofibers, we sought to specifically KO Chodl in SCs to examine its role specifically in these cells. To this end, we crossed Pax7CreER mice with Chodlflox/flox mice to generate a TMX-inducible SC-specific Chodl KO (ChodlPKO) model. We then deleted Chodl in the SCs of adult mice by TMX injection, followed by CTX-induced injury of the TA muscles to assess muscle repair at 3.5 dpi (Figure 5A). To evaluate SC proliferation in vivo, 5-ethynyl-2′-deoxyuridine (EdU) was administered to mice 8 h before euthanasia via intraperitoneal (IP) injection to mark proliferating cells (Figure 5A). Immunofluorescent staining for embryonic myosin heavy chain (eMyHC) revealed fewer, eMyHC+ myofibers in ChodlPKO muscles compared to control mice at 3.5 dpi. This was consistent with the observations in ChodlMKO mice, suggesting a defective regeneration (Figures 5B and 5C). In addition, a significant reduction in the number of PAX7+ SCs was observed in ChodlPKO muscles compared to control muscleD and 5E). Furthermore, the percentage of EdU+ cells among the PAX7+ cells was significantly lower in ChodlPKO muscles compared to control muscles (7.1% versus 13.1%) (Figures 5F and 5G), indicative of a reduction in proliferation. These results suggest a cell-intrinsic role for CHODL in maintaining the regenerative capacity of adult SCs by promoting their proliferative activity.
Figure 5.
Inducible deletion of Chodl in adult SCs decreases proliferation and impedes muscle regeneration
(A) Schematics show CTX injury and EdU labeling of cell proliferation in 2-month-old control (Ctrl) and ChodlPKO mice after tamoxifen (TMX)-induced specific knockout of Chodl in SCs.
(B) Immunofluorescence of eMyHC on TA muscle cross-sections. Scale bars, 50 μm.
(C) Quantification of the eMyHC+ cell number per area as shown in (B).
(D) Immunofluorescence of PAX7 and laminin on TA muscle cross-sections. Scale bars, 50 μm.
(E) Quantification of the number of PAX7+ cells per area, as shown in (D).
(F) Immunofluorescence of PAX7, laminin, and EdU on TA muscle cross-sections. Scale bars, 50 μm.
(G) Quantification of the average number of PAX7+/EdU+ and PAX7+ cells per area, as shown in (F). Data are represented as mean ± SEM; unpaired Student’s t test; ∗p < 0.05 and ∗∗p < 0.01.
Chodl KO affects the expression of the Notch signaling pathway and ECM component genes
To understand the molecular mechanisms underlying CHODL function in SCs, we took advantage of scTenifoldKnk, a computational algorithm for predicting the molecular targets of genes of interest.31 The scTenifoldKnk-based virtual KO analysis recapitulates most of the findings of real-animal KO experiments, validating its utility.31,32 To identify the molecular targets of CHODL in SCs, we obtained RNA-seq data from wild-type (WT) mice generated by Yue et al.,6 and used the expression matrix from these WT mice as the input for scTenifoldKnk. We constructed the WT gene regulatory network (GRN) and then virtually knocked out Chodl. The scTenifoldKnk analysis revealed that 166 genes were differentially expressed between WT and Chodl-virtual KO, with a false discovery rate (FDR) < 0.05 (Figure 6A). More specifically, these virtual KO-perturbed genes included a large cohort of ECM-receptor interaction genes (Col3a1, Col4a1, Col4a2, Col5a1, Col5a2, Col5a3, Col6a1, Cav1, Creb3l2, Erbb3, Fgfr1, Jsrp1, Lama2, Lamc1, Neb, and Osm), several myogenic marker genes (Myf5, Myog, and Mymk) and Notch signaling pathway genes (Notch3, Dll1) (Figures 6A; Table S1). The perturbation of ECM genes suggests a key role for CHODL in SC niche function. Consistently, Notch signaling is not only crucial for the maintenance of QSCs but also plays a role in regulating the SC niche.33 The perturbation of Myomaker (Mymk) in the Chodl virtual KO is also consistent with its function in myoblast fusion.34
Figure 6.
Virtual knockout analyses identify that ECM-receptor interaction is disturbed in Chodl-KO mice
scTenifoldKnk was used to achieve a virtual knockout of Chodl in mouse skeletal muscle with the published RNA-seq data. By comparing the control and pseudo-Chodl KO gene regulatory networks (GRNs), 166 genes were identified with alterations in transcriptional regulatory networks and evaluated the knockout's effects on the control GRN. The resulting data were then used for enrichment analysis.
(A) Volcano plot of Chodl virtual KO perturbed genes.
(B) The KEGG pathway analysis of genes that are differentially expressed between control and Chodl-virtual KO.
(C) Interaction enrichment analysis of Chod-virtual KO perturbed genes.
We further performed Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis of the 166 differentially expressed genes (DEGs). The results revealed that the DEGs were highly enriched in several pathways, including “PI3K-Akt signaling pathway,” “focal adhesion,” “cardiac muscle contraction,” and “ECM-receptor interaction” (Figure 6B). These findings are consistent with a potential role of CHODL in mediating ECM interactions. Next, we applied the interaction enrichment analysis,35 which was based on the STRING protein-protein interaction database, on these 166 DEGs. We found that most of the DEGs appeared in a fully connected component in the STRING interaction network (Figure 6C), indicating a tightly integrated relationship between these genes. The core of the interactome map contains mostly muscle structural and metabolic genes (marked by red dots), while the ECM (blue dots) and Notch signaling (green dots) genes are clustered around the core genes (Figure 6C). Together, this in silico analysis indicates predictive roles for CHODL in muscle structure (myofiber) and ECM interaction.
CHODL is critical for retaining SCs in the myofiber niche
Inspired by the potential role of CHODL in mediating ECM interactions that are crucial for SC maintenance affected by the Chodl KO, we investigated whether CHODL plays a role in the localization of SCs within the niche. We first isolated single myofibers from EDL muscles and labeled SCs with PAX7 and the ECM with laminin (Figure 7A). We observed that a substantial fraction of PAX7+ SCs (∼11%) were loosely associated with myofibers in ChodlPKO mice, while only ∼3% of SCs were not closely attached to myofibers in control mice (Figures 7A and 7B). To exclude potential artifacts from collagen digestion during myofiber isolation, we examined SCs in cross sections of TA muscles from adult mice (Figure 7C). In control muscles, SCs were predominantly located under the basal lamina (ECM), with only ∼5% located outside the basal lamina (Figure 7D). In contrast, ∼30% of SCs were found outside the basal lamina in the interstitial space in the Chodl KO muscles (Figure 7D). The stem cell niche is crucial for maintaining stem cell quiescence. We further investigated whether the SCs in the interstitial space were precociously activated based on EdU uptake (Figure 7E). We found that the percentage of EdU+ SCs in ChodlPKO mice was 5 times higher than that in control mice (Figure 7F). These results indicate that the loss of CHODL disrupts the sublaminar localization of SCs, and this displacement of SCs correlates with their precocious activation.
