Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2026 Jun 3.
Published in final edited form as: Methods Enzymol. 2025 Sep 23;721:19–38. doi: 10.1016/bs.mie.2025.08.017

A Metallophotoredox Strategy for Biocatalytic Radical C‒N3 and C–SCN Bond Formation

Jinyan Rui 1, Xinpeng Mu 2, Xiongyi Huang 1,*
PMCID: PMC13229595  NIHMSID: NIHMS2174913  PMID: 41167843

Abstract

Metallophotoredox catalysis, an approach that combines photoredox and transition metal catalysis, has emerged as a powerful strategy in modern synthetic chemistry. This dual-catalyst system takes advantage of the broad mechanisms of photocatalysts for substrate activation and the capabilities of transition metal complexes to control reactive radical species. Its modular nature allows each catalytic component to be independently tuned for desired reactivity and selectivity. Despite its significance on synthetic methodologies, biocatalytic analogs of metallophotoredox catalysis remain largely unexplored. To address this gap, our group has recently discovered that several nonheme iron enzymes can be combined with synthetic photocatalysts such as eosin Y and fluorescein to enable radical generation from redox-active NHPI esters. The resulting substrate radicals can then be selectively intercepted by the enzymes to promote enantioselective transformations. Particularly, we have successfully repurposed a nonheme iron enzyme, (4-hydroxyphenyl)pyruvate dioxygenase from Streptomyces avermitilis (SavHPPD), to catalyze enantioselective photoredox decarboxylative C–N3 and C–SCN bond formation. This chapter provides a detailed experimental protocol for this latest development in biocatalytic metallophotoredox catalysis. Moreover, the outlined procedures could serve as a general framework for engineering metalloenzymes toward new photocatalytic functions.

1. Introduction

Metalloenzymes, which are enzymes contain metal cofactors, constitute nearly half of all known enzymes and catalyze some of nature’s most challenging reactions, including methane oxidation and nitrogen fixation (1). Advances in bioinorganic chemistry have revealed an extensive repertoire of reactive intermediates employed by metalloenzymes, such as 5’-deoxyadenosyl radical and high-valent metal-oxygen complexes, to carry out diverse radical transformations, highlighting their ability to generate and control highly reactive radical species (Fig. 1a) (2-4). Recent progress in metalloenzyme engineering has further expanded their synthetic capabilities beyond native biological functions, enabling new-to-nature transformations through rational design and directed evolution (5-7). Over the past decade, researchers have leveraged the reaction promiscuity and evolvability of metalloenzymes to develop fully genetically encoded biocatalysts capable of mediating a broad range of abiotic metal-catalyzed reactions (8-21).

Fig. 1.

Fig. 1

Open in a new tab

(a) Common reactive intermediates for radical reactivity of natural metalloenzymes. (b) Merging photoredox and metalloenzymatic catalysis for new-to-nature radical reaction development.

Despite these advances, the scope of transition-metal catalyzed reactions available in enzymes remains limited compared to the diversity of transformations achieved in synthetic systems. Furthermore, the integration of transition metal catalysis with enzymatic photochemistry remains largely underexplored. To date, only three families of natural enzymes are known to harness light for transformations: DNA photolyases (22), light-dependent protochlorophyllide reductases involved in chlorophyll biosynthesis (23), and flavin-dependent photoenzymes such as flavin-dependent fatty acid decarboxylase (24, 25). Recently, photobiocatalysis has been expanded through by repurposing natural enzymes for new-to-nature reactions. These efforts have mostly relied on enzymes containing organic cofactors such as flavin, nicotinamide, thiamine, and pyridoxal (12, 15, 26-34).

To address these gaps, we sought to integrate metallophotoredox catalysis, an important class of metal-catalyzed radical transformations in synthetic chemistry into enzymes (35). As a proof of concept, we developed a biocatalytic platform that integrates photoredox activation of N-hydroxyphthalimide (NHPI) esters with enantioselective radical interception by Fe(III) intermediates of nonheme enzymes (17) (Fig. 1b). With this newly established radical activation mode, we have successfully developed a biocatalytic platform based on (4-hydroxyphenyl)pyruvate dioxygenase from Streptomyces avermitilis (SavHPPD) for enantioselective C(sp3)–N3 and C(sp3)–SCN bond formation. Our findings further demonstrate that merging photoredox catalysis with natural metalloenzymatic systems can unlock new opportunities in photobiocatalysis. In this chapter, we present detailed protocols for the engineering and directed evolution of SavHPPD to enable light-activated decarboxylative azidation and thiocyanation. We also provide detailed procedures for conducting these enzymatic reactions at both analytical and preparative scales.

2. Cloning for a site-saturated mutagenesis screening library

2.1. Equipment

  • Eppendorf Research® Plus single channel mechanical pipettes, variable volumes

  • Bio-Rad T100™ Thermal Cycler

  • Bio-Rad PowerPac™ Basic power supply

  • Bio-Rad Mini-Sub® Cell GT

  • VWR® Blue Light Transilluminator

  • Bio-Rad MicroPulser™ electroporator

  • Bulldog Bio electroporation cuvettes-2 mm gap

  • Eppendorf 5425R centrifuge

  • NanoQuant Plate™ (TECAN)

  • TECAN SPARK plate reader

  • Eppendorf microcentrifuge tubes (2 mL)

  • TempAssure® 0.2 mL PCR tubes, flat caps (USA Scientific, Catalog number: 1402-8100)

  • Sterile inoculation loops.

