Cell autonomous control of CAR signaling and receptor shedding via ADAM17-mediated proteolysis

Jeremy R Bjelajac; Adrià Cañellas-Socias; Preeti Nehra; Kevin Reynolds; Meena Malipatlolla; Naiara Martinez Velez; Diane C Manjarrez; Katie Ho; Peng Xu; Jennifer L Hamad; Sean A Yamada-Hunter; Louai Labanieh; Elena Sotillo; Crystal L Mackall

doi:10.1016/j.cell.2026.04.037

. Author manuscript; available in PMC: 2026 Jun 23.

Published in final edited form as: Cell. 2026 May 15;189(13):3883–3902.e23. doi: 10.1016/j.cell.2026.04.037

Cell autonomous control of CAR signaling and receptor shedding via ADAM17-mediated proteolysis

Jeremy R Bjelajac ^1,^2,³, Adrià Cañellas-Socias ^2,³, Preeti Nehra ², Kevin Reynolds ², Meena Malipatlolla ², Naiara Martinez Velez ², Diane C Manjarrez ², Katie Ho ⁴, Peng Xu ², Jennifer L Hamad ^5,⁶, Sean A Yamada-Hunter ^2,⁷, Louai Labanieh ^2,^8,⁹, Elena Sotillo ^2,³, Crystal L Mackall ^2,^3,^4,^7,^10,^11,^12,^*

PMCID: PMC13286248 NIHMSID: NIHMS2176700 PMID: 42143019

SUMMARY

We sought to endow T cell autonomous regulation of cell surface protein expression by exploiting the conditional proteolytic activity of ADAM17 following T cell activation. Screening of canonical ADAM17 substrates yielded a minimal 15-aa CD62L-derived motif that confers rapid and reversible cleavage of a receptor following T cell activation—termed Activation-Induced Release (AIR). Embedding AIR into tonic-signaling CARs reduced basal CAR expression proportional to the degree of tonic signaling induced, curtailing exhaustion and improving antitumor potency. In non-tonic signaling CARs, AIR decreased activation-induced cell death and enhanced T cell expansion after stimulation. AIR’s modularity supports higher-order logic-gating; AIR-regulated peptide masks enable antigen-dependent unmasking of an EGFR-targeting CAR. Finally, CRISPR knock-in of AIR into endogenous FAS or TGFBR2 endowed them with activation-induced shedding, which enhanced tumor clearance, while preserving signaling in non-activating conditions. AIR is a compact switch that provides fast, autonomous regulation of surface proteins for next-generation cell therapies.

Keywords: CAR, T-cells, Immunotherapy, Cancer, Synthetic biology, Bioengineering, ADAM17, Protease

Graphical Abstract

graphic file with name nihms-2176700-f0001.jpg

In Brief:

AIR, a minimal 15–amino acid motif, enables rapid, activation-dependent shedding of surface receptors through ADAM17, allowing T cells to autonomously tune receptor expression. AIR reduces tonic CAR signaling and exhaustion, limits activation-induced cell death, enables logic-gated antigen recognition, and improves tumor clearance when engineered into CARs or endogenous receptors.

INTRODUCTION

Chimeric antigen receptors, and other synthetic immune receptors, seek to redirect immune cell responses toward specific targets of interest while retaining the power, longevity and control inherent to natural immune responses. CAR T cells mediate impressive clinical results in some settings.^1–11 However when compared to natural T cell receptors, CAR T cells are hampered by a greater propensity for T cell exhaustion,^12–16 a higher antigen density activation threshold,^17,18 and greater cytokine-related toxicities.^19–21 Further, due in large part to variable propensities for antigen independent tonic signaling, engineering individual CAR receptors largely remains a bespoke process requiring extensive trial and error, limiting the efficiency of therapeutic development.^12,22–29 T cells have naturally evolved a wide array of mechanisms to fine tune the quality and duration of signaling to maximize potency while minimizing toxicity. One such circuit is activation induced downmodulation of the T cell receptor, an important cell autonomous mechanism for limiting T cell-derived inflammatory responses.^30–32 Current synthetic receptors largely lack cell intrinsic control circuits and while extensive efforts have been made to remotely control CAR T cells with biologics or small molecules, these approaches are challenging to deploy broadly within the clinical arena.

One natural autonomous control cellular mechanism is protein shedding, a widely conserved process that regulates the abundance of proteins on the cell surface.^33–35 and provides controlled release of hundreds of active molecules, such as growth factors and cytokines from membrane-bound precursors.^36–39 With the goal of mimicking natural activation induced downregulation of TCR signaling, we sought to harness T cell activation dependent proteases to endow cell autonomous regulation of CAR signaling. By profiling activation induced changes in the T cell surfaceome in the presence of a translation inhibitor, we determined that the majority of cell surface proteins conditionally shed by human T cells are regulated by A disintegrin and metalloproteinase 17 (ADAM17), a protease that is conditionally expressed on the surface of T cells following activation of PKCθ.⁴⁰ Through systematic screening of canonical ADAM17 cleavage-sites (ACS), we discovered that genetic insertion of a 15-amino-acid ACS at the membrane proximal site endows cell surface receptors with activation induced shedding via ADAM17 or Activation Induced Release (AIR). Unlike cell circuits regulated via transcription, which manifest slow ON-OFF kinetics, the AIR platform delivers near complete receptor shedding within 30–60 minutes of CAR or αCD3/28 bead-based activation and is essentially completely reversed within 4–8 hours of cessation of the activating stimulus.

Integrating the short AIR module into CAR receptors prone to tonic signaling induced downregulation of basal CAR expression in proportion to the degree of tonic signaling present, thereby providing cell intrinsic tuning for optimal CAR receptor expression levels. This cell intrinsic regulation prevented tonic signaling, diminished exhaustion and enhanced cell potency across a wide array of CARs tested. Moreover, AIR-CD19.28z-CAR T cells, which do not exhibit tonic signaling, manifest improved tumor killing, proliferation and reduced activation induced cell death compared to conventional counterparts. Mechanistically, we found that antigen stimulation of AIR-CD19.28ζ CAR T cells preserves NF-κB while selectively dampening NFAT output relative to conventional CD19.28ζ CARs, suggesting AIR may enhance potency by biasing signaling away from Ca²⁺/NFAT-linked dysfunction and exhaustion programs.

We further employed AIR’s rapid, protein-level regulation to build logic circuits that allow T cells to conditionally target otherwise unsafe antigens and to augment cell potency via activation induced cleavage of FAS and TGF beta receptor 2—all without exogenous drugs or auxiliary transgenes. Collectively, our findings illustrate the power of embedding compact, physiology-inspired control elements into engineered T cells. By precisely integrating a single, fully human 15-amino-acid motif, we achieve autonomous, activation-responsive regulation that dramatically enhances T cell fitness, persistence, and antitumor efficacy. This work exemplifies how strategically designed, minimal genetic modifications can yield outsized therapeutic benefits, opening new avenues for cell-based immunotherapies.

RESULTS

Mapping of Activation-Induced Protein Downregulation Reveals ADAM17 and ADAM10 as Dominant Regulators of the T Cell Surfaceome

To identify proteases that mediate activation induced regulation of cell surface receptors on T cells, we catalogued activation-induced protein shedding in primary human T cells. Using cycloheximide to eliminate transcription-based effects, we measured activation induced changes in surfaceome composition on CD19.28ζ CAR-T cells (Figure 1A). As expected, activation increased surface expression of proteins known to be translated and stored intracellularly prior to stimulation, such as CD69⁴¹ and LAMP-1⁴² (Figure 1B), but decreased expression of the transcriptionally regulated activation markers CD25 and CD44 (SFigure 1A),^43,44 which also serve as substrates for shedding proteases.^45,46 These results confirm that cycloheximide was sufficient to isolate protein-level alterations in surface expression in this system. In toto, activation triggered a significant decrease in surface expression of 30 proteins at 2 hours and 46 proteins at 12 hours (SFigure 1A, Figure 1B, Table S1), including the canonical shed proteins CD62L⁴⁷ and CD27,⁴⁸ as well as several proteins not previously reported to be shed by T cells, such as CD100 and CD162 (Figure 1B, C).

Figure 1. — (A) Workflow to identify proteins up- or downregulated at the cell surface following CD19.28ζ CAR-mediated activation using BioLegend LEGENDScreen^™ (354 PE-conjugated antibodies).

(B) Changes in surface protein expression after 12 hours of stimulation in two donors. CD19.28ζ CAR T cells were cultured for 10 days, pre-treated with 50μM cycloheximide (CHX), and stimulated (green) with plate-bound CD19-ScFv idiotype or isotype control (purple). Significant hits: p<0.05 with log2FC >0.5 (red) or <−0.5 (blue). Data pooled from two donors (n=2).

(C) Histograms from one representative donor (n = 2 biological replicates) depicting the change in surface expression of CD62L, CD100, CD27, CD162.

(D) Forty canonical ADAM10/17 substrates were selected from prior literature.54,55 The N-terminal 25 amino acids proximal to each UniProt-annotated transmembrane domain were cloned into a surface mNeonGreen reporter to assess cleavage. ADAM10 activity was evaluated by comparing AAVS1 vs ADAM10 KO T cells. ADAM17 activity was assessed by comparing stimulated vs unstimulated CD19.28ζ CAR T cells in ADAM17 WT (AAVS1 KO) and KO backgrounds.

(E) Scatter plots showing surface mNeonGreen MFI in unstimulated (X-axis) vs stimulated (Y-axis) CD19.28ζ CAR T cells in ADAM17 WT (left) or KO (right). ACS yielding ≥30% decrease are shown in green; ≥30% increase in pink; no cleavage site control in gray.

(F) Scatter plots of mNeonGreen MFI in ADAM10 KO (Y-axis) vs AAVS1 KO (X-axis) cells. ACS with ≥30% increase are shown in red; ≥30% decrease in cyan.

Based upon transcriptional datasets from resting and activated human T cells,⁴⁹ curated databases^50,51 and manual annotation, we deduced that ADAM17 and ADAM10 were likely responsible for the majority of protein downregulation observed in our screen (SFigure 1C, Top), with several proteins reportedly susceptible to cleavage by either protease (SFigure 1C, Bottom, Table S2A, S2B, S2C). Because ADAM10 constitutively mediates substrate shedding,⁵² while ADAM17 mediates activation-dependent shedding,^37,53 we sought to identify ADAM-17 specific substrates based upon the hypothesis that these cleavage sites could endow activation induced protein regulation for exogenous proteins in human T cells.

Identification of Minimal ADAM10 and ADAM17-Specific Cleavage Sites suitable for Activation Induced Regulation

To identify ADAM17-specific substrates, we selected 40 canonical ADAM10 and/or ADAM17-regulated substrates,^54,55 cloned their 25 amino acid (AA) membrane proximal domains harboring ADAM Cleavage Sites (ACS) into a membrane-bound mNeonGreen reporter and expressed them in CD19.28ζ CAR T cells (Figure 1D). We then measured mNeongreen surface expression before and after CAR stimulation. Fourteen ACS induced >30% decreases in surface mNeonGreen mean fluorescence intensity (MFI) following activation, including those contained within well characterized shed receptors, such as CD62L, TNF-A, TREM2, MUC1, and TNFR1 (Figure 1E, Left, SFigure 1D). To determine whether these ACS require ADAM17 for activation-induced cleavage, we performed the same screen in T cells with genetic ablation of the ADAM17 gene (ADAM17 KO) (Figure 1E, Right, SFigure1E). Of the ACS-responsive ACS tested, three (CD62L, TNF-A, and TREM2) showed no significant change in mNeonGreen expression following stimulation in ADAM17KO cells, consistent with specific regulation by ADAM17.

Among the ADAM17-responsive ACS, we noted lower basal surface mNeonGreen expression when compared to a control containing no ACS (Figure 1E), which we hypothesized could be due to partial constitutive shedding by ADAM10. To test this, we compared basal mNeonGreen expression for each ACS following CRISPR/Cas9-mediated genetic ablation of ADAM10 (ADAM10 KO) or AAVS1 (AAVS1 KO) in CD19.28ζ CAR-T cells (Figure 1F, SFigure 1F). ADAM10 KO substantially increased basal mNeonGreen expression for several ACS (HB-EGF, CD44, TNFRSF1B, NOTCH1, and CD16) relative to AAVS1 cells, confirming a role for ADAM10-mediated cleavage on these sites (SFigure 1G). However, several of the ADAM17 dependent ACS previously identified, including CD62L, TNF-A, and TREM2, displayed no significant differences in basal mNeonGreen expression in ADAM10 vs. AAVS1 KO T cells. Together the data demonstrate that the ACS from CD62L, TNF-A and TREM2 are not cleavable via ADAM10 and are specifically regulated in an activation-dependent manner via ADAM17 and thus are compelling candidates for integration into synthetic receptors to endow activation induced shedding.

CD62L-Derived AIR Receptors Enable Rapid and Robust ADAM17-Dependent Protein Shedding Following T Cell Activation

We next optimized and characterized the Activation Induced Release (AIR) platform, leveraging ADAM17-mediated proteolysis to shed extracellular domains (ECDs) from exogenous proteins. Based on prior results, the CD62L-derived ACS supported high basal expression with robust activation-induced shedding, and was therefore selected as the AIR module. ADAM17 cleaves CD62L between Lys²⁸³ and Ser²⁸⁴,⁵⁶ with efficient shedding requiring close membrane proximity.⁵⁷ To define minimal requirements, we generated AIR-mNeonGreen constructs spanning the CD62L hinge. A 15-amino-acid region containing Lys283–Ser284 was sufficient for efficient cleavage (SFigure 2A). Mutational analysis revealed that truncations (ΔK–S, ΔM–N), deletion of Lys283, or insertion of a rigid spacer (APAPA) markedly reduced shedding, whereas alanine substitutions of cationic residues had minimal impact (Figure 2A–C). These data confirm that precise sequence context and membrane proximity are critical for ADAM17 activity, leading us to adopt the 15-aa ACS for AIR, with ΔM–N as a non-cleavable control (mutAIR).

We next assessed the kinetics of AIR shedding by monitoring AIR-mNeonGreen surface expression throughout a stimulation time course (Figure 2D). Within 30 minutes of stimulation using anti-CD3/28 magnetic beads, AIR cells demonstrated an ~80% reduction in detectable surface mNeonGreen while T cells expressing the largely inactive ΔM-N variant (mutAIR-mNeonGreen) demonstrated negligible changes (Figure 2D,E). Within 4–8 hours of ceasing stimulation, AIR-mNeonGreen T cells re-expressed mNeonGreen at pre-stimulation levels. To validate that the loss of surface mNeonGreen was due to shedding, and not due to alternative degradation or internalization, we analyzed the supernatant of activated mNeonGreen AIR T cells via ELISA and observed rapid accumulation of soluble mNeonGreen throughout stimulation; more so, upon washing cells and removing beads, mNeonGreen secretion dropped precipitously (Figure 2F). Impressively, even after short periods of anti-CD3/28 stimulation (1 hour), AIR surface expression reached pre-stimulation levels within ~8 hours of rest (Figure 2G). Alternatively, longer periods of stimulation resulted in lower rates of AIR shedding (Figure 2H), likely due to a depletion in mature ADAM17, which has been observed throughout periods of long-term T cell activation⁵⁸. We also measured whether AIR shedding efficiency scales with activation mode and stimulus strength. We co-expressed an NY-ESO TCR in AIR–mNeonGreen+ T cells and stimulated them using PMA/ionomycin, CD3/CD28 beads (1:1), or NY-ESO-1 peptide-presenting A375 tumor cells (1:1) (SFigure 2C). After 2 hours of stimulation, AIR-Neongreen and CD62L manifested more homogenous shedding across CD3/CD28 beads and PMA/ionomycin conditions, with lower shedding following A375 stimulation; however, 16 hours of A375 stimulation yielded rates of shedding similar to PMA/ionomycin and CD3/CD28 beads (SFigure 2D). Furthermore, treatment with ADAM17 inhibitor, GW280264X, dramatically reduced rates of shedding for both mNeonGreen and CD62L, further demonstrating AIR’s exclusive dependence on ADAM17. These findings are consistent with a model wherein the magnitude of ADAM17 induced receptor shedding correlates with signal strength.

To assess whether introduction of an AIR receptor interfered with the shedding of canonical ADAM17 substrates, we compared shedding of CD122, CD25, and CD62L in untransduced (Mock) vs AIR-mNeonGreen T cells (Figure 2I). We observed no significant changes in activation-induced receptor downregulation for all measured ADAM17 substrates between Mock and AIR-mNeonGreen T cells, indicating that expression of exogenous AIR-regulated substrates does not attenuate ADAM17’s ability to shed canonical endogenous substrates. To further assess AIR’s exclusive dependence on ADAM17, we stimulated AIR-mNeonGreen T cells in the presence of GW280264X (GW), a mutual ADAM10 and ADAM17 inhibitor vs. GI254023X (GI), an inhibitor which is 100-fold more selective for ADAM10 over ADAM17^59,60. Activation-induced AIR shedding was significantly attenuated in the presence of the ADAM10/17 inhibitor GW, while remaining unchanged in the presence of ADAM10 inhibitor GI, consistent with a model wherein the AIR platform delivers cell surface regulation mediated essentially entirely by ADAM17 (Figure 2J).

Tonic Signaling AIR-CARs Manifest Diminished Exhaustion, Enhanced T-Cell Fitness and Antitumor Activity

Previous work demonstrated that CAR T cell potency is often limited by aggregation of CAR receptors, leading to chronic antigen-independent T cell activation, exhaustion and dysfunction^12,61,62. We reasoned that AIR-mediated shedding of tonically signaling CARs could provide a cell autonomous regulatory circuit whereby CAR clustering-induced activation leads to CAR shedding, attenuating chronic activation and preventing T cell exhaustion. To test this, we generated AIR and cleavage-deficient (mutAIR) forms of HA.28ζ (Figure 3A), a high-affinity GD2-targeting CAR that induces functional, and epigenetic hallmarks of T cell exhaustion via tonic signaling^61,62. To normalize for transduced cell frequency, DNA vectors for each CAR construct contained a truncated NGFR (NGFRt) expressed via fusion with a P2A peptide (SFigure 3A). When expressed in T cells, AIR-HA.28ζ demonstrated markedly lower surface CAR expression when compared to mutAIR and conventional HA.28z (Figure 3B,C) To validate that this downregulation in CAR expression was dependent upon HA.28ζ-mediated tonic signaling, AIR-HA.28ζ CAR T cells were treated with Dasatinib, a broad-spectrum Src Kinase inhibitor that potently inhibits T cell activation (Figure 3D)⁶³. Dasatinib treatment resulted in substantial upregulation of CAR surface expression in AIR-HA.28ζ, while conventional HA.28ζ CAR T cells were largely unaffected. Similarly, TAPI-1, a potent ADAM17 inhibitor, induced dose-dependent increases in surface AIR- HA28ζ CAR expression (SFigure 3B, C) associated with increased cell activation as evidenced by upregulation of CD25 and CD69 (SFigure 3D). Additionally, we used confocal microscopy to assess the distribution of CAR molecules on the surface and found that AIR-HA.28ζ CAR T cells exhibited significantly fewer clusters of CARs at baseline compared to HA.28ζ (Figure 3E, SFigure 3E, F), while AIR-regulated and conventional CD19.28ζ displayed no change in CAR clustering. These data indicate that tonic signaling-driven activation of ADAM17 can be utilized in a cell autonomous manner to regulate deleterious cell-intrinsic CAR expression.

Figure 3. — **(A)** Schematic of tonic signaling-driven exhaustion in HA.28ζ CAR T cells (left) and the proposed effect of AIR regulation (right).

**(B)** Histograms showing surface expression of conventional (red), mutAIR (pink), and AIR (blue) HA.28ζ CARs in primary T cells.

**(C)** Fold change in CAR MFI across HA.28ζ variants, normalized to conventional CAR.

**(D)** Effect of 48 h treatment with Dasatinib (1 μM, dotted) or DMSO (solid) on CAR surface expression in conventional (left) and AIR (right) HA.28ζ CAR T cells.

**(E)** Variability in CAR surface expression assessed by confocal microscopy. Top: coefficient of variation (CV; SD/mean pixel MFI) from n=15 cells. Bottom: representative images. Surface staining used Alexa Fluor 647-conjugated anti-CD19- or anti-GD2-scFv idiotype.

**(F)** Surface phenotyping of HA.28ζ CAR T cell variants at day 14 of culture.

**(G)** Experimental design: 3×10⁶ CAR T cells infused IV into NSG mice 4 days after engraftment of 1×10⁶ GFP⁺/ffluc⁺ Nalm6-GD2 leukemia cells.

**(H)** Tumor burden (bioluminescence), survival, weight, and circulating human T cells (day 12 post-engraftment) in blood of NSG mice.