Figure 7.
Chodl is critical for retaining SCs in the myofiber niche during development
(A) Immunofluorescence of PAX7, laminin on freshly isolated myofibers from young adult (2-month-old) control (Ctrl) and ChodlPKO mice extensor digitorum longus (EDL) muscles. Scale bars, 20 μm.
(B) Percentage of satellite cells (SCs) detached from the fiber as shown in (A). n = 4 mice per group, 20–25 fibers per mice.
(C) Immunofluorescence of PAX7, laminin on TA muscle cross-sections of adult Ctrl and ChodlPKO mice. Scale bars, 20 μm for the left three panels, 10 μm for the right panel with enlarged area.
(D) Percentage of SCs localized at the interstitial space as shown in (C), n = 4 mice per group.
(E) Immunofluorescence of PAX7, EdU on TA muscle cross-sections of young adult Ctrl and ChodlPKO mice. Red arrowhead indicates EdU/PAX7 double-positive cells. Scale bars, 20 μm.
(F) Percentage of EdU/PAX7 double-positive cells to total PAX7+ cells as shown in (E), n = 4 mice per group.
(G) Immunofluorescence of PAX7 and laminin on TA muscle cross-sections of Ctrl and ChodlMKO mice at postnatal day 7 (P7). Scale bars, 20 μm.
(H) Percentage of SCs localized at the interstitial space as shown in (G), n = 4 mice per group.
(I) Immunofluorescence of PAX7, laminin on TA muscle cross-sections of Ctrl and ChodlMKO mice at postnatal day 21 (P21). Scale bars, 20 μm.
(J) Percentage of SCs localized at the interstitial space as shown in (J), n = 4 mice per group. Data are represented as mean ± SEM; unpaired Student’s t test; ∗∗p < 0.01 and ∗∗∗p < 0.001.
The interstitial localization of SCs in adult muscles could be due to their inability to maintain niche localization or defects in niche homing during development. A proportion of fetal PAX7+ myoblasts occupy a sublaminar position to become QSCs starting from fetal development throughout early postnatal growth.36,37,38 This provides a time window to study the homing of SCs. To evaluate the impact of Chodl KO on the homing of SCs during muscle growth, we co-stained for PAX7 and laminin to examine the localization of PAX7+ SCs at postnatal day 7 and 21 (P7 and P21) (Figures 7G and 7I). The analysis of PAX7+ cells in TA muscles of control and ChodlMKO mice revealed two phenomena. First, higher percentages of PAX7+ SCs were located outside the basal lamina in the ChodlMKO muscles than in the control muscles, at both P7 and P21, compared to control SCs (Figures 7H and 7J). The difference in sublaminar SCs at such early stages is suggestive of homing defects rather than an inability to maintain the SC niche. Second, the percentage of interstitial SCs decreased from 15% at P7 to 12% at P21 in control muscles (Figures 7H and 7J), indicative of ongoing SC homing during postnatal growth and development. However, the percentage of interstitial (extra-niche) SCs remained at around 22% at both P7 and P21 in ChodlMKO mice (Figures 7H and 7J), suggesting that homing is stalled during this period. These results together demonstrate that Chodl deletion profoundly affects the homing of SCs during muscle development.
Discussion
CHODL was initially identified as a member of the C-type lectin family, and subsequent studies have shown that it is predominantly expressed in the vascular muscle of the testes, muscle cells of the prostate stroma, the heart, and skeletal muscle.21,26 The observation of highly enriched Chodl expression in QSC SCs led us to hypothesize that CHODL might play a crucial role in regulating muscle stem cell function. In this study, we utilized two cell-type-specific Chodl KO mouse models to investigate their function and demonstrate their essential role in SC pool maintenance, cellular behavior, and muscle regeneration. Our findings indicate that the loss of CHODL disrupts SC proliferation and impairs the maintenance of the SC pool, which results in a diminished muscle regeneration capacity post injury. Taken together, our study reveals a previously unrecognized role for CHODL in SC biology and its contribution to muscle regenerative capacity.
Despite the demonstrated importance of CHODL in SCs, its cellular mechanism of action remains poorly understood. CHODL has been reported to interact with ECM through its extracellular C-type lectin domain and to associate intracellularly with the Rab GTPase complex, suggesting a role in mediating ECM-dependent signaling in SCs.25,39 Consistent with this model, we observed a significant delay in muscle regeneration following SC-specific Chodl deletion, accompanied by an increased number of Chodl-deficient SCs aberrantly localized within the interstitial space between myofibers, which is indicative of precocious SC activation. Ex vivo myofiber isolation further supported these findings, revealing an increased number of detached SCs in the absence of CHODL. These observations align with the role of CHODL in ECM signaling, which is essential for maintaining SC adhesion to the myofiber surface.16,19,40 SCs reside within a structurally unique and highly polarized niche, sandwiched between the basal lamina and the underlying myofiber sarcolemma. We propose that CHODL is intrinsic to this polarity, likely localizing to the apical membrane to mediate adhesion with the collagen-rich basal lamina. Loss of this apical tether in Chodl-deficient SCs would disrupt niche asymmetry, resulting in SC detachment and the subsequent loss of quiescence-enforcing ECM signals. Although this model predicts a polarized subcellular distribution of CHODL, we were unable to directly visualize its localization due to the lack of commercially available antibodies with sufficient specificity for immunofluorescence in muscle tissue sections. Nonetheless, the protein topology of CHODL, particularly its extracellular C-type lectin domain with known collagen-binding capacity, strongly suggests its localization at the ECM-facing surface of SCs, where it functions to anchor cells to the basal lamina.25 This predicted localization is consistent with our functional observations that loss of CHODL leads to the physical detachment of SCs from their niche.