2.2. Materials and reagents

  • Thermo Scientific™ Phusion® High-Fidelity DNA Polymerase, DMSO (dimethyl sulfoxide), Phusion® 5× HF (High-Fidelity) Buffer, deoxyribonucleotide triphosphate solutions (dNTPs), DpnI, from New England Biolabs (NEB)

  • ddI water (autoclaved MilliQ water)

  • 50× TAE buffer (50 mM EDTA, 2 M Tris, 1 M acetic acid)

  • 2% agarose gel (10 g agarose (low electroendosmosis, GoldBio, Catalog number: A-201-500) in 500 mL 1× TAE buffer, microwave carefully until transparent)

  • Thermo Scientific™ GeneRuler 100 bp and 1 kb DNA ladders (Catalog number: SM0241, SM0311)

  • DNA loading dye (6×), no SDS (Thermo Scientific™, Catalog number: R0611) with SYBR® Gold nucleic acid gel stain (10,000×) (Invitrogen, Catalog number: S11494), kept at −20 °C and avoid light)

  • Thermo Scientific™ GeneJET Gel Extraction Kit (Catalog number: K0692)

  • Gibson Mastermix (36) [320 μL 5× isothermal buffer (25% PEG-8000, 500 mM Tris-HCl pH 7.5, 50 mM MgCl2, 50 mM dithiothreitol, 1 mM each of the dNTPs, and 5 mM NAD)], 0.64 μL of 10 U/μL T5 exonuclease, 20 μL of 2 U/μL Phusion® High-Fidelity DNA Polymerase, 160 μL of 40 U/μL Taq DNA ligase from NEB

  • SOC medium (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, and 20 mM glucose, autoclaved)

  • Electrocompetent E. coli (Escherichia coli) strain E. cloni BL21(DE3) cells (Lucigen)

  • LBamp agar plate [15 g agar (RPI Research) in Luria-Bertani medium with 0.1 mg/mL ampicillin sodium salt (RPI Research)]

  • Ampicillin sodium salt (GoldBio)

2.3. Sequences of template and primers

The gene of interest (GOI) was cloned into pET-22b(+) vector between NdeI and XhoI with a C-terminal 6× His-tag. The DNA sequence of the wt SavHppD is shown below. Additional features are annotated as follows:

  • The ribosome binding site from the pET-22b(+) vector AAGGAG is highlighted in bold blue.

  • The start codon ATG is highlighted in bold black.

  • The construct includes a C-terminus 6xHis tag (highlighted in bold green) connected to the protein via a leucine-glutamate linker (underscored in green).

  • The stop codon TAA is highlighted in bold red.

AAGGAGATATACATATGACGCAGACTACACATCACACGCCCGACACGGCACGTCA GGCAGATCCATTTCCAGTGAAGGGTATGGATGCTGTTGTGTTCGCTGTAGGTAATGC AAAACAGGCGGCGCACTATTACAGCACAGCCTTTGGGATGCAGTTGGTGGCCTACA GTGGTCCCGAAAATGGGAGCCGTGAGACCGCCTCGTATGTCTTGACCAACGGATCA GCGCGTTTCGTCCTGACAAGCGTTATTAAGCCGGCCACGCCATGGGGACATTTCCTT GCAGATCACGTTGCAGAGCACGGAGATGGAGTTGTAGACCTGGCTATTGAAGTCCC CGACGCCCGTGCCGCTCACGCCTACGCTATCGAACACGGTGCCCGCTCCGTGGCGGA ACCGTACGAATTAAAGGACGAGCACGGCACGGTCGTTTTGGCTGCCATCGCCACCT ACGGCAAAACGCGCCACACACTGGTAGACCGTACGGGCTACGACGGGCCATACTTG CCGGGGTACGTAGCTGCCGCCCCTATTGTCGAGCCCCCTGCGCACCGCACCTTCCAA GCTATTGACCACTGTGTAGGTAATGTGGAATTAGGACGCATGAACGAATGGGTGGG CTTCTATAATAAGGTTATGGGGTTCACCAACATGAAAGAGTTTGTAGGGGATGACAT TGCAACAGAATATTCGGCCCTGATGTCAAAAGTGGTCGCTGATGGGACCCTTAAAGT AAAATTTCCCATTAACGAACCCGCTTTAGCAAAGAAGAAATCTCAAATTGATGAATA CTTAGAATTTTACGGAGGAGCGGGAGTCCAACATATCGCTTTAAACACGGGCGACA TCGTGGAGACGGTCCGTACCATGCGTGCAGCTGGGGTACAATTCCTGGACACTCCCG ATTCATACTATGACACGCTTGGTGAGTGGGTTGGCGATACTCGTGTTCCGGTCGACA CTCTTCGTGAGCTGAAAATCTTGGCGGATCGCGACGAGGATGGATACTTATTACAAA TTTTTACTAAACCAGTGCAGGACCGTCCTACCGTTTTCTTCGAAATTATTGAGCGTCA TGGGAGCATGGGGTTTGGTAAGGGGAATTTCAAGGCCCTTTTTGAGGCAATCGAGC GTGAGCAAGAGAAACGCGGGAATTTACTCGAGCACCACCACCACCACCACTAA

  • Primers (005, 006, 007, 008, NDT, VHG, TGG, and rev primers; purchased from IDT)

  • Forward primer 005: for the amplification of GOI: 5′-GAAATAATTTTGTTTAACTTTA AGAAGGAGATATACATATG-3′

  • Reverse primer 006 for the amplification of GOI: 5′-GCCGGATCTCAGTGGTGGTGGT GGTGGTGCTCGAG-3′

  • Reverse primer 007 for the amplification of the backbone: reverse complement strand of 005

  • Forward primer 008 for the amplification of the backbone: reverse complement strand of 006

  • Forward (NDT, VHG, TGG) and reverse primers designed for site-saturation mutagenesis using the “22-codon trick” method (37).

