Paternal heat conditioning enhances offspring’s thermal resilience via epigenetic regulation of mir-210a

Abstract

Early-life exposure to environmental stressors can induce long-term physiological adaptations that extend across generations. This study examines embryonic heat conditioning (EHC) effects on heat stress resilience and paternal transgenerational inheritance in poultry. Fertilized male chicken eggs that underwent EHC (F₀-EHC) were raised to maturity before breeding with naïve hens to generate F₁ offspring, which were reared under standard conditions. A heat challenge at day 10 post-hatch revealed that both F₀-EHC chicks and their offspring (F₁-EHC) exhibited significantly greater thermal resilience compared to controls, as reflected by a lower increase in body temperature. To explore molecular mechanisms underlying EHC we focused on microRNAs (miRs), analyzing CpG-DNA differentially methylated regions near miR genes in the preoptic anterior hypothalamus (PO/AH) of F₁ chicks and identified miR-210a as a key candidate. Both F₀-EHC chicks and their offspring (F₁-EHC) displayed increased miR-210a expression at baseline, which was significantly reduced during heat challenge. Intracranial injection of mature miR-210a into naïve chicks confirmed its regulatory role, inducing changes in gene expression in the PO/AH. RNA-Seq analysis identified 57 genes differentially expressed post-injection, including genes involved in chromatin organization, stress responses, and thermogenesis. Overlapping analyses of the RNA-Seq results with RRBS methylation data from F₀ sperm and F₁ PO/AH implicated ARID5B as a potential mediator of epigenetic inheritance to explore its function, we injected ARID5B sense and antisense oligonucleotides into the third ventricle of chicks and found that antisense treatment significantly increased ARID5B and miR-210a expression in the PO/AH without affecting body temperature. Together, these results reveal how embryonic thermal experience shapes hypothalamic gene regulation to promote transgenerational thermotolerance in chickens. Understanding this epigenetic mechanism may inform strategies to enhance resilience and sustainability in poultry exposed to thermal stress.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-026-44987-3.

Introduction

Environmental stressors, such as high ambient temperatures and humidity, disrupt physiological homeostasis in biological systems¹. Developing innovative strategies to mitigate the impact of these stressors is essential for maintaining poultry health, productivity, and welfare, particularly as global temperatures continue to rise². To cope with fluctuating environmental conditions, organisms have evolved adaptive mechanisms that include behavioral, biochemical, and physiological plasticity. In response to ambient temperature, each animal possesses a genetically determined thermal set point³, which can be fine-tuned epigenetically to enhance resilience to environmental fluctuations^4,5. Environmental stressors, including heat stress, modulate a stress response during early brain development, a critical period of neuronal plasticity, regulated by the hypothalamus and neuroendocrine system⁶. Epigenetic mechanisms mediate molecular adaptations to heat, forming either adaptive or maladaptive memory that influences resilience to future heat exposure and cross-tolerance to other environmental stressors^7–10. These environmentally induced epigenetic modifications can persist across generations, potentially shaping long-term adaptability⁷.

Unlike mammals, where maternal factors complicate embryonic manipulation, the avian egg provides a controlled system for studying developmental responses to environmental stressors due to its susceptibility to environmental and pharmacological interventions and its hypothalamic thermal control system’s similarity to that of mammals. Additionally, chicks are considered an ideal model for transgenerational epigenetic research because of their short generation time, independence from maternal guidance, well-assembled genome, and readily assessable post-hatching behaviors^5,11.

Epigenetic inheritance enables the transmission of environmental information across generations through mechanisms such as DNA methylation, histone modifications, and noncoding RNAs, thereby influencing offspring phenotypes without altering their genetic sequence^12–14. These mechanisms are critical for long-term acclimation to stressful temperatures. In avian species, epigenetic markers are shaped by both genetic factors and environmental conditions¹⁵. DNA methylation, one of the most studied epigenetic marks, occurs across the genome, including gene promoters and intergenic regulatory regions, often correlating with transcriptional regulation¹⁶.

In a series of studies, we and others demonstrated the role of epigenetic regulation in thermotolerance acquisition^17,18. For instance, Kisliouk et al. observed increased methylation in a distal region of the HSP70 promoter in a preconditioned chick model, suggesting that epigenetic memory associated with heat stress may differentiate between resilient and vulnerable individuals¹⁹. Prenatal ambient temperature influences epigenetic regulatory processes²⁰, and embryonic heat conditioning (EHC) in chicks has been shown to regulate the thermal response set point, with thermal resilience transmitted to subsequent generations^17,21. Our previous research demonstrated that EHC enhances chick resilience later in life, mitigating the negative impacts of post-hatch heat stress by improving thermotolerance acquisition during embryogenesis²². We have also demonstrated the intriguing concept of cross-tolerance in chickens, where exposure to one type of stress enhances resilience to another through shared molecular pathways^23,24. Moreover, thermal conditioning enhances both heat and immune cross-tolerance through epigenetic mechanisms such as DNA methylation and microRNA (miRNA) activation^10,17,24.

This study focuses on CpG-DNA methylation and miRNAs, which are small (18–26 nucleotide), highly conserved non-coding RNAs that regulate gene expression post-transcriptionally. MiRNAs can act as epigenetic modulators by targeting key enzymes responsible for epigenetic modifications, including DNMTs (DNA methyltransferase), HDACs (histone deacetylases), and HMTs (histone methyltransferases). We have previously shown that miR-138 inhibits EZH2 methyltransferase expression and methylation of histone H3 at lysine 27, and affects thermotolerance acquisition²⁵. MiRNA expression can also be regulated by epigenetic mechanisms, such as DNA methylation, RNA modifications, and histone post-translational modifications⁵. Recently, we identified miR-200a as a potential regulator mediating cross-tolerance effects in EHC-treated chicks¹⁰. A study by Raza et al. demonstrated that microRNAs (miRNAs) play a crucial role in regulating oxidative stress and inflammation, thereby helping organisms cope with environmental stressors. These findings also suggest that miRNAs have potential applications as biomarkers and therapeutic targets for managing environmental stress²⁶. In this study, we focus on miR-210a, a key regulator of cellular responses to hypoxia that is eminently known as master hypoxamir²⁷. miR-210a plays a crucial role in mitochondrial metabolism, angiogenesis, DNA repair, and cell survival. Additionally, it is involved in inflammatory responses under extreme stress conditions. In neural progenitor cells, miR-210 expression increases in response to hypoxia²⁸. While temperature-dependent epigenetic regulation of gene expression is well-documented in plants²⁹ and animals³⁰, limited research explores the role of embryonic heat conditioning in miRNA-mediated transgenerational epigenetics and heat resilience in offspring.