Maintaining the balance between quiescence and activation is a key function of the progenitor cell niche, with ECM interactions playing a pivotal role in regulating SC fate across various stem cell niches.7,8,9,19 Beyond its structural function, the ECM acts as a signaling platform, where cell surface receptors interact with ECM proteins to regulate cellular behavior.19 Notably, SCs cultured on ECM-coated plates (e.g., laminin and collagen) exhibit increased Pax7 expression compared to those grown on uncoated plates.41,42 The Notch signaling pathway is a critical regulator of SC quiescence,43,44 acting as a sensor of homeostatic conditions and reinforcing the niche by promoting the production of active collagen V, which in turn maintains SC quiescence.15 A previous microarray study suggested that CHODL may contribute to basal lamina assembly through Notch signaling.33 The in silico perturbations identified by our virtual KO analysis, most prominently involving ECM-receptor interactions and Notch signaling, suggest a mechanistic connection between niche adhesion and SC fate control. We propose that CHODL serves as a molecular anchor that promotes stable SC attachment to the collagen-rich basal lamina, potentially through its extracellular C-type lectin domain and associated ECM interactions. This physical anchorage may help preserve a niche geometry that supports basal Notch signaling, a pathway central to maintaining SC quiescence. In this model, loss of CHODL-mediated adhesion destabilizes SC-basal lamina contact, increasing the likelihood of sublaminar displacement and creating a permissive context for premature exit from quiescence. Nonetheless, these pathway-level inferences remain predictive and hypothesis-generating, and future studies will be required to define the direct binding partners of CHODL and to delineate how CHODL-dependent adhesion is coupled to Notch activity and other niche-derived signals.
Given the essential role of CHODL in SC maintenance and muscle homeostasis, it is important to explore its pathophysiological roles in various conditions. An examination of uninjured muscle weight and morphology in aged control and Chodl KO mice revealed no significant differences in muscle weight, CSA, and myofiber morphology. These observations suggest that CHODL is not strictly essential for the age-associated maintenance of myofiber architecture. We speculate that the normal muscle development observed in Chodl KO mice may be due to functional compensation by other C-type lectin family members, several of which are involved in skeletal muscle function.25 In experimental CTX-induced muscle injury, the initial decrease in CHODL expression may result from SC differentiation into myofibers during regeneration. However, it appears that CHODL levels are restored post-injury to maintain an adequate SC pool. Our data suggest that this process depends on functional CHODL, as Chodl KO significantly reduced the SC pool during injury recovery. Moreover, Chodl KO also led to a reduction in the SC pool in aged mice. Previous studies have demonstrated a progressive decline in the number of SCs with aging, leading to impaired muscle regeneration and contributing to age-related functional decline.45,46 This depletion of SCs is a causative factor in the onset of various muscle disorders such as sarcopenia.47 In aging muscle, the loss of SCs results in diminished regenerative capacity, primarily due to the dysregulation of SC homeostasis and a reduction in self-renewal capacity.8,48,49,50 Therefore, defining the role of CHODL in aging-related muscle decline and elucidating the signaling pathways it mediates may uncover therapeutic targets for preserving muscle function during aging.
Our data reveal a distinct biphasic expression pattern for Chodl: it is highly enriched in QSCs, markedly downregulated during the proliferative phase, and robustly re-expressed in differentiated myofibers. We propose a two-stage functional model in which the early suppression of Chodl facilitates exit from quiescence and re-entry into the cell cycle, whereas its later re-expression during terminal differentiation reflects a distinct role in muscle maturation and repair. Given CHODL’s predicted extracellular/transmembrane properties, this late-phase function may be structural, supporting nascent myotube stability, reinforcing cell-ECM interactions, and/or contributing to the restoration of niche architecture during regeneration, including in self-renewing SCs. Future studies that define the CHODL-dependent pathways and interaction partners governing SC quiescence, niche engagement, and differentiation will be important to clarify the underlying mechanism. Gain-of-function experiments, such as overexpressing CHODL in myofibers via viral delivery or in vivo electroporation, would provide a complementary test of our model by directly assessing whether elevated niche CHODL is sufficient to drive SC quiescence, as reflected by increased calcitonin receptor expression and reduced EdU incorporation. Such work may also illuminate whether dysregulated CHODL contributes to muscle functional decline in aging or disease and whether CHODL-associated pathways offer therapeutic opportunities to improve muscle maintenance and regeneration.
Limitations of the study
A key limitation is that the downstream molecular mechanisms of CHODL remain incompletely defined. Our identification of candidate CHODL-regulated pathways relied primarily on in silico network perturbation using scTenifoldKnk. Although this computational approach predicted disruptions in Notch signaling and ECM-receptor interactions, these pathway-level inferences remain hypothesis-generating because they were not directly validated through rescue experiments or functional assays in the current study. Future studies should prioritize experimentally determining whether CHODL directly binds specific collagen isoforms and whether CHODL loss leads to a quantifiable reduction in the Notch signaling pathway in vivo. Additionally, due to the lack of high-specificity commercial antibodies suitable for immunofluorescence, we were unable to directly visualize the predicted apical localization of CHODL on the SC plasma membrane. Alternative strategies, such as epitope tagging or knock-in reporter approaches, will be important to define the subcellular localization of CHODL more precisely and to clarify how its spatial distribution supports SC niche adhesion and quiescence.
Resource availability
Lead contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Feng Yue, Ph.D., fengyue@ufl.edu.
Materials availability
Materials used in this study are commercially available. Reagents generated in this study are available on request.
Data and code availability
This paper analyzes existing, publicly available scRNA-seq data, accessible at GEO with the accession number GSE109774,28 GSE138826,29 and GSE150366.6 This paper does not report original code. Any additional information required for the original data and reanalyzed data reported in this paper is available from the lead contact upon request.
Acknowledgments
This work was supported by grants from the US National Institutes of Health R01AR078695 and R01DK132819 to S.K., and UF Start-ups funds to F.Y. The authors thank Jun Wu for technical assistance.
Author contributions
F. Y. and S. K. conceptualized the study. L.G. and K. H.K. completed experiments. S.O. and X.C. performed transcriptome analysis. L.G., K. H. K., Y.L., and J.R. analyzed data and completed statistical analysis. L.G. and Y.L. wrote the original manuscript; F. Y. and S. K. revised the manuscript.
Declaration of interests
The authors declare that they have no competing interests.