  • Example primers designed for site-saturation mutagenesis at the S230X site using “wt SavHppD” as the parent:

  • S230X_fwd_NDT: 5′-CATTGCAACAGAATATTCGGCCCTGATGNDTAAAGTGGTC-3′

  • S230X_fwd_VHG: 5′-CATTGCAACAGAATATTCGGCCCTGATGVHGAAAGTGGTC-3′

  • S230X_fwd_TGG: 5′-CATTGCAACAGAATATTCGGCCCTGATGTGGAAAGTGGTC-3′

  • S230X_rev: 5′- CAGGGCCGAATATTCTGTTGCAATG-3′

  • Backbone (100 ng/μL as determined using NanoQuant Plate™) of the pET-22b (+) vector; prepared by long-range PCR using pET-22b(+) as the template and 007 and 008 as primers

2.4. Cloning and mutagenesis

The primary mutagenesis method employed in this directed evolution campaign is site-saturation mutagenesis (SSM), a well-established and efficient strategy for generating mutant libraries to improve enzyme function (38). In SSM, one or a few residues of the target enzyme are selected for random mutagenesis using primers that contain degenerate codons such as NNK, NDT, and VHG. In this work, the 22-codon trick was adopted, which enables the encoding of all 20 canonical amino acids with minimal codon redundancy. Residue selection for random mutagenesis is guided by structural or modeling data. Specifically, residues near the iron center or involved in binding the native substrate of SavHPPD are targeted, based on the hypothesis that these positions would require modification to accommodate the non-natural radical relay chemistry. Given the substantial mechanistic differences between decarboxylative photoredox reactions and the native activity of SavHPPD, these residues are likely to be functionally important.

We adopted a sequential SSM strategy: in each round of directed evolution, single-site SSM and screening were performed for one or a few positions. The best-performing mutant from each round is used as the parent for the next. This approach allows for rapid screening due to the manageable size of single-site libraries, although it does not fully explore residue cooperativity or the impact of mutation order on final outcomes. Residue order was prioritized based on proximity to the iron center.

  1. Prepare the primer mix by diluting all primers to 25 uM with ddI H2O. Combine forward primers (NDT/VHG/TGG: 120 μL/90 μL/10 μL) in a 2 mL microcentrifuge tube. Vortex to mix thoroughly to get the Fwd_primers mix.

  2. Set up two PCR reactions (fragment 1 & 2):
    • PCR1: Mix 34 μL ddI H2O, 10 μL 5× Phusion® HF buffer (Thermo Scientific™), 1.5 μL DMSO, 1 μL 10 mM dNTP mix, 1 μL DNA template (30–150 ng/μL), 1 μL Fwd_primers mix, and 1 μL 006 primer to a PCR tube. Mix and spin down.
    • PCR2: Mix 34 μL ddI H2O, 10 μL 5× HF buffer, 1.5 μL DMSO, 1 μL 10 mM dNTPs, 1 μL DNA template (30–150 ng/μL), 1 μL Rev_primer, and 1 μL 005 primer to a PCR tube.
    • Add 0.5 μL Phusion DNA polymerase to each PCR tube. Mix and spin down.

  3. Run the PCR reactions in the Thermal Cycler’s (fragment 1 & 2) using the temperature program as following: Initial denaturation step (98 °C, 30 s), Denaturation step (98 °C, 10 s), Annealing step (55 °C, 30 s), Extension step (72 °C, 30 s), Cycles (25–30 cycles), Final extension step (72 °C, 10 min), and hold at 4 °C. (For Phusion DNA polymerase, the extension rate is around 1 kbp/30s. Calculate the extension time based on the length of the DNA and extension rate of Phusion DNA polymerase).

  4. Purify the PCR product using gel electrophoresis (fragment 1 & 2). Add 5 μL DNA loading dye (6×) with 0.1% of SYBE® gold Nucleic Acid Gel Stain to PCR products. Load PCR1 and PCR2 to a 2% Agarose gel alongside a 100 bp DNA ladder. Run at 130 V for 20 min. Cut out the appropriate band under a blue-light transilluminator and purify using the Thermo Scientific™ GeneJET DNA Gel Extraction Kit; usually elute in 25 μL elution. Measure the DNA concentration using NanoQuant and then keep the PCR products at −20 °C for storage.

  5. Set up the PCR reactions (gene of interest): Mix 34 μL ddI H2O, 10 μL 5× HF buffer, 1.5 μL DMSO, 1 μL 10 mM dNTP mix (dATP, dGTP, dTTP, dCTP), 1 μL DNA template (the combined PCR products from step 4), 1 μL 005 and 1 μL 006 primer to a PCR tube, then, add 0.5 μL Phusion DNA polymerase. Mix and spin down.

  6. Run the PCR reactions in the Thermal Cycler’s (gene of interest) using the temperature program as following: Initial denaturation step (98 °C, 30 s), Denaturation step (98 °C, 10 s), Annealing step (55 °C, 30 s), Extension step (72 °C, 45 s), cycles (25–30 cycles), Final extension step (72 °C, 10 min), and hold at 4 °C.

  7. Purify the PCR product (gene of interest) using gel electrophoresis and GeneJET DNA Gel Extraction Kit. Elute with 15 μL elution buffer to maintain a high DNA concentration.

  8. Perform Gibson Assembly (for plasmid) by adding 1.25 μL backbone and 1.25 μL PCR product (gene of interest) to a PCR tube containing 7.5 μL of Gibson mix. Incubate at 50 °C for 1 h in the Thermal Cycler.