Therefore, miRNA profiling will help elucidate their roles in epigenetic regulation. This study examines how paternal heat conditioning enhances offspring thermal resilience via epigenetic modulation of miR-210a.

Materials and methods

Experimental model and subject details

All experimental procedures were approved by the Volcani Center Animal Experimentation Ethics Committee (Protocol No. 916/21) and performed in accordance with the European Community Council Directive and the ARRIVE guidelines (https://arriveguidelines.org).

First and second generation

Fertile eggs (F₀; n = 150) from Cobb strain broilers (Gallus gallus) were obtained from Brown Hatcheries (Hod Hasharon, Israel). The breeder flock was 38 weeks of age. Eggs were incubated under either control conditions or embryonic heat conditioning (EHC) in two Type 65Hs automatic incubators (Massalles, Barcelona, Spain). EHC was applied to the F₀ generation at 39.5 °C and 65% relative humidity for 12 h/day from embryonic days 7–16. Control eggs were maintained at 37.8 °C and 56% relative humidity throughout the 21-day incubation period. In the second generation (F₁; n = 125), hens aged 32–36 weeks—offspring of both treatments—produced eggs that were incubated under standard conditions (37.8 °C and 56% relative humidity). Husbandry procedures were conducted in accordance with established protocols previously reported by our laboratory^10,17.

Bird housing (first and second generation)

Hatchability was 86% in the control group (n = 129 hatchlings) and 85% in the EHC group (n = 127 hatchlings). Chicks were weighed, tagged, and randomly allocated to pens (40 cm × 1 m) (eight chicks per pen). Birds were housed in climate-controlled rooms at 30 °C under a 20 h light/4 h dark artificial photoperiod, with ad libitum access to feed and water. Ambient temperature was maintained at 30 °C during the first week post-hatch. Feed was provided via standard feeders and water via nipple drinkers. Sex was determined by real-time PCR targeting the W chromosome using the following primers: F-5′-CCCAAATATAACACGCTTCACT-3′ and R-5′-GAAATGAATTATTTTCTGGCGAC-3′³¹. At day 7 post-hatch, chicks were regrouped into pens (40 cm × 1 m) containing five birds each. Bird health and general welfare were monitored throughout the study. All chicks were raised and managed according to the Cobb Broiler Management Guide (2018)³² (Fig. 1A).

Fig. 1.

Expression profile of miR-210a in response to heat stress in F₀ and F₁ EHC. (A) Experimental design: Embryonic heat conditioning (EHC, F₀) was applied during incubation days 7–16, while the control group was maintained under standard incubation conditions. After hatching, animals were raised and bred to produce the F₁ generation. Both F₀ and F₁ generations underwent a heat challenge on post-hatch day 10. Total RNA and DNA were isolated from the PO/AH at time 0 and 6 h post-challenge, and miR-210a expression was measured using a TaqMan microRNA assay. (B) Schematic Venn diagram represents the computationally predicted targets of miR-210a-3p and 5p from miRDB compared with the F₁ RRBS-PO/AH. (C) GO for overlap of differentially expressed genes (DEGs) between F₁ RRBS-PO/AH and predicted targets of miR-210a-3p and 5p from miRDB. Bar length represents log10 (p-value) for the presented pathway. (D) Expression of miR-210a relative to HMBS in F₀ (C and EHC) chicks at time 0 (n: C = 9; EHC = 9) and 6 h into heat challenge (n: C = 10; EHC = 12). In F₀ the Two-way ANOVA indicates significant effects in interaction (p = 0.007). Sidak’s multiple comparisons reveal a significant increased expression of miR-210a expression in F₀-EHC compared to F₀-C at time 0 (p = 0.02) and significant reduced expression at 6 h of heat challenge in F₀-EHC (p = 0.009). (E) Expression of miR-210a relative to HMBS in F₁ (C and EHC) chicks at time 0 (n: C = 10; EHC = 10) and 6 h into the heat challenge (n: C = 10; EHC = 9). In F₁ the Two-way ANOVA indicates significant effects in interaction (p = 0.001). Sidak’s multiple comparisons reveal a significant increased expression of miR-210a expression in F₁-EHC compared to F₁-C at time 0 (p = 0.004) and significant reduced expression at 6 h of heat challenge in F₁-EHC (p = 0.02).

Heat challenge

In both generations, chicks were subjected to a thermal challenge on day 10 post-hatch. The heat challenge was conducted in an automated, climate-controlled chamber equipped with a computerized regulation system that continuously monitored and adjusted ambient temperature, humidity, air velocity, lighting, and ventilation for the experiment with 30 °C under a 20 h light/4 h dark artificial photoperiod, with ad libitum access to feed and water. Ambient temperature was maintained with a precision of ± 0.5 °C using digital sensors. These conditions were maintained and monitored throughout the experimental period. Ten day old chicks were euthanized by rapid decapitation at 0 h and after 6 h of heat challenge without prior anaesthesia to avoid anaesthesia-induced alterations in hypothalamic neuroendocrine and gene expression profiles. All procedures were approved by the Institutional Animal Ethics Committee and performed by trained personnel¹⁷.

Tissue collection

The preoptic area/ anterior hypothalamus (PO/AH) was dissected and immersed in RNA later pH 5.2 for total RNA and DNA isolation from 10-day-old chicks immediately following euthanasia. The PO/AH region was carefully dissected from the whole brain the PO/AH tissue was collected bilaterally using fine microdissection tools, taking care to exclude adjacent regions. The brain was extracted from the skull the cut was made along the Lambda Suture and the sagittal suture and positioned with the lateral side facing upward. The boundaries of the PO/AH were determined based on the optic chiasma and clearly defined hypothalamic landmarks (coordinates: A 8–10, L 0–1.4 in both hemispheres) following Kuenzel and Masson³³. The precise location has also been validated in previous studies from our laboratory³⁴. For ChIP analysis the isolated tissues were frozen immediately in liquid nitrogen and stored in -80 °C.