**(I)** Representative tumor BLI images over time. (G–I) Data reproduced in two independent experiments with different donors. [(D)] Representative experiment from two independent experiments (n = 2 donors). [(B), (C), (F)] Experiments were performed in three independent experiments with n = 3 different donors. [(C), (E), (F), (H)] Two-tailed unpaired Student’s t test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

We next asked whether AIR-HA.28ζ-mediated down-modulation of CAR surface density could mitigate hallmark features of exhaustion and enhance T-cell performance^12–14. In vitro, AIR-HA.28ζ cells proliferated more robustly, maintained higher viability, and secreted more IL2 in response to antigen than both conventional and mutAIR counterparts (SFigure 3G, H, I). Despite their lower CAR expression, we hypothesized that AIR-HA.28ζ CAR T cells could secrete more cytokine than the conventional version by lowering rates of exhaustion. To validate this, we performed phenotypic profiling and found that AIR-HA.28ζ displayed attenuated basal activation (lower CD69 and CD25), a pronounced reduction in exhaustion markers (CD39, TIM-3, LAG-3, PD-1), accompanied by an enrichment of the stem-cell memory marker CD62L (Figure 3F, SFigure 4A). AIR-HA.28ζ T cells also mediated enhanced tumor control in vitro (SFigure 4B) and in vivo (Figure 3G–I, SFigure 4C); in NSG mice bearing Nalm6-GD2 leukemia, AIR-HA.28ζ T cells displayed enhanced tumor clearance, extended survival of mice, and proliferated significantly more than conventional and mutAIR T cells. Collectively, these findings demonstrate that AIR mediated regulation of CAR T cell receptors greatly diminishes tonic-signaling of CAR-T cells, resulting in improved proliferation, viability, cytokine production, and antitumor activity.

AIR-regulation of HA.28z CAR recapitulates pharmacologically induced “rest” in vitro

Prior studies have demonstrated that transient rest induced via small molecule mediated inhibition of T cell signaling can epigenetically reinvigorate exhausted CAR T cells and improve functionality⁶². We hypothesized that AIR regulation could provide intermittent rest in a cell autonomous manner and thereby enhance CAR T cell potency. To test this, we compared the broad changes in protein and RNA expression of untreated and Dasatinib-rested HA.28z CAR T cells versus AIR-HA.28z CAR T cells via bulk RNA sequencing (RNAseq) and Cytometry by Time-of-Flight (CyTOF), respectively (Figure 4A). Unbiased principal components analysis (PCA) of RNAseq for each condition displayed significant overlap between Dasatinib treated HA.28z and AIR-HA.28z CAR T cells, which separated from HA.28z and mutAIR-HA.28z cells along principal component 1 (PC1), illustrating that AIR regulation and Dasatinib treatment resulted in similar transcriptomic reprogramming (Figure 4B). Hierarchical clustering of the top 100 genes driving PC1 variance identified exhaustion-related markers (PDCD1, ENTPD1, LAG-3, and ZBED2) and memory-associated genes (IL7R, CD44, KLF2, and ADA2)^61,64,65 (Figure 4C). When contrasted with HA.28ζ, AIR-HA.28ζ and Dasatinib-rested HA.28ζ CAR T cells were highly concordant, sharing ~78% of differentially expressed genes (DEGs) between the two conditions (Figure 4D,E). Similarly, unbiased clustering of AIR-HA.28z and Dasatinib treated CAR T cells analyzed via mass cytometry did not demonstrate significant proteomic distinctions across multiple donors (Figure 4E). AIR-HA.28z CAR T cells display significantly lower expression of proteins associated basal activation (pNFkB, pS6, OX40), and higher expression of memory associated CD127 (IL7Ra) when compared to HA.28z, as seen in prior reports using intermittent rest^62,63 (Figure 4F,G). AIR-HA.28 ζ also displayed lower expression of cell death-associated proteins (CD95, active-Caspase 3, active-Caspase 7). Together, the data provides convincing evidence that ADAM17 mediated cleavage of CAR T cell receptors via the AIR platform provides cell autonomous regulation of tonic signaling in CAR T cells and offers a potential alternative to pharmacological-mediated inhibition of tonic signaling to prevent exhaustion.

Figure 4. — **(A)** Conventional, AIR, and mutAIR HA.28ζ CAR T cells were generated from three healthy donors and treated with DMSO or Dasatinib for 7 days before being analyzed by CyTOF or bulk RNA sequencing.

**(B)** Principle component analysis (PCA) plot of bulk RNA-seq data from representative conditions.

**(C)** Heatmap and hierarchical clustering of the top 100 genes driving PC1, which identified clusters of exhaustion- and memory-associated genes enriched or depleted in HA.28ζ and mutAIR-HA.28ζ, respectively.

**(D)** Volcano plots depicting the significantly (P<0.05, Log2 Fold Change >1, or Log2 Fold Change <−1) upregulated or downregulated genes in Dasatinib treated (Left) or AIR-HA.28ζ (Right) relative to HA.28ζ CAR T cells.

**(E)** Venn Diagram of differentially expressed genes (DEGs) from Volcano Plots for Dasatinib treated (Red) and AIR-HA.28ζ (Blue) vs. HA.28ζ.

**(F)** UMAP analysis of Mock, HA.28ζ, HA.28ζ +Das., and AIR-HA.28ζ cells from three donors. Expression of 36 protein markers was analyzed via CyTOF. Individual donors are displayed and colored by cell conditions (Left). HA.28ζ and AIR-HA.28ζ from all donors are plotted together (Right) and colored by condition, or by **(G)** marker intensity.

AIR Improves Expansion and Potency of Non-Tonic Signaling CD19.28ζ CAR-T Cells

To determine whether AIR enhances CARs that do not tonically-signal, we engineered wild type (WT), mutAIR, and AIR-CD19.28ζ variants (Figure 5A). All displayed comparable baseline CAR expression (Figure 5B), indicating antigen-independent AIR shedding is restricted to tonic CARs. Upon coculture with CD19⁺ Nalm6 leukemia, however, AIR CD19.28ζ T cells downregulated surface CAR more rapidly and completely than WT or mutAIR cells (Figure 5C), enabling prompt antigen disengagement; this effect was also inhibited by GW, confirming ADAM17 dependence. We believe that this rapid “off-switch” more closely parallels native TCR downregulation³¹, as well as scFvs reported to display rapid off-rate kinetics, which are associated with limited toxicity and enhanced T cell persistence^66,67. We thus tested whether antigen induced CAR shedding via AIR enhances T cell potency and tumor clearance in serial rechallenge assays. AIR-CD19.28ζ T cells demonstrated superior tumor killing against both CD19-expressing 143b osteosarcoma (SFigure 5A) and Nalm6 (Figure 5D), while also expanding more robustly and maintaining a less-exhausted phenotype—as measured via higher CD62L, and lower CD39 expression—relative to WT and mutAIR cells (Figure 5E).

Interestingly, AIR-CD19.28ζ T cells produced less IL-2 during short-term tumor coculture than conventional CD19.28ζ cells (SFigure 5B), prompting investigation into alternative mechanisms underlying AIR’s improved tumor control. Given reduced cell death–associated proteins in AIR-HA.28ζ CARs (Figure 4G), we assessed whether AIR may be inducing alterations in rates of activation-induced cell death (AICD). Following Nalm6 stimulation, AIR-CD19.28ζ T cells exhibited significantly fewer Annexin V⁺ cells despite comparable CD69 expression (Figure 5F). Consistently, AIR cells showed reduced Propidium Iodide (PI) uptake (SFigure 5C), along with increased viability during chronic stimulation (Figure 5G; SFigure 5D) and decreased caspase activity without altered NF-κB signaling (Figure 5H; SFigure 5E). Functionally, AIR-CD19.28ζ T cells expanded more robustly following stimulation (SFigure 5F) and displayed enhanced proliferation in coculture assays despite similar tumor killing (SFigure 5G). Mechanistically, AIR seemed to preserve NF-κB activity while reducing NFAT signaling, with ADAM17 inhibition restoring NFAT output (Figure 5I; SFigure 5H). NFAT output is strongly shaped by the intensity of calcium flux,⁶⁸ indicating that AIR-based CAR shedding preferentially dampens NFAT-biased signaling, potentially skewing differentiation away from exhaustion-like programs.^61,69 Together, these findings demonstrate that AIR mediated CAR shedding limits the duration of signaling in response to antigen, diminishes the rate of AICD, enhances the magnitude of the proliferative response and enhances antitumor potency.

Given that AIR downregulates surface CAR expression following activation, we assessed whether this impairs function against low antigen density tumors. Using GFP-labeled Nalm6 clones expressing graded ROR1 levels (SFigure 6A), we compared AIR, mutAIR, and conventional ROR1.28ζ CAR T cells. Consistent with CD19 models, AIR ROR1.28ζ T cells produced less IL-2 and IFNγ (SFigure 6B), yet more effectively cleared HIGH and VERY HIGH ROR1 targets, with comparable activity across LOW and MEDIUM antigen densities (SFigure 6C). These data indicate that AIR preserves function at low antigen levels while enhancing clearance at high antigen density. We next asked whether shed scFv from AIR CD19 CAR T cells could mask antigen and impair cytotoxicity. Supernatants from activated AIR-CD19-V5 CAR T cells bound CD19 on Nalm6 (SFigure 6E), but did not significantly reduce antigen availability or impair killing by CD19.BBζ CAR T cells (SFigure 6F). Even high concentrations of recombinant AIR scFv had minimal impact on cytotoxicity (SFigure 6G,H). Together, these results indicate that shed scFv has negligible functional impact on antigen accessibility or CAR-mediated tumor clearance.

AIR Enhances Potency Across a Range of Clinically Relevant CARs

Building on our finding that AIR prevents tonic-signaling–driven exhaustion and limits activation-induced cell death, we sought to determine the utility of incorporating AIR regulation across a variety of clinically relevant CARs, many of which demonstrate some degree of tonic signaling^70,71. Based upon the hypothesis that higher levels of tonic signaling would associate with greater AIR induced CAR downregulation as measured by an AIR downregulation ratio (ADR = AIR CAR MFI divided by conventional CAR MFI), we assessed the surface CAR density of AIR vs. matched conventional constructs and observed the lowest ADR in the highly tonically signaling AIR-HA-28ζ CAR (Figure 6A,B, SFigure 7A, Table S3), and highest ratio in the low-tonic signaling CD19.28ζ construct, with most CARs displaying intermediate degrees of AIR-dependent downregulation that paralleled their basal NF-κB activity (SFigure 7B). As expected, CARs with lower ADRs (high tonic signaling CAR) showed lower levels of CD62L at baseline for the conventional version, but this relationship was abrogated in AIR-regulated versions, indicating that AIR-regulation enables cell-autonomous differential recalibration of T-cell activation-induced differentiation (Figure 6C). Extending the analysis to a broader panel of activation and early-exhaustion markers (CD69, CD25, CD39, TIM-3, LAG-3, PD-1) and transcription-factor reporters (NF-κB and NFAT) revealed the same pattern: in conventional CARs, activation marker expression inversely tracked with ADR, whereas AIR-CAR counterparts showed little or no correlation (Figure 6D, SFigure 7C).

Figure 6. — **(A)** Histograms depicting surface expression of multiple AIR-regulated (Blue) or conventional (Red) CARs

**(B)** *AIR downregulation ratio* (ADR = conventional CAR MFI divided by AIR-CAR MFI) was calculated and plotted as a bar graph for each CAR. Data shown are mean ± SD of n = 3 experimental replicates.

**(C)** CD62L expression from all conventional (Left) or AIR (Right) CARs plotted vs. respective ADR. Pearson correlation coefficients (R²) and p values were calculated using triplicate MFI values for all conventional and AIR CARs tested (7 conventional, 7 AIR CARs).

**(D)** R² values for activation marker expression (CD69, CD39, CD25, LAG-3, PD-1, NFKB, NFAT) vs. ADR for conventional and AIR-regulated CAR T cells. Data shown are from one representative donor (n = 2) and are mean of n = 7 CAR T cell conditions.

**(E)** NSG mice were injected intravenously with 1×10⁶ Nalm6-GD2 leukemia and treated with 1.5×10⁶ AIR and conventional versions of GD2.28z and GD2.BBz 4 days after tumor infusion (n = 5 mice). Survival (Right) and quantification of tumor growth by bioluminescent imaging (Bottom) of CAR-treated mice shown in (E).

**(F)** Tumor area of NSG mice injected orthotopically with 1×10⁶ 143B osteosarcoma cells and treated 3 days later with 5 ×10⁶ non-transduced, or AIR- or conventional HER2.28z CAR T cells. [(A-D)] Representative experiment from two biological replicates (n = 2 donors). [D] R² calculated via simple linear regression used on data from three independent experiments (representative donor shown of n = 2 independent donors). [D] Two-tailed unpaired Student’s t test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. [(E), (F)] **P < 0.01, **P < 0.001; log-rank Mantel-Cox test, n = 5 mice per group).

To further evaluate whether AIR-regulated CARs outperform conventional CARs, we tested GD2- and HER2-directed CAR-T cells in orthogonal xenograft models. Firstly, NSG mice bearing Nalm6-GD2 leukemia received CAR-T infusion four days after tumor inoculation (Figure 6E). AIR-engineered GD2.28ζ and GD2.BBζ cells achieved more robust tumor clearance and significantly prolonged survival compared with their conventional counterparts. A similar benefit was observed in a solid-tumor model: mice engrafted with 143B osteosarcoma and treated with AIR-HER2.28ζ CAR-T cells displayed superior tumor control and extended survival (Figure 6F). These data demonstrate that the AIR architecture enhances antitumor efficacy across CAR designs, independent of each receptor’s intrinsic tonic-signaling propensity. By enabling cell-autonomous, protease-mediated modulation of surface CAR density, AIR equilibrates T-cell activation states and mitigates activation-associated dysfunction, thereby improving therapeutic potency.

Generation of rapid combinatorial antigen logic gates using AIR-regulated CAR Masking

To expand AIR’s utility beyond self-regulating CAR expression, we reasoned that AIR’s rapid protein-level regulation would make it an attractive mechanism to generate IF-THEN logic gates for targeting promiscuous antigens. As a proof of concept, we sought to control activity of a cetuximab-based EGFR CAR (EGFR.28ζ). We utilized a engineered peptide “mask”^72,73 that blocks the scFv–EGFR interaction and displayed this mask in trans on a separate transmembrane receptor containing the CD62L-derived ADAM17 cleavage site (AIR-Mask.28ζ) (SFigure 8A). Initial co-expression of EGFR.28ζ and AIR-Mask.28ζ produced weak-to-undetectable masking (SFigure 8B), so we forced co-localization of AIR-Mask and EGFR-Scfv by fusing complementary high-affinity leucine-zipper domains to the C-termini of the CAR and mask receptors, respectively (EGFR.28ζ-ZZ[A] and AIR-Mask.28ζ-ZZ[B])⁷⁴ (Figure 7A). In CD19 CAR-T cells co-expressing EGFR.28ζ-ZZ[A] and AIR-Mask28ζ-ZZ[B], the EGFR scFv was almost completely occluded at baseline in receptors containing the zipper pair in several orientations (SFigure 8C), but brief priming through a co-expressed CD19 CAR triggered ADAM17-dependent shedding of the mask, restoring nearly full scFv accessibility to a level comparable with an unmasked EGFR.28ζ (Figure 7B). To assess whether this AIR-Masking system could enable cells to conditionally target EGFR+ cells only following engagement with CD19 antigen (Figure 7C), we co-cultured these T cells with different combinations of CD19 and EGFR expressing A375 melanoma cells. AIR-Masked-CAR T cells eradicated A375-EGFR+ targets only in the presence of A375-CD19+ “priming” cells, whereas A375-EGFR+ targets remained unharmed in CD19-depleted cultures (Figure 7D). Non-AIR-regulated masks, by contrast, blocked killing irrespective of priming. These data demonstrate that AIR can be repurposed from a self-regulatory module to generate rapid, antigen-gated logic circuits, expanding its utility well beyond mitigation of tonic signaling and activation-induced cell death. To enhance the relevancy of this platform, we validated its utility in targeting a more relevant antigen pair (HER2 and EGFR) and validated the ability of HER2 CAR+ AIR-Mask+ EGFR.28ζ+ T cells to conditionally eliminate EGFR+ Nalm6 only in the presence of HER2+ Nalm6 (SFigure 8D, E).

Figure 7. — **(A)** Schematic of AIR-mediated, CD19-dependent unmasking of an EGFR.28ζ CAR. T cells co-express a CD19.28ζ priming CAR, an HA-tagged EGFR.28ζ fused to leucine zipper ZZ(A), and a FLAG-tagged AIR-regulated Mask receptor fused toa complementary leucine zipper ZZ(B).

**(B)** Histograms showing unmasked EGFR-scFv before and after 2 h stimulation with CD19+ Nalm6. Unmasking was measured by Alexa Fluor 647-conjugated EGFR-Fc staining; dotted line indicates gating.

**(C)** Conceptual model of AIR-masking to conditionally target EGFR+ tumor cells. EGFR expressing cells will not be targeted by AIR-Maked CAR T cells in the absence of CD19 expressing cells (Left), but when CD19 expressing targets are present (Right), CD19 CAR engagement enables AIR-mediated unmasking of the EGFR.28ζ and subsequent cytotoxicity of EGFR+ targets.

**(D)** Cytotoxicity of engineered T cells against mixed EGFR+/CD19+ (green) and EGFR+/CD19− (gray) A375 cells (E:T 1:2). Data normalized to t=0; statistics at 72 h.

**(E)** Depiction of genomic engineering strategy to integrate AIR regulation into the FAS locus (Left) and the resulting proteins for each (Right).

**(F)** Histograms depicting surface FAS (Left) or CD62L (Right) on AAVS1-KO, FAS-KO, or AIR-FAS T cells prior to or following stimulation with PMA/Ionomycin.

**(G)** Cytotoxicity of AAVS1-KO, FAS-KO, or AIR-FAS CD19.BBζ (left) and HA-28ζ (right) CAR T cells against GD2/CD19+ Nalm6 (E:T 1:4). Data normalized to t=0; statistics at 420 h (CD19.BBζ) and 320 h (HA-28ζ).

**(H)** Depiction of genomic engineering strategy to integrate AIR regulation into the TGFBR2 locus (Left) and the resulting proteins for each (Right).

**(I)** Intracellular pSMAD2/3 levels in AAVS1-KO (purple), AIR-TGFBR2 (blue), or TGFBR2-KO (gray) T cells under no stimulus, as well as TGFβ (5 ng/mL), or TGFβ plus CD3/CD28 stimulation. Dotted line indicates gating.

**(J)** Cytotoxicity of GD2.BBζ T cells (AAVS1-KO, AIR-TGFBR2, or TGFBR2-KO) against 143b osteosarcoma with or without TGFβ (5 ng/mL). Data normalized to t=0; statistics at 205 h. [(B)] Data from one representative donor shown (n = 2 independent donors tested). [(D),(G),(J)] Data shown are mean ± S.D. of three triplicate wells. [(D), (G), (J)] Two-tailed unpaired Student’s t test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Utilizing AIR to Efficiently Rewire Regulation of Endogenous Proteins

Encouraged by AIR’s modularity, we sought to engineer endogenous receptors to endow them with activation-dependent surface expression as a means of inhibiting deleterious signaling pathways that limit CAR T persistence. Using ADAM17cs-containing single-stranded oligodeoxynucleotide (AIR-ssODN) repair templates combined with CRISPR-Cas9 ribonucleoprotein (RNP) complexes, we introduced high-efficiency, precise nucleotide insertions at several endogenous loci in primary T cells through homology-directed repair (HDR)⁷⁵. As a proof of concept, we sought to implement AIR regulation onto endogenous FAS (CD95) (Figure 7E); While ablation of FAS has been found to enhance T cell anti-tumor activity during chronic antigen exposure^76,77, somatic mutations inhibiting FAS-induced apoptosis of lymphocytes is a principal feature of the autoimmune lymphoproliferative syndrome (ALPS)^78,79. As such, we sought to endow cell autonomous control of FAS shedding to diminish the rate of activation induced cell death while avoiding risks associated with constitutive FAS knockout. Following electroporation, we observed highly efficient KO of FAS and KI of the ADAM17cs (SFigure 8F,G Left). T cells edited to carry the ADAM17cs within the endogenous FAS locus (AIR-FAS) displayed wild-type levels of surface FAS at rest. Upon stimulation with PMA/Ionomycin, however, FAS was rapidly shed to a similar extent observed in FAS-KO cells, whereas CD62L shedding remained unchanged across all groups (Figure 7F). More so, CD19.BBζ and HA-28ζ CAR T cells expressing AIR-FAS demonstrated enhanced tumor killing in serial Nalm6 rechallenge assays, similar to that seen in cells with full FAS deletion (Figure 7G).