  9. Place the electroporation cuvette and a tube of electrocompetent E. coli cells (50 μL) on ice. Add 1 μL Gibson product into electrocompetent E. coli cells, mix and transfer to cuvette. Wipe dry electrodes of the cuvette and electroporate in “Bacteria” mode (1.8 kV). Quickly add 500 μL SOC medium and recover at 37 °C, 230 rpm for 45 min. Plate 50-100 μL SOC culture on LBamp Agar with sterile inoculation loops and incubate overnight at 37 °C.

  10. Prepare parent control in parallel by transforming E. coli cells with plasmids encoding parent enzymes.

3. Library screening

3.1. Equipment

  • Eppendorf Xplore® plus 12-channel pipettes, variable volumes

  • Toothpicks (autoclaved)

  • Breathable sealing film, sterile (Sigma, Catalog number: AB0718)

  • New Brunswick Innova 44R shaker

  • Eppendorf 5910R centrifuge

  • Eppendorf 5425R centrifuge

  • Fisherbrand® microplate shaker

  • Coy Lab vinyl anaerobic chamber

  • MEIKEE 150 W RGB LED Flood Lights, ASIN: B09KLRBS7X from Amazon

  • CHIRALPAK® IA column (4.6 mm × 250 mm, 5 mic)

  • Agilent 1260 series instruments

  • Agilent 1260 LC/MSD iQ-series HPLC

  • 96-well deep-well plates (VWR, Catalog number: 43001-0020)

  • 24-well deep-well plates (VWR, Catalog number: 104026-638)

  • Tissue Culture Plate (VWR, Catalog number: 10861-562)

  • Eppendorf 2mL microcentrifuge tubes

  • 2mL screw-top vials (Agilent)

  • Cell density meter (Biowave, WPA CO8000) for OD600 measurement

3.2. Materials and reagents

  • LBamp medium (Lennox L Broth with 100 ng/mL ampicillin)

  • TBamp medium (Terrific Broth with 100 ng/mL ampicillin)

  • 1 M isopropyl β-D-1-thiogalactopyranoside (IPTG, 1000×) in ddI H2O (sterilized by membrane filtration through a 0.22-micron sterile cellulose acetate)

  • Egg white lysosome (Goldbio)

  • 50mM Kpi buffer (34.8 mM K2HPO4, 15.2 mM KH2PO4, pH 7.4)

  • DMF (N, N-Dimethylformamide) (Sigma-Aldrich , ≥99%, Catalog number: D158550)

  • 400 mM 1-NHPI substrate in DMF

  • 100 mM ferrous ammonium sulfate in ddI H2O

  • 1 M sodium azide in ddI H2O

  • 5mM eosin Y in ddI H2O

  • Thermo Scientific™ Formic acid, 88%, ACS reagent

  • Acetonitrile (HPLC grade, ≥99%, Sigma-Aldrich, Catalog number: 439134)

  • 200mM methyl 2-(diphenylphosphaneyl)benzoate in acetonitrile

3.3. Protocols for protein expression in 96-well plates

  1. Transfer 600 uL LBamp medium into each well of a 96-well plate using an Eppendorf Xplorer® 12-channel pipette. Pick single colonies of the parent enzyme with autoclaved toothpicks and inoculate designated wells (e.g., E6 and F6) as parent controls. Pick seventy colonies from the SSM screening library agar plate and inoculate the 96-well plate. Seal the plate with breathable film and incubate at 37 °C, 230 rpm for 16h in a New Brunswick Innova 44R shaker.

  2. Transfer 4 mL TBamp medium into each well of four new sterile 24-well plates. Inoculate each well with 200 μL of LBamp overnight culture. Seal with breathable film and incubate at 37 °C, 230 rpm for 2 h until the OD600 ≈ 1.0.

  3. Simultaneously, prepare glycerol stocks: dispense 100 μL of sterile 50% glycerol (in ddl H2O) into a new 96-well plate. Add 100 μL of the overnight LBamp cultures into each corresponding well. Mix by gentle swirling, seal, and store at −80 °C.

  4. After 2 h of growth, place the 24-well expression plates on ice for 30 min. Thaw the 1000× IPTG stock from the −20 °C freezer and adjust concentration to 50mM with sterile ddI water. Add 42 μL IPTG to each well to induce protein expression. Gently shake the plate to ensure good mixing. Seal with breathable film and incubate at 20.5 °C, 180 rpm for 20 h in a New Brunswick Innova 44R shaker.

3.4. Set up whole-cell screening reactions in 96-well plate:

  1. Pre-cool the Eppendorf 5910R centrifuge to 4 °C. Cool down the 24-well plates on ice for 15 min, then centrifuge at 4 °C, 4500 xg for 10 min. Keep the cell pellets and discard the supernatant.

  2. Resuspend cell pellets in 600 μL Kpi buffer (pH 7.4) containing 0.5 mg/mL egg white lysozyme. Shake on a Fisher Scientific microplate shaker at 400 rpm for 2h at room temperature.

  3. Spin down the lysed cultures at 4500 xg for 10 min. Transfer 300uL of each supernatant to labeled 2mL screw-top vials.

  4. Transfer the vials, substrate stock and freshly prepared Fe(II) stock (ferrous ammonium sulfate, 100 mM in ddI H2O) into a Coy anaerobic chamber.

  5. Sequentially add 10 μL Fe(II) solution, 10 μL of 1M sodium azide, 10 μL 400mM 1-NHPI in DMF and 8 μL of 4mM eosin Y into each well using an Eppendorf Xplorer® 12-channel pipette. Shake on a microplate shaker at 680 rpm for 2 min after each addition.