RNA extraction and cDNA synthesis

Total RNA was extracted from the hypothalamus using TriReagent (Molecular Research Center, Cincinnati, OH, USA) according to the manufacturer’s protocol and checked for concentration and purity (260:280 nm absorbency) using the nanodrop and only samples with the concentrations ≥ 50 ng/µl with the 260/280 absorbance ratio between 1.8 and 2.1 were used for further analysis. 0.5 µg hypothalamic RNA was reverse transcribed to cDNA by SuperScript II Reverse Transcriptase and oligo (dT) plus random primers (Invitogen, Carlsbad, CA, USA).

miR potential target identification

Online bioinformatics database miRDB (http://mirdb.org) was used to identify the potential targets of miR-210a in the chicken (Gallus gallus). Predicted targets from miRDB was compared with previously published results of reduced representation bisulfite sequencing (RRBS) analysis from the PO/AH of F1 (F₁RRBS-PO/AH) (S5 and S6) (10.1096/fj.202101948R)¹⁷ in interactive venn (https://www.interactivenn.net/).

Real-time PCR

Realtime PCR was performed with 500 ng cDNA in the Applied Biosystems StepOnePlus Real Time PCR System (Thermo Fisher Scientific, Waltham, MA, United States) with PerfeCta SYBR Green FastMix, ROX (Quanta BioSciences, Gaithersburg, MD, United States). Dissociation curves were analyzed following each real-time PCR to confirm the presence of only one product and the absence of primer dimer formation. The threshold cycle number (Ct) for each tested gene (X) was used to quantify the relative abundance of that gene using the formula [2–(Ct gene X –Ct standard)]. Hydroxymethylbilane Synthase (HMBS) was used as the standard for mRNA expression. The primers used for real-time PCR were as follows: HMBS: F-CGTTTGGAGGGTGGCTGTAG; R-TGTCAAGTACAACTGGCCATCTTT; ARID5B NM_001031220.2: F-CCACGGCGAGGATGAAGTTA; R-TTCCCACATCCATCGGCTTA.

Gga-miR-210a levels were quantified using Applied Biosystems dre-miR-210 TaqMan miRNA Assay (ThermoFisher Scientific Baltics UAB, Vilnus, Lithuania) according to the manufacturer’s instructions. Briefly, 10ng of total RNA was reverse-transcribed using dre-miR-210 specific primer and TaqMan^® MicroRNA Reverse Transcription Kit, followed by real-time PCR with TaqMan probes. Within each sample, relative miRNA expression was normalized to that of HMBS mRNA.

miR-210a injection experiment

Gga-miR-210a-3p sense and antisense parts were synthesised as follows: gga-miR-210a-3p CUGUGCGUGUGACAGCGGCUAA[dt][dt]; gga-miR-210a-3p-as- UUAGCCGCUGUCACACGCACAG[dt][dt] (Sigma Aldrich, Israel).

Gga-miR-210a-3p and miRIDIAN mimic-negative control (Dharmacon, Lafayette, CO, USA) were dissolved in saline (1 µg/µl) and then injected into the third ventricle of 3-day-old naïve chicks (n = 10 each/2.5 µg/chick). The chicks were euthanized by cervical dislocation at 0, 2, 6–24 h after the injection, the PO/AH was dissected and immersed in RNA later. The expression of miR-210a was evaluated at using dre-miR-210a Taqman Micro RNA assay (ThermoFisher Scientific).

ARID5B injection experiment

The antisense DNA was designed to hybridize to the AUG translation-initiation codon of the mRNA encoding ARID5B. The antisense and sense sequences were 5’- T*C*CATCGCGGCTCCGGC*G-3’ and 5′- A*G*TTCAATCGCGCCGGA*G-3′, respectively. Both sense and antisense oligonucleotides were protected by phosphorothiolation on both the 3′ and 5′ ends (* represents protected nucleotides), and were purified by HPLC (Sigma Aldrich, Israel). Both oligonucleotides were dissolved in saline to a final concentration of 40µM and then 2.5 µl is injected into the third ventricle of 10-day-old chicks (n = 8 each/100pmol/chick). Injection was performed according to Johnston and Rose³⁵ and as performed previously in our laboratory^9,19,25,36, with slight modifications. In brief, a 28-gauge needle was connected via PE20 tubing to a Hamilton microsyringe. The injection was into the third ventricle area, with coordinates A = 8.4 mm from the ear position in the middle of the skull (coordinates according to Kunzel and Masson, 1988). The injection needle was fitted with a stop that limited penetration to a maximum of 9 mm. The injection location was verified in preliminary experiments by 2% Evans-blue injection dissolved in saline. The free-hand injection to the third ventricle is facile and precise because the location is into the Sutura sagittalis. This procedure does not require anesthetic and is routinely performed without administration of analgesics³⁵. The chicks were not overly distressed by the injection, and their behaviour seemed normal as they immediately after injection walk, eat, does not make any Startled squawks and their body temperature (T_b) does not change. The chicks were euthanized by cervical dislocation at 0, 2, 6–24 h (n = 8 in each group) after the injection, the PO/AH was dissected and immersed in RNA later.

Sperm collection and RRBS analysis

Sperm was collected from each animal and stored immediately at – 80 °C. DNA was isolated according to the manufacturer’s protocol (Genomic mini AX Swab & semen spin, A&A Biotechnology, Poland). RRBS library preparation was done using 70–140 ng of DNA using Zymo-seq RRBS library Kit at the Crown Genomics institute of Nancy and Stephen Grand Israel National Center for personalised Medicine, Weizmann Institute of Science. Library quality was measured through the Tape station and Qubit. Paired end sequencing was performed on Nova seq 6000 instrument (Illumina) using SP 100 cycle kit. Illumina adapters trimming was done through Trim Galore. Then the reads were mapped to chicken genome galGal 5.0 using Bismark v.0-22-3, bowtie mode. Finally methylation calls were extracted with Bismark methylation extractor mode. Edge R was used for the extraction and analysis on single CpGs (Differential methylation site) with the cut-off of 8 reads in every sample and FDR < 0.05³⁷. Methilene v.0.2-8 is used for extraction and analysis of Differential methylated Regions³⁸.

RNA sequencing and analysis

RNA-sequencing was performed at the Crown Genomics Institute of the Nancy and Stephen Grand Israel National Center for Personalized Medicine (INCPM), Weizmann Institute of Science (Rehovot, Israel) using the INCPM MARS seq protocol. Briefly, 15 ng of purified RNA (n = 5 per group) was used for library preparation with the bulk MARS-seq method, involving barcoding of samples by reverse transcription using an oligo dT primer, pooling of samples, and subsequent molecular reactions for linear amplification and preparation for Illumina sequencing. A 100 bp single reads were sequenced on a Novaseq 6000 sequencing system. The output was ~ 16 million reads per sample.