STAR★Methods
Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Mouse monoclonal anti-PAX7 | DSHB | Cat# PAX7, RRID: AB_2299243 |
| Mouse monoclonal anti-MyoG | DSHB | Cat# F5D, RRID: AB_2146602 |
| Mouse monoclonal anti-MyHC | DSHB | Cat# MF 20, RRID: AB_2147781 |
| Mouse Monoclonal anti-MYH2 | DSHB | Cat# SC-71, RRID: AB_2147165 |
| Mouse Monoclonal anti-MYH4 | DSHB | Cat# BF-F3, RRID: AB_2266724 |
| Mouse Monoclonal anti-MYH7 | DSHB | Cat# BA-D5, RRID: AB_2235587 |
| Mouse monoclonal anti-eMyHC | DSHB | Cat# F1.652, RRID: AB_528358 |
| Rabbit polyclonal anti-Laminin | Sigma | Cat# L9393, RRID: AB_477163 |
| Rabbit Polyclonal anti-CHODL | Thermo Fisher Scientific | Cat# PA5-69993, RRID: AB_2689238 |
| Mouse monoclonal anti-GAPDH | Santa Cruz Biotechnology | Cat# sc-32233, RRID: AB_627679 |
| Alexa 568 goat anti-mouse IgG1 | Invitrogen | Cat# A-21124, RRID: AB_2535766 |
| Alexa 488 goat anti-mouse IgM | Invitrogen | Cat# A-21121, RRID: AB_2535764 |
| Alexa 647 goat anti-mouse IgG2b | Invitrogen | Cat# A-21242, RRID: AB_2535811 |
| Alexa 488 goat anti-rabbit IgG | Invitrogen | Cat# A-11034, RRID: AB_2576217 |
| Alexa 647 goat anti-rabbit IgG | Invitrogen | Cat# A-21244, RRID: AB_2535812 |
| HRP AffiniPure goat anti-mouse IgG | Jackson ImmunoResearch | Cat# 115-035-003, RRID: AB_10015289 |
| HRP AffiniPure goat anti-rabbit IgG | Jackson ImmunoResearch | Cat# 111-035-003, RRID: AB_2313567 |
| Chemicals, peptides, and recombinant proteins | ||
| Tamoxifen (TMX) | Calbiochem | 579000 |
| 4-Hydroxytamoxifen (4-OHT) | Sigma-Aldrich | H6278 |
| Cardiotoxin | Sigma-Aldrich | 217503 |
| Ketamine HCl | Akron | 59399-114-10 |
| Xylazine | Akron | 59399-110-20 |
| Collagenase, Type I | Worthington | LS004197 |
| Collagenase, Type II | Worthington | LS004179 |
| Dispase II | Sigma-Aldrich | 04942078001 |
| Ham’s F-10 Nutrient Mix | Gibco | 11550043 |
| Dulbecco’s Modified Eagle Medium | Gibco | 11995065 |
| Fetal bovine serum | HyClone | SH30080.03 |
| Donor Horse Serum | Corning | MT35030CV |
| Penicillin–Streptomycin | Sigma-Aldrich | P4333 |
| Phosphate-buffered saline | Gibco | 21600–069 |
| DAPI | Invitrogen | D1306 |
| Paraformaldehyde | Sigma-Aldrich | P6148 |
| O.C.T. Compound | Fisher Scientific | 23-730-571 |
| Fibroblast growth factor , basic | Promega | 9PIG507 |
| BD Matrigel Matrix | BD Biosciences | 356235 |
| Collagen from rat tail | Sigma-Aldrich | C7661 |
| 5-Ethynyl-2′-deoxyuridine (EdU) | Cayman Chemical | 20518 |
| Tetramethylrhodamine (TAMRA) azide | Invitrogen | T10182 |
| Goat serum | MP Biomedicals | 08642921 |
| Bovine serum albumin | GeminiBio | 700-105P |
| TRIzol Reagent | Sigma-Aldrich | T9424 |
| Chloroform | VWR Chemicals | BDH1109 |
| Methanol | Fisher Scientific | A412-20 |
| NP-40 | Thermo Scientific | 85124 |
| Sodium deoxycholate | Sigma-Aldrich | D6750 |
| Sodium Dodecyl Sulfate (SDS) | Sigma-Aldrich | P8849 |
| Protease Inhibitor Cocktail | Fisher Scientific | A637-500 |
| PMSF | Calbiochem | 7110-OP |
| Critical commercial assays | ||
| M-MLV reverse transcriptase | Invitrogen | 28025021 |
| PicoPure RNA Isolation Kit | Applied Biosystems | KIT0204 |
| FastStart Universal SYBR Green Master | Roche | 49138500 |
| Pierce BCA Protein Assay Reagent | Thermo Scientific | 23225 |
| Western Blotting Chemiluminescence Luminol Reagent | Santa Cruz Biotechnology | sc-2048 |
| Deposited data | ||
| Single cell RNA-seq data | The Tabula Muris Consortium et al.28 | GSE109774 |
| Single cell RNA-seq data of satellite cells during regeneration | Oprescu et al.29 | GSE138826 |
| Single cell RNA-seq data of satellite cells | Yue et al.6 | GSE150366 |
| Experimental models: Organisms/strains | ||
| Mouse: B6;129-Pax7tm2.1(cre/ERT2)Fan/J | The Jackson Laboratory | JAX stock: #012476 |
| Mouse: B6.Cg-Pax7tm1(cre/ERT2)Gaka/J | The Jackson Laboratory | JAX stock: #017763 |
| Mouse: FVB.Cg-Myod1tm2.1(icre)Glh/J | The Jackson Laboratory | JAX stock: #014140 |
| Mouse: B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J | The Jackson Laboratory | JAX stock: #007909 |
| Mouse: B6.Chodlflox/flox | This paper | N/A |
| Oligonucleotides | ||
| Mouse β-actin forward primer: GTCCCTCACCCTCCCAAAAG | This paper | N/A |
| Mouse β-actin reverse primer: GCTGCCTCAACACCTCAACCC | This paper | N/A |
| Mouse Chodl forward primer: AGCGGAGATGGCCAAACATC | This paper | N/A |
| Mouse Chodl reverse primer: TTCAGCGGGCTCTGTTGGAT | This paper | N/A |
| Software and algorithms | ||
| Seurat v3.1 | Stuart et al.51 | Satija lab: satijalab.org/seurat/ |
| scTenifoldKnk | Osorio et al.31 | https://doi.org/10.32614/CRAN.package.scTenifoldKnk |
| BD FACSDiva Software | BD Biosciences | RRID:SCR_001456 |
| MetaMorph Microscopy Automation and Image Analysis Software | Molecular Devices, LLC | RRID:SCR_002368 |
| Adobe Photoshop | Adobe Inc. | RRID:SCR_014199 |
| Prism 10 | GraphPad Prism | RRID:SCR_002798 |
Experimental model details
Animals
All procedures involving animals were conducted in compliance with National Institutes of Health and Institutional guidelines with approval by the Purdue Animal Care and Use Committee (approval number #1112000440). Chodlflox/+ mice were created via CRISPR/Cas9 technology. Firstly, two sgRNAs-targeting the introns on both sides of the floxed region (contains exons 2–4) of Chodl were synthesized and transcribed, respectively. The donor vector with the loxP fragment was designed and constructed in vitro. Then Cas9 mRNA, sgRNA and donor were co-injected into zygotes. Thereafter, the zygotes were transferred into the oviduct of pseudo pregnant ICR females at 0.5 days postcoitum, and F0 mice was born 19–21 days after transplantation. Finally, F0 mice were crossed with C57BL/6J mice to create heterozygous mice, which were used to produce homozygous Chodlflox/flox mice. Pax7CreER/+ (stock #017763) Pax7CreERT2(Gaka) (stock #017763), Rosa26-tdTomatoLSL (stock #007909), and MyoDCre/+ (stock #014140) mice were purchased from the Jackson Lab. Both male or female mice were used and always sex-matched for each specific experiment. Mice were housed and maintained in the animal facility, with free access to standard rodent chow and water.