  6. Cap the vials tightly and remove them from the anaerobic chamber to a 4°C cold room. Affix vials to a 150W RGB LEB panel using adhesive tape and set the LED panel to emit green light at maximum power. To maintain consistent light intensity, place no more than 20 vials on each LED panel holds (totally four LED panels used per library assessment). Shake the assemblies on the microplate shaker at 300 rpm for 12 h with fan cooling.

3.5. Work-up for the Reactions:

  1. Add 600 μL acetonitrile to each vial to quench the reaction and mix well. Shake vials on microplate shaker at 600 rpm for 30 min to ensure complete cell debris precipitation. Transfer mixtures to 2 mL microcentrifuge tubes and centrifuge at 14,000 xg for 5 min using an Eppendorf 5425R.

  2. Transfer 300 μL of the clear supernatant to fresh 2 mL screw-cap GC vials. Add 10μL of methyl 2-(diphenylphosphaneyl)benzoate stock solution. Shake at 600 rpm for 12 h at room temperature to fully derivatize the azidation products via Staudinger ligation (Fig. 2a and 2b).

  3. Analyze samples using reverse phase LCMS [Agilent 1260 LC/MSD iQ series instruments, CHIRALPAK® IA column (4.6 mm × 250 mm, 5 mic)] with the following conditions: 55% acetonitrile/ H2O, 0.6 mL/min, single ion monitoring mode detection (m/z = 426.0). The expected retention times of two enantiomers elute at t1 = 11.7 min and t2 = 12.7 min.

  4. Identify hits based on LCMS analysis.

Fig. 2.

Fig. 2

Open in a new tab

(a) Directed evolution of SavHPPD for decarboxylative azidation using derivatization via Staudinger ligation and LCMS assay. (b) Reaction setup for analytical scale and screening reactions. (c) Reaction setup for preparative scale reactions.

4. Validation of the enzymatic reactions

4.1. Equipment

  • Agilent 5977B GC/MSD

  • HP-5MS UI column (30.0 m × 0.25 mm)

  • Agilent 1260-series HPLC

  • CHIRALPAK® ODH column (4.6 mm × 250 mm, 5 mic)

  • Agilent XDB-C18 column (9.4 × 250 mm)

  • Agilent 8860 series instrument

  • CP-Chirasil-Dex CB column (25 m × 0.25 mm)

  • Vortex-Genie 2 Mixer (Scientific Industries)

  • Cell density meter (Biochrom, WPA CO8000) for OD600 measurement

  • New Brunswick Innova 44R shaker

  • Eppendorf 5910R centrifuge

  • Eppendorf 5425R centrifuge

  • Fisherbrand® microplate shaker

  • Fisherbrand® Model 505 Sonic Dismembrator

  • Thermo Scientific™ Pierce protein concentrator (10K MWCO) (Catalog number: 88513)

  • Erlenmeyer flasks, variable volumes

  • Coy Lab vinyl anaerobic chamber

  • MEIKEE 150 W RGB LED Flood Lights, ASIN: B09KLRBS7X from Amazon

  • Lumidox® green LED array (Analytical Sales and Services, Inc.)

  • Fisherbrand® disposable sterile plastic culture tubes (Catalog number: FB149566B)

  • Eppendorf 2mL microcentrifuge tubes

  • Falcon tubes (50 mL & 15 mL)

  • 2mL screw-top vials (Agilent)

  • Glass Flask Liquid Bottle from Amazon (ASIN: B0B8765L3N).

  • Biotage Isolera One Flash Chromatography System

  • ÄKTA start protein purification system (Cytiva)

  • Thermo Scientific™ GeneJET Plasmid Miniprep Kit (Catalog number: K0503)

  • 5mL Ni-NTA column (HisTrap HP, Cytiva)

  • Thermo Scientific™ SnakeSkin™ Dialysis Tubing (Catalog number: 88243)

4.2. Materials and reagents

  • LBamp medium (Lennox L Broth with 100 ng/mL ampicillin)

  • TBamp medium (Terrific Broth with 100 ng/mL ampicillin)

  • 1 M isopropyl β-D-1-thiogalactopyranoside (IPTG, 1000×) in ddI H2O (sterilized by membrane filtration through a 0.22-micron sterile cellulose acetate)

  • Buffer A (50 mM Kpi, pH 7.4, 100 mM NaCl, 20 mM imidazole)

  • Buffer B (50 mM Kpi, pH 7.4, 100 mM NaCl, 500 mM imidazole)

  • Buffer C (50 mM Kpi, pH 7.4, 10% glycerol)

  • EDTA (Ethylenediaminetetraacetic acid) (Sigma-Aldrich, Catalog number: E9884)

  • Thermo Scientific™ Formic acid, 88%, ACS reagent

  • Acetonitrile (HPLC grade, ≥99%, Sigma-Aldrich, Catalog number: 439134)

  • 2-Propanol (HPLC grade, Sigma-Aldrich, Catalog number: 650447)

  • Hexanes (98.5% hexane, mixture of isomers, HPLC grade, Sigma-Aldrich, Catalog number: 293253)

  • EtOAc (ethyl acetate) (HPLC grade, ≥99.7%, Sigma-Aldrich, Catalog number: 34858)

  • Extraction solution (0.5 mM 1,3,5-trimethoxybenzene in EtOAc/hexanes: 3/2)

  • SiliaFlash® P60, 40-63 μm (230-400 mesh), 60 Å (SiliCycle, Catalog number: R12030B)

4.3. Protocols for protein purification

To validate the beneficial mutation(s) identified during library screening, it is necessary to perform analytical-scale reactions using enzymes expressed from larger-scale cell cultures. This step helps confirm beneficial variants and eliminate false positives from initial screening.