Disrupting TGF-β signaling by ablating TGFBR2 can improve CAR-T persistence in vivo^80,81, yet constitutive loss of the receptor can aggravate autoimmunity⁸². As such, we sought to endow cell autonomous control of TGFBR2 shedding via AIR regulation (Figure 7H). T cells expressing AIR-TGFBR2 displayed induction of pSMAD2/3 in proportion to editing efficiency following addition of soluble TGF-β (SFigure 8G, Right); however, activation of T cells prior to exposure to soluble TGF-β resulted in near-undetectable increases in pSMAD2/3 over TGF-β -absent conditions (Figure 7I). During serial re-challenge against 143B osteosarcoma, GD2.BBζ CAR-T cells expressing AIR-TGFBR2 controlled tumors as effectively as wild-type or TGFBR2-knockout cells under basal conditions. Crucially, addition of exogenous TGF-β severely impaired tumor clearance by wild-type, and even TGFBR2-KO—CAR-T cells, whereas AIR-TGFBR2 cells exhibited more potent antitumor activity (Figure 7J). Together, these findings demonstrate that AIR can be seamlessly grafted onto endogenous checkpoint receptors, furnishing a stimulus-responsive “safety valve” that silences pro-apoptotic or immunosuppressive signaling only during activation, thereby boosting CAR-T persistence within the confines of a gated circuit to prevent uncontrolled activation.

DISCUSSION

Chimeric antigen receptor (CAR) T cell therapy has demonstrated remarkable efficacy in hematologic malignancies and is expanding into solid tumors and autoimmune disease.^{10,11,83–86} However, progress is limited by suboptimal potency and toxicity, and CAR design remains an empirical, labor-intensive process. Each new scFv must be optimized across multiple configurations to balance antigen recognition with physiologic signaling, with suboptimal designs often inducing tonic signaling, exhaustion, and reduced persistence.^24,26–28 While high-throughput and computational approaches aim to streamline this process, gains are often context-specific and fail to generalize across CARs. Here, we show that insertion of a minimal 15–amino acid human motif enables CARs to engage an endogenous regulatory mechanism that autonomously tunes receptor expression in proportion to signaling strength. This cell-intrinsic control improves function independent of antigen specificity and provides a generalizable strategy to streamline CAR engineering. Moreover, AIR functions as a modular regulatory element that enables advanced cellular logic without the need for exogenous transgenes or small molecules.

T cell exhaustion remains a major barrier to CAR T cell efficacy.^{12–14,87,88} Strategies to mitigate exhaustion, such as scFv optimization, anti-exhaustion modules, regulated degradation, and drug-controlled systems, have shown variable success and often introduce additional complexity or immunogenicity.^61,62,89 Multi-layered synthetic circuits (e.g., SynNotch⁹⁰, SNIPR⁹¹, SUPRA⁹² and others⁹³) provide flexible logic but increase vector size and slow response kinetics. In contrast, AIR leverages endogenous protease activity to regulate CAR function autonomously, enabling rapid, protein-level control that parallels native TCR downregulation while avoiding exogenous control systems.

AIR builds on protein shedding, a conserved mechanism regulating surface protein abundance across hundreds of substrates.^33,34,39,50 However, defining cleavage requirements in native contexts has been challenging due to dependence on membrane-proximal motifs and protease localization.^94,95 By profiling activation-induced surfaceome changes, we identified ADAM17 as the dominant regulator of activation-dependent shedding and discovered that insertion of a CD62L-derived motif confers robust, activation-dependent cleavage. When applied to tonic signaling CARs, AIR reduced surface expression proportionally to signaling intensity, with effects reversed by ADAM17 inhibition. AIR-regulated CAR T cells exhibited reduced exhaustion, improved expansion, and enhanced in vivo antitumor activity. Notably, AIR recapitulated the effects of pharmacologic “rest” induced by Src kinase inhibition, but through intrinsic autonomous regulation.

Strikingly, AIR also enhanced function in a non-tonic signaling CD19.28ζ CARs, improving tumor control, proliferation, and cell health following repeated stimulation. AIR-mediated downregulation following activation reduced activation-induced cell death and preserved signaling balance. This data is in line with evidence that CD19 CARs manifesting a fast off rate^66,67 demonstrated enhanced T cell potency, improved engraftment and reduced toxicity. AIR-CD19.28ζ also maintained NF-κB signaling while dampening NFAT induction. Given the association of sustained NFAT signaling with exhaustion programs, these findings suggest AIR may bias signaling toward productive activation states.^61,69,96

Beyond CAR regulation, AIR functions as a broadly deployable regulatory motif. AIR-mediated masking enabled rapid IF–THEN logic gating, where CD19 priming triggered ADAM17-dependent unmasking of an EGFR CAR, allowing selective targeting of EGFR⁺ cells only in the appropriate antigen context. AIR also enabled precise rewiring of endogenous receptors: AIR-FAS preserved baseline expression but induced activation-dependent shedding, recapitulating the benefits of FAS deletion while mitigating autoimmune risk. Similarly, AIR-TGFBR2 maintained baseline responsiveness but conferred resistance to immunosuppressive TGF-β during activation, enhancing tumor control beyond TGFBR2 knockout, likely through sequestration of soluble ligand.

The AIR platform debuted here illustrates the power of mining and co-opting native biology, rather than building ever-larger synthetic circuits, to achieve sophisticated control of engineered T cells. Instead of integrating arrays of auxiliary or synthetic transgenes to improve CAR signaling, we sought to define how endogenous proteases remodel the T-cell surface during activation. Proteome-wide screening in this physiologic context revealed that two enzymes, ADAM10 and ADAM17, dominate activation-induced shedding. By distilling ADAM17’s activity down to a 15-residue hinge motif, we tapped directly into a pre-existing, highly tuned regulatory network and converted it into a modular switch for both transgenic and endogenous receptors. This strategy highlights a general design principle, wherein deliberate interrogation of natural signaling pathways can uncover minimal elements that repurpose the cell’s own machinery, yielding compact, rapid and immunologically harmonious solutions than endow de-novo synthetic logic.

Limitations of the study

While we show that AIR regulation confers rapid, activation-dependent control of engineered receptors, this performance is inherently coupled to the magnitude and context of T cell activation; accordingly, we observe graded shedding across distinct stimuli and reduced shedding after prolonged stimulation, consistent with stimulus-dependent constraints on ADAM17 availability. Additionally, while the AIR motif is derived from a human protein fragment, its insertion into synthetic and endogenous receptors could potentially yield non-native splice sites that, if presented on an MHC, could potentially be perceived as immunogenic. Mechanistically, our dependence experiments rely heavily on pharmacologic metalloprotease inhibitors rather than comprehensive genetic dissection and thus cannot fully exclude context-specific contributions from additional proteases or compensatory mechanisms. In addition, NFAT/NF-κB reporter readouts provide a useful transcriptional proxy but do not directly resolve upstream signaling dynamics may underlie AIR-biased signaling outputs. Although we tested soluble scFv shedding and found minimal impact on subsequent CAR killing under our assay conditions, these experiments cannot rule out antigen masking in other antigen-density or affinity contexts. Finally, in vivo efficacy and persistence were evaluated in only several different NSG xenograft models, which do not capture key features of human immunity (endogenous cytokine milieus, myeloid regulation, antigen spread, or on-target/off-tumor toxicities), and therefore the translational impact of AIR regulation on safety and durability will require validation in more immunocompetent or humanized systems and ultimately in clinical settings.

RESOURCE AVAILABILITY

Lead contact

Requests for further information and resources should be directed to and will be fulfilled by the lead contact, Crystal Mackall, MD (cmackall@stanford.edu).

Materials availability

Plasmids generated in this study can be made available on request.

Data and code availability

RNA-seq data have been deposited at GEO at GEO:GSE328715 and are publicly available as of the date of publication.
This paper does not report original code.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

STAR★METHODS

Cell lines

The Nalm6 B-ALL cell line was provided by David Barrett (Children’s Hospital of Philadelphia) and retrovirally transduced to express GFP and firefly luciferase (N6-GL). All Nalm6-GL lines used in this study were made via retroviral or lentiviral transduction of cDNA encoding the antigen/protein of interest (HER2, B7H3, ROR1, GD2). Clones of Nalm6-GL expressing variable human ROR1 (Nalm6-ROR1) were generated from single cell clones isolated from the transduced population⁹⁹. GD2 expression on Nalm6-GD2 was achieved using with lentiviral constructs expressing B4GALNT1 (GD2 synthase) and ST8SIA1 (GD3 synthase). 143B osteosarcoma cells (ATCC) were retro- virally transduced with GFP and luciferase (143B-GL). A375 melanoma cells were transduced with either GFP-luciferase, or cDNA encoding hCD19 and GFP-luciferase. EGFR was then genetically ablated via CRISPR/Cas9 gene editing on A375 cell lines. All engineered cells were sorted based on transgene expression via FACS. Nalm6, 143B, and A375 were cultured in RPMI-1640 (Gibco). 293GP were cultured in DMEM (Gibco). Cell line culture media was supplemented with 10% FBS, 10mM HEPES, 2mM L-glutamine, 100 U/mL penicillin, and 100mg/mL streptomycin (Gibco). STR DNA profiling of all cell lines was conducted once per year (Genetica Cell Line testing). All cell lines were routinely tested for mycoplasma. Cell lines were cultured at 37 C in a 5% CO2 environment.

Animal models

NSG mice (NOD.Cg-Prkdc^scid Il2rgt^m1Wjl/SzJ) were purchased from the Jackson Laboratory and bred in house under Stanford University APLAC-approved protocols. Healthy male and female mice were used for in vivo experiments between 6 and 10 weeks old at tumor engraftment and were drug naïve and not involved in previous procedures. Mice were housed in sterile cages in a barrier facility at Stanford University with a 12-hour light/dark cycle. Veterinary Services Center (VSC) staff at Stanford University monitored the mice daily and were euthanized when mice manifested persistent hunched posture, persistent scruffy coat, paralysis, impaired mobility, greater than 20% weight loss, if tumors significantly interfered with normal bodily functions, or if they exceeded limits designated in APLAC-approved protocols. Per recommendation by VSC staff, mice with morbidities were supported with 500mL subcutaneous saline, diet gel (DietGel 76A, ClearH2O), and wet chow.

Source of primary human T cells

Leukapheresis products (Leukopaks) from healthy donors were purchased from the Stanford Blood Center or Stem Cell Technologies under an IRB-exempt-protocol. Primary human T cells were purified by negative selection using the EasySep^™ Human T Cell Isolation Kit (Stem Cell Technologies). T cells were cryopreserved at 1–2×10⁷ cells per mL in CryoStor CS10 cryopreservation media (Stem Cell Technologies) until use.

METHOD DETAILS

CAR T cell manufacturing

At day 0, primary human T cells were thawed and activated with anti-CD3/CD28 human T-Expander Dynabeads (Thermo Fisher Scientific) at a 1:1 bead to cell ratio. On day 2, virus-coated culture plates were prepared on non-tissue-culture-treated 12-well plates that had been precoated with RetroNectin (Takara Bio) according to the manufacturer’s instructions, by incubating with 1 ml of retroviral supernatant (2 × 107–5 × 107 TU ml−1), respectively and centrifugation at 3,200 rpm and 32 °C for 2 h. The supernatant was subsequently aspirated off of the wells and 0.5–1E10⁶ T cells were added in 1 ml of T cell medium comprising RPMI-1640 (Gibco), 10% FBS, 100 U ml−1 penicillin (Gibco), 100 mg ml−1 streptomycin (Gibco), 2 mM l-glutamine (Gibco), 10 mM HEPES (Gibco) and 50 U ml⁻¹ rhIL-2 (Peprotech). After addition of the T cells, the plates were gently centrifuged at 1,200 rpm for 2 min then incubated for 24 h at 37 °C under 5% CO2. This transduction process was repeated on day 3. Dynabeads were removed on day 3 or 4 by magnetic separation. Cells were maintained between 0.4–2E10⁶ cells per ml and expanded until day 10–14 for use in various functional assays.

Virus production

Retroviral supernatant was packaged using 293GP cells and the RD114 envelope plasmid. In brief, 11 μg RD114 and 22 μg of the corresponding MSGV1 transfer plasmid were delivered to 293GP cells grown on 150 mm poly-d-lysine dishes (Corning) to 80% confluency by transient transfection with Lipofectamine 2000 (Thermo Fisher Scientific). The medium was replenished every 24 h. Virus production was performed side by side for comparable CAR constructs. The retroviral supernatant was collected 48 and 72 h after transfection. The supernatants from replicate dishes were pooled, centrifuged to deplete cell debris and stored at −80 °C until use.

Viral vector construction

All retroviral constructs were cloned into the MSGV1 retroviral vector (Hughes et al., 2005). All AIR-regulated CAR constructs were cloned by separately amplifying the extracellular domains (Leader sequence, ScFV, Hinge) and the transmembrane domain and intracellular domain (costimulatory domain and CD3 ζ) of the respective CAR. A single-stranded oligodeoxynucleotide (ssODN) was then ordered (IDT Technologies) containing the AIR cleavage site (KLDKSFSMIKEGDYN) or mutAIR (KLDKSFS) and 20–40 bases of 5’ homology for the extracellular amplicon, and 3’ homology for the transmembrane-intracellular amplicon. Both amplicons and the ssODN were combined using Gibson assembly (NEBuilder 2X Master Mix, NEB) into an MSGV1 retroviral vector containing upstream of a P2A-NGFRt. The antibody clones for each CAR used were: FMC63 (CD19), Cetuximab,C225 (EGFR), 4D5 (HER2), MGA.271 (B7H3), 14G2A (GD2/HA-GD2), Clone F(ROR1). All CARs mentioned to contain a CD28-based costimulatory domain also contain CD28-based hinge and transmembrane domains, while CARs containing 41BB-based costimulatory domains possess CD8a-based hinge and transmembrane domains. AIR-Mask-based constructs were cloned using the same architecture as the CARs; in place of the ScFV, an engineered C225(EGFR)-binding peptide mask (QGQSGQCISPRGCPDGPYVMY) was inserted^72,73. MSGV1(mut5’LTR)-based NF-κB-CFP and NFAT-eGFP reporter constructs were previously generated¹⁰² (Addgene 118094 and 118031).

T cell surfaceome screening and idiotype stimulation

Expression of cell surface proteins on T cells was assessed using a panel of monoclonal antibodies against a wide variety of common immune cell proteins (LEGENDScreen Human PE kit, Biolegend). Lyophilized antibodies from the kit were prepared and used as per the manufacturers instructions. To coat plates for CAR stimulation, αCD19 CAR idiotype (GenScript) or mouse IgG1 isotype control (R&D Systems) was diluted to a concentration of 1ug mL⁻¹ in PBS (Gibco). 100uL of diluted αCD19 CAR idiotype (CAR stimulating) or mouse IgG1 isotype mixture (Unstimulated) was added to each well of separate TC-treated flat bottom 96-well plate and incubated at 37 C in a 5% CO2 environment for 2 hours. Plates were then washed twice in PBS and aspirated until dry. T cells isolated from two different healthy donors were engineered to express a CD19.28ζ. On Day 10 of culture, CD19.28ζ T cells were washed in complete RPMI media (10%FBS, 1% PSG, 1%HEPES) containing no IL2 and resuspended to a concentration of 1E6/ml. T cells were then pretreated with 50 μM Cycloheximide (CHX) for 30 minutes. 50ul (5E4) of T cells were then added to the αCD19 CAR idiotype and mouse IgG1 isotype-coated plates for either 2 or twelve hours before being harvested, stained and analyzed via a full spectrum Cytek Aurora (5L UV-V-B-YG-R).

CRISPR-Cas9 Knockout of ADAM10, ADAM17, and AAVS1 in Primary T cells

Ribonucleoprotein (RNP) was prepared using synthetic sgRNA with 2-O-methyl phosphorothioate modification (IDT Technologies) diluted in TE buffer at 120 μM. A total of 5 μl sgRNA was incubated with 2.5 μl duplex buffer (IDT) and 2.5 μg Alt-R Streptococcus pyogenes Cas9 Nuclease V3 (IDT) for 30 min at room temperature. In case of ADAM10 and ADAM17 knockout, two guides per gene were ordered and pooled equally and complexed with Cas9 protein. Reactions (100 μl) were assembled with 5 million T cells, 90 μl P3 buffer (Lonza) and 10 μl RNP. Cells were pulsed with protocol EO115 using the P3 Primary Cell 4D-Nucleofector Kit and 4D-Nucleofector System (Lonza). Cells were recovered immediately with warm medium for 6 h before transduction with the respective CAR or AIR virus. Cells were electroporated with RNP on day 2 following thaw and transduced the same day. Guide sequences are as follows: ADAM10: 5’-CCCCATAAATACGGTCCTCA-3’, GATACCTCTCATATTTACAC. ADAM17: CGAAAGGAACCACGCTGGTC, CATCTATCGGAACACTTCAT. AAVS1: GGGGCCACUAGGGACAGGAU.

ssODN-mediated knock-in of ADAM17cs into FAS and TGFBR2

ssODNs were synthetized through solid-phase phosphoramidite chemistry (IDT Technologies) encoding the AIR-derived ADAM17cs, flanked by 40 base pairs of homology on both the 5’ and 3’ end for the locus of interest. 100 pM of ssODN per reaction (4–5 uM = 2.7 ug DNA/reaction) was mixed with Cas9 RNPs that were generated as previously described above. T cells were then prepared as described above and electroporated using the 4D-Nucleofector System (Lonza). Guide sequences are as follows: FAS: 5’-AAGCCACCCCAAGTTAGATC-3’. TGFBR2: CTAGTCATATTTCAAGTGAC. Sequences of ssODNs used for knock-in are as follows: AIR-FAS: 5’-AAAATGTCCAATGTTCCAACCTACAGGATCCAGATCTAACAAGCTTGATAAATCCTTCTCTATGATAAA GGAGGGTGATTACAACTTGGGGTGGCTTTGTCTTCTTCTTTTGCCAATTCCACTAA −3’. AIR-TGFBR2: 5’-ACACCAGCAATCCTGACTTGTTGCTAGTCATATTTCAAGTGAAGCTTGATAAATCCTTCTCTATGATAA AGGAGGGTGATTACAACACAGGCATCAGCCTCCTGCCACCACTGGGAGTTGCCATAT-3’.

Screening of minimal ADAM cleavage sequences

A DNA plasmid was synthesized encoding a signal peptide from GM-CSF fused to mNeonGreen¹⁰³, followed by the extracellular hinge and transmembrane domains of CD28, and a P2A-NGFRt fused N to C terminus. Amplicons of the mNeonGreen-extracellular domain and transmembrane-P2A-NGFRt were generated via PCR in a manner similar to how AIR-CARs were generated to allow for high throughput assembly of different cleavage sequences into the mNeonGreen reporter. Canonical ADAM substrates were identified via literature^54,55. 40 substrates were chosen based on cloning capacity and the relative proof of ADAM cleavage. Once identified, UniProt was used to identify the topological domains for each protein, and the 25 amino acids N terminal to the transmembrane domain were codon optimized and synthesized as an eblock (IDT Technologies). These eblocks were then cloned into the standard Retroviral backbonè along with our two aforementioned amplicons to generate a library of surface-bound mNeonGreen constructs with different ADAM cleavage sites. Constructs were then tested in an arrayed format by stimulating CAR T cells for 2 hours with plate-bound αCD19 CAR idiotype or Isotype for 2 hours. ADAM cleavage of all constructs was measured via detection of mNeongreen on the surface via staining with an Alexa fluoro-647 or 488 conjugated (Abcam, ab269823, ab236553) or monoclonal VHH for mNeongreen (Thermo, NT-250). ADAM10 KO efficiency was assessed via surface staining for ADAM10 (Biolegend, 352706), while ADAM17 KO was assessed via relative cleavage of CD62L (Biolegend, 384824) following CAR stimulation.

T cell stimulation time course with αCD3/CD28 magnetic beads

T cells were stimulated at a 1:1 bead to cell ratio with anti-CD3/CD28 human T-Expander Dynabeads (Thermo Fisher Scientific). Beads were washed three times in complete RPMI before being resuspended to 1E6 beads per mL. T cells to be stimulated were harvested, washed in complete RPMI (no IL2) and resuspended at 1E6/mL. 100ul of T cells (1E5) were then aliquoted into a 96 well round bottom plate and mixed with diluted beads before being spun briefly and allowed to incubate at 37 C in a 5% CO2 environment. T cells were then separated from beads before being stained and analyzed via flow cytometry.

T cell stimulation with CD19 idiotype conjugated magnetic beads

Anti-CD19 idiotype-coated beads were used to stimulate T cells at a 1:1 bead:cell ratio. Cells were washed twice with complete RPMI, then resuspended at 1E6 cells per mL. 100uL of cells was then used to incubate with labelled beads. To coat beads with antibody, 50 μg of CD19 anti-idiotype antibody was biotinylated using the Biotin-XX Microscale Protein Labeling Kit (Invitrogen) according to the manufacturer’s protocol. Streptavidin M-450 Dynabeads (Invitrogen) were magnetically separated from buffer solution and washed once with PBS, then incubated with biotinylated antibody (2.5 μg antibody per 6 × 10⁷ beads) in PBS for 10 min. Labelled beads were then magnetically separated from the mixture again and resuspended in PBS at 6 × 10⁵ beads per μl. Antibody-coated beads were made fresh for stimulations.