Poly-A/T stretches and Illumina adapters were trimmed from the reads using Cutadapt³⁹. The resulting reads shorter than 30 bp were discarded. The remaining reads were mapped onto 3′ UTR regions (1000 bases) of the Gallus genome (galGal5.0, UCSD) according to Refseq annotations, using STAR⁴⁰ with End-to-End option and out FilterMismatchNoverLmax was set to 0.05. Deduplication was carried out by flagging all reads that were mapped to the same gene and had the same UMI. Read counts per gene were calculated using HTSeq-count with the following parameters: “htseq-count -s no–mode=union.” Normalization and differential expression analysis were performed using the DESeq2⁴¹ with the betaPrior, cooksCutoff and independentFiltering parameters set to False. Raw P values were adjusted for multiple testing using the procedure of Benjamini and Hochberg. Pipeline was run using snakemake⁴². Differentially expressed genes (DEG) were defined as genes that had a significant adjusted p-value (padj) of less than 0.05. To elucidate gene alterations across all analysed groups, the expression of all DEG was assessed. Respective heat maps were generated by custom R scripts and the Complex heatmap R package. Gene ontology (GO) analysis of Upregulated and downregulated genes was performed using the online software Metascape (http://metascape.org). Interactive venn was used to retain the common potential for down regulated genes, F₁ RRBS-PO/AH and F₀ RRBS-Sperm (10.3389/fimmu.2025.1487135/full#supplementary). All sequencing data have been deposited in the Gene Expression Omnibus database (GEO) under accession number RNA-Seq data: GSE282656, GSE293886 and for RRBS data: GSE282655.

Chromatin immunoprecipitation (ChIP) assays

To obtain DNA fragments of 200–1000 bp, PO/AH tissues (n = 10) were cross-linked with 1% formaldehyde for 10 min. Samples were then sonicated using a Sonic-150 W Ultrasonic Processor (MRC Ltd., Holon, Israel) in cell lysis buffer (1% SDS, 10 mM EDTA, and 50 mM Tris-HCl, pH 8.1) supplemented with a protease inhibitor cocktail (Cell Signaling Technology, Beverly, MA, USA). Sonication was performed for a total of 6 min, consisting of ten on/off pulses.

The sheared chromatin was diluted in ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl, pH 8.1, 167 mM NaCl, and protease inhibitor cocktail) and incubated overnight at 4 °C with 10 µg of anti-ARID5B antibody (LS-C159115/50153; LifeSpan Biosciences Inc., USA) or 1 µg of mouse IgG (Merck Millipore, Darmstadt, Germany) as a negative control. Immunocomplexes were captured using Magna ChIP Protein A + G magnetic beads (20 µl per sample; Millipore) by incubation for 2 h at 4 °C.

Immunoprecipitates were reverse cross-linked for 2 h at 62 °C in ChIP elution buffer (1% SDS, 100 mM NaHCO₃, 0.2 M NaCl) containing proteinase K (50 µg per sample). DNA was then purified using the Simple ChIP DNA Purification Buffers and Spin Columns (Cell Signaling Technology) according to the manufacturer’s instructions.

Purified DNA was analyzed by quantitative real-time PCR using primers specific for the miR-210a promoter region:

• Proximal region: forward 5′-AGCGTGCCCCATCCATAAA-3′, reverse 5′-GGTTGACACACGTTGCTCCAT-3′.

• Distal region: forward 5′-GCTCCACACAGGGTGATTTGA-3′, reverse 5′-CCCAGGAGTGTTTGCAGTGA-3′.

Data were normalized to input DNA samples that were not subjected to immunoprecipitation.

Statistical analysis

Statistical analyses of heat challenge, ChIP and miRNA expression data were performed using GraphPad Prism version 6 (GraphPad Software, San Diego, CA, USA). Data distribution and homogeneity of variance were evaluated using goodness-of-fit and Bartlett’s tests, respectively. Sample sizes (n), representing the number of chicks per treatment group, are indicated in the corresponding figure legends. Cloacal temperature and gene expression data were analyzed using two-way ANOVA with treatment and time as fixed factors, followed by Sidak’s multiple comparisons test. miRNA injection experiments were analyzed using multiple unpaired t-tests with correction for multiple comparisons. ChIP data were analyzed using one-way ANOVA followed by Tukey’s post hoc multiple comparisons test. Data are presented as mean ± SEM, and statistical significance was defined as p < 0.05. RNA-seq data were analyzed using dedicated bioinformatics pipelines, as described in the relevant Materials and Methods sections.

Results

Paternal EHC enhances offspring’s thermal resilience

This study aimed to analyse the impact of EHC on life-long response to heat stress and its paternal transgenerational transmission. To this end, we repeated the experiment which was published by Rosenberg et al.²⁴ in which the first-generation cohort (F₀) underwent EHC. Both untreated and EHC-treated male chicks were raised to sexual maturity and then bred with naïve hens to produce the F₁ generation. All F₁ embryos were subsequently raised under normal conditions (Fig. 1A). Ten days post-hatch in both generations, body temperature was measured 6 h after a heat challenge to assess the heat resilience by evaluating the cloacal temperature.

The heat challenge effectively induced a significant increase in body temperature in both F₀ and F₁ naïve chicks after 6 h (p < 0.01 for both comparisons). However, EHC-treated chicks and their offspring exhibited greater heat resilience, showing a smaller increase in body temperatureCloacal temperatures were consistent with those reported previously by Rosenberg et al. 2022 in which the EHC treated chicks showed a greater resilience by exhibiting a significantly smaller rise in body temperature in response to heat challenge by ± 0.5 °C¹⁷.

EHC modulates miR-210a expression in response to heat stress across generations

We examined miRs whose regulatory sequences exhibited altered DNA CpG methylation in EHC chicks. To this end, we analyzed our previously published RRBS data from the PO/AH¹⁷, identifying 283 methylation sites near pre-miR sequences in 150 unique miRs (some pre-miRs were associated with multiple methylation sites; see Supplementary Table 1).

As a proof of concept for the involvement of miRs in heat resilience and its transgenerational transmission in the present study we focused on miR-210a, Notably, a hypermethylation site was identified in the promoter of Gga-miR-210a in EHC treated chicks, further supporting its role in heat stress regulation. To further establish the significance of this miR-210a in the transgenerational transfer of heat resilience, we compared F₁ RRBS-DMS data from the PO/AH with the identified targets of miR-210a from miRDB. The overlap analysis revealed 37 common genes between those that are differentially methylated in the offspring of EHC chicks (F₁-EHC) and the potential targets of miR-210a (Fig. 1B). Gene ontology analysis of these overlapping genes demonstrated their involvement in chromosome organization (PRC1, ASCC3, DHX30, PDS5B) and apoptotic signaling pathways (INHBB, DYRK2, TNFSF10, USP28) (Fig. 1C). INHBB is known to regulate TGF-β signalling and apoptosis whereas DYRK2 and USP28 regulate cell death through p53 mediated pathways. TNFSF10 is a key initiator of extrinsic apoptosis suggesting a coordinated apoptotic response.