  1. Add 5 mL LBamp medium to a sterile culture tube. Inoculate with bacterial glycerol stock using a sterile toothpick. Cap the culture tube loosely to allow ventilation. Incubate the starter culture at 37 °C, 230 rpm for 12–14 h in an Eppendorf Innova 44R shaker.

  2. To validate screening hits from library, save a copy of bacterial glycerol stock in −80 °C freezer. Extract plasmids using GeneJET Plasmid Miniprep Kit and verify the sequence of identified mutations via Sanger sequencing.

  3. Transfer 200 mL of TBamp medium into a 1 L Erlenmeyer flask. Inoculate with 2 mL of the overnight culture. Incubate at 37 °C, 230 rpm in an Eppendorf Innova 44 R shaker until OD600 reaches 0.7.

  4. Thaw the IPTG (1000×) stock from the −20 °C freezer. After 2 h, place the flask on ice for 20 min to cool down. Add 200 μL of IPTG stock to each flask to induce expression. Incubate at 20.5 °C, 180 rpm for 20 h in an Eppendorf Innova 44R shaker.

  5. Pre-cool the Eppendorf 5910R tabletop centrifuge to 4 °C before use. Transfer the expression culture into a 50 mL falcon tube and cool down on ice for 15 min. Spin down the cell pellet at 4000 x g at 4 °C for 15 min. Discard the supernatant and store the cell pellet at −80 °C freezer for 24h.

  6. Thaw the cell pellet and resuspend in 50mM Kpi buffer containing 100mM sodium chloride and 20mM imidazole (pH 7.5) at a ratio of 10mM of buffer per gram of cell pellet.

  7. Sonicate the cell suspension on ice for 5 min (5s on, 5s off, at a 50% duty cycle, repeated twice). Aliquot the lysate into 2 mL microcentrifuge tubes and spin down at 14,000 xg for 30 min at 4 °C using Eppendorf centrifuge 5425R.

  8. Combine the supernatants and filter through a 0.45 μm cellulose acetate filter.

  9. Run protein purification on ÄKTA start protein purification system (Cytiva) with following program:
    • Equilibrate a 5mL Ni-NTA column with 5 CV (column volumes) of Buffer A.
    • Load protein lysate onto Ni-NTA column
    • Wash with 15 CV of Buffer A to remove unbound proteins.
    • Elute target protein with a linear gradient of 20 to 500mM imidazole over 10 CV using Buffer A and Buffer B.

  10. Pool fractions containing target protein and concentrate using a Pierce protein concentrator (10K MWCO) in an Eppendorf 5910R tabletop centrifuge at 4 °C.

  11. Transfer the concentrated protein to SnakeSkin™ Dialysis Tubing and first dialyze against 1L of Buffer C containing 10mM EDTA for 12h at 4 °C. Perform three additional rounds of dialysis against 1L of Buffer C (without EDTA).

  12. Measure protein absorbance at 280nm using a NanoQuant spectrophotometer. Calculate protein concentration using theoretical extinction coefficients for SavHPPD and its variants, determined via the ExPASy Bioinformatics Resources Portal (http://www.expasy.org).

4.4. Protocol for analytic-scale reactions

Analytical scale reactions are carried out in triplicate and the reaction with parent is carried out as a control.

  1. Dilute purified protein to 40 μM in 25mM Kpi buffer (pH 7.4). Transfer the diluted protein into the 2 mL screw-cap vials.

  2. Transfer the sample vials, freshly made Fe(II) stock solution and substrate stock solution into a Coy anaerobic chamber.

  3. Sequentially add 10 μL of 100mM Fe(II) solution, 10 μL of 1M sodium azide, 10 μL 400mM 1-NHPI in DMF and 6 μL of 4mM eosin Y to each vial. After each addition, shake the vials on a Fisher Scientific microplate shaker at 680 rpm for 2 min to ensure good mixing.

  4. Cap the vials tightly and seal them with parafilm. Remove the vials from the anaerobic chamber and place them in a 4°C cold room. Affix vials between a 150W RGB LEB panel and a Lumidox green LED array using adhesive tape and set both panels to emit green light at maximum power. To ensure consistent light intensity, do not place more than 12 vials per assembly. Shake the setup at 300 rpm for 30 min with fan cooling (Fig. 2b).

  5. After 40 min, remove the sample vials from shaker and return them to the anaerobic chamber. Add 100 μL of 40 μM purified protein to the reaction mixture and seal the vials tightly.

  6. Remove the vials from the anaerobic chamber and return them to the photoreaction setup in a 4°C cold room. Allow the reaction to proceed under green light for 14h.

  7. Work up reactions by adding 900 μL extraction solution to each vial. Transfer the mixture into 2 mL microcentrifuge tubes and vortex for 10s repeated three times. Load the tubes in an Eppendorf 5425R centrifuge to separate the organic and the aqueous layers at 14,000 x g for 5 min.

  8. Transfer 300 μL of the organic layer into a 0.5 mL insert and place into a 2mL screw-top vials for GCMS. Analyze using a GCMS system [Agilent 5977B GC/MSD system, HP-5MS UI column (30.0 m × 0.25 mm)] with the following oven temperature setting (helium flow: 1 ml/min): Initial: 90 °C (hold 0 min); Ramp 1: 90–140 °C (20 °C/min, hold 0 min); Ramp 2: 140–225 °C (15 °C/min, hold 0 min); Ramp 3: 225–270 °C (30 °C/min, hold 4 min).