Assessing Caspase 3/7 activity via Incucyte

T cells were taken from culture and resuspended to 1E6 cells per mL. 100uL of cells were aliquoted into each well of a flat bottom 96 well plate alone or 1:1 with activating beads. Incucyte^® Caspase-3/7 Red Dye was then diluted in comp RPMI to 5uM and diluted 1:1 in cell volume. 96 well plates were then spun at 1000 RPM for 2 minutes before being placed on an Incucyte set to capture Red fluorescence (ex. 630nm).

Usage of protease inhibitors to monitor ADAM-mediated protein shedding

For assessing the relative impact of both ADAM10 and ADAM17 on shedding proteins from the surface, T cells were harvest, washed, and diluted to 1E6 cells per mL. T cells were then pre-treated with 1μM GI, 1μM GW, or 10nM-10uM TAPI-1 for 30 minutes. Following treatment, 1E5 T cells per well were seeded in 96-well plates either with anti-CD3/CD28 human T-Expander Dynabeads (Thermo Fisher Scientific), plate-bound αCD19 CAR idiotype, or Isotype before being spun briefly and allowed to incubate at 37 C in a 5% CO2 environment. In case of TAPI-1 inhibition of HA.28z cells, drug and cells were allowed to incubate for 48 hours before assessing CAR shedding via Alexa-fluor 647-conjugated αGD2 CAR idiotype.

Flow cytometry analysis of mammalian cells

Cells were washed with FACS buffer (2% FBS in PBS) before staining. Staining was performed in FACS buffer for 30 min at 4 °C. When staining for viability, cells were first stained with Fixable Viability Dye eFluor 780 (eBioscience, 1:2,000) in FACS buffer for 10 min at room temperature before washing with FACS buffer and staining with other antibodies. After staining, cells were then washed once with FACS buffer and analyzed on either the BD Fortessa system with FACSDiva (v.8.0.1; BD) software or on a Cytek Aurora system via SpectraFlow analysis. Flow data was exported as FCS files and via FlowJo software (v.10.8.1; BD). Recombinant B7H3-Fc, ROR1-Fc, EGFR-Fc, HER2-Fc (all R&D systems, 1:400 dilution) were used to detect B7H3, ROR1, EGFR, and HER2 surface CAR, respectively. Likewise, anti-FMC63 idiotype antibody (Genscript, 1:400) was used to detect CD19 CARs, while anti-14G2a idiotype antibody (National Cancer Institute, 1:400) was used to detect GD2 and HA CARs. CAR detection reagents were fluorescently labelled using the DyLight 650 Microscale Antibody Labelling Kit (Thermo Fisher Scientific). The following antibodies were used for detection of cell surface proteins: calreticulin (PE, FMC 75, Abcam, 1:100); human CD4 (BUV 395, SK3, BD, 1:400); human CD8 (BUV 805, SK1, BD, 1:400); human CD45 (Per-CP-Cy5.5, HI30, Invitrogen, 1:50); human CD69 (BV421, FN50, BioLegend, 1:100); human CD39 (BV605, A1, BioLegend, 1:100); human TIM3 (BV510, F38–2E2, BioLegend, 1:100); human LAG3 (PE, 3DS223H, Invitrogen, 1:200); human PD1 (PE-Cy7, J105, Invitrogen, 1:200); human CD45RA (BV785, HI100, BioLegend, 1:100); human CD62L (BV605, DREG-56, BD, 1:200); human CD25 (BUV 737, 2A3, BD, 1:200); human CD95 (PE, DX2, Biolegend, 1:200); Anti-Active Caspase-3 (Alexa Fluor 647, C92–605.rMAb, BD, 1:50); CD39 (APC-Cy7, A1, Biolegend, 1:200); NF-kB p65 (pS529), (PE, K10–895.12.50, BD, 1:40); pSMAD2/3 (PE, O72–670, Biolegend, 1:40); Annexin V was detected using the eBioscience Annexin V Apoptosis Detection Kit (Invitrogen) according to the manufacturer’s instructions.

IncuCyte tumor killing assays and secreted cytokine analysis

A total of 5E4 GFP-labelled tumor cells was cocultured with 5E5 CAR T cells in 300 μl RPMI supplemented with 10% FBS, 10 mM HEPES, 2mM l-glutamine, 100 U ml−1 penicillin and 100 μg ml−1 streptomycin. CAR T cells were washed twice to remove IL2. Triplicate wells were plated in 96-well flat-bottom plates for each condition and 1:2–8 E:T ratios were used. In the cases of mixed A375 tumor coculture, 200ul of 1E4 total tumor cells (5E3 CD19+/−, 5E3 EGFR+ cells) we allowed to adhere to the bottom of a 96-well flat bottom plate for two hours before T cells were added at a 1:2–8 E:T ratio. Tumor fluorescence was monitored every 3–4 hours with a 10x objective using the IncuCyte S3 Live-Cell Analysis System (Sartorius), housed in a cell culture incubator at 37 °C and 5% CO2, set to take 4 images per well at each timepoint. The total integrated GFP intensity was quantified using the IncuCyte basic analyzer software feature (IncuCyte S3 v.2023B Rev2; Sartorius). In cases of repeat tumor challenge, the initial co culture plate was removed after 48–96 hours and mixed before transferring 100ul of each well to a new plate containing 200ul of of 5E4 GFP-labelled tumor cells. The plate was then briefly spun and put back onto the Incucyte. Data were normalized to the first timepoint and plotted as the fold change in tumor fluorescence over time. For cytokine secretion, cocultures were set up as described above except in 96-well round-bottom plates. After approximately 16–18 hours, the plates were centrifuged to pellet cells and 150 μl of supernatant was collected and stored at −20 °C until analysis. IFNγ and IL-2 levels in the coculture supernatants were quantified by Lumit ELISA (ProMega, W6021, W6041) according to the manufacturer’s instructions. Negative cytokine values were set to 0. Absorbance values were measured using the Synergy H1 Hybrid Multi-Mode Reader with Gen5 software (v.2.00.18; BioTek).

Confocal microscopy

CD19 or HA.28ζ CAR T cells were taken from culture on Day 6–8 post-bead removal, washed, stained with Alexa-fluor 647-conjugated αCD19/GD2 CAR idiotype, and allowed to incubate overnight on 18-well μ-Slides (Ibidi) coated with Poly-D-Lysine. Data acquisition was performed on LSM700 Zeiss laser scanning confocal microscope (objective lens 40–63X, pixel size 0.07 μm, pinhole size 1 AU) using ZEN software (ZEISS Microscopy). All groups of images were acquired using the same settings. Data analysis was performed using Fiji software. The samples were quantified by drawing two elliptical ROIs to isolate the cell membrane and calculating the pixel MFI. The Coefficient of Variation was calculated as standard deviation divided by average pixel MFI.

Nalm6 leukemia tumor models

A total of 1E6 GD2 overexpressing Nalm6-GFP-fLuc cells in 200 μl DPBS was implanted by tail-vein injection into NSG male or female mice aged 6–10 weeks⁹⁹. Four days after tumor implantation and after confirmation of tumor formation by BLI, mice were treated with AIR or conventional CAR T cells: 2E6 for (HA)GD2–28ζ, 1.5E6 for GD2–28ζ, 1.5E6 for GD2-BBζ. Tumor progression was monitored by fLuc BLI measurement. Mice were euthanized according to the criteria described in the ‘Animal models’ section.

143B osteosarcoma tumor model

1E6 143B-GFPfluc resuspended in 100 μl DPBS were injected into the tibial periosteum of six- to ten-wee-kold NSG male or female mice (engraftment dose indicated below for each specific study). 3 days after tumor implantation and after visual confirmation of tumor formation, mice were treated with HER2–28ζ CAR T cells. Tumor progression was monitored by measurement using calipers. Mice were euthanized according to the criteria described in the ‘Animal models’ section.

BLI analysis

Mice were administered 200 μl of 15 mg/ml for firefly luciferase imaging by intraperitoneal injection. Images were acquired on the IVIS (Perkin Elmer) or Lago (Spectral Instruments Imaging) imaging system 4 min after injection for fLuc using 30 s exposures and medium binning. If saturated pixels were detected in the image, an additional image was acquired using the auto-expose setting. Total flux was measured using Living Image (v.4.7.3; Perkin Elmer) or Aura (v.4.0.7; Spectral Instruments Imaging) software with a region of interest around the body of each mouse. Only non-saturated images were used for quantification of BLI. Mice were randomized before T cell administration to ensure uniform distribution of tumor burden between groups. At the end of the experiment, all of the images were collected into a single sequence on Aura and set to the same luminescence scale.

CD19.28ζ T cells expansion after stimulation

At Day 10 post thaw, 5E4 CD19.28ζ T cells were activated with plate-bound aCD19 CAR idiotype for 24 hours in triplicate in a 96-well plate. This was repeated 10 times for each T cell condition (Mock, AIR, CAR mutAIR) to be able to harvest cells at various downstream timepoints. T cells and their supernatants were then harvested plated on a non-stimulating 96-well plate and allowed to expand. Cultures were moved to a 48-well plate once at 100 hours post-stimulation removal. Cell counts and viability measurements were obtained using the Cellaca Mx Automated Cell Counter (Nexcelom). Cells were stained with acridine orange and propidium iodide to assess viability.

Propidium Iodide Inclusion in stimulated CD19.28ζ T cells

At Day 12 post thaw, 1E5 CD19.28ζ T cells were premixed with Propidium Iodide (1ug/mL) in a final volume of 200uL before being stimulated with either Nalm6-GFPfluc tumor that was CD19 WT or CD19 KO in triplicate in a 96-well plate for 6 hours. T cells were then washed and stained for CD69 upregulation before being analyzed by flow cytometry.

Bulk RNA-seq

CAR T cells were collected on day 14 after either 7 days of Dasatinib (1uM) or DMSO treatment and processed without freezing. RNA was extracted using the RNeasy mini kit (Qiagen). RNA quality was assessed by BioAnalyzer (Agilent). Sequencing libraries were prepared by Novogene (Sacramento, CA), and 150 bp paired-end sequencing at a depth of 3 × 10⁷ reads per sample was obtained using the Illumina NovaSeq6000 platform. FASTQ files were generated by Novogene. Transcripts were quantified with Salmon, and DESeq2 was used to identify differentially expressed genes. Gene set enrichment analysis was performed using GSEA software (Broad Institute).

CyTOF sample preparation and data analysis

CAR-T cells (2E6) were collected on day 14 and stained for viability using 250 nM cisplatin (Standard BioTools, Cat# 201064). Cells were washed in 1× PBS (without serum) and incubated with cisplatin for 3 minutes at room temperature. The reaction was quenched with 5× Cell Staining Medium (CSM; PBS supplemented with 0.05% BSA and 0.02% sodium azide), followed by two washes at 400 × g. Cells were subsequently fixed in paraformaldehyde (PFA; Electron Microscopy Sciences, Hatfield, PA, USA) to a final concentration of 1.6% for 10 minutes at room temperature for 10 minutes, washed twice with PBS, flash frozen on dry ice, and stored at −80 °C until further processing. For barcoding, cells were thawed and washed once with CSM and once with 1× PBS. Barcoding was performed using the Cell-ID 20-Plex Pd Barcoding Kit (Standard BioTools, Cat# 201060) according to the manufacturer’s protocol. Barcoded samples were pooled and stained with antibodies against surface markers for 30 minutes at room temperature, followed by two washes at 750 × g. Cells were permeabilized with 4C Methanol for 10 min at 4c (ice) then stored at −80. Cells were washed with CSM (2X) and stained for intracellular markers and phospho antibodies for 45 min on ice. Cells were washed (1X) with CSM and stained with 191Ir/193Ir DNA intercalator (1:6000 dil) in PBS with 1.6% PFA for 20 min at RT. Prior to acquisition, samples were washed once with CSM and twice with filtered Milli-Q water, resuspended in 1X EQ Four Element Calibration Beads (Fluidigm), filtered through a 50 μm mesh strainer, and acquired on a Helios mass cytometer (Fluidigm). Data were normalized using a MATLAB-based algorithm as previously described (Finck et al., 2013), and debarcoded using the MATLAB debarcoder tool. Normalized and debarcoded FCS files were uploaded to the OMIQ analysis platform (OMIQ.ai). Initial gating steps were performed to exclude beads, dead cells, and doublets. Downstream analyses were conducted on live, intact singlets.

Detection of Soluble AIR proteins via ELISA

Relative amounts of shed AIR proteins were measured via detection of a N-terminally-fused FLAG tag. Supernatants from CD3/28 bead activated or rested T cells (5E4 cells) expressing mutAIR or AIR-mNeonGreen cultured without IL-2 in round bottom 96-well plates were harvested and diluted 1:5 or 1:10 in complete RPMI media before being analyzed by anti-DYKDDDDK-tag ELISA (GenScript). Triplicate wells were plated for each condition. Results were read via microplate reader capable of measuring absorbance at 450 and normalized to values from mock transduced T cells.

QUANTIFICATION AND STATISTICAL ANALYSIS

For in vivo tumor-growth curves, significance was computed at the indicated timepoint on the plot by unpaired two-tailed t test comparing the constitutive group with the AIR group. Significance for survival data was calculated using the log-rank Mantel–Cox test. Statistical analysis on flow cytometry quantification was computed by unpaired two-tailed t test comparing the indicated groups, unless otherwise indicated. All statistical tests were performed on GraphPad Prism 9/10. Asterisks denoting statistical significance are in Graphpad Prism style with one, two, three, or four asterisks representing P values less than 0.05, 0.01, 0.001, and 0.0001, respectively.

ADDITIONAL RESOURCES

Supplementary Material

Table S1. Mean fluorescence intensity (MFI) values for all surface proteins measured in the T cell surfaceome activation screen, Related to Figure 1. A) MFI values of 354 unique protein surface markers on T cells before stimulation (0hr), and after stimulation (2hr, 12hr) for CD19 CAR T cells from two different donors.

NIHMS2176700-supplement-1.xlsx^{(57KB, xlsx)}

Table S2. Analysis and annotation of proteins exuding activation-dependent downregulation, Related to Figure 1. A) Analysis of Log2-fold change in MFI for all 354 surface proteins at 2hr or B) 12hr post activation relative to 0hr. Significantly downregulated proteins (Log2FC >−0.5, p value <0.05) are highlighted in blue. For those proteins that are significantly downregulated, any literature found on the mechanism of that proteins downregulation is listed. C) All significantly downregulated proteins were classified based on mechanism of downregulation: Protease-mediated, none observed, observed via unknown mechanism. In the case of protease-mediated, the respective protease is listed.

NIHMS2176700-supplement-2.xlsx^{(42.9KB, xlsx)}

Table S3. Description of CARs used throughout the study, Related to Figure 6. A) Each CAR utilized in this study is thoroughly described according to its: ScFV, spacer-hinge, transmembrane domain, co-stimulatory domain, basal NFkB activity of T cells that express the CAR, as well as a CARs relative ADR (AIR downregulation ratio) after engineering the AIR-regulated version.

NIHMS2176700-supplement-3.xlsx^{(13.1KB, xlsx)}

NIHMS2176700-supplement-4.pdf^{(13.8MB, pdf)}

Document S1. SFigures 1–8

Document S2. Tables S1–3

KEY RESOURCES TABLE

REAGENT OR RESOURCE	SOURCE	IDENTIFIER
Antibodies
Anti-FMC63 idiotype antibody	Lawrence Cooper, MD Anderson Cancer Center	⁹⁷
PE Mouse IgG1, κ Isotype Ctrl (FC) Antibody, clone MOPC-21	Biolegend	400114
LEGENDScreen^™ Human PE Kit	Biolegend	700011
Anti-14G2A idiotype antibody (Clone 1A7	National Cancer Institute	⁹⁸
BV605 Mouse Anti-Human CD62L (Clone DREG-56)	BD	Cat# 562719; RRID: AB_2744487
BUV395 Mouse Anti-Human CD4 (Clone SK3)	BD	Cat# 563550; RRID: AB_2738201
BD BUV805 Mouse Anti-Human CD8 (Clone SK1)	BD	Cat# 612889; RRID: AB_2833033
Brilliant Violet 421anti-human CD69 (Clone FN50)	Biolegend	Cat# 310930; RRID: AB_2561921
FITC anti-human CD39 (Clone A1)	Biolegend	Cat# 328206; RRID: AB_940488)
Anti-ROR1 monoclonal antibody (Clone F)	Mackall lab	99
CD223 (LAG-3) Monoclonal Antibody (Clone 3DS223H), PE	Thermo Fisher	Cat# 12-2239-42; RRID: AB_2572552
CD279 (PD-1) Monoclonal Antibody (Clone eBioJ105 (J105))	Thermo Fisher	Cat# 25-2799-42; RRID: AB_10853812
Anti-CD27 (clone 323)	BioLegend	Cat# 302839; RRID: AB_2562843
Brilliant Violet 421^™ anti-DYKDDDDK Tag Antibody	Biolegend	637322
PE anti-HA.11 Epitope Tag Antibody	Biolegend	901518
Recombinant Human EGFR Fc Chimera Alexa Fluor^® 647 Protein	R&D Systems	AFR344
PE/Cyanine7 anti-mouse CD122 (IL-2Rβ) Antibody	Biolegend	123216
BD Horizon^™ BUV737 Mouse Anti-Human CD25	BD	612807
PE/Cyanine7 anti-human CD271 (NGFR) Antibody	Biolegend	345110
APC/Cyanine7 anti-human CD39 Antibody	Biolegend	328226
PE/Cyanine7 anti-human CD45	Biolegend	982310
APC anti-human TCR Vβ13.1 Antibody	Biolegend	362408
BD Horizon^™ BUV737 Rabbit Anti-Active Caspase-3	BD	570784
BD Phosflow^™ PE Mouse anti-NF-κB p65 (pS529)	BD	558423
PE anti-human CD95 (Fas) Antibody	Biolegend	305608
BD Phosflow^™ PE Mouse anti-Smad2 (pS465/pS467)/Smad3 (pS423/pS425)	BD	562586
APC anti-human CD156c (ADAM10) Antibody	Biolegend	352706
CD57 Antibody (HCD-57)	Biolegend	322325
TCf-7 Antibody	IN HOUSE (Cell signaling)	44070S
CD278 Antibody (DX29)	IN HOUSE(BD)	557801
PS6(Ser 235,236) Antibody	IN HOUSE (Cell signaling)	92243S
pNFKb(ps529) Antibody (K10-895.12.50)	IN HOUSE(BD)	558393
CD62L Antibody (DREG-56)	IN HOUSE(Biolegend)	104443
CD4 Antibody (RPT-T4)	Fluidigm	3145001B
CD8 Antibody (RPT-T8)	Fluidigm	3146001B
CD28 Antibody (CD28.2)	IN HOUSE(Biolegend)	302937
Anti-Cas-3 Antibody (C92-605)	BD (in house)	3206270
CD45RO Antibody (UCHL1)	FDM	3149001B
CD134(OX40) Antibody (ACT35)	Fluidigm	3150023B
CD244(2B4) Antibody (C1.7)	IN HOUSE (Biolegend)	329502
TIM-3 Antibody (F38-2E2)	FDM	3153008B
TGIT Antibody (MBSA43)	FDM	3154016B
AKT(ps473) Antibody (pS473)	cell signaling	31957SF
pCD3z Antibody (K25-407.69)	BD (in house)	558402
IL-2 Antibody (MQI-17H2)	FDM	3158007B
CD178 Antibody (NOK-1)	BD	556372
Tbet Antibody (4B10)	FDM	3160010B
CD152(CTLA-4) Antibody (14D3)	FDM	3161004B
LCK(pY505) Antibody (T505)	Cell signaling	3162004A
CD272 (BTLA) Antibody (MIH26)	FDM	3163009B
CD39 Antibody (A1)	IN HOUSE (Biolegend)	328221
CD223 (LAG3) Antibody (11C3C65)	FDM	3165037B
CD197(CCR7) Antibody (G043H7)	FDM	3167009A
CD127 Antibody (A019D5)	FDM	3168017B
CD45RA Antibody (HI100)	FDM	3170010B
CD122 Antibody (TU27)	IN HOUSE(Biolegend)	339015
ki-67 Antibody (ki-67)	Fluidigm	3168001B
CD95 Antibody (DX2)	IN HOUSE(Biolegend)	305631
CD279 (PD-1) Antibody (EH12.2H7)	FDM	3174020B
TOX Antibody (6E6D03)	IN HOUSE(Biolegend)	682602
Eomes Antibody (WD1928)	IN HOUSE (eBiosciences)	14-4877-82



Bacterial and virus strains
Stellar^™ Competent Cells	Clontech	636766

Biological samples
Leukapheresis (leukopaks) from healthy donors	Stanford Blood Center	N/A
Leukapheresis (leukopaks) from healthy donors	Stem Cell Technologies	N/A