To further validate the responsiveness of miR-210a to EHC and its role in heat resilience and paternal heredity, we assessed its expression profile in the PO/AH using qPCR at 6 h into the heat challenge in both F₀ and F₁ generations. Baseline expression analysis revealed 1.7- and 2.9-fold increase in miR-210a levels in EHC-treated chicks and their offspring, respectively (p = 0.02 and p = 0.009, respectively). Moreover, following six hours of heat exposure, miR-210a expression in the PO/AH of EHC-treated chicks (F₀-EHC) and their offspring (F₁-EHC) was significantly reduced by 2.2 and 2.3-fold compared to pre-exposure levels (p = 0.004 and p = 0.02, respectively; Fig. 1D, E).

Intracranial injection of miR-210a was effective 6 h after injection

To explore the role of miR-210a in regulation of gene expression in the PO/AH, a Gga-miR-210a-3p was intracranially injected into the third ventricle of 3-day-old chicks. The effectiveness of miR-210a incorporation was assessed by measuring its expression levels in the PO/AH at 2, 6, and 24 h post-injection, compared to both mimic-negative control-injected and naïve chicks (Fig. 2A). As shown in Fig. 2B, a 2.5-µg dose of the miR-210a was highly effective. Multiple t-tests comparing miR-210a injected animals with their respective controls at each time point (2 h, 6–24 h). MiR-210a expression exhibited a 2.1-fold increase at 2 h post-injection (p < 0.09), followed by a significant 3.8-fold increase at 6 h post-injection compared to the mimic-negative control group (p = 0.01). By 24 h post-injection, miR-210a levels returned to baseline, similar to those observed in the mimic-negative control and naïve chicks (Fig. 2B). Notably, ectopic injection of miR-210a had no effect on chick body temperature.

Fig. 2.

Time dependent expression of miR-210a after intracranial injection. (A) A schematic representation of the experimental design: Gga-miR-210a-3p and miRIDIAN mimic-negative control were injected into the PO/AH of 3-day old chick (2.5 µg/chick) and compared to non-injected age matched naïve chicks. (B) Expression of miR-210a at various time point 2 h, 6 h and 24 h after injection was quantified using a dre-miR-210 TaqMan miRNA Assay (n = 10 in each treatment/time point). Multiple T-test at 6 h after injection the comparison of miR negative vs. miR-210a showed a significant increased expression at 6 h. The p values were adjusted using the Holm–Sidak correction.

Intracranial injection of miR-210a alters gene expression patterns in the PO/AH

Given that the maximum amount of miR-210a in the PO/AH was observed 6 h after miR-210a injection, we conducted RNA-Seq analysis on samples extracted from the PO/AH of naive chicks and those collected 6 h after miR-210a injection.

Principal component analysis (PCA) revealed a substantial difference between the naïve and miR-210a mimic treatment groups (PC1: 28% variance; PC2: 26% variance; Fig. 3A). Differential gene expression patterns between these groups, 6 h after injection, are visualized in the heat-map, which displays the log₂FoldChange values of differentially expressed genes (DEGs; padj ≤ 0.05). A total of 57 genes exhibited altered expression following miR-210a mimic injection compared to naïve chicks (Fig. 3B; full gene list in Supplementary Table 2). The volcano plot illustrates the 48 upregulated and 9 downregulated genes in the miR-210a-treated group compared to the naïve group, based on the defined threshold for significant differential expression (padj ≤ 0.05, Fold Change 1.5, min count ≥ 30; Fig. 3C). Additionally, when applying a relaxed threshold (padj ≤ 0.1), 115 genes were upregulated, and 90 were downregulated (Supplementary Tables 3 and 4).

Fig. 3.

Differentially expressed genes (DEGs) 6 h after intracranial injection of miR-210a. (A) Principal Component Analysis (PCA) of gene expression in naïve and miR-210a-injected samples 6 h post-injection. (B) Heatmap of significantly differentially expressed genes (DEGs) 6 h post-injection in naïve and miR-210a-treated groups. Genes are grouped based on expression patterns, with colour intensity representing log₂ fold change (log₂FC) (blue = downregulated, red = upregulated). (C) Volcano plot of RNA-seq data comparing miR-210a-injected vs. naïve samples. The x-axis represents log₂FC in gene expression, while the y-axis shows -log₁₀(p-value). Downregulated genes are marked in blue, and upregulated genes in red. (D) Gene Ontology (GO) enrichment analysis for miR-210a-downregulated genes. Bar length represents -log₁₀(p-value) for each pathway. (E) Schematic representation of DEGs overlapping between F₁ RRBS (DMS)-PO/AH, F₀ RRBS (DMS)-sperm, and miR-210a-downregulated genes. (F) Schematic representation of DEGs overlapping between F₁ RRBS (DMS)-PO/AH, F₁ RNA-seq (heat: control vs. EHC), and miR-210a-downregulated genes.

The downregulated gene ontology demonstrate that these genes are involved in response to chromatin modifying enzymes (ATF2, SMARCA2, BRD1, ARID5B, KMT5A), which regulate histone modification, nucleosome remodelling, and transcriptional activity and the chromatin organisation (NOTCH2, SOX11, USH1C, AHI1) contribute to chromatin structure, gene accessibility, and developmental gene regulation, and thermogenesis (ATF2, SMARCA2, CREB3L2) in which these genes are transcriptional regulators of energy metabolism (Fig. 3D). These genes indicate the possible epigenetic regulation of stress-responsive transcription.

To refine our understanding of miR-210a function, we identified genes with overlapping methylation patterns across the F₁ RRBS PO/AH analysis, F₀ RRBS sperm, and miR-210a downregulated genes at padj ≤ 0.1. The Venn diagram represented in Fig. 3E points to 4 common genes between F₀ RRBS sperm and miR-210a down regulated genes (AIF1L- cytoskeleton organisation, ARID5B-chromatin remodelling, AKAP6-signal transduction, CSPG5-neuronal development) and 3 common genes between F₁ RRBS PO/AH and miR-210a down regulated genes (FXYD2, GNA11, SOX11-chromatin remodelling). The 3 genes which are common to F₁ RNA-Seq and miR-210 downregulated genes are SYT1, NOTCH2- chromatin and transcription regulation and NAP1L1- nucleosome assembly (Fig. 3F). These findings indicate that miR-210a may exert coordinated regulation of gene expression both epigenetically in the germline and transcriptionally in offspring, potentially affecting chromatin remodelling, neuronal function, and metabolic pathways.