  9. Dry the remaining organic layer. Redissolve the crude product in acetonitrile and purify the sample using a semipreparative HPLC (high-performance liquid chromatography) [Agilent 1260 series, XDB-C18 column (9.4 × 250 mm)] with following method: 15% acetonitrile (0–1 min), then 15–95% acetonitrile (1–9 min) and 95% (9–13 min), flow rate at 3.5 mL/min.

  10. Load the purified product in chiral GC or chiral HPLC. Determine enantioselectivity using chiral GC [Agilent 8860 series, CP-Chirasil-Dex CB column (25 m × 0.25 mm), 80 °C isotherm, 1.25 mL/min H2 carrier gas flow] or normal phase chiral HPLC [Agilent 1260 series, CHIRALPAK® ODH (4.6 × 250 mm, 5 mic), isocratic elution: 0% iPrOH/hexanes, 0.5 mL/min].

  11. Identify the hits based on both GCMS and chiral analysis results.

4.5. Protocol for preparative-scale reactions

To enhance the synthetic utility of this enzymatic system, the following produce outlines the steps to perform the reaction on a preparative scale.

  1. Dilute the purified protein to 40 μM in 25mM Kpi buffer (pH 7.4). Transfer the diluted protein into a Glass Flask Liquid Bottle. Place the reaction bottle, freshly prepared Fe(II) stock solution, and substrate stock solution into a Coy anaerobic chamber.

  2. Add 400 μL of 100mM Fe(II) solution, 400 μL of 1M sodium azide and 240 μL of 5 mM eosin Y. Shake the bottle on a Fisher Scientific microplate shaker at 300 rpm for 5 min to ensure thorough mixing. Add 200 μL of 400mM 1-NHPI in DMF to reaction bottle.

  3. Cap the bottle tightly and seal it with parafilm. Remove the reaction bottle from the anaerobic chamber and place it in a 4°C cold room. Affix the bottle between a 150W RGB LEB panel and a Lumidox green LED array using adhesive tape and set both LED panels to emit green light at maximum intensity. Shake the assembly on the microplate shaker at 300 rpm for 30 min with fan cooling (Fig. 2c).

  4. After 40 min, remove the reaction bottle from the shaker and return it to the anaerobic chamber. Add 200 μL of 400mM 1-NHPI in DMF and 160 μL of 5 mM eosin Y to the reaction mixture and seal the bottle tightly.

  5. Remove it from the anaerobic chamber and return it to the photoreaction setup in the 4°C cold room. Resume irradiation under green light for 14h.

  6. Transfer reaction mixture to a 50mL Falcon tube and add 25mL extraction solution. Vortex for 30s repeated three times. Load the tubes in an Eppendorf 5910R centrifuge to separate the organic and the aqueous layers at 10,500 x g for 10 min.

  7. Transfer the organic layer to a clean Erlenmeyer flask. Extract the aqueous layer twice more with extraction solution. Combine the organic layers and dry over anhydrous MgSO4. Filter the combined organic extracts through a celite plug to remove Na2SO4. Concentrate the filtrate via rotary evaporation. Purify the azidation product using flash chromatography on a Biotage Isolera.

5. Summary

The integration of synergistic photocatalysis with metalloenzymes offers a powerful strategy to expand the scope of photobiocatalysis, unlocking reaction pathways that are beyond the reach of enzymes utilizing organic cofactors. Directed evolution has proven to be an effective tool for reprogramming enzymes to perform abiological transformations with remarkable activity and selectivity. In this chapter, we present comprehensive protocols for enabling C(sp3)–H azidation reactions using nonheme iron enzymes under light activation. The methods include high-throughput enzyme engineering and activity screening in a 96-well plate format, as well as procedures for conducting reactions at both analytical and preparative scales. By offering detailed guidance, these protocols aim to support and inspire future efforts to expand the catalytic repertoire of metalloenzymes.

Acknowledgments

We acknowledge Johns Hopkins University and National Institute for General Medical Sciences (R35GM147639) for financial support.