Primary myoblast isolation, culture, and differentiation
Satellite-cell-derived primary myoblasts were isolated from hindlimb skeletal muscles of Pax7CreER; Chodlflox/flox mice at the age of 6–8 weeks as previously described. Muscles were minced and digested in collagenase type I and Dispase B mixture. The digestion was stopped with growth medium (Ham’s F-10 Nutrient Mix medium supplemented with 20% FBS, 4 ng/mL basic FGF, and 1% penicillin–streptomycin). Cells were then filtered from debris, centrifuged, and cultured in growth medium on collagen-coated cell culture plates at 37°C, 5% CO2. For in vitro genetic deletion, Pax7CreER; Chodlflox/flox primary myoblasts were induced by 2 days of 4-Hydroxytamoxifen (0.4 μM), and the primary myoblasts treated with vehicle were set as the control. For differentiation, primary myoblasts were seeded on BD Matrigel-coated cell culture plates and induced to differentiate in a low serum medium (DMEM supplemented with 2% horse serum and 1% penicillin-streptomycin).
Single myofiber isolation and culture
Single myofibers were isolated from Extensor Digitorum Longus (EDL) muscles of adult mice as previously described.52 The EDL muscle was removed from the hindlimb of the mouse and digested with 0.2% collagenase type I for 60 min in shaking water bath at 37 °C. Single muscle fibers were obtained by gently triturating the digested muscle using a glass pipet in DMEM under a dissection microscope. Released single myofibers were then transferred and cultured in a horse serum-coated Petri dish (60-mm) in DMEM supplemented with 20% FBS, 4 ng/mL basic FGF, and 1% penicillin–streptomycin at 37 °C for indicated days. Fresh isolated and cultured myofibers were fixed immediately in 4% paraformaldehyde (PFA) for further analysis.
Method details
scRNA-seq data analysis
scRNA-seq datasets of muscle satellite cell during muscle regeneration were downloaded from publicly available data (GSE138826).29 For data analysis, barcodes and reads were aligned to mm10 (Mus Musculus) using CellRanger v3.1, and data analysis was performed using Seurat v3.1 as previously described.51,53 Data for Chodl gene expression in various cell types in mouse was explored through the Tabula Muris data portal (GSE109774).28
In vivo treatment
Tamoxifen was dissolved in corn oil at a concentration of 10 mg/mL. Both Pax7CreER; Chodlflox/flox and Chodlflox/flox mice were administered tamoxifen at a concentration of 100 mg/kg per day for five continuous days by intraperitoneal injection. In continuous labeling experiments, 2′-Deoxy-5-ethynyluridine (EdU) was administrated uninterruptedly to mice through drinking water (0.3 mg/mL) at 8 h before sampling. Drinking bottles were protected from light.
Muscle injury and regeneration
Muscle regeneration was induced by cardiotoxin (CTX) injection. Adult mice were anesthetized using a ketamine-xylazine cocktail, and CTX (50 μL of a 10 μM solution) was injected into the tibialis anterior (TA) muscle of one limb, while the contralateral TA muscle served as the uninjured control. Muscles were harvested at the indicated days post-injury (dpi) to assess the progression of regeneration and repair. The muscle recovery rate was calculated as the ratio of the weight of the injured TA muscle to that of the uninjured contralateral control.
Satellite cell isolation by flow cytometry
tdT+ QSCs and ASCs were isolated from uninjured and injured muscles of Pax7CreERT2; Rosa26-tdTomatoLSL mice by flow cytometry, performed as previously described.54 Hindlimb muscles from adult mice were minced and digested with 700 U/ml collagenase type II at 37 °C for 1 h. Samples were then centrifuged and digested with 100 U/ml collagenase type II and 1U/ml Dispase II at 37 °C for 30 min. Each sample was consecutively filtered through 70-μm cell strainers. Cell suspension was then centrifuged, washed with F-10 Ham’s medium containing 10% horse serum. SCs were identified and purified by gating with tdT using a BD-FACS Aria III fluorescence-activated cell sorting (FACS) system (BD Biosciences).
Histology and immunofluorescence staining
Whole muscle tissues from control, ChodlMKO and ChodlPKO mice were dissected and frozen immediately in an O. C. T. compound. Frozen muscles were cross-sectioned (10 μm) using a Leica CM1850 cryostat. The slides were subjected to histological H&E staining or immunofluorescence staining. For immunofluorescence staining, cross-sections, single myofibers, or cultured cells were fixed in 4% PFA for 10 min, quenched with 100 mM glycine for 10 min, and incubated in blocking buffer (5% goat serum, 2% BSA, 0.1% Triton X-100, and 0.1% sodium azide in PBS) for 1 h. Samples were then incubated with primary antibodies and then secondary antibodies and DAPI. All images were captured using a Leica DM 6000B microscope with MetaMorph Microscopy Automation and Image Analysis Software, and images for control and KO samples were captured using identical parameters. The quantification of histological staining was performed on ≥3 non-overlapping fields from entire muscle cross-sections for each mouse. All the images shown are representative results of at least three biological replicates.