Chemicals, peptides, and recombinant proteins
Cycloheximide from microbial, ≥94% (TLC)	Millipore Sigma	C7698-1G
Recombinant Human ROR1 Fc Chimera Protein, CF	R&D Systems	9490-RO-050
Recombinant Human B7-H3 Fc Chimera Protein, CF	R&D Systems	1027-B3-100
Recombinant Human ErbB2/Her2 Fc Chimera Protein, CF	R&D Systems	1129-ER-050
Recombinant Human IL-2	Peprotech	200-02-1mg
RetroNectin Recombinant Human Fibronectin Fragment	Takara	T100B
Lipofectamine 2000 Transfection Reagent	Thermo Fisher	11668500
eBioscience Monensin Solution (1000X)	Thermo Fisher	00-4505-51
D-Luciferin Firefly, potassium salt	Thermo Fisher	L82201G
Cisplatin	Fluidigm	201064
DNA intercalator	Fluidigm	201191B
eBioscience^™ Fixable Viability Dye eFluor^™780	Thermo Fisher	65-0865-18
GW280264X (ADAM17 inhibitor) 10 mM * 1 mL in DMSO ready for reconstitution	MedChemExpress	HY-115670
GI254023X (ADAM10 inhibitor) 10 mM * 1 mL in DMSO ready for reconstitution	MedChemExpress	HY-19956
TAPI-1 (ADAM17 inhibitor) 1mg	MedChemExpress	HY-16657
Dasatinib (25mg)	MilliporeSigma	CDS023389
Propidium Iodide	Biolegend	421301
PerCP/Cyanine5.5 Annexin V	Biolegend	640936
Recombinant Human B7-H3 Fc Chimera Protein, CF	R&D Systems	1027-B3-100
Human TGF-beta 1 Recombinant Protein, PeproTech^®	Peprotech	100-21-10UG
Incucyte^® Red −3/7 Dye for Apoptosis	Sartorius	4440

Critical commercial assays
NEBuilder^® HiFi DNA Assembly Master Mix	New England Biolabs	E2621L Lot #10238675
Intracellular Fixation & Permeabilization Buffer Set Kit	Thermo Fisher	88-8824-00
DyLight 650 Microscale Antibody Labeling Kit	Thermo Fisher	84536
PE/Cy7^® Conjugation Kit - Lightning-Link^®	ABCAM	ab102903
Lumit^® IL-2 (Human) Immunoassay	Promega	W6020
Lumit^® IFN-γ (Human) Immunoassay	Promega	W6040
DYKDDDDK Tag Antibody Plate	Genscript	L00455B
Gene Knockout Kit (EGFR)	EditCo	NA
EasySep^™ Human T Cell Isolation Kit	StemCell Technologies	Catalog # 100-0695
CryoStor^® CS10	StemCell Technologies	Catalog # 100-1061


Deposited data
Bulk RNA sequencing	GEO:GSE328715



Experimental models: Cell lines
Nalm6-GL	¹⁰⁰	NA
Nalm6-B7H3	¹⁰⁰	NA
143B-GL	⁶¹	NA
143B-mKate2(NLR)	This Paper	NA
Nalm6-HER2 (CD19 KO)	¹⁰¹	NA
Nalm6 (mKate2)-EGFR	This Paper	NA
Nalm6(mKate2)	This Paper	NA
A375 melanoma cells	ATCC	CRL-1619
A375 (EGFR KO)	This paper	NA
A375 CD19+	This Paper	NA
Nalm6-GD2	⁶²	NA
NALM6 ROR1 LINES	⁹⁹	NA
293GP	National Cancer Institute, Surgery Branch	NA
293T	National Cancer Institute, Surgery Branch	NA


Experimental models: Organisms/strains
NSG mice (NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ)	Jackson Laboratory	005557
Oligonucleotides
ADAM10-sgRNA-1- 5’-CCCCATAAATACGGTCCTCA-3’	IDT	N/A
ADAM10-sgRNA-1- 5’GATACCTCTCATATTTACAC −3’	IDT	N/A
ADAM17-sgRNA-1- 5’- CGAAAGGAACCACGCTGGTC −3’	IDT	N/A
ADAM17-sgRNA-1- 5’- CATCTATCGGAACACTTCAT -3’	IDT	N/A
AAVS1-sgRNA-1- 5’- GGGGCCACUAGGGACAGGAU -3’	IDT	N/A
AIR-FAS ssODN 5’- AAAATGTCCAATGTTCCAACCTACAGGATCCAGATCTAACAAGCTTGATAAATCCTTCTCTATGATAAAGGAGGGTGATTACAACTTGGGGTGGCTTTGTCTTCTTCTTTTGCCAATTCCACTAA -3’	IDT	N/A
AIR-TGFBRII ssODN 5’- AACACCAGCAATCCTGACTTGTTGCTAGTCATATTTCAAGTGAAGCTTGATAAATCCTTCTCTATGATAAAGGAGGGTGATTACAACACAGGCATCAGCCTCCTGCCACCACTGGGAGTTGCCATAT -3’	IDT	N/A


Recombinant DNA
MSGV1	⁶¹	NA
RD114	⁶¹	NA
pMDLg/pRRE	⁶¹	NA
pRSV-REV	⁶¹	NA
VSVG	⁶¹	NA
NF-κB-CFP	Addgene	118094
NFAT-eGFP	Addgene	118031
NF-κB -eGFP	This Paper	NA

Software and algorithms
Incucyte ZOOM software	Sartorius	https://www.sartorius.com/en
FlowJo 10.7.1	FlowJo	Flowjo.com
R Studio	R, R studio	Rstudio.com
Living Image v4.7.4	PerkinElmer	PerkinElmer.com
Graphpad Prism	GraphPad Software	https://www.graphpad.com/
Cell Ranger	10X Genomics	10xgenomics.com
FIJI (imageJ)	ImageJ	https://imagej.net/software/fiji/downloads
SpectraFlow	Cytek Biosciences	https://cytekbio.com/pages/spectro-flo
DESeq2	Bioconductor	Bioconductor.org
Salmon	Salmon	https://salmon.readthedocs.io/en/latest/salmon.html
Other
Dynabeads Human T-Expander CD3/CD28	Thermo Fisher	11141D
Helios	Fluidigm	NA
IVIS Spectrum imaging system	PerkinElmer	NA
Incucyte S3	Sartorius	NA
Cytek Aurora	Cytek Biosciences	NA
Inverted Zeiss LSM880 laser scanning confocal microscope	Zeiss	https://www.zeiss.com/microscopy/us/products/lightmicroscopes/confocal-microscopes.html

Open in a new tab

Highlights:

A 15-aa AIR motif endows activation-induced receptor shedding in human T cells.
AIR tunes tonic signaling CARs, reducing exhaustion and improving anti-tumor potency.
AIR improves CAR activity by selectively dampening NFAT signaling and limiting AICD.
AIR enables logic-gated CARs and activation-shed FAS/TGFBR2 to enhance tumor control.

ACKNOWLEDGMENTS

This work was supported by NIH Grants: R35CA283888, R0CA263500-01, 2P01CA217959-06A1, 2P30CA124435-16, the Mark Foundation, the Virginia and D.K. Ludwig Fund for Cancer Research (C.L.M.). J.R.B. received support from the Stanford Biosciences Training grant 5T32-GM11999505 through the Institute for Stem Cell Biology & Regenerative Medicine, and the National Science Foundation Graduate Research Fellowship Program under Award Number 2146755. A.C.S received support from the EMBO Long-Term Fellowship (ALTF 405-2023), the Fundación Ramon Areces Postdoctoral Fellowship and the CRIS Cancer Foundation Out-Back Fellowship. C.L.M. is a member of the Parker Institute for Cancer Immunotherapy, which supports the Stanford University Cancer Immunotherapy Program and a Weill West Coast Cancer Hub Investigator. Graphical Abstract was designed using BioRender^™ illustrations.

DECLARATION OF INTERESTS

J.R.B., S.A.Y.-H., L.L, E.S., A.C.S. and C.L.M. are listed as coinventors on a patent related to this work (U.S. Patent Application #63/787,591, submitted by the board of trustees of the Leland Stanford Junior University). C.L.M. holds equity in Link Cell Therapies and Ensoma, which are developing CAR-based therapies; consults for Link, Immatics, Ensoma, Astra-Zeneca, Moderna, Kite Pharma, Grace Science and Red Tree Capital; and receives research funding from Tune Therapeutics. S.A.Y.-H. is a consultant for Quince Therapeutics. E.S. holds equity in Lyell Immunopharma. L.L. is a cofounder of, consults for and holds equity in CARGO Therapeutics. E.S consults for Lepton Pharmaceuticals and Galaria. The other authors declare no competing interests.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

DECLARATION OF GENERATIVE AI AND AI-ASSISTED TECHNOLOGIES

Author(s) used ChatGPT to ensure proper grammar and sentence structure of this manuscript. After using this tool, the author(s) reviewed and edited the content as needed and take full responsibility for the content of the publication.