ARID5B as a potential mediator of paternal heat conditioning-induced epigenetic regulation

Since the downregulated GO of miR-210a included genes involved in chromatin-modifying enzymes and thermogenesis, we sought to determine whether paternal heat conditioning influences thermal resilience through epigenetic regulation. To explore this, we compared F₀ RRBS sperm data with the genes downregulated by miR-210a (AIF1L (– 4.7 logFC), ARID5B, AKAP6 (– 3.7 logFC), CSPG5 (1.9 logFC)) and identified ARID5B as a key candidate which is hypermethylated (1.86 Log FC) in the intron region. ARID5B may contribute to heritable epigenetic modifications potentially altering chromatin accessibility and/or gene expression, including mir-210a gene by itself.

ARID5B gene expression was quantified using qPCR in both F₀ and F₁ generations. In F₀, 1.5-fold reduction in ARID5B expression was observed in the F₀-EHC group compared to F₀-C at baseline (p = 0.03) and after 6 h of heat challenge in F₀-C (p = 0.03) (Fig. 4A). Similarly, in F₁, ARID5B expression in the F₁C group was 1.6-fold reduced after 6 h of heat challenge compared to its baseline expression (p = 0.03) (Fig. 4B). This shows that there is significant downregulation of ARID5B in 6 h of control and no change EHC at baseline and after 6 h.

Fig. 4.

ARID5B expression in F₀, F₁ and after intracranial injection in chicks and its interaction with the miR-210a gene via ChIP analysis. (A) ARID5B gene expression relative to HMBS in F₀ chicks at baseline (time 0, n = 9) and 6 h into the heat challenge (n: Control [C] = 10; EHC = 12). Two-way ANOVA indicates significant effects of conditioning (p = 0.01) and heat challenge (p = 0.01). Sidak’s multiple comparisons reveal a significant reduction in ARID5B expression in F₁-EHC compared to F₁-C at time 0 (p = 0.03) and at 6 h of heat challenge in F₁-C (p = 0.03). (B) ARID5B gene expression relative to HMBS in F₁ chicks at time 0 (n = 10) and 6 h into the heat challenge (n: C = 10; EHC = 9). Two-way ANOVA indicates a significant conditioning effect (p = 0.01). Sidak’s multiple comparisons show a significant reduction in ARID5B expression in F₁-C at 6 h of heat challenge (p = 0.03) compared to time 0 F₁-C. (C) ChIP analysis of ARID5B binding to the proximal region of the miR-210a gene, relative to input. One-way ANOVA shows a significant effect (p = 0.01). Tukey’s multiple comparisons indicate decreased ARID5B binding in F₁-EHC compared to F₁-C (p = 0.04) and increased binding in F1-EHC at 6 h into the heat challenge compared to its respective control (p = 0.04). (D) ChIP analysis of ARID5B binding to the distal region of the miR-210a gene, relative to input. (E) Time dependent expression (2,6, 24 h) of ARID5B after intracranial injection of sense and antisense into the PO/AH of 10-day old chick (100pmol/chick). Expression of ARID5B at various time point 2 h, 6 h and 24 h after injection was quantified using qPCR (n = 8) in each treatment/time point). Multiple T-test at 6 h after injection the comparison of ARID5B sense vs. ARID5B antisense showed a significant increased expression at 6 h (p = 0.004). (F) Expression of miR-210a 6 h after injection was quantified using a dre-miR-210 TaqMan miRNA Assay (n = 11). Multiple T-test at 6 h after injection the comparison of ARID5B sense vs. ARID5B antisense showed a significant increased expression at 6 h (p = 0.02).

To further examine the relationship between ARID5B DNA binding and the transcriptional regulation of miR-210a, ChIP analysis was performed on the proximal regions of the miR-210a gene, which overlap with the methylation sites. As a control, ChIP analysis was also conducted on the distal region of the ARID5B sequence using the same samples.

As shown in Fig. 4C, ARID5B binding levels in the proximal region of miR-210a were significantly lower (2.14-fold) in the F₁EHC group compared to F₁C (p = 0.04) but higher (2.11 fold) in the F₁Ch6hEHC group (p = 0.04). In contrast, no significant differences were observed in the control distal region (Fig. 4D). Immunoprecipitation with normal mouse IgG was used as a background control.

To further investigate the role of ARID5B in the PO/AH, sense and antisense oligonucleotides of ARID5B were injected intracranially into the third ventricle of 10-day-old chicks. The effectiveness of the ARID5B antisense treatment was assessed by measuring ARID5B expression levels in the PO/AH at 2-, 6-, and 24-h post-injection, relative to chicks injected with the sense sequence. As shown in Fig. 4E, ARID5B antisense was most effective at the 6-hour time point, resulting in a 2.4-fold increase in ARID5B sense expression (p = 0.004). A decreasing trend was observed at 2 h, while no significant difference was detected at 24 h. ARID5B injection did not affect body temperature.

Given that a significant change in ARID5B expression was observed at 6 h, we next examined whether miR-210a expression was also regulated at this time point. Analysis revealed a twofold increase in miR-210a expression in ARID5B antisense-injected samples compared with sense controls (p = 0.02) (Fig. 4F).

Discussion

The role of epigenetic mechanisms in transmitting environmentally induced traits across generations is increasingly supported by experimental evidence. Epigenetic modifications, in interaction with environmental exposures, contribute to phenotypic variation and may persist across generations (multigenerational inheritance), thereby establishing an epigenetic memory that enhances resilience to heat stress⁷. Heat stress represents one of the most consequential environmental challenges, exerting profound acute and chronic effects on animal physiology. Thermoregulatory control continues to mature after hatch, during which the preoptic/anterior hypothalamic (PO/AH) region displays marked developmental plasticity. The early post-hatch period (days 3–5) constitutes a critical window during which molecular and physiological responses to thermal stress are programmed^34,43. Consistent with this framework, numerous studies demonstrate that embryonic heat conditioning (EHC)—exposure of embryos to cyclic elevations in ambient temperature between embryonic days 7 and 16—induces durable thermal resilience in chickens and the epigenetic signatures measured at day 10 reflect stable, long-lasting changes in chicks previously subjected to embryonic or early-life heat conditioning⁴⁴. In the present study, heat conditioning was applied exclusively to the paternal line during embryogenesis (in ovo) to minimize maternal influences and directly test heritable transmission. All F1 eggs were subsequently incubated under standard thermal conditions; therefore, phenotypic differences observed in the offspring can be attributed primarily to mechanisms transmitted through the male germline.