Protein extraction and western blot analysis
Total protein was extracted from homogenized muscle tissue using RIPA buffer containing 25 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1 mM EDTA, 0.5% NP-40, 0.5% sodium deoxycholate, and 0.1% SDS, supplemented with proteinase inhibitor (PI) and phenylmethylsulphonyl fluoride (PMSF). Protein concentration was measured by BCA protein assay. Proteins were separated by electrophoresis, transferred to polyvinylidene fluoride (PVDF) membrane, blocked with 5% fat-free milk for 1 h at room temperature and incubated with primary antibodies overnight at 4°C. Immunodetection was detected after incubating with secondary antibodies using chemiluminescence western blotting substrate on a FluorChem R system (Proteinsimple).
Total RNA extraction and qRT-PCR
Total RNA was extracted from cells and tissues using TRIzol reagent according to the manufacturer’s instruction or PicoPure RNA Isolation Kit for FACS-isolated SCs. A total of 2 μg or 0.3 μg of total RNA was reversed transcribed with random primers, M-MLV reverse transcriptase and DTT. Real-time qPCR was carried out in a Roche Light cycler 480 PCR system with FastStart Universal SYBR Green Master Mix and gene-specific primers. Relative changes in gene expression were analyzed using the 2−ΔΔCT method and normalized to β-actin.
Virtual knockout of Chodl
scTenifoldKnk was used to achieve virtual knockout of Chodl in mouse skeletal muscle with the published RNA-seq data.6,31 In brief, scTenifoldKnk uses a gene-by-cell count matrix from the wild-type (WT) sample as input. It first constructs a WT GRN (Gene Regulatory Network) based on this matrix and then simulates Chodl knockout by removing the Chodl gene from the WT GRN, resulting in a pseudo-Chodl KO GRN. A network comparison method is then applied to identify differentially regulated (DR) genes by comparing the WT and pseudo-Chodl KO scGRNs. These DR genes, also referred to as virtual KO perturbed genes, then be used for gene function enrichment analysis.
Quantification and statistical analysis
Experiments involving mice were performed with a minimum of three biological replicates. All muscle histological analysis including the CSA of myofibers, fiber type, and the number of PAX7+, MyoG+, eMyHC+, and EdU+ cells per area were quantified by Fiji-ImageJ software or by PhotoShop software. Sample size or replicate number (designated as ‘‘n’’) for each experiment are indicated in the figure legends. All analyses were conducted with unpaired Student’s t test, with a two-tail distribution. All experimental data are represented as mean ± SEM. Comparisons with p values <0.05 were considered significant.
Published: April 10, 2026
Footnotes
Supplemental information can be found online at https://doi.org/10.1016/j.isci.2026.115703.
Contributor Information
Shihuan Kuang, Email: shihuan.kuang@duke.edu.
Feng Yue, Email: fengyue@ufl.edu.
Supplemental information
References
- 1.Yin H., Price F., Rudnicki M.A. Satellite cells and the muscle stem cell niche. Physiol. Rev. 2013;93:23–67. doi: 10.1152/physrev.00043.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Kuang S., Gillespie M.A., Rudnicki M.A. Niche regulation of muscle satellite cell self-renewal and differentiation. Cell Stem Cell. 2008;2:22–31. doi: 10.1016/j.stem.2007.12.012. [DOI] [PubMed] [Google Scholar]
- 3.Sartorelli V., Ciuffoli V. Metabolic regulation in adult and aging skeletal muscle stem cells. Genes Dev. 2025;39:186–208. doi: 10.1101/gad.352277.124. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.de Morree A., Rando T.A. Regulation of adult stem cell quiescence and its functions in the maintenance of tissue integrity. Nat. Rev. Mol. Cell Biol. 2023;24:334–354. doi: 10.1038/s41580-022-00568-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Relaix F., Bencze M., Borok M.J., Der Vartanian A., Gattazzo F., Mademtzoglou D., Perez-Diaz S., Prola A., Reyes-Fernandez P.C., Rotini A., Taglietti Perspectives on skeletal muscle stem cells. Nat. Commun. 2021;12:692. doi: 10.1038/s41467-020-20760-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Yue F., Oprescu S.N., Qiu J., Gu L., Zhang L., Chen J., Narayanan N., Deng M., Kuang S. Lipid droplet dynamics regulate adult muscle stem cell fate. Cell Rep. 2022;38 doi: 10.1016/j.celrep.2021.110267. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Hicks M.R., Pyle A.D. The emergence of the stem cell niche. Trends Cell Biol. 2023;33:112–123. doi: 10.1016/j.tcb.2022.07.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Brunet A., Goodell M.A., Rando T.A. Ageing and rejuvenation of tissue stem cells and their niches. Nat. Rev. Mol. Cell Biol. 2023;24:45–62. doi: 10.1038/s41580-022-00510-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Fuchs E., Blau H.M. Tissue stem cells: architects of their niches. Cell Stem Cell. 2020;27:532–556. doi: 10.1016/j.stem.2020.09.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Webster M.T., Manor U., Lippincott-Schwartz J., Fan C.M. Intravital Imaging Reveals Ghost Fibers as Architectural Units Guiding Myogenic Progenitors during Regeneration. Cell Stem Cell. 2016;18:243–252. doi: 10.1016/j.stem.2015.11.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Vracko R., Benditt E.P. Basal lamina: the scaffold for orderly cell replacement. Observations on regeneration of injured skeletal muscle fibers and capillaries. J. Cell Biol. 1972;55:406–419. doi: 10.1083/jcb.55.2.406. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Rayagiri S.S., Ranaldi D., Raven A., Mohamad Azhar N.I.F., Lefebvre O., Zammit P.S., Borycki A.G. Basal lamina remodeling at the skeletal muscle stem cell niche mediates stem cell self-renewal. Nat. Commun. 