REFERENCES

1.Schuster SJ, Svoboda J, Chong EA, Nasta SD, Mato AR, Anak O, Brogdon JL, Pruteanu-Malinici I, Bhoj V, Landsburg D, et al. (2017). Chimeric Antigen Receptor T Cells in Refractory B-Cell Lymphomas. N Engl J Med 377, 2545–2554. 10.1056/NEJMoa1708566. [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Maude SL, Laetsch TW, Buechner J, Rives S, Boyer M, Bittencourt H, Bader P, Verneris MR, Stefanski HE, Myers GD, et al. (2018). Tisagenlecleucel in Children and Young Adults with B-Cell Lymphoblastic Leukemia. N Engl J Med 378, 439–448. 10.1056/NEJMoa1709866. [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Raje N, Berdeja J, Lin Y, Siegel D, Jagannath S, Madduri D, Liedtke M, Rosenblatt J, Maus MV, Turka A, et al. (2019). Anti-BCMA CAR T-Cell Therapy bb2121 in Relapsed or Refractory Multiple Myeloma. N Engl J Med 380, 1726–1737. 10.1056/NEJMoa1817226. [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Nastoupil LJ, Jain MD, Feng L, Spiegel JY, Ghobadi A, Lin Y, Dahiya S, Lunning M, Lekakis L, Reagan P, et al. (2020). Standard-of-Care Axicabtagene Ciloleucel for Relapsed or Refractory Large B-Cell Lymphoma: Results From the US Lymphoma CAR T Consortium. J Clin Oncol 38, 3119–3128. 10.1200/JCO.19.02104. [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Berdeja JG, Madduri D, Usmani SZ, Jakubowiak A, Agha M, Cohen AD, Stewart AK, Hari P, Htut M, Lesokhin A, et al. (2021). Ciltacabtagene autoleucel, a B-cell maturation antigen-directed chimeric antigen receptor T-cell therapy in patients with relapsed or refractory multiple myeloma (CARTITUDE-1): a phase 1b/2 open-label study. Lancet 398, 314–324. 10.1016/S0140-6736(21)00933-8. [DOI] [PubMed] [Google Scholar]
6.Locke FL, Miklos DB, Jacobson CA, Perales MA, Kersten MJ, Oluwole OO, Ghobadi A, Rapoport AP, McGuirk J, Pagel JM, et al. (2022). Axicabtagene Ciloleucel as Second-Line Therapy for Large B-Cell Lymphoma. N Engl J Med 386, 640–654. 10.1056/NEJMoa2116133. [DOI] [PubMed] [Google Scholar]
7.Schultz LM, Baggott C, Prabhu S, Pacenta HL, Phillips CL, Rossoff J, Stefanski HE, Talano JA, Moskop A, Margossian SP, et al. (2022). Disease Burden Affects Outcomes in Pediatric and Young Adult B-Cell Lymphoblastic Leukemia After Commercial Tisagenlecleucel: A Pediatric Real-World Chimeric Antigen Receptor Consortium Report. J Clin Oncol 40, 945–955. 10.1200/JCO.20.03585. [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Labanieh L, and Mackall CL (2023). CAR immune cells: design principles, resistance and the next generation. Nature 614, 635–648. 10.1038/s41586-023-05707-3. [DOI] [PubMed] [Google Scholar]
9.Frank MJ, Baird JH, Kramer AM, Srinagesh HK, Patel S, Brown AK, Oak JS, Younes SF, Natkunam Y, Hamilton MP, et al. (2024). CD22-directed CAR T-cell therapy for large B-cell lymphomas progressing after CD19-directed CAR T-cell therapy: a dose-finding phase 1 study. Lancet 404, 353–363. 10.1016/S0140-6736(24)00746-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Choi BD, Gerstner ER, Frigault MJ, Leick MB, Mount CW, Balaj L, Nikiforow S, Carter BS, Curry WT, Gallagher K, and Maus MV (2024). Intraventricular CARv3-TEAM-E T Cells in Recurrent Glioblastoma. N Engl J Med 390, 1290–1298. 10.1056/NEJMoa2314390. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Monje M, Mahdi J, Majzner R, Yeom KW, Schultz LM, Richards RM, Barsan V, Song KW, Kamens J, Baggott C, et al. (2025). Intravenous and intracranial GD2-CAR T cells for H3K27M(+) diffuse midline gliomas. Nature 637, 708–715. 10.1038/s41586-024-08171-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Long AH, Haso WM, Shern JF, Wanhainen KM, Murgai M, Ingaramo M, Smith JP, Walker AJ, Kohler ME, Venkateshwara VR, et al. (2015). 4–1BB costimulation ameliorates T cell exhaustion induced by tonic signaling of chimeric antigen receptors. Nat Med 21, 581–590. 10.1038/nm.3838. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Fraietta JA, Lacey SF, Orlando EJ, Pruteanu-Malinici I, Gohil M, Lundh S, Boesteanu AC, Wang Y, O’Connor RS, Hwang WT, et al. (2018). Determinants of response and resistance to CD19 chimeric antigen receptor (CAR) T cell therapy of chronic lymphocytic leukemia. Nat Med 24, 563–571. 10.1038/s41591-018-0010-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Delgoffe GM, Xu C, Mackall CL, Green MR, Gottschalk S, Speiser DE, Zehn D, and Beavis PA (2021). The role of exhaustion in CAR T cell therapy. Cancer Cell 39, 885–888. 10.1016/j.ccell.2021.06.012. [DOI] [PubMed] [Google Scholar]
15.Good CR, Aznar MA, Kuramitsu S, Samareh P, Agarwal S, Donahue G, Ishiyama K, Wellhausen N, Rennels AK, Ma Y, et al. (2021). An NK-like CAR T cell transition in CAR T cell dysfunction. Cell 184, 6081–6100 e6026. 10.1016/j.cell.2021.11.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Selli ME, Landmann JH, Terekhova M, Lattin J, Heard A, Hsu YS, Chang TC, Chang J, Warrington J, Ha H, et al. (2023). Costimulatory domains direct distinct fates of CAR-driven T-cell dysfunction. Blood 141, 3153–3165. 10.1182/blood.2023020100. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Harris DT, Hager MV, Smith SN, Cai Q, Stone JD, Kruger P, Lever M, Dushek O, Schmitt TM, Greenberg PD, and Kranz DM (2018). Comparison of T Cell Activities Mediated by Human TCRs and CARs That Use the Same Recognition Domains. J Immunol 200, 1088–1100. 10.4049/jimmunol.1700236. [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Majzner RG, Rietberg SP, Sotillo E, Dong R, Vachharajani VT, Labanieh L, Myklebust JH, Kadapakkam M, Weber EW, Tousley AM, et al. (2020). Tuning the Antigen Density Requirement for CAR T-cell Activity. Cancer Discov 10, 702–723. 10.1158/2159-8290.CD-19-0945. [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Korell F, Berger TR, and Maus MV (2022). Understanding CAR T cell-tumor interactions: Paving the way for successful clinical outcomes. Med 3, 538–564. 10.1016/j.medj.2022.05.001. [DOI] [PubMed] [Google Scholar]
20.Brudno JN, and Kochenderfer JN (2024). Current understanding and management of CAR T cell-associated toxicities. Nat Rev Clin Oncol 21, 501–521. 10.1038/s41571-024-00903-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Lin MY, Nam E, Shih RM, Shafer A, Bouren A, Ayala Ceja M, Harris C, Khericha M, Vo KH, Kim M, et al. (2024). Self-regulating CAR-T cells modulate cytokine release syndrome in adoptive T-cell therapy. J Exp Med 221. 10.1084/jem.20221988. [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Frigault MJ, Lee J, Basil MC, Carpenito C, Motohashi S, Scholler J, Kawalekar OU, Guedan S, McGettigan SE, Posey AD Jr., et al. (2015). Identification of chimeric antigen receptors that mediate constitutive or inducible proliferation of T cells. Cancer Immunol Res 3, 356–367. 10.1158/2326-6066.CIR-14-0186. [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Calderon H, Mamonkin M, and Guedan S (2020). Analysis of CAR-Mediated Tonic Signaling. Methods Mol Biol 2086, 223–236. 10.1007/978-1-0716-0146-4_17. [DOI] [PubMed] [Google Scholar]
24.Singh N, Frey NV, Engels B, Barrett DM, Shestova O, Ravikumar P, Cummins KD, Lee YG, Pajarillo R, Chun I, et al. (2021). Antigen-independent activation enhances the efficacy of 4–1BB-costimulated CD22 CAR T cells. Nat Med 27, 842–850. 10.1038/s41591-021-01326-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Wang Y, Gao Y, Niu C, Wang B, Zhao S, Roex G, Qian J, Qie J, Chen L, Yi C, et al. (2022). Chimeric antigen receptor clustering via cysteines enhances T-cell efficacy against tumor. Cancer Immunol Immunother 71, 2801–2814. 10.1007/s00262-022-03195-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Chen X, Chen LC, Khericha M, Meng X, Salvestrini E, Shafer A, Iyer N, Alag AS, Ding Y, Nicolaou DM, and Chen YY (2023). Rational Protein Design Yields a CD20 CAR with Superior Antitumor Efficacy Compared with CD19 CAR. Cancer Immunol Res 11, 150–163. 10.1158/2326-6066.CIR-22-0504. [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Chang JF, Landmann JH, Chang TC, Selli ME, Tenzin Y, Warrington JM, Ritchey J, Hsu YS, Slade M, Gupta DK, et al. (2024). Rational Protein Engineering to Enhance MHC-Independent T-cell Receptors. Cancer Discov 14, 2109–2121. 10.1158/2159-8290.CD-23-1393. [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Lakhani A, Chen X, Chen LC, Hong M, Khericha M, Chen Y, Chen YY, and Park JO (2024). Extracellular domains of CARs reprogramme T cell metabolism without antigen stimulation. Nat Metab 6, 1143–1160. 10.1038/s42255-024-01034-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Adachi K, Kano Y, Nagai T, Okuyama N, Sakoda Y, and Tamada K (2018). IL-7 and CCL19 expression in CAR-T cells improves immune cell infiltration and CAR-T cell survival in the tumor. Nature Biotechnology 36, 346–351. 10.1038/nbt.4086. [DOI] [PubMed] [Google Scholar]
30.Cai Z, Kishimoto H, Brunmark A, Jackson MR, Peterson PA, and Sprent J (1997). Requirements for peptide-induced T cell receptor downregulation on naive CD8+ T cells. J Exp Med 185, 641–651. 10.1084/jem.185.4.641. [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Valitutti S, Muller S, Salio M, and Lanzavecchia A (1997). Degradation of T cell receptor (TCR)-CD3-zeta complexes after antigenic stimulation. J Exp Med 185, 1859–1864. 10.1084/jem.185.10.1859. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Liu H, Rhodes M, Wiest DL, and Vignali DA (2000). On the dynamics of TCR:CD3 complex cell surface expression and downmodulation. Immunity 13, 665–675. 10.1016/s1074-7613(00)00066-2. [DOI] [PubMed] [Google Scholar]
33.Huovila AP, Turner AJ, Pelto-Huikko M, Karkkainen I, and Ortiz RM (2005). Shedding light on ADAM metalloproteinases. Trends Biochem Sci 30, 413–422. 10.1016/j.tibs.2005.05.006. [DOI] [PubMed] [Google Scholar]
34.Lichtenthaler SF, Lemberg MK, and Fluhrer R (2018). Proteolytic ectodomain shedding of membrane proteins in mammals-hardware, concepts, and recent developments. EMBO J 37. 10.15252/embj.201899456. [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Wang Z, Li W, Chen S, and Tang XX (2023). Role of ADAM and ADAMTS proteases in pathological tissue remodeling. Cell Death Discov 9, 447. 10.1038/s41420-023-01744-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Xanthoulea S, Pasparakis M, Kousteni S, Brakebusch C, Wallach D, Bauer J, Lassmann H, and Kollias G (2004). Tumor necrosis factor (TNF) receptor shedding controls thresholds of innate immune activation that balance opposing TNF functions in infectious and inflammatory diseases. J Exp Med 200, 367–376. 10.1084/jem.20040435. [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Le Gall SM, Bobe P, Reiss K, Horiuchi K, Niu XD, Lundell D, Gibb DR, Conrad D, Saftig P, and Blobel CP (2009). ADAMs 10 and 17 represent differentially regulated components of a general shedding machinery for membrane proteins such as transforming growth factor alpha, L-selectin, and tumor necrosis factor alpha. Mol Biol Cell 20, 1785–1794. 10.1091/mbc.e08-11-1135. [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Weber S, and Saftig P (2012). Ectodomain shedding and ADAMs in development. Development 139, 3693–3709. 10.1242/dev.076398. [DOI] [PubMed] [Google Scholar]
39.Tsumagari K, Chang CH, and Ishihama Y (2021). Exploring the landscape of ectodomain shedding by quantitative protein terminomics. iScience 24, 102259. 10.1016/j.isci.2021.102259. [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Le Gall SM, Maretzky T, Issuree PD, Niu XD, Reiss K, Saftig P, Khokha R, Lundell D, and Blobel CP (2010). ADAM17 is regulated by a rapid and reversible mechanism that controls access to its catalytic site. J Cell Sci 123, 3913–3922. 10.1242/jcs.069997. [DOI] [PMC free article] [PubMed] [Google Scholar]
41.O’Neil-Andersen NJ, and Lawrence DA (2002). Differential modulation of surface and intracellular protein expression by T cells after stimulation in the presence of monensin or brefeldin A. Clin Diagn Lab Immunol 9, 243–250. 10.1128/cdli.9.2.243-250.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Rohrer J, Schweizer A, Russell D, and Kornfeld S (1996). The targeting of Lamp1 to lysosomes is dependent on the spacing of its cytoplasmic tail tyrosine sorting motif relative to the membrane. J Cell Biol 132, 565–576. 10.1083/jcb.132.4.565. [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Shatrova AN, Mityushova EV, Vassilieva IO, Aksenov ND, Zenin VV, Nikolsky NN, and Marakhova II (2016). Time-Dependent Regulation of IL-2R alpha-Chain (CD25) Expression by TCR Signal Strength and IL-2-Induced STAT5 Signaling in Activated Human Blood T Lymphocytes. PLoS One 11, e0167215. 10.1371/journal.pone.0167215. [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Baaten BJ, Li CR, and Bradley LM (2010). Multifaceted regulation of T cells by CD44. Commun Integr Biol 3, 508–512. 10.4161/cib.3.6.13495. [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Stamenkovic I, and Yu Q (2009). Shedding light on proteolytic cleavage of CD44: the responsible sheddase and functional significance of shedding. J Invest Dermatol 129, 1321–1324. 10.1038/jid.2009.13. [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Pedersen AE, and Lauritsen JP (2009). CD25 shedding by human natural occurring CD4+CD25+ regulatory T cells does not inhibit the action of IL-2. Scand J Immunol 70, 40–43. 10.1111/j.1365-3083.2009.02268.x. [DOI] [PubMed] [Google Scholar]
47.Yang S, Liu F, Wang QJ, Rosenberg SA, and Morgan RA (2011). The shedding of CD62L (L-selectin) regulates the acquisition of lytic activity in human tumor reactive T lymphocytes. PLoS One 6, e22560. 10.1371/journal.pone.0022560. [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Sun L, Jiao A, Liu H, Ding R, Yuan N, Yang B, Zhang C, Jia X, Wang G, Su Y, et al. (2024). Targeting a disintegrin and metalloprotease (ADAM) 17-CD122 axis enhances CD8(+) T cell effector differentiation and anti-tumor immunity. Signal Transduct Target Ther 9, 152. 10.1038/s41392-024-01873-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Guerrero JA, Klysz DD, Chen Y, Malipatlolla M, Lone J, Fowler C, Stuani L, May A, Bashti M, Xu P, et al. (2024). GLUT1 overexpression in CAR-T cells induces metabolic reprogramming and enhances potency. Nat Commun 15, 8658. 10.1038/s41467-024-52666-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Huang WY, and Wu KP (2023). SheddomeDB 2023: A Revision of an Ectodomain Shedding Database Based on a Comprehensive Literature Review and Online Resources. J Proteome Res 22, 2570–2576. 10.1021/acs.jproteome.3c00001. [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Rawlings ND, Barrett AJ, Thomas PD, Huang X, Bateman A, and Finn RD (2018). The MEROPS database of proteolytic enzymes, their substrates and inhibitors in 2017 and a comparison with peptidases in the PANTHER database. Nucleic Acids Res 46, D624–D632. 10.1093/nar/gkx1134. [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Hundhausen C, Misztela D, Berkhout TA, Broadway N, Saftig P, Reiss K, Hartmann D, Fahrenholz F, Postina R, Matthews V, et al. (2003). The disintegrin-like metalloproteinase ADAM10 is involved in constitutive cleavage of CX3CL1 (fractalkine) and regulates CX3CL1mediated cell-cell adhesion. Blood 102, 1186–1195. 10.1182/blood-2002-12-3775. [DOI] [PubMed] [Google Scholar]
53.Sahin U, Weskamp G, Kelly K, Zhou HM, Higashiyama S, Peschon J, Hartmann D, Saftig P, and Blobel CP (2004). Distinct roles for ADAM10 and ADAM17 in ectodomain shedding of six EGFR ligands. J Cell Biol 164, 769–779. 10.1083/jcb.200307137. [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Crawford HC, Dempsey PJ, Brown G, Adam L, and Moss ML (2009). ADAM10 as a therapeutic target for cancer and inflammation. Curr Pharm Des 15, 2288–2299. 10.2174/138161209788682442. [DOI] [PubMed] [Google Scholar]
55.Calligaris M, Cuffaro D, Bonelli S, Spano DP, Rossello A, Nuti E, and Scilabra SD (2021). Strategies to Target ADAM17 in Disease: From its Discovery to the iRhom Revolution. Molecules 26. 10.3390/molecules26040944. [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Kahn J, Ingraham RH, Shirley F, Migaki GI, and Kishimoto TK (1994). Membrane proximal cleavage of L-selectin: identification of the cleavage site and a 6-kD transmembrane peptide fragment of L-selectin. J Cell Biol 125, 461–470. 10.1083/jcb.125.2.461. [DOI] [PMC free article] [PubMed] [Google Scholar]
57.Sommer A, Kordowski F, Buch J, Maretzky T, Evers A, Andra J, Dusterhoft S, Michalek M, Lorenzen I, Somasundaram P, et al. (2016). Phosphatidylserine exposure is required for ADAM17 sheddase function. Nat Commun 7, 11523. 10.1038/ncomms11523. [DOI] [PMC free article] [PubMed] [Google Scholar]
58.Lorenzen I, Lokau J, Korpys Y, Oldefest M, Flynn CM, Kunzel U, Garbers C, Freeman M, Grotzinger J, and Dusterhoft S (2016). Control of ADAM17 activity by regulation of its cellular localisation. Sci Rep 6, 35067. 10.1038/srep35067. [DOI] [PMC free article] [PubMed] [Google Scholar]
59.Ludwig A, Hundhausen C, Lambert MH, Broadway N, Andrews RC, Bickett DM, Leesnitzer MA, and Becherer JD (2005). Metalloproteinase inhibitors for the disintegrin-like metalloproteinases ADAM10 and ADAM17 that differentially block constitutive and phorbol ester-inducible shedding of cell surface molecules. Comb Chem High Throughput Screen 8, 161–171. 10.2174/1386207053258488. [DOI] [PubMed] [Google Scholar]
60.Seifert A, Dusterhoft S, Wozniak J, Koo CZ, Tomlinson MG, Nuti E, Rossello A, Cuffaro D, Yildiz D, and Ludwig A (2021). The metalloproteinase ADAM10 requires its activity to sustain surface expression. Cell Mol Life Sci 78, 715–732. 10.1007/s00018-020-03507-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
61.Lynn RC, Weber EW, Sotillo E, Gennert D, Xu P, Good Z, Anbunathan H, Lattin J, Jones R, Tieu V, et al. (2019). c-Jun overexpression in CAR T cells induces exhaustion resistance. Nature 576, 293–300. 10.1038/s41586-019-1805-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
62.Weber EW, Parker KR, Sotillo E, Lynn RC, Anbunathan H, Lattin J, Good Z, Belk JA, Daniel B, Klysz D, et al. (2021). Transient rest restores functionality in exhausted CAR-T cells through epigenetic remodeling. Science 372. 10.1126/science.aba1786. [DOI] [PMC free article] [PubMed] [Google Scholar]
63.Weber EW, Lynn RC, Sotillo E, Lattin J, Xu P, and Mackall CL (2019). Pharmacologic control of CAR-T cell function using dasatinib. Blood Adv 3, 711–717. 10.1182/bloodadvances.2018028720. [DOI] [PMC free article] [PubMed] [Google Scholar]
64.Omilusik KD, Best JA, Yu B, Goossens S, Weidemann A, Nguyen JV, Seuntjens E, Stryjewska A, Zweier C, Roychoudhuri R, et al. (2015). Transcriptional repressor ZEB2 promotes terminal differentiation of CD8+ effector and memory T cell populations during infection. J Exp Med 212, 2027–2039. 10.1084/jem.20150194. [DOI] [PMC free article] [PubMed] [Google Scholar]
65.Wu Z, Gao S, Watanabe N, Batchu S, Kajigaya S, Diamond C, Alemu L, Raffo DQ, Feng X, Hoffmann P, et al. (2022). Single-cell profiling of T lymphocytes in deficiency of adenosine deaminase 2. J Leukoc Biol 111, 301–312. 10.1002/JLB.5A0621-314R. [DOI] [PubMed] [Google Scholar]
66.Roddie C, Dias J, O’Reilly MA, Abbasian M, Cadinanos-Garai A, Vispute K, Bosshard-Carter L, Mitsikakou M, Mehra V, Roddy H, et al. (2021). Durable Responses and Low Toxicity After Fast Off-Rate CD19 Chimeric Antigen Receptor-T Therapy in Adults With Relapsed or Refractory B-Cell Acute Lymphoblastic Leukemia. J Clin Oncol 39, 3352–3363. 10.1200/JCO.21.00917. [DOI] [PMC free article] [PubMed] [Google Scholar]
67.Zhang Y, Patel RP, Kim KH, Cho H, Jo JC, Jeong SH, Oh SY, Choi YS, Kim SH, Lee JH, et al. (2023). Safety and efficacy of a novel anti-CD19 chimeric antigen receptor T cell product targeting a membrane-proximal domain of CD19 with fast on- and off-rates against non-Hodgkin lymphoma: a first-in-human study. Mol Cancer 22, 200. 10.1186/s12943-023-01886-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
68.Trebak M, and Kinet JP (2019). Calcium signalling in T cells. Nat Rev Immunol 19, 154–169. 10.1038/s41577-018-0110-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
69.Martinez GJ, Pereira RM, Aijo T, Kim EY, Marangoni F, Pipkin ME, Togher S, Heissmeyer V, Zhang YC, Crotty S, et al. (2015). The transcription factor NFAT promotes exhaustion of activated CD8(+) T cells. Immunity 42, 265–278. 10.1016/j.immuni.2015.01.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
70.Ajina A, and Maher J (2018). Strategies to Address Chimeric Antigen Receptor Tonic Signaling. Mol Cancer Ther 17, 1795–1815. 10.1158/1535-7163.MCT-17-1097. [DOI] [PMC free article] [PubMed] [Google Scholar]
71.Chen J, Qiu S, Li W, Wang K, Zhang Y, Yang H, Liu B, Li G, Li L, Chen M, et al. (2023). Tuning charge density of chimeric antigen receptor optimizes tonic signaling and CAR-T cell fitness. Cell Res 33, 341–354. 10.1038/s41422-023-00789-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
72.Donaldson JM, Kari C, Fragoso RC, Rodeck U, and Williams JC (2009). Design and development of masked therapeutic antibodies to limit off-target effects: application to anti-EGFR antibodies. Cancer Biol Ther 8, 2147–2152. 10.4161/cbt.8.22.9765. [DOI] [PMC free article] [PubMed] [Google Scholar]
73.Han X, Bryson PD, Zhao Y, Cinay GE, Li S, Guo Y, Siriwon N, and Wang P (2017). Masked Chimeric Antigen Receptor for Tumor-Specific Activation. Mol Ther 25, 274–284. 10.1016/j.ymthe.2016.10.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
74.Lebar T, Lainscek D, Merljak E, Aupic J, and Jerala R (2020). A tunable orthogonal coiled-coil interaction toolbox for engineering mammalian cells. Nat Chem Biol 16, 513–519. 10.1038/s41589-019-0443-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
75.Schumann K, Lin S, Boyer E, Simeonov DR, Subramaniam M, Gate RE, Haliburton GE, Ye CJ, Bluestone JA, Doudna JA, and Marson A (2015). Generation of knock-in primary human T cells using Cas9 ribonucleoproteins. Proc Natl Acad Sci U S A 112, 10437–10442. 10.1073/pnas.1512503112. [DOI] [PMC free article] [PubMed] [Google Scholar]
76.Freitas KA, Belk JA, Sotillo E, Quinn PJ, Ramello MC, Malipatlolla M, Daniel B, Sandor K, Klysz D, Bjelajac J, et al. (2022). Enhanced T cell effector activity by targeting the Mediator kinase module. Science 378, eabn5647. 10.1126/science.abn5647. [DOI] [PMC free article] [PubMed] [Google Scholar]
77.Belk JA, Yao W, Ly N, Freitas KA, Chen YT, Shi Q, Valencia AM, Shifrut E, Kale N, Yost KE, et al. (2022). Genome-wide CRISPR screens of T cell exhaustion identify chromatin remodeling factors that limit T cell persistence. Cancer Cell 40, 768–786 e767. 10.1016/j.ccell.2022.06.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
78.Rieux-Laucat F, Le Deist F, Hivroz C, Roberts IA, Debatin KM, Fischer A, and de Villartay JP (1995). Mutations in Fas associated with human lymphoproliferative syndrome and autoimmunity. Science 268, 1347–1349. 10.1126/science.7539157. [DOI] [PubMed] [Google Scholar]
79.Holzelova E, Vonarbourg C, Stolzenberg MC, Arkwright PD, Selz F, Prieur AM, Blanche S, Bartunkova J, Vilmer E, Fischer A, et al. (2004). Autoimmune lymphoproliferative syndrome with somatic Fas mutations. N Engl J Med 351, 1409–1418. 10.1056/NEJMoa040036. [DOI] [PubMed] [Google Scholar]
80.Stuber T, Monjezi R, Wallstabe L, Kuhnemundt J, Nietzer SL, Dandekar G, Wockel A, Einsele H, Wischhusen J, and Hudecek M (2020). Inhibition of TGF-beta-receptor signaling augments the antitumor function of ROR1-specific CAR T-cells against triple-negative breast cancer. J Immunother Cancer 8. 10.1136/jitc-2020-000676. [DOI] [PMC free article] [PubMed] [Google Scholar]
81.Narayan V, Barber-Rotenberg JS, Jung IY, Lacey SF, Rech AJ, Davis MM, Hwang WT, Lal P, Carpenter EL, Maude SL, et al. (2022). PSMA-targeting TGFbeta-insensitive armored CAR T cells in metastatic castration-resistant prostate cancer: a phase 1 trial. Nat Med 28, 724–734. 10.1038/s41591-022-01726-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
82.Deng Z, Fan T, Xiao C, Tian H, Zheng Y, Li C, and He J (2024). TGF-beta signaling in health, disease, and therapeutics. Signal Transduct Target Ther 9, 61. 10.1038/s41392-024-01764-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
83.Brown CE, Hibbard JC, Alizadeh D, Blanchard MS, Natri HM, Wang D, Ostberg JR, Aguilar B, Wagner JR, Paul JA, et al. (2024). Locoregional delivery of IL-13Ralpha2-targeting CAR-T cells in recurrent high-grade glioma: a phase 1 trial. Nat Med 30, 1001–1012. 10.1038/s41591-024-02875-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
84.Bagley SJ, Desai AS, Fraietta JA, Silverbush D, Chafamo D, Freeburg NF, Gopikrishna GK, Rech AJ, Nabavizadeh A, Bagley LJ, et al. (2025). Intracerebroventricular bivalent CAR T cells targeting EGFR and IL-13Ralpha2 in recurrent glioblastoma: a phase 1 trial. Nat Med 31, 2778–2787. 10.1038/s41591-025-03745-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
85.Steffin D, Ghatwai N, Montalbano A, Rathi P, Courtney AN, Arnett AB, Fleurence J, Sweidan R, Wang T, Zhang H, et al. (2025). Interleukin-15-armoured GPC3 CAR T cells for patients with solid cancers. Nature 637, 940–946. 10.1038/s41586-024-08261-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
86.Qi C, Liu C, Peng Z, Zhang Y, Wei J, Qiu W, Zhang X, Pan H, Niu Z, Qiu M, et al. (2025). Claudin-18 isoform 2-specific CAR T-cell therapy (satri-cel) versus treatment of physician’s choice for previously treated advanced gastric or gastro-oesophageal junction cancer (CT041-ST-01): a randomised, open-label, phase 2 trial. Lancet 405, 2049–2060. 10.1016/S0140-6736(25)00860-8. [DOI] [PubMed] [Google Scholar]
87.Kouro T, Himuro H, and Sasada T (2022). Exhaustion of CAR T cells: potential causes and solutions. J Transl Med 20, 239. 10.1186/s12967-022-03442-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
88.Ledergor G, Fan Z, Wu K, McCarthy E, Hyrenius-Wittsten A, Starzinski A, Chang H, Bridge M, Kwek S, Cheung A, et al. (2024). CD4+ CAR T-cell exhaustion associated with early relapse of multiple myeloma after BCMA CAR T-cell therapy. Blood Adv 8, 3562–3575. 10.1182/bloodadvances.2023012416. [DOI] [PMC free article] [PubMed] [Google Scholar]
89.Chen J, Lopez-Moyado IF, Seo H, Lio CJ, Hempleman LJ, Sekiya T, Yoshimura A, Scott-Browne JP, and Rao A (2019). NR4A transcription factors limit CAR T cell function in solid tumours. Nature 567, 530–534. 10.1038/s41586-019-0985-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
90.Roybal KT, Williams JZ, Morsut L, Rupp LJ, Kolinko I, Choe JH, Walker WJ, McNally KA, and Lim WA (2016). Engineering T Cells with Customized Therapeutic Response Programs Using Synthetic Notch Receptors. Cell 167, 419–432 e416. 10.1016/j.cell.2016.09.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
91.Zhu I, Liu R, Garcia JM, Hyrenius-Wittsten A, Piraner DI, Alavi J, Israni DV, Liu B, Khalil AS, and Roybal KT (2022). Modular design of synthetic receptors for programmed gene regulation in cell therapies. Cell 185, 1431–1443 e1416. 10.1016/j.cell.2022.03.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
92.Cho JH, Collins JJ, and Wong WW (2018). Universal Chimeric Antigen Receptors for Multiplexed and Logical Control of T Cell Responses. Cell 173, 1426–1438 e1411. 10.1016/j.cell.2018.03.038. [DOI] [PMC free article] [PubMed] [Google Scholar]
93.Lee S, Khalil AS, and Wong WW (2022). Recent progress of gene circuit designs in immune cell therapies. Cell Syst 13, 864–873. 10.1016/j.cels.2022.09.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
94.Hogl S, Kuhn PH, Colombo A, and Lichtenthaler SF (2011). Determination of the proteolytic cleavage sites of the amyloid precursor-like protein 2 by the proteases ADAM10, BACE1 and gamma-secretase. PLoS One 6, e21337. 10.1371/journal.pone.0021337. [DOI] [PMC free article] [PubMed] [Google Scholar]
95.Seegar TCM, Killingsworth LB, Saha N, Meyer PA, Patra D, Zimmerman B, Janes PW, Rubinstein E, Nikolov DB, Skiniotis G, et al. (2017). Structural Basis for Regulated Proteolysis by the alpha-Secretase ADAM10. Cell 171, 1638–1648 e1637. 10.1016/j.cell.2017.11.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
96.Seo H, Chen J, Gonzalez-Avalos E, Samaniego-Castruita D, Das A, Wang YH, Lopez-Moyado IF, Georges RO, Zhang W, Onodera A, et al. (2019). TOX and TOX2 transcription factors cooperate with NR4A transcription factors to impose CD8(+) T cell exhaustion. Proc Natl Acad Sci U S A 116, 12410–12415. 10.1073/pnas.1905675116. [DOI] [PMC free article] [PubMed] [Google Scholar]
97.Jena B, Maiti S, Huls H, Singh H, Lee DA, Champlin RE, and Cooper LJ (2013). Chimeric antigen receptor (CAR)-specific monoclonal antibody to detect CD19-specific T cells in clinical trials. PLoS One 8, e57838. 10.1371/journal.pone.0057838. [DOI] [PMC free article] [PubMed] [Google Scholar]
98.Sen G, Chakraborty M, Foon KA, Reisfeld RA, and Bhattacharya-Chatterjee MB (1998). Induction of IgG antibodies by an anti-idiotype antibody mimicking disialoganglioside GD2. J Immunother 21, 75–83. 10.1097/00002371-199801000-00010. [DOI] [PubMed] [Google Scholar]
99.Labanieh L, Majzner RG, Klysz D, Sotillo E, Fisher CJ, Vilches-Moure JG, Pacheco KZB, Malipatlolla M, Xu P, Hui JH, et al. (2022). Enhanced safety and efficacy of protease-regulated CAR-T cell receptors. Cell 185, 1745–1763 e1722. 10.1016/j.cell.2022.03.041. [DOI] [PMC free article] [PubMed] [Google Scholar]
100.Majzner RG, Theruvath JL, Nellan A, Heitzeneder S, Cui Y, Mount CW, Rietberg SP, Linde MH, Xu P, Rota C, et al. (2019). CAR T Cells Targeting B7-H3, a Pan-Cancer Antigen, Demonstrate Potent Preclinical Activity Against Pediatric Solid Tumors and Brain Tumors. Clin Cancer Res 25, 2560–2574. 10.1158/1078-0432.CCR-18-0432. [DOI] [PMC free article] [PubMed] [Google Scholar]
101.Walker AJ, Majzner RG, Zhang L, Wanhainen K, Long AH, Nguyen SM, Lopomo P, Vigny M, Fry TJ, Orentas RJ, and Mackall CL (2017). Tumor Antigen and Receptor Densities Regulate Efficacy of a Chimeric Antigen Receptor Targeting Anaplastic Lymphoma Kinase. Mol Ther 25, 2189–2201. 10.1016/j.ymthe.2017.06.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
102.Jutz S, Leitner J, Schmetterer K, Doel-Perez I, Majdic O, Grabmeier-Pfistershammer K, Paster W, Huppa JB, and Steinberger P (2016). Assessment of costimulation and coinhibition in a triple parameter T cell reporter line: Simultaneous measurement of NF-kappaB, NFAT and AP-1. J Immunol Methods 430, 10–20. 10.1016/j.jim.2016.01.007. [DOI] [PubMed] [Google Scholar]
103.Shaner NC, Lambert GG, Chammas A, Ni Y, Cranfill PJ, Baird MA, Sell BR, Allen JR, Day RN, Israelsson M, et al. (2013). A bright monomeric green fluorescent protein derived from Branchiostoma lanceolatum. Nat Methods 10, 407–409. 10.1038/nmeth.2413. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