A previous study by Rosenberg et al. demonstrated that embryonic thermal conditioning induces transgenerational effects that enhance resilience to both thermal and immunological stressors.The 6-h heat challenge at 36 °C was selected as a well-established acute heat stress paradigm¹⁷. In addition, prior work by Cramer et al. demonstrated that exposure to 36 °C effectively differentiates chicks subjected to mild versus harsh early-life conditioning, revealing distinct resilience and vulnerability phenotypes accompanied by clear molecular and epigenetic differences⁹. Consistent with these findings, our results show that EHC-induced thermal resilience is preserved in both F₀ and F₁ generations following a 6-h heat challenge at 36 °C, a well-established model of acute thermal stress, thereby supporting the inheritance of an adaptive phenotype. Molecular analysis was limited to 6 h at 36 °C exposure which captures the primary thermophysiological response before compensatory acclimation occurs. Previous work from our laboratory has shown that differences in body temperature between control and thermally conditioned birds are most pronounced during the early phase of heat exposure (2–6 h), whereas values tend to converge by 24 h due to physiological adaptation. The heat exposure applied on day 10 post-hatch does not induce long-term alterations in chicks’ responses to prolonged (24 h) environmental temperature changes^22,34. Cloacal temperature measurements recorded at baseline (0 h) and after 6 h of heat exposure revealed a consistent phenotypic response in which EHC birds maintained lower body temperatures compared with controls in both generations, indicating improved thermoregulatory capacity during acute heat exposure. These time points were selected to capture the thermoregulatory phenotype before and following stress in both control and embryonic heat-conditioned groups which represents a direct and well-established indicator of core body temperature and thermoregulatory efficiency during heat exposure. Cloacal temperature provide a functional readout of hypothalamic thermoregulatory control and are widely used as the primary phenotypic endpoint in avian heat stress models. Several studies by Yahav et al. have shown that early thermal conditioning helps in reduction of elevated core body temperature during subsequent heat challenge indicating an improved heat tolerance⁴⁵. A Study by Katz & Meiri showed that altered epigenetic signature and gene expression in the hypothalamus shows the control of body temperature during heat stress which is projected as a phenotypic expression of hypothalamic thermoregulation³⁴. These findings align with reports by Loyau et al. who showed that thermally manipulated broilers exhibit reduced body temperatures, potentially reflecting decreased metabolic heat production in muscle tissue and enhanced heat dissipation⁴⁶. A study by Liu et al. also demonstrates that the broilers exposed to acute heat stress in early age shows thermotolerace with the upregulation of skeletal muscle gene expression⁴⁷. Importantly, the persistence of this phenotype in the F₁ generation—reared under standard incubation conditions—suggests that the adaptive response is not solely a consequence of direct environmental exposure but may involve heritable epigenetic programming. Given the known developmental plasticity of the thermoregulatory PO/AH region, early embryonic thermal signals may induce long-lasting neuroendocrine and metabolic adjustments that recalibrate the thermal set-point^8,9. The glucocorticoid responses during thermal stress and their association with heat resilience/vulnerability is regulated by hypothalamic regulatory pathways mainly by HPA axis^8,9,48. Such mechanisms could include alterations in hypothalamic gene expression, which have been implicated in improved heat tolerance. Together, these results strengthen the concept that embryonic environmental cues can shape transgenerational physiological resilience with potential implications for poultry production under increasing climatic stress⁴⁹.

Given that miRNAs are regulated by epigenetic modifications⁵⁰ and play a crucial role in post-transcriptional gene regulation, cellular homeostasis, and stress responses, their involvement in heat stress adaptation is anticipated⁵¹. The transgenerational transfer of epigenetic information is suggested to involve miRs in which miR-210a has been previously associated with stress responses^52–55. To explore the epigenetic mechanisms underlying transgenerational heat resilience, we analyzed DNA methylation patterns in the PO/AH using F₁ RRBS-DMS data from our previous study. Our analysis revealed a 2.49-fold increase in CpG DNA methylation (DMS) at position − 943 bp upstream of the gga-miR-210a transcription start site¹⁷.

miR-210 is a well-characterized hypoxia-induced microRNA with established targets involved in mitochondrial metabolism, angiogenesis, DNA damage response, cell proliferation, and apoptosis⁵⁶. Previous studies have shown that miR-210a regulates microglial activation and neuroinflammatory responses through NF-κB–mediated inflammatory signaling via targeting of SIRT1⁵⁷. In addition, miR-210 has been implicated in structural and functional neuroplasticity through coordinated regulation of metabolic and synaptic gene networks⁵⁸. To investigate the potential transgenerational role of miR-210a in heat stress resilience, we performed an overlap analysis between F1 RRBS data from the PO/AH region and predicted miR-210a target genes. Venn diagram analysis identified 37 shared genes, predominantly associated with chromosome organization and apoptotic signaling pathways (Fig. 1B and C). The observed hypermethylation of gga-miR-210a in the F1 RRBS dataset, together with its functional enrichment in chromosome organization pathways, prompted further investigation of its regulation in EHC chicks and its potential contribution to transgenerational epigenetic inheritance.

To assess miR-210a expression in response to heat stress, we analyzed its levels in the PO/AH of F₀ and F₁ chicks. Our results showed that EHC significantly reduced miR-210a expression in both F₀ and F₁ PO/AH after 6 h of heat challenge, indicating that the parental effects of EHC were transmitted to the offspring (Fig. 1D and E). This finding aligns with studies reporting that miR-210 overexpression is associated with reactive oxygen species (ROS) generation, apoptosis, and various cancers⁵⁹. Additionally, miR-210-3p has been shown to target HIF-1α, a key regulator in hypoxia-induced STAT3 activation⁶⁰, and its inhibition has been linked to neuroprotection in a neonatal rat hypoxic-ischemic encephalopathy (HIE) model⁵⁵.