2018;9:1075. doi: 10.1038/s41467-018-03425-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Ishii K., Sakurai H., Suzuki N., Mabuchi Y., Sekiya I., Sekiguchi K., Akazawa C. Recapitulation of Extracellular LAMININ Environment Maintains Stemness of Satellite Cells In Vitro. Stem Cell Rep. 2018;10:568–582. doi: 10.1016/j.stemcr.2017.12.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Penton C.M., Badarinarayana V., Prisco J., Powers E., Pincus M., Allen R.E., August P.R. Laminin 521 maintains differentiation potential of mouse and human satellite cell-derived myoblasts during long-term culture expansion. Skelet. Muscle. 2016;6:44. doi: 10.1186/s13395-016-0116-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Baghdadi M.B., Castel D., Machado L., Fukada S.I., Birk D.E., Relaix F., Tajbakhsh S., Mourikis P. Reciprocal signalling by Notch-Collagen V-CALCR retains muscle stem cells in their niche. Nature. 2018;557:714–718. doi: 10.1038/s41586-018-0144-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Urciuolo A., Quarta M., Morbidoni V., Gattazzo F., Molon S., Grumati P., Montemurro F., Tedesco F.S., Blaauw B., Cossu G., et al. Collagen VI regulates satellite cell self-renewal and muscle regeneration. Nat. Commun. 2013;4:1964. doi: 10.1038/ncomms2964. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Lukjanenko L., Jung M.J., Hegde N., Perruisseau-Carrier C., Migliavacca E., Rozo M., Karaz S., Jacot G., Schmidt M., Li L., et al. Loss of fibronectin from the aged stem cell niche affects the regenerative capacity of skeletal muscle in mice. Nat. Med. 2016;22:897–905. doi: 10.1038/nm.4126. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Chang N.C., Sincennes M.-C., Chevalier F.P., Brun C.E., Lacaria M., Segalés J., Muñoz-Cánoves P., Ming H., Rudnicki M.A. The dystrophin glycoprotein complex regulates the epigenetic activation of muscle stem cell commitment. Cell Stem Cell. 2018;22:755–768.e6. doi: 10.1016/j.stem.2018.03.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Thomas K., Engler A.J., Meyer G.A. Extracellular matrix regulation in the muscle satellite cell niche. Connect. Tissue Res. 2015;56:1–8. doi: 10.3109/03008207.2014.947369. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Goetsch S.C., Hawke T.J., Gallardo T.D., Richardson J.A., Garry D.J. Transcriptional profiling and regulation of the extracellular matrix during muscle regeneration. Physiol. Genomics. 2003;14:261–271. doi: 10.1152/physiolgenomics.00056.2003. [DOI] [PubMed] [Google Scholar]
- 21.Weng L., Hübner R., Claessens A., Smits P., Wauters J., Tylzanowski P., Van Marck E., Merregaert J. Isolation and characterization of chondrolectin (Chodl), a novel C-type lectin predominantly expressed in muscle cells. Gene. 2003;308:21–29. doi: 10.1016/s0378-1119(03)00425-6. [DOI] [PubMed] [Google Scholar]
- 22.Zelensky A.N., Gready J.E. The C-type lectin-like domain superfamily. FEBS J. 2005;272:6179–6217. doi: 10.1111/j.1742-4658.2005.05031.x. [DOI] [PubMed] [Google Scholar]
- 23.Weis W.I., Taylor M.E., Drickamer K. The C-type lectin superfamily in the immune system. Immunol. Rev. 1998;163:19–34. doi: 10.1111/j.1600-065x.1998.tb01185.x. [DOI] [PubMed] [Google Scholar]
- 24.Enjin A., Rabe N., Nakanishi S.T., Vallstedt A., Gezelius H., Memic F., Lind M., Hjalt T., Tourtellotte W.G., Bruder C., et al. Identification of novel spinal cholinergic genetic subtypes disclose Chodl and Pitx2 as markers for fast motor neurons and partition cells. J. Comp. Neurol. 2010;518:2284–2304. doi: 10.1002/cne.22332. [DOI] [PubMed] [Google Scholar]
- 25.Oprişoreanu A.M., Smith H.L., Arya S., Webster R., Zhong Z., Eaton-Hart C., Wehner D., Cardozo M.J., Becker T., Talbot K., Becker C.G. Interaction of Axonal Chondrolectin with Collagen XIXa1 Is Necessary for Precise Neuromuscular Junction Formation. Cell Rep. 2019;29:1082–1098.e10. doi: 10.1016/j.celrep.2019.09.033. [DOI] [PubMed] [Google Scholar]
- 26.Claessens A., Van de Vijver K., Van Bockstaele D.R., Wauters J., Berneman Z.N., Van Marck E., Merregaert J. Expression and localization of CHODLDeltaE/CHODLfDeltaE, the soluble isoform of chondrolectin. Cell Biol. Int. 2007;31:1323–1330. doi: 10.1016/j.cellbi.2007.05.014. [DOI] [PubMed] [Google Scholar]
- 27.Sleigh J.N., Barreiro-Iglesias A., Oliver P.L., Biba A., Becker T., Davies K.E., Becker C.G., Talbot K. Chondrolectin affects cell survival and neuronal outgrowth in in vitro and in vivo models of spinal muscular atrophy. Hum. Mol. Genet. 2014;23:855–869. doi: 10.1093/hmg/ddt477. [DOI] [PubMed] [Google Scholar]
- 28.Tabula Muris Consortium. Overall coordination. Logistical coordination. Organ collection and processing. Library preparation and sequencing. Writing group. Supplemental text writing group. Principal investigator Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris. Nature. 2018;562:367–372. doi: 10.1038/s41586-018-0590-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Oprescu S.N., Yue F., Qiu J., Brito L.F., Kuang S. Temporal Dynamics and Heterogeneity of Cell Populations during Skeletal Muscle Regeneration. iScience. 2020;23 doi: 10.1016/j.isci.2020.100993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Kanisicak O., Mendez J.J., Yamamoto S., Yamamoto M., Goldhamer D.J. Progenitors of skeletal muscle satellite cells express the muscle determination gene, MyoD. Dev. Biol. 2009;332:131–141. doi: 10.1016/j.ydbio.2009.05.554. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Osorio D., Zhong Y., Li G., Xu Q., Yang Y., Tian Y., Chapkin R.S., Huang J.Z., Cai J.J. scTenifoldKnk: An efficient virtual knockout tool for gene function predictions via single-cell gene regulatory network perturbation. Patterns (N Y) 2022;3 doi: 10.1016/j.patter.2022.100434. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Erbe R., Gore J., Gemmill K., Gaykalova D.A., Fertig E.J. The use of machine learning to discover regulatory networks controlling biological systems. Mol. Cell. 2022;82:260–273. doi: 10.1016/j.molcel.2021.12.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Bröhl D., Vasyutina E., Czajkowski M.T., Griger J., Rassek C., Rahn H.P., Purfürst B., Wende H., Birchmeier C. Colonization of the satellite cell niche by skeletal muscle progenitor cells depends on Notch signals. Dev. Cell. 2012;23:469–481. doi: 10.1016/j.devcel.2012.07.014. [DOI] [PubMed] [Google Scholar]