Reference

  • 1.Lu Y, Yeung N, Sieracki N, Marshall NM, Design of functional metalloproteins. Nature 460, 855–862 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Huang X, Groves JT, Oxygen activation and radical transformations in heme proteins and metalloporphyrins. Chem. Rev 118, 2491–2553 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Broderick JB, Duffus BR, Duschene KS, Shepard EM, Radical S-adenosylmethionine enzymes. Chem. Rev 114, 4229–4317 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Krebs C, Galonic Fujimori D, Walsh CT, Bollinger JM Jr., Non-heme Fe(IV)-oxo intermediates. Acc. Chem. Res 40, 484–492 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Schwizer F et al. , Artificial metalloenzymes: Reaction scope and optimization strategies. Chem. Rev 118, 142–231 (2018). [DOI] [PubMed] [Google Scholar]
  • 6.Chen K, Arnold FH, Engineering new catalytic activities in enzymes. Nat. Catal 3, 203–213 (2020). [Google Scholar]
  • 7.Miller DC, Athavale SV, Arnold FH, Combining chemistry and protein engineering for new-to-nature biocatalysis. Nat. Synth 1, 18–23 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Yang Y, Arnold FH, Navigating the unnatural reaction space: Directed evolution of heme proteins for selective carbene and nitrene transfer. Acc. Chem. Res 54, 1209–1225 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Ren X, Fasan R, Engineered and artificial metalloenzymes for selective C–H functionalization. Curr. Opin. Green Sustain. Chem 31, 100494 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Mondal D, Snodgrass HM, Gomez CA, Lewis JC, Non-native site-selective enzyme catalysis. Chem. Rev 123, 10381–10431 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Rui J et al. , Directed evolution of nonheme iron enzymes to access abiological radical-relay C(sp3)–H azidation. Science 376, 869–874 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Zhao L-P et al. , Cooperative photometallobiocatalysis: Nonheme Fe enzyme-catalyzed enantioconvergent radical decarboxylative azidation, thiocyanation, and isocyanation of redox-active esters. Angew. Chem. Int. Ed n/a, e202506361 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Wan Z et al. , Stereoconvergent reduction of alkenes using a repurposed iron-based dioxygenase. Nat. Synth (2025). [Google Scholar]
  • 14.He H et al. , Enantioselective trifluoromethylazidation of styrenyl olefins catalyzed by an engineered nonheme iron enzyme. Angew. Chem. Int. Ed 64, e202423507 (2025). [DOI] [PubMed] [Google Scholar]
  • 15.Rui J et al. , Merging photoredox with metalloenzymatic catalysis for enantioselective decarboxylative C(sp3)–N3 and C(sp3)–SCN bond formation. Nat. Catal 7, 1394–1403 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Zhao et L-P et al. , Biocatalytic enantioselective C(sp3)–H fluorination enabled by directed evolution of non-haem iron enzymes. Nat. Synth 3, 967–975 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Zhao Q et al. , Engineering non-haem iron enzymes for enantioselective C(sp3)–F bond formation via radical fluorine transfer. Nat. Synth (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Wang B et al. , Repurposing iron- and 2-oxoglutarate-dependent oxygenases to catalyze olefin hydration. Angew. Chem. Int. Ed 62, e202311099 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Rui J et al. , Directed evolution of nonheme iron enzymes to access abiological radical-relay C(sp3)–H azidation. Science 376, 869–874 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Vila MA, Steck V, Rodriguez Giordano S, Carrera I, Fasan R, C–H amination via nitrene transfer catalyzed by mononuclear non-heme iron-dependent enzymes. ChemBioChem 21, 1981–1987 (2020). [DOI] [PubMed] [Google Scholar]
  • 21.Goldberg NW, Knight AM, Zhang RK, Arnold FH, Nitrene transfer catalyzed by a non-heme iron enzyme and enhanced by non-native small-molecule ligands. J. Am. Chem. Soc 141, 19585–19588 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Sancar A, Structure and function of DNA photolyase and cryptochrome blue-light photoreceptors. Chem. Rev 103, 2203–2238 (2003). [DOI] [PubMed] [Google Scholar]
  • 23.Gabruk M, Mysliwa-Kurdziel B, Light-dependent protochlorophyllide oxidoreductase: Phylogeny, regulation, and catalytic properties. Biochemistry 54, 5255–5262 (2015). [DOI] [PubMed] [Google Scholar]
  • 24.Sorigué D et al. , An algal photoenzyme converts fatty acids to hydrocarbons. Science 357, 903–907 (2017). [DOI] [PubMed] [Google Scholar]
  • 25.Sorigué D et al. , Mechanism and dynamics of fatty acid photodecarboxylase. Science 372, eabd5687 (2021). [DOI] [PubMed] [Google Scholar]
  • 26.Harrison W, Huang X, Zhao H, Photobiocatalysis for abiological transformations. Acc. Chem. Res 55, 1087–1096 (2022). [DOI] [PubMed] [Google Scholar]
  • 27.Fu H, Hyster TK, From ground-state to excited-state activation modes: Flavin-dependent “ene”-reductases catalyzed non-natural radical reactions. Acc. Chem. Res 57, 1446–1457 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ouyang Y, Page CG, Bilodeau C, Hyster TK, Synergistic photoenzymatic catalysis enables synthesis of α-tertiary amino acids using threonine aldolases. J. Am. Chem. Soc 146, 13754–13759 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Cheng L et al. , Stereoselective amino acid synthesis by synergistic photoredox-pyridoxal radical biocatalysis. Science 381, 444–451 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Wang T-C et al. , Stereoselective amino acid synthesis by photobiocatalytic oxidative coupling. Nature 629, 98–104 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Xu Y et al. , A light-driven enzymatic enantioselective radical acylation. Nature 625, 74–78 (2024). [DOI] [PubMed] [Google Scholar]
  • 32.Trimble JS et al. , A designed photoenzyme for enantioselective [2+2] cycloadditions. Nature 611, 709–714 (2022). [DOI] [PubMed] [Google Scholar]
  • 33.Sun N et al. , Enantioselective [2+2]-cycloadditions with triplet photoenzymes. Nature 611, 715–720 (2022). [DOI] [PubMed] [Google Scholar]
  • 34.Zhang J et al. , Enantiodivergent radical alkylation by synergistic Lewis-acid-enzyme and photoredox catalysis. Angew. Chem. Int. Ed 64, e202500338 (2025). [DOI] [PubMed] [Google Scholar]
  • 35.Chan AY et al. , Metallaphotoredox: The merger of photoredox and transition metal catalysis. Chem. Rev 122, 1485–1542 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Gibson DG et al. , Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 6, 343 (2009). [DOI] [PubMed] [Google Scholar]
  • 37.Kille S et al. , Reducing codon redundancy and screening effort of combinatorial protein libraries created by saturation mutagenesis. ACS Synth. Biol 2, 83–92 (2013). [DOI] [PubMed] [Google Scholar]
  • 38.Reetz MT, Carballeira JD, Iterative saturation mutagenesis (ISM) for rapid directed evolution of functional enzymes. Nat. Protoc 2, 891–903 (2007). [DOI] [PubMed] [Google Scholar]

RESOURCES