To further explore the role of miR-210a in the PO/AH, we performed intracranial injections of miR-210a in 3-day-old chicks and monitored its expression over time. Our results showed that miR-210a expression peaked at 6 h post-injection (Fig. 2B). This finding aligns with Kisliouk et al. who reported that EZH2 inhibition and maximal miR-138 expression occurred 6 h after intracranial injection²⁵. Similarly, Rapps et al. demonstrated that administration of a miR-211 mimic affected immune and cell cycle-related gene expression in rats within the same timeframe⁶¹. To further investigate transcriptomic changes, we performed RNA sequencing (RNA-seq) following intracranial injection, identifying 57 differentially expressed genes.

To directly define the functional consequences of miR-210a activity, we examined transcriptional changes 6 h following intracranial administration. Pathway enrichment analysis demonstrated that miR-210a robustly suppresses gene networks governing chromatin organization, stress-responsive signalling, angiogenic pathways, and thermogenic/metabolic regulation (Fig. 3D), indicating that miR-210a functions as a central regulator of hypothalamic adaptive programming. Rather than acting on isolated targets, miR-210a appears to coordinate a broad transcriptional shift that integrates epigenetic remodelling with neuroendocrine and metabolic adaptation during acute thermal stress.

The affected pathways strongly intersect with CREB-dependent transcriptional circuits that regulate BDNF, a critical mediator of thermal experience–dependent hypothalamic plasticity in chicks^34,49,62, supporting a role for miR-210a in reshaping neural circuitry underlying thermoregulation. Concurrent modulation of angiogenic signalling further suggests that miR-210a contributes to vascular and metabolic remodelling necessary for sustained thermal tolerance, consistent with prior evidence demonstrating protective roles for these pathways under chronic heat stress⁶³. Collectively, these data suggest miR-210a as a master regulatory mode that synchronizes chromatin accessibility, neuronal plasticity, and metabolic homeostasis, thereby establishing the molecular framework required for durable heat resilience following embryonic conditioning.

A central mechanistic finding of the present study is the identification of ARID5B as a key epigenetic regulator associated with EHC-induced transgenerational heat resilience. ARID5B, a validated miR-210a target involved in chromatin organization, belongs to the ARID family of transcriptional regulators that interact directly with chromatin or participate in remodelling complexes to shape gene expression programs^64,65. Its functional versatility has been demonstrated across diverse biological systems, including regulation of oxidative metabolism and survival pathways in NK cells through modulation of UQCRB and BCL2 expression⁶⁶, control of inflammatory signalling via IL-6 regulation⁶⁷, regulation of adipocyte differentiation and thermogenic programming through IRX3/IRX5 repression⁶⁸, and tumor suppressive functions in endometrial cancer⁶⁹. Moreover, the inverse association between ARID5B expression and CpG hypermethylation reported under metabolic stress conditions⁷⁰ further supports its sensitivity to epigenetic regulation.

In the present study, ARID5B emerged as a candidate mediator of epigenetic inheritance, as its intronic region displayed hypermethylation in F₀ sperm RRBS analysis, suggesting a potential mechanism for paternal transmission of adaptive traits. Consistent with this notion, ARID5B expression was reduced in the PO/AH of both F₀ and F₁ EHC chicks and inversely correlated with miR-210a levels. Functional manipulation further demonstrated that intracranial administration of miR-210a decreased ARID5B mRNA expression, indicating direct regulatory control within the thermoregulatory hypothalamus. ChIP analysis provided additional mechanistic support by showing dynamic ARID5B binding at the proximal miR-210a promoter: reduced basal binding in F₁-EHC chicks and increased binding following 6 h of heat challenge. Together, these findings support a reciprocal negative feedback loop in which miR-210a suppresses ARID5B expression while ARID5B acts as a transcriptional repressor of miR-210a, thereby stabilizing stress-responsive transcriptional programs in the PO/AH.

Mechanistically, this bidirectional regulatory axis may integrate early-life environmental cues with long-term neuroendocrine and metabolic adaptation. Given the established plasticity of the PO/AH during early development, modulation of chromatin accessibility and miRNA expression may recalibrate thermoregulatory set-points and mitochondrial efficiency, ultimately contributing to reduced metabolic heat production and improved thermal tolerance. The persistence of altered ARID5B–miR-210a regulation in the F₁ generation, incubated under standard conditions, further supports a role for sperm-mediated epigenetic programming in transmitting adaptive phenotypes.

Conclusion

Overall, our results suggest that paternal EHC enhances heat resilience in offspring through epigenetic modifications at the miR-210a locus, contributing to transgenerational thermal adaptation. The coordinated regulation of miR-210a and ARID5B in the preoptic area/anterior hypothalamus (PO/AH) points to a molecular pathway by which paternal experiences are epigenetically encoded and transmitted to progeny. These findings provide mechanistic evidence linking sperm DNA methylation changes with hypothalamic gene regulation in the next generation. By uncovering how early-life environmental exposures can shape offspring physiology through heritable epigenetic programming, this study advances our understanding of adaptive plasticity in response to climate stress. Such insights may ultimately inform strategies for improving thermal tolerance in animal populations under changing environmental conditions.

Supplementary Information

Below is the link to the electronic supplementary material.

Abbreviations

EHC

Embryonic heat conditioning

PO/AH

Preoptic anterior hypothalamus

ARID5B

AT-rich interactive domain-containing protein 5B

PCA

Principal component analysis

RRBS

Reduced representation bisulfite sequencing

miR

MicroRNA

HMBS

Hydroxymethylbilane synthase

DEG

Differentially expressed genes

F₀

First generation

F₁

Second generation

RNA

Seq-RNA sequencing

Nacl

Saline

GO

Gene ontology

HSP

Heat shock proteins

ChIP

Chromatin immunoprecipitation

Author contributions

PM. Ravi, and N. Meiri designed research; PM. Ravi, T.Kisliouk, A. Haron, and S. Druyan performed the research; PM. Ravi, T. Kisliouk and N. Meiri analyzed data; PM. Ravi, T. Kisliouk and N. Meiri wrote the paper.

Funding

This research was supported by the Israel Science Foundation Grant No. 2587/21.

Data availability

All sequencing data have been deposited in the Gene Expression Omnibus database (GEO) under accession number RNA-Seq data: GSE282656, GSE293886 and for RRBS data: GSE282655.

Declarations

Competing interests

The authors declare no competing interests.

Ethical approval

All procedures conducted in this study were approved by the Volcani Center Animal Experimentation Ethics Committee (Number: 916/21) and carried out in accordance with the guidelines set forth by the European Community Council and also in compliance with the ARRIVE guidelines (https://arriveguidelines.org).

Consent for publication

There are no individual person’s data in any form.