- 34.Millay D.P., O'Rourke J.R., Sutherland L.B., Bezprozvannaya S., Shelton J.M., Bassel-Duby R., Olson E.N. Myomaker is a membrane activator of myoblast fusion and muscle formation. Nature. 2013;499:301–305. doi: 10.1038/nature12343. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Szklarczyk D., Franceschini A., Wyder S., Forslund K., Heller D., Huerta-Cepas J., Simonovic M., Roth A., Santos A., Tsafou K.P., et al. STRING v10: protein-protein interaction networks, integrated over the tree of life. Nucleic Acids Res. 2015;43:D447–D452. doi: 10.1093/nar/gku1003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Schultz E. Changes in the satellite cells of growing muscle following denervation. Anat. Rec. 1978;190:299–311. doi: 10.1002/ar.1091900212. [DOI] [PubMed] [Google Scholar]
- 37.Tamaki T., Akatsuka A., Ando K., Nakamura Y., Matsuzawa H., Hotta T., Roy R.R., Edgerton V.R. Identification of myogenic-endothelial progenitor cells in the interstitial spaces of skeletal muscle. J. Cell Biol. 2002;157:571–577. doi: 10.1083/jcb.200112106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Kassar-Duchossoy L., Giacone E., Gayraud-Morel B., Jory A., Gomès D., Tajbakhsh S. Pax3/Pax7 mark a novel population of primitive myogenic cells during development. Genes Dev. 2005;19:1426–1431. doi: 10.1101/gad.345505. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Claessens A., Weyn C., Merregaert J. The cytoplasmic domain of chondrolectin interacts with the beta-subunit of Rab geranylgeranyl transferase. Cell. Mol. Biol. Lett. 2008;13:250–259. doi: 10.2478/s11658-007-0052-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Gattazzo F., Urciuolo A., Bonaldo P. Extracellular matrix: a dynamic microenvironment for stem cell niche. Biochim. Biophys. Acta. 2014;1840:2506–2519. doi: 10.1016/j.bbagen.2014.01.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Grefte S., Vullinghs S., Kuijpers-Jagtman A.M., Torensma R., Von den Hoff J.W. Matrigel, but not collagen I, maintains the differentiation capacity of muscle derived cells in vitro. Biomed. Mater. 2012;7 doi: 10.1088/1748-6041/7/5/055004. [DOI] [PubMed] [Google Scholar]
- 42.Wilschut K.J., Haagsman H.P., Roelen B.A.J. Extracellular matrix components direct porcine muscle stem cell behavior. Exp. Cell Res. 2010;316:341–352. doi: 10.1016/j.yexcr.2009.10.014. [DOI] [PubMed] [Google Scholar]
- 43.Conboy I.M., Rando T.A. The regulation of Notch signaling controls satellite cell activation and cell fate determination in postnatal myogenesis. Dev. Cell. 2002;3:397–409. doi: 10.1016/s1534-5807(02)00254-x. [DOI] [PubMed] [Google Scholar]
- 44.Bjornson C.R.R., Cheung T.H., Liu L., Tripathi P.V., Steeper K.M., Rando T.A. Notch signaling is necessary to maintain quiescence in adult muscle stem cells. Stem Cell. 2012;30:232–242. doi: 10.1002/stem.773. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Chakkalakal J.V., Jones K.M., Basson M.A., Brack A.S. The aged niche disrupts muscle stem cell quiescence. Nature. 2012;490:355–360. doi: 10.1038/nature11438. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Blau H.M., Cosgrove B.D., Ho A.T.V. The central role of muscle stem cells in regenerative failure with aging. Nat. Med. 2015;21:854–862. doi: 10.1038/nm.3918. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Shefer G., Van de Mark D.P., Richardson J.B., Yablonka-Reuveni Z. Satellite-cell pool size does matter: defining the myogenic potency of aging skeletal muscle. Dev. Biol. 2006;294:50–66. doi: 10.1016/j.ydbio.2006.02.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Brack A.S., Muñoz-Cánoves P. The ins and outs of muscle stem cell aging. Skelet. Muscle. 2016;6 doi: 10.1186/s13395-016-0072-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Feige P., Brun C.E., Ritso M., Rudnicki M.A. Orienting Muscle Stem Cells for Regeneration in Homeostasis, Aging, and Disease. Cell Stem Cell. 2018;23:653–664. doi: 10.1016/j.stem.2018.10.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Rando T.A., Brunet A., Goodell M.A. Hallmarks of stem cell aging. Cell Stem Cell. 2025;32:1038. doi: 10.1016/j.stem.2025.06.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Stuart T., Butler A., Hoffman P., Hafemeister C., Papalexi E., Mauck W.M., Hao Y., Stoeckius M., Smibert P., Satija R. Comprehensive integration of single-cell data. Cell. 2019;177:1888–1902.e21. doi: 10.1016/j.cell.2019.05.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Pasut A., Jones A.E., Rudnicki M.A. Isolation and culture of individual myofibers and their satellite cells from adult skeletal muscle. J. Vis. Exp. 2013;22 doi: 10.3791/50074. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Oprescu S.N., Yue F., Kuang S. Single-Cell Isolation from Regenerating Murine Muscles for RNA-Sequencing Analysis. STAR Protoc. 2020;1 doi: 10.1016/j.xpro.2020.100051. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Liu L., Cheung T.H., Charville G.W., Rando T.A. Isolation of skeletal muscle stem cells by fluorescence-activated cell sorting. Nat. Protoc. 2015;10:1612–1624. doi: 10.1038/nprot.2015.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
This paper analyzes existing, publicly available scRNA-seq data, accessible at GEO with the accession number GSE109774,28 GSE138826,29 and GSE150366.6 This paper does not report original code. Any additional information required for the original data and reanalyzed data reported in this paper is available from the lead contact upon request.