NIHMS2176700-supplement-1.xlsx^{(57KB, xlsx)}

NIHMS2176700-supplement-2.xlsx^{(42.9KB, xlsx)}

NIHMS2176700-supplement-3.xlsx^{(13.1KB, xlsx)}

NIHMS2176700-supplement-4.pdf^{(13.8MB, pdf)}

Data Availability Statement

RNA-seq data have been deposited at GEO at GEO:GSE328715 and are publicly available as of the date of publication.
This paper does not report original code.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

[R1] 1.Schuster SJ, Svoboda J, Chong EA, Nasta SD, Mato AR, Anak O, Brogdon JL, Pruteanu-Malinici I, Bhoj V, Landsburg D, et al. (2017). Chimeric Antigen Receptor T Cells in Refractory B-Cell Lymphomas. N Engl J Med 377, 2545–2554. 10.1056/NEJMoa1708566. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R2] 2.Maude SL, Laetsch TW, Buechner J, Rives S, Boyer M, Bittencourt H, Bader P, Verneris MR, Stefanski HE, Myers GD, et al. (2018). Tisagenlecleucel in Children and Young Adults with B-Cell Lymphoblastic Leukemia. N Engl J Med 378, 439–448. 10.1056/NEJMoa1709866. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R3] 3.Raje N, Berdeja J, Lin Y, Siegel D, Jagannath S, Madduri D, Liedtke M, Rosenblatt J, Maus MV, Turka A, et al. (2019). Anti-BCMA CAR T-Cell Therapy bb2121 in Relapsed or Refractory Multiple Myeloma. N Engl J Med 380, 1726–1737. 10.1056/NEJMoa1817226. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R4] 4.Nastoupil LJ, Jain MD, Feng L, Spiegel JY, Ghobadi A, Lin Y, Dahiya S, Lunning M, Lekakis L, Reagan P, et al. (2020). Standard-of-Care Axicabtagene Ciloleucel for Relapsed or Refractory Large B-Cell Lymphoma: Results From the US Lymphoma CAR T Consortium. J Clin Oncol 38, 3119–3128. 10.1200/JCO.19.02104. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R5] 5.Berdeja JG, Madduri D, Usmani SZ, Jakubowiak A, Agha M, Cohen AD, Stewart AK, Hari P, Htut M, Lesokhin A, et al. (2021). Ciltacabtagene autoleucel, a B-cell maturation antigen-directed chimeric antigen receptor T-cell therapy in patients with relapsed or refractory multiple myeloma (CARTITUDE-1): a phase 1b/2 open-label study. Lancet 398, 314–324. 10.1016/S0140-6736(21)00933-8. [DOI] [PubMed] [Google Scholar]

[R6] 6.Locke FL, Miklos DB, Jacobson CA, Perales MA, Kersten MJ, Oluwole OO, Ghobadi A, Rapoport AP, McGuirk J, Pagel JM, et al. (2022). Axicabtagene Ciloleucel as Second-Line Therapy for Large B-Cell Lymphoma. N Engl J Med 386, 640–654. 10.1056/NEJMoa2116133. [DOI] [PubMed] [Google Scholar]

[R7] 7.Schultz LM, Baggott C, Prabhu S, Pacenta HL, Phillips CL, Rossoff J, Stefanski HE, Talano JA, Moskop A, Margossian SP, et al. (2022). Disease Burden Affects Outcomes in Pediatric and Young Adult B-Cell Lymphoblastic Leukemia After Commercial Tisagenlecleucel: A Pediatric Real-World Chimeric Antigen Receptor Consortium Report. J Clin Oncol 40, 945–955. 10.1200/JCO.20.03585. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R8] 8.Labanieh L, and Mackall CL (2023). CAR immune cells: design principles, resistance and the next generation. Nature 614, 635–648. 10.1038/s41586-023-05707-3. [DOI] [PubMed] [Google Scholar]

[R9] 9.Frank MJ, Baird JH, Kramer AM, Srinagesh HK, Patel S, Brown AK, Oak JS, Younes SF, Natkunam Y, Hamilton MP, et al. (2024). CD22-directed CAR T-cell therapy for large B-cell lymphomas progressing after CD19-directed CAR T-cell therapy: a dose-finding phase 1 study. Lancet 404, 353–363. 10.1016/S0140-6736(24)00746-3. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R10] 10.Choi BD, Gerstner ER, Frigault MJ, Leick MB, Mount CW, Balaj L, Nikiforow S, Carter BS, Curry WT, Gallagher K, and Maus MV (2024). Intraventricular CARv3-TEAM-E T Cells in Recurrent Glioblastoma. N Engl J Med 390, 1290–1298. 10.1056/NEJMoa2314390. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R11] 11.Monje M, Mahdi J, Majzner R, Yeom KW, Schultz LM, Richards RM, Barsan V, Song KW, Kamens J, Baggott C, et al. (2025). Intravenous and intracranial GD2-CAR T cells for H3K27M(+) diffuse midline gliomas. Nature 637, 708–715. 10.1038/s41586-024-08171-9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R12] 12.Long AH, Haso WM, Shern JF, Wanhainen KM, Murgai M, Ingaramo M, Smith JP, Walker AJ, Kohler ME, Venkateshwara VR, et al. (2015). 4–1BB costimulation ameliorates T cell exhaustion induced by tonic signaling of chimeric antigen receptors. Nat Med 21, 581–590. 10.1038/nm.3838. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R13] 13.Fraietta JA, Lacey SF, Orlando EJ, Pruteanu-Malinici I, Gohil M, Lundh S, Boesteanu AC, Wang Y, O’Connor RS, Hwang WT, et al. (2018). Determinants of response and resistance to CD19 chimeric antigen receptor (CAR) T cell therapy of chronic lymphocytic leukemia. Nat Med 24, 563–571. 10.1038/s41591-018-0010-1. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R14] 14.Delgoffe GM, Xu C, Mackall CL, Green MR, Gottschalk S, Speiser DE, Zehn D, and Beavis PA (2021). The role of exhaustion in CAR T cell therapy. Cancer Cell 39, 885–888. 10.1016/j.ccell.2021.06.012. [DOI] [PubMed] [Google Scholar]

[R15] 15.Good CR, Aznar MA, Kuramitsu S, Samareh P, Agarwal S, Donahue G, Ishiyama K, Wellhausen N, Rennels AK, Ma Y, et al. (2021). An NK-like CAR T cell transition in CAR T cell dysfunction. Cell 184, 6081–6100 e6026. 10.1016/j.cell.2021.11.016. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R16] 16.Selli ME, Landmann JH, Terekhova M, Lattin J, Heard A, Hsu YS, Chang TC, Chang J, Warrington J, Ha H, et al. (2023). Costimulatory domains direct distinct fates of CAR-driven T-cell dysfunction. Blood 141, 3153–3165. 10.1182/blood.2023020100. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R17] 17.Harris DT, Hager MV, Smith SN, Cai Q, Stone JD, Kruger P, Lever M, Dushek O, Schmitt TM, Greenberg PD, and Kranz DM (2018). Comparison of T Cell Activities Mediated by Human TCRs and CARs That Use the Same Recognition Domains. J Immunol 200, 1088–1100. 10.4049/jimmunol.1700236. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R18] 18.Majzner RG, Rietberg SP, Sotillo E, Dong R, Vachharajani VT, Labanieh L, Myklebust JH, Kadapakkam M, Weber EW, Tousley AM, et al. (2020). Tuning the Antigen Density Requirement for CAR T-cell Activity. Cancer Discov 10, 702–723. 10.1158/2159-8290.CD-19-0945. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R19] 19.Korell F, Berger TR, and Maus MV (2022). Understanding CAR T cell-tumor interactions: Paving the way for successful clinical outcomes. Med 3, 538–564. 10.1016/j.medj.2022.05.001. [DOI] [PubMed] [Google Scholar]

[R20] 20.Brudno JN, and Kochenderfer JN (2024). Current understanding and management of CAR T cell-associated toxicities. Nat Rev Clin Oncol 21, 501–521. 10.1038/s41571-024-00903-0. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R21] 21.Lin MY, Nam E, Shih RM, Shafer A, Bouren A, Ayala Ceja M, Harris C, Khericha M, Vo KH, Kim M, et al. (2024). Self-regulating CAR-T cells modulate cytokine release syndrome in adoptive T-cell therapy. J Exp Med 221. 10.1084/jem.20221988. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R22] 22.Frigault MJ, Lee J, Basil MC, Carpenito C, Motohashi S, Scholler J, Kawalekar OU, Guedan S, McGettigan SE, Posey AD Jr., et al. (2015). Identification of chimeric antigen receptors that mediate constitutive or inducible proliferation of T cells. Cancer Immunol Res 3, 356–367. 10.1158/2326-6066.CIR-14-0186. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R23] 23.Calderon H, Mamonkin M, and Guedan S (2020). Analysis of CAR-Mediated Tonic Signaling. Methods Mol Biol 2086, 223–236. 10.1007/978-1-0716-0146-4_17. [DOI] [PubMed] [Google Scholar]

[R24] 24.Singh N, Frey NV, Engels B, Barrett DM, Shestova O, Ravikumar P, Cummins KD, Lee YG, Pajarillo R, Chun I, et al. (2021). Antigen-independent activation enhances the efficacy of 4–1BB-costimulated CD22 CAR T cells. Nat Med 27, 842–850. 10.1038/s41591-021-01326-5. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R25] 25.Wang Y, Gao Y, Niu C, Wang B, Zhao S, Roex G, Qian J, Qie J, Chen L, Yi C, et al. (2022). Chimeric antigen receptor clustering via cysteines enhances T-cell efficacy against tumor. Cancer Immunol Immunother 71, 2801–2814. 10.1007/s00262-022-03195-4. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R26] 26.Chen X, Chen LC, Khericha M, Meng X, Salvestrini E, Shafer A, Iyer N, Alag AS, Ding Y, Nicolaou DM, and Chen YY (2023). Rational Protein Design Yields a CD20 CAR with Superior Antitumor Efficacy Compared with CD19 CAR. Cancer Immunol Res 11, 150–163. 10.1158/2326-6066.CIR-22-0504. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R27] 27.Chang JF, Landmann JH, Chang TC, Selli ME, Tenzin Y, Warrington JM, Ritchey J, Hsu YS, Slade M, Gupta DK, et al. (2024). Rational Protein Engineering to Enhance MHC-Independent T-cell Receptors. Cancer Discov 14, 2109–2121. 10.1158/2159-8290.CD-23-1393. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R28] 28.Lakhani A, Chen X, Chen LC, Hong M, Khericha M, Chen Y, Chen YY, and Park JO (2024). Extracellular domains of CARs reprogramme T cell metabolism without antigen stimulation. Nat Metab 6, 1143–1160. 10.1038/s42255-024-01034-7. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R29] 29.Adachi K, Kano Y, Nagai T, Okuyama N, Sakoda Y, and Tamada K (2018). IL-7 and CCL19 expression in CAR-T cells improves immune cell infiltration and CAR-T cell survival in the tumor. Nature Biotechnology 36, 346–351. 10.1038/nbt.4086. [DOI] [PubMed] [Google Scholar]

[R30] 30.Cai Z, Kishimoto H, Brunmark A, Jackson MR, Peterson PA, and Sprent J (1997). Requirements for peptide-induced T cell receptor downregulation on naive CD8+ T cells. J Exp Med 185, 641–651. 10.1084/jem.185.4.641. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R31] 31.Valitutti S, Muller S, Salio M, and Lanzavecchia A (1997). Degradation of T cell receptor (TCR)-CD3-zeta complexes after antigenic stimulation. J Exp Med 185, 1859–1864. 10.1084/jem.185.10.1859. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R32] 32.Liu H, Rhodes M, Wiest DL, and Vignali DA (2000). On the dynamics of TCR:CD3 complex cell surface expression and downmodulation. Immunity 13, 665–675. 10.1016/s1074-7613(00)00066-2. [DOI] [PubMed] [Google Scholar]

[R33] 33.Huovila AP, Turner AJ, Pelto-Huikko M, Karkkainen I, and Ortiz RM (2005). Shedding light on ADAM metalloproteinases. Trends Biochem Sci 30, 413–422. 10.1016/j.tibs.2005.05.006. [DOI] [PubMed] [Google Scholar]

[R34] 34.Lichtenthaler SF, Lemberg MK, and Fluhrer R (2018). Proteolytic ectodomain shedding of membrane proteins in mammals-hardware, concepts, and recent developments. EMBO J 37. 10.15252/embj.201899456. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R35] 35.Wang Z, Li W, Chen S, and Tang XX (2023). Role of ADAM and ADAMTS proteases in pathological tissue remodeling. Cell Death Discov 9, 447. 10.1038/s41420-023-01744-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R36] 36.Xanthoulea S, Pasparakis M, Kousteni S, Brakebusch C, Wallach D, Bauer J, Lassmann H, and Kollias G (2004). Tumor necrosis factor (TNF) receptor shedding controls thresholds of innate immune activation that balance opposing TNF functions in infectious and inflammatory diseases. J Exp Med 200, 367–376. 10.1084/jem.20040435. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R37] 37.Le Gall SM, Bobe P, Reiss K, Horiuchi K, Niu XD, Lundell D, Gibb DR, Conrad D, Saftig P, and Blobel CP (2009). ADAMs 10 and 17 represent differentially regulated components of a general shedding machinery for membrane proteins such as transforming growth factor alpha, L-selectin, and tumor necrosis factor alpha. Mol Biol Cell 20, 1785–1794. 10.1091/mbc.e08-11-1135. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R38] 38.Weber S, and Saftig P (2012). Ectodomain shedding and ADAMs in development. Development 139, 3693–3709. 10.1242/dev.076398. [DOI] [PubMed] [Google Scholar]

[R39] 39.Tsumagari K, Chang CH, and Ishihama Y (2021). Exploring the landscape of ectodomain shedding by quantitative protein terminomics. iScience 24, 102259. 10.1016/j.isci.2021.102259. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R40] 40.Le Gall SM, Maretzky T, Issuree PD, Niu XD, Reiss K, Saftig P, Khokha R, Lundell D, and Blobel CP (2010). ADAM17 is regulated by a rapid and reversible mechanism that controls access to its catalytic site. J Cell Sci 123, 3913–3922. 10.1242/jcs.069997. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R41] 41.O’Neil-Andersen NJ, and Lawrence DA (2002). Differential modulation of surface and intracellular protein expression by T cells after stimulation in the presence of monensin or brefeldin A. Clin Diagn Lab Immunol 9, 243–250. 10.1128/cdli.9.2.243-250.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R42] 42.Rohrer J, Schweizer A, Russell D, and Kornfeld S (1996). The targeting of Lamp1 to lysosomes is dependent on the spacing of its cytoplasmic tail tyrosine sorting motif relative to the membrane. J Cell Biol 132, 565–576. 10.1083/jcb.132.4.565. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R43] 43.Shatrova AN, Mityushova EV, Vassilieva IO, Aksenov ND, Zenin VV, Nikolsky NN, and Marakhova II (2016). Time-Dependent Regulation of IL-2R alpha-Chain (CD25) Expression by TCR Signal Strength and IL-2-Induced STAT5 Signaling in Activated Human Blood T Lymphocytes. PLoS One 11, e0167215. 10.1371/journal.pone.0167215. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R44] 44.Baaten BJ, Li CR, and Bradley LM (2010). Multifaceted regulation of T cells by CD44. Commun Integr Biol 3, 508–512. 10.4161/cib.3.6.13495. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R45] 45.Stamenkovic I, and Yu Q (2009). Shedding light on proteolytic cleavage of CD44: the responsible sheddase and functional significance of shedding. J Invest Dermatol 129, 1321–1324. 10.1038/jid.2009.13. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R46] 46.Pedersen AE, and Lauritsen JP (2009). CD25 shedding by human natural occurring CD4+CD25+ regulatory T cells does not inhibit the action of IL-2. Scand J Immunol 70, 40–43. 10.1111/j.1365-3083.2009.02268.x. [DOI] [PubMed] [Google Scholar]

[R47] 47.Yang S, Liu F, Wang QJ, Rosenberg SA, and Morgan RA (2011). The shedding of CD62L (L-selectin) regulates the acquisition of lytic activity in human tumor reactive T lymphocytes. PLoS One 6, e22560. 10.1371/journal.pone.0022560. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R48] 48.Sun L, Jiao A, Liu H, Ding R, Yuan N, Yang B, Zhang C, Jia X, Wang G, Su Y, et al. (2024). Targeting a disintegrin and metalloprotease (ADAM) 17-CD122 axis enhances CD8(+) T cell effector differentiation and anti-tumor immunity. Signal Transduct Target Ther 9, 152. 10.1038/s41392-024-01873-6. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R49] 49.Guerrero JA, Klysz DD, Chen Y, Malipatlolla M, Lone J, Fowler C, Stuani L, May A, Bashti M, Xu P, et al. (2024). GLUT1 overexpression in CAR-T cells induces metabolic reprogramming and enhances potency. Nat Commun 15, 8658. 10.1038/s41467-024-52666-y. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R50] 50.Huang WY, and Wu KP (2023). SheddomeDB 2023: A Revision of an Ectodomain Shedding Database Based on a Comprehensive Literature Review and Online Resources. J Proteome Res 22, 2570–2576. 10.1021/acs.jproteome.3c00001. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R51] 51.Rawlings ND, Barrett AJ, Thomas PD, Huang X, Bateman A, and Finn RD (2018). The MEROPS database of proteolytic enzymes, their substrates and inhibitors in 2017 and a comparison with peptidases in the PANTHER database. Nucleic Acids Res 46, D624–D632. 10.1093/nar/gkx1134. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R52] 52.Hundhausen C, Misztela D, Berkhout TA, Broadway N, Saftig P, Reiss K, Hartmann D, Fahrenholz F, Postina R, Matthews V, et al. (2003). The disintegrin-like metalloproteinase ADAM10 is involved in constitutive cleavage of CX3CL1 (fractalkine) and regulates CX3CL1mediated cell-cell adhesion. Blood 102, 1186–1195. 10.1182/blood-2002-12-3775. [DOI] [PubMed] [Google Scholar]

[R53] 53.Sahin U, Weskamp G, Kelly K, Zhou HM, Higashiyama S, Peschon J, Hartmann D, Saftig P, and Blobel CP (2004). Distinct roles for ADAM10 and ADAM17 in ectodomain shedding of six EGFR ligands. J Cell Biol 164, 769–779. 10.1083/jcb.200307137. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R54] 54.Crawford HC, Dempsey PJ, Brown G, Adam L, and Moss ML (2009). ADAM10 as a therapeutic target for cancer and inflammation. Curr Pharm Des 15, 2288–2299. 10.2174/138161209788682442. [DOI] [PubMed] [Google Scholar]

[R55] 55.Calligaris M, Cuffaro D, Bonelli S, Spano DP, Rossello A, Nuti E, and Scilabra SD (2021). Strategies to Target ADAM17 in Disease: From its Discovery to the iRhom Revolution. Molecules 26. 10.3390/molecules26040944. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R56] 56.Kahn J, Ingraham RH, Shirley F, Migaki GI, and Kishimoto TK (1994). Membrane proximal cleavage of L-selectin: identification of the cleavage site and a 6-kD transmembrane peptide fragment of L-selectin. J Cell Biol 125, 461–470. 10.1083/jcb.125.2.461. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R57] 57.Sommer A, Kordowski F, Buch J, Maretzky T, Evers A, Andra J, Dusterhoft S, Michalek M, Lorenzen I, Somasundaram P, et al. (2016). Phosphatidylserine exposure is required for ADAM17 sheddase function. Nat Commun 7, 11523. 10.1038/ncomms11523. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R58] 58.Lorenzen I, Lokau J, Korpys Y, Oldefest M, Flynn CM, Kunzel U, Garbers C, Freeman M, Grotzinger J, and Dusterhoft S (2016). Control of ADAM17 activity by regulation of its cellular localisation. Sci Rep 6, 35067. 10.1038/srep35067. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R59] 59.Ludwig A, Hundhausen C, Lambert MH, Broadway N, Andrews RC, Bickett DM, Leesnitzer MA, and Becherer JD (2005). Metalloproteinase inhibitors for the disintegrin-like metalloproteinases ADAM10 and ADAM17 that differentially block constitutive and phorbol ester-inducible shedding of cell surface molecules. Comb Chem High Throughput Screen 8, 161–171. 10.2174/1386207053258488. [DOI] [PubMed] [Google Scholar]

[R60] 60.Seifert A, Dusterhoft S, Wozniak J, Koo CZ, Tomlinson MG, Nuti E, Rossello A, Cuffaro D, Yildiz D, and Ludwig A (2021). The metalloproteinase ADAM10 requires its activity to sustain surface expression. Cell Mol Life Sci 78, 715–732. 10.1007/s00018-020-03507-w. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R61] 61.Lynn RC, Weber EW, Sotillo E, Gennert D, Xu P, Good Z, Anbunathan H, Lattin J, Jones R, Tieu V, et al. (2019). c-Jun overexpression in CAR T cells induces exhaustion resistance. Nature 576, 293–300. 10.1038/s41586-019-1805-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R62] 62.Weber EW, Parker KR, Sotillo E, Lynn RC, Anbunathan H, Lattin J, Good Z, Belk JA, Daniel B, Klysz D, et al. (2021). Transient rest restores functionality in exhausted CAR-T cells through epigenetic remodeling. Science 372. 10.1126/science.aba1786. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R63] 63.Weber EW, Lynn RC, Sotillo E, Lattin J, Xu P, and Mackall CL (2019). Pharmacologic control of CAR-T cell function using dasatinib. Blood Adv 3, 711–717. 10.1182/bloodadvances.2018028720. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R64] 64.Omilusik KD, Best JA, Yu B, Goossens S, Weidemann A, Nguyen JV, Seuntjens E, Stryjewska A, Zweier C, Roychoudhuri R, et al. (2015). Transcriptional repressor ZEB2 promotes terminal differentiation of CD8+ effector and memory T cell populations during infection. J Exp Med 212, 2027–2039. 10.1084/jem.20150194. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R65] 65.Wu Z, Gao S, Watanabe N, Batchu S, Kajigaya S, Diamond C, Alemu L, Raffo DQ, Feng X, Hoffmann P, et al. (2022). Single-cell profiling of T lymphocytes in deficiency of adenosine deaminase 2. J Leukoc Biol 111, 301–312. 10.1002/JLB.5A0621-314R. [DOI] [PubMed] [Google Scholar]

[R66] 66.Roddie C, Dias J, O’Reilly MA, Abbasian M, Cadinanos-Garai A, Vispute K, Bosshard-Carter L, Mitsikakou M, Mehra V, Roddy H, et al. (2021). Durable Responses and Low Toxicity After Fast Off-Rate CD19 Chimeric Antigen Receptor-T Therapy in Adults With Relapsed or Refractory B-Cell Acute Lymphoblastic Leukemia. J Clin Oncol 39, 3352–3363. 10.1200/JCO.21.00917. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R67] 67.Zhang Y, Patel RP, Kim KH, Cho H, Jo JC, Jeong SH, Oh SY, Choi YS, Kim SH, Lee JH, et al. (2023). Safety and efficacy of a novel anti-CD19 chimeric antigen receptor T cell product targeting a membrane-proximal domain of CD19 with fast on- and off-rates against non-Hodgkin lymphoma: a first-in-human study. Mol Cancer 22, 200. 10.1186/s12943-023-01886-9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R68] 68.Trebak M, and Kinet JP (2019). Calcium signalling in T cells. Nat Rev Immunol 19, 154–169. 10.1038/s41577-018-0110-7. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R69] 69.Martinez GJ, Pereira RM, Aijo T, Kim EY, Marangoni F, Pipkin ME, Togher S, Heissmeyer V, Zhang YC, Crotty S, et al. (2015). The transcription factor NFAT promotes exhaustion of activated CD8(+) T cells. Immunity 42, 265–278. 10.1016/j.immuni.2015.01.006. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R70] 70.Ajina A, and Maher J (2018). Strategies to Address Chimeric Antigen Receptor Tonic Signaling. Mol Cancer Ther 17, 1795–1815. 10.1158/1535-7163.MCT-17-1097. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R71] 71.Chen J, Qiu S, Li W, Wang K, Zhang Y, Yang H, Liu B, Li G, Li L, Chen M, et al. (2023). Tuning charge density of chimeric antigen receptor optimizes tonic signaling and CAR-T cell fitness. Cell Res 33, 341–354. 10.1038/s41422-023-00789-0. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R72] 72.Donaldson JM, Kari C, Fragoso RC, Rodeck U, and Williams JC (2009). Design and development of masked therapeutic antibodies to limit off-target effects: application to anti-EGFR antibodies. Cancer Biol Ther 8, 2147–2152. 10.4161/cbt.8.22.9765. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R73] 73.Han X, Bryson PD, Zhao Y, Cinay GE, Li S, Guo Y, Siriwon N, and Wang P (2017). Masked Chimeric Antigen Receptor for Tumor-Specific Activation. Mol Ther 25, 274–284. 10.1016/j.ymthe.2016.10.011. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R74] 74.Lebar T, Lainscek D, Merljak E, Aupic J, and Jerala R (2020). A tunable orthogonal coiled-coil interaction toolbox for engineering mammalian cells. Nat Chem Biol 16, 513–519. 10.1038/s41589-019-0443-y. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R75] 75.Schumann K, Lin S, Boyer E, Simeonov DR, Subramaniam M, Gate RE, Haliburton GE, Ye CJ, Bluestone JA, Doudna JA, and Marson A (2015). Generation of knock-in primary human T cells using Cas9 ribonucleoproteins. Proc Natl Acad Sci U S A 112, 10437–10442. 10.1073/pnas.1512503112. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R76] 76.Freitas KA, Belk JA, Sotillo E, Quinn PJ, Ramello MC, Malipatlolla M, Daniel B, Sandor K, Klysz D, Bjelajac J, et al. (2022). Enhanced T cell effector activity by targeting the Mediator kinase module. Science 378, eabn5647. 10.1126/science.abn5647. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R77] 77.Belk JA, Yao W, Ly N, Freitas KA, Chen YT, Shi Q, Valencia AM, Shifrut E, Kale N, Yost KE, et al. (2022). Genome-wide CRISPR screens of T cell exhaustion identify chromatin remodeling factors that limit T cell persistence. Cancer Cell 40, 768–786 e767. 10.1016/j.ccell.2022.06.001. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R78] 78.Rieux-Laucat F, Le Deist F, Hivroz C, Roberts IA, Debatin KM, Fischer A, and de Villartay JP (1995). Mutations in Fas associated with human lymphoproliferative syndrome and autoimmunity. Science 268, 1347–1349. 10.1126/science.7539157. [DOI] [PubMed] [Google Scholar]

[R79] 79.Holzelova E, Vonarbourg C, Stolzenberg MC, Arkwright PD, Selz F, Prieur AM, Blanche S, Bartunkova J, Vilmer E, Fischer A, et al. (2004). Autoimmune lymphoproliferative syndrome with somatic Fas mutations. N Engl J Med 351, 1409–1418. 10.1056/NEJMoa040036. [DOI] [PubMed] [Google Scholar]

[R80] 80.Stuber T, Monjezi R, Wallstabe L, Kuhnemundt J, Nietzer SL, Dandekar G, Wockel A, Einsele H, Wischhusen J, and Hudecek M (2020). Inhibition of TGF-beta-receptor signaling augments the antitumor function of ROR1-specific CAR T-cells against triple-negative breast cancer. J Immunother Cancer 8. 10.1136/jitc-2020-000676. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R81] 81.Narayan V, Barber-Rotenberg JS, Jung IY, Lacey SF, Rech AJ, Davis MM, Hwang WT, Lal P, Carpenter EL, Maude SL, et al. (2022). PSMA-targeting TGFbeta-insensitive armored CAR T cells in metastatic castration-resistant prostate cancer: a phase 1 trial. Nat Med 28, 724–734. 10.1038/s41591-022-01726-1. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R82] 82.Deng Z, Fan T, Xiao C, Tian H, Zheng Y, Li C, and He J (2024). TGF-beta signaling in health, disease, and therapeutics. Signal Transduct Target Ther 9, 61. 10.1038/s41392-024-01764-w. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R83] 83.Brown CE, Hibbard JC, Alizadeh D, Blanchard MS, Natri HM, Wang D, Ostberg JR, Aguilar B, Wagner JR, Paul JA, et al. (2024). Locoregional delivery of IL-13Ralpha2-targeting CAR-T cells in recurrent high-grade glioma: a phase 1 trial. Nat Med 30, 1001–1012. 10.1038/s41591-024-02875-1. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R84] 84.Bagley SJ, Desai AS, Fraietta JA, Silverbush D, Chafamo D, Freeburg NF, Gopikrishna GK, Rech AJ, Nabavizadeh A, Bagley LJ, et al. (2025). Intracerebroventricular bivalent CAR T cells targeting EGFR and IL-13Ralpha2 in recurrent glioblastoma: a phase 1 trial. Nat Med 31, 2778–2787. 10.1038/s41591-025-03745-0. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R85] 85.Steffin D, Ghatwai N, Montalbano A, Rathi P, Courtney AN, Arnett AB, Fleurence J, Sweidan R, Wang T, Zhang H, et al. (2025). Interleukin-15-armoured GPC3 CAR T cells for patients with solid cancers. Nature 637, 940–946. 10.1038/s41586-024-08261-8. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R86] 86.Qi C, Liu C, Peng Z, Zhang Y, Wei J, Qiu W, Zhang X, Pan H, Niu Z, Qiu M, et al. (2025). Claudin-18 isoform 2-specific CAR T-cell therapy (satri-cel) versus treatment of physician’s choice for previously treated advanced gastric or gastro-oesophageal junction cancer (CT041-ST-01): a randomised, open-label, phase 2 trial. Lancet 405, 2049–2060. 10.1016/S0140-6736(25)00860-8. [DOI] [PubMed] [Google Scholar]

[R87] 87.Kouro T, Himuro H, and Sasada T (2022). Exhaustion of CAR T cells: potential causes and solutions. J Transl Med 20, 239. 10.1186/s12967-022-03442-3. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R88] 88.Ledergor G, Fan Z, Wu K, McCarthy E, Hyrenius-Wittsten A, Starzinski A, Chang H, Bridge M, Kwek S, Cheung A, et al. (2024). CD4+ CAR T-cell exhaustion associated with early relapse of multiple myeloma after BCMA CAR T-cell therapy. Blood Adv 8, 3562–3575. 10.1182/bloodadvances.2023012416. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R89] 89.Chen J, Lopez-Moyado IF, Seo H, Lio CJ, Hempleman LJ, Sekiya T, Yoshimura A, Scott-Browne JP, and Rao A (2019). NR4A transcription factors limit CAR T cell function in solid tumours. Nature 567, 530–534. 10.1038/s41586-019-0985-x. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R90] 90.Roybal KT, Williams JZ, Morsut L, Rupp LJ, Kolinko I, Choe JH, Walker WJ, McNally KA, and Lim WA (2016). Engineering T Cells with Customized Therapeutic Response Programs Using Synthetic Notch Receptors. Cell 167, 419–432 e416. 10.1016/j.cell.2016.09.011. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R91] 91.Zhu I, Liu R, Garcia JM, Hyrenius-Wittsten A, Piraner DI, Alavi J, Israni DV, Liu B, Khalil AS, and Roybal KT (2022). Modular design of synthetic receptors for programmed gene regulation in cell therapies. Cell 185, 1431–1443 e1416. 10.1016/j.cell.2022.03.023. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R92] 92.Cho JH, Collins JJ, and Wong WW (2018). Universal Chimeric Antigen Receptors for Multiplexed and Logical Control of T Cell Responses. Cell 173, 1426–1438 e1411. 10.1016/j.cell.2018.03.038. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R93] 93.Lee S, Khalil AS, and Wong WW (2022). Recent progress of gene circuit designs in immune cell therapies. Cell Syst 13, 864–873. 10.1016/j.cels.2022.09.006. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R94] 94.Hogl S, Kuhn PH, Colombo A, and Lichtenthaler SF (2011). Determination of the proteolytic cleavage sites of the amyloid precursor-like protein 2 by the proteases ADAM10, BACE1 and gamma-secretase. PLoS One 6, e21337. 10.1371/journal.pone.0021337. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R95] 95.Seegar TCM, Killingsworth LB, Saha N, Meyer PA, Patra D, Zimmerman B, Janes PW, Rubinstein E, Nikolov DB, Skiniotis G, et al. (2017). Structural Basis for Regulated Proteolysis by the alpha-Secretase ADAM10. Cell 171, 1638–1648 e1637. 10.1016/j.cell.2017.11.014. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R96] 96.Seo H, Chen J, Gonzalez-Avalos E, Samaniego-Castruita D, Das A, Wang YH, Lopez-Moyado IF, Georges RO, Zhang W, Onodera A, et al. (2019). TOX and TOX2 transcription factors cooperate with NR4A transcription factors to impose CD8(+) T cell exhaustion. Proc Natl Acad Sci U S A 116, 12410–12415. 10.1073/pnas.1905675116. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R97] 97.Jena B, Maiti S, Huls H, Singh H, Lee DA, Champlin RE, and Cooper LJ (2013). Chimeric antigen receptor (CAR)-specific monoclonal antibody to detect CD19-specific T cells in clinical trials. PLoS One 8, e57838. 10.1371/journal.pone.0057838. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R98] 98.Sen G, Chakraborty M, Foon KA, Reisfeld RA, and Bhattacharya-Chatterjee MB (1998). Induction of IgG antibodies by an anti-idiotype antibody mimicking disialoganglioside GD2. J Immunother 21, 75–83. 10.1097/00002371-199801000-00010. [DOI] [PubMed] [Google Scholar]

[R99] 99.Labanieh L, Majzner RG, Klysz D, Sotillo E, Fisher CJ, Vilches-Moure JG, Pacheco KZB, Malipatlolla M, Xu P, Hui JH, et al. (2022). Enhanced safety and efficacy of protease-regulated CAR-T cell receptors. Cell 185, 1745–1763 e1722. 10.1016/j.cell.2022.03.041. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R100] 100.Majzner RG, Theruvath JL, Nellan A, Heitzeneder S, Cui Y, Mount CW, Rietberg SP, Linde MH, Xu P, Rota C, et al. (2019). CAR T Cells Targeting B7-H3, a Pan-Cancer Antigen, Demonstrate Potent Preclinical Activity Against Pediatric Solid Tumors and Brain Tumors. Clin Cancer Res 25, 2560–2574. 10.1158/1078-0432.CCR-18-0432. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R101] 101.Walker AJ, Majzner RG, Zhang L, Wanhainen K, Long AH, Nguyen SM, Lopomo P, Vigny M, Fry TJ, Orentas RJ, and Mackall CL (2017). Tumor Antigen and Receptor Densities Regulate Efficacy of a Chimeric Antigen Receptor Targeting Anaplastic Lymphoma Kinase. Mol Ther 25, 2189–2201. 10.1016/j.ymthe.2017.06.008. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R102] 102.Jutz S, Leitner J, Schmetterer K, Doel-Perez I, Majdic O, Grabmeier-Pfistershammer K, Paster W, Huppa JB, and Steinberger P (2016). Assessment of costimulation and coinhibition in a triple parameter T cell reporter line: Simultaneous measurement of NF-kappaB, NFAT and AP-1. J Immunol Methods 430, 10–20. 10.1016/j.jim.2016.01.007. [DOI] [PubMed] [Google Scholar]

[R103] 103.Shaner NC, Lambert GG, Chammas A, Ni Y, Cranfill PJ, Baird MA, Sell BR, Allen JR, Day RN, Israelsson M, et al. (2013). A bright monomeric green fluorescent protein derived from Branchiostoma lanceolatum. Nat Methods 10, 407–409. 10.1038/nmeth.2413. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Cell autonomous control of CAR signaling and receptor shedding via ADAM17-mediated proteolysis

Jeremy R Bjelajac

Adrià Cañellas-Socias

Preeti Nehra

Kevin Reynolds

Meena Malipatlolla

Naiara Martinez Velez

Diane C Manjarrez

Katie Ho

Peng Xu

Jennifer L Hamad

Sean A Yamada-Hunter

Louai Labanieh

Elena Sotillo

Crystal L Mackall

SUMMARY

Graphical Abstract

In Brief:

INTRODUCTION

RESULTS

Mapping of Activation-Induced Protein Downregulation Reveals ADAM17 and ADAM10 as Dominant Regulators of the T Cell Surfaceome

Figure 1. Characterization of the T cell surfaceome identifies proteins with activation-dependent surface expression and analysis of the minimal regions required for surface downregulation.

Identification of Minimal ADAM10 and ADAM17-Specific Cleavage Sites suitable for Activation Induced Regulation

CD62L-Derived AIR Receptors Enable Rapid and Robust ADAM17-Dependent Protein Shedding Following T Cell Activation

Figure 2. ADAM17-mediated regulation of CD62L-based AIR receptors is rapid and robust.

Tonic Signaling AIR-CARs Manifest Diminished Exhaustion, Enhanced T-Cell Fitness and Antitumor Activity

Figure 3. AIR-regulation of HA.28z CAR T cells reduces tonic signaling-driven exhaustion and improves tumor control in vivo.

AIR-regulation of HA.28z CAR recapitulates pharmacologically induced “rest” in vitro

Figure 4. AIR regulation rewires the transcriptome and proteome of HA-28ζ CAR-T cells in a similar manner elicited by Dasatinib-induced pharmacologic rest.

AIR Improves Expansion and Potency of Non-Tonic Signaling CD19.28ζ CAR-T Cells

Figure 5. AIR-CD19.28ζ CAR T cells display enhanced tumor killing and mitigated death following CAR stimulation.

AIR Enhances Potency Across a Range of Clinically Relevant CARs

Figure 6. AIR regulation allows T cells to differentially alter CAR expression based on intrinsic strength of tonic signaling to improve in tumor control in vivo.

Generation of rapid combinatorial antigen logic gates using AIR-regulated CAR Masking

Figure 7. Using the AIR platform to conditionally target EGFR+ tumor cells and endow endogenous proteins with activation-induced shedding.

Utilizing AIR to Efficiently Rewire Regulation of Endogenous Proteins

DISCUSSION

Limitations of the study

RESOURCE AVAILABILITY

Lead contact

Materials availability

Data and code availability

STAR★METHODS

Cell lines

Animal models

Source of primary human T cells

METHOD DETAILS

CAR T cell manufacturing

Virus production

Viral vector construction

T cell surfaceome screening and idiotype stimulation

CRISPR-Cas9 Knockout of ADAM10, ADAM17, and AAVS1 in Primary T cells

ssODN-mediated knock-in of ADAM17cs into FAS and TGFBR2

Screening of minimal ADAM cleavage sequences

T cell stimulation time course with αCD3/CD28 magnetic beads

T cell stimulation with CD19 idiotype conjugated magnetic beads

Assessing Caspase 3/7 activity via Incucyte

Usage of protease inhibitors to monitor ADAM-mediated protein shedding

Flow cytometry analysis of mammalian cells

IncuCyte tumor killing assays and secreted cytokine analysis

Confocal microscopy

Nalm6 leukemia tumor models

143B osteosarcoma tumor model

BLI analysis

CD19.28ζ T cells expansion after stimulation

Propidium Iodide Inclusion in stimulated CD19.28ζ T cells

Bulk RNA-seq

CyTOF sample preparation and data analysis

Detection of Soluble AIR proteins via ELISA

QUANTIFICATION AND STATISTICAL ANALYSIS

ADDITIONAL RESOURCES

Supplementary Material

Highlights:

ACKNOWLEDGMENTS

DECLARATION OF INTERESTS

Footnotes

REFERENCES

Associated Data

Supplementary Materials