Chelerythrine enhances anti-fungi immunity in Caenorhabditis elegans via DAF-16 and NHR-49 mediated fatty acid metabolism

Abstract

Chelerythrine is a natural benzophenanthridine alkaloid with various pharmacological activities. However, whether Chelerythrine can influence innate immunity and its underlying molecular mechanisms remain unclear. In this study, we found that 10 μM Chelerythrine significantly extended the lifespan of Caenorhabditis elegans infected with Candida albicans (C. albicans) and inhibited the proliferation of C. albicans. This enhanced host resistance to infection was not achieved by reducing the intestinal fungal burden. Transcriptomic sequencing analysis revealed that Chelerythrine activates the FoxO and Fatty acid metabolism pathways in C. elegans. Interestingly, the lifespan-extending effect of Chelerythrine was completely abolished in daf-16 and nhr-49 mutants. Similarly, mutations in the fatty acid desaturase genes fat-5, fat-6, and fat-7 also blocked this protective effect. RT-qPCR results confirmed that Chelerythrine treatment significantly upregulated the expression of FoxO pathway downstream genes (sod-3, thn-2, lys-7) and fatty acid metabolism-related genes (nhr-49, mdt-15, fat-5, fat-6, fat-7). Fluorescent reporter gene assays further demonstrated that Chelerythrine promotes the nuclear localization of DAF-16::GFP and enhances the fluorescence expression of SOD-3::GFP, FAT-5::GFP, FAT-6::GFP, and FAT-7::GFP. Additionally, broad-spectrum antibacterial assays showed that 10 μM Chelerythrine had no direct inhibitory activity against various pathogens, including Listeria monocytogenes, Enterococcus faecalis, Pseudomonas aeruginosa, and Salmonella enterica, indicating that it does not enhance host immunity by directly suppressing pathogen growth. In summary, this study demonstrates that Chelerythrine enhances the innate immune response of C. elegans against C. albicans by activating the DAF-16/FoxO pathway and the NHR-49-mediated fatty acid metabolism pathway. Our work reveal that Chelerythrine is a potential therapeutic candidate for the treatment of C. albicans infections.

1. Introduction

Candidiasis, primarily caused by Candida albicans, is a globally prevalent opportunistic infection (1, 2). This disease has a significantly higher incidence in immunocompromised populations, such as neonates, the elderly, and HIV-infected individuals, and can lead to mucosal damage, feeding difficulties, and even severe systemic infections (3). Currently, azole drugs remain the first-line clinical therapy. However, due to factors such as the long-term use of antifungal agents, the formation of C. albicans biofilms, and genetic mutations, the resistance of C. albicans to existing antifungal drugs continues to rise, making the development of new prevention and treatment strategies particularly urgent (4, 5). The World Health Organization (WHO) recently released its first fungal priority pathogen list, based on concerns regarding “ concerns over drug resistance and/or treatment management,” in which C. albicans was listed as one of the four “critical priority pathogens” (6). In this context, beyond directly inhibiting the pathogenic microorganisms, enhancing host innate immunity through pharmacological intervention to proactively boost defensive capacity has emerged as a promising complementary therapeutic strategy (7). Therefore, exploring natural products with immunomodulatory activity from traditional medicinal plants provides an important avenue for discovering novel anti-infective agents.

Chelerythrine (CHE) is a natural benzophenanthridine alkaloid extracted from plants such as Chelidonium majus L. of the Papaveraceae family (8). Studies have demonstrated that Chelerythrine exhibits broad-spectrum biological activities, including antifungal, anti-inflammatory, anticancer, and antiviral properties (9–13). However, whether Chelerythrine can enhance host resistance against Candida albicans by modulating innate immune function and the underlying mechanisms involved remain to be elucidated. To elucidate the molecular mechanisms underlying drug-mediated modulation of innate immunity, the selection of an appropriate research model is essential. The nematode Caenorhabditis elegans serves as a well-established model organism, characterized by its small size, short life cycle, and well-defined genetic background. Its innate immune defense system is highly conserved throughout evolution, making it widely utilized in studies of host-pathogen interactions and drug activity screening (14). The validity of this model in fungal infection research has been thoroughly established, including its application in studies involving Candida albicans infection (15, 16).

DAF-16 is a critical FoxO family transcription factor in C. elegans that is primarily regulated by the insulin/insulin-like growth factor-1 signaling pathway (17). The DAF-16 insulin-like signaling pathway is evolutionarily conserved and governs multiple aspects of organismal physiology, including pathogen resistance, metabolism, stress response, and longevity. Upon exposure to stresses such as pathogenic infection, DAF-16 is activated and translocates to the nucleus, where it initiates the expression of a suite of target genes involved in diverse processes including antioxidant defense (e.g., sod-3), antimicrobial immunity (e.g., lys-7) (17, 18), autophagy, and metabolic reprogramming, thereby systemically enhancing organismal survival and immune defense. On the other hand, NHR-49, the functional ortholog of mammalian peroxisome proliferator-activated receptor alpha (PPARα), serves as a master regulator of lipid metabolism in C. elegans (19). It maintains lipid homeostasis by modulating fatty acid β-oxidation, the expression of desaturases (e.g., fat-5, fat-6, fat-7), and lipid droplet dynamics (17). Accumulating evidence indicates that lipid metabolites not only function as energy sources but also act as critical mediators of immune signal transduction. NHR-49-mediated lipid remodeling is indispensable for effective resistance against pathogenic infection. DAF-16 and NHR-49 pathways engage in extensive crosstalk, forming an integrated immune-metabolic regulatory network. However, the precise mechanisms by which specific pharmacological agents, such as Chelerythrine, modulate this network to enhance host immunity remain to be elucidated.

In this study, we investigated the role of Chelerythrine in host defenses of C. elegans. Via transcriptomic sequencing and GO analysis, we found that Chelerythrine protected host against Candida albicans (C. albicans) through the Forkhead box O (FoxO) signaling pathway and fatty acid metabolism pathway. In addition, Chelerythrine enhanced the innate immunity through the activation of the transcription factor DAF-16 and the nuclear receptor NHR-49. Given the evolutionary conservation of the FoxO signaling and fatty acid metabolism pathways, these findings suggest that Chelerythrine enhances innate immunity through a mechanism that is likely conserved across species.

2. Results

2.1. Chelerythrine enhances anti-fungi immunity in C. elegans

To investigate whether Chelerythrine promotes innate immunity, worms were exposed to the human opportunistic pathogen C. albicans. The chemical structure of Chelerythrine is shown (Figure 1A). We found that wild-type animals treated with Chelerythrine (0 μM, 1 μM, 10 μM, 100 μM) exhibited increased resistance to C. albicans in a dose-dependent manner. Meanwhile, Chelerythrine showed a saturating effect on pathogen resistance, with maximal effect at 10 μM and a decline at 100 μM, possibly due to toxicity at high concentrations (Figure 1B). These results suggested that Chelerythrine enhances innate immunity in C. elegans. To test whether Chelerythrine promotes host immune responses by directly inhibiting the growth of pathogenic fungi, we performed a fungal growth assay. The results showed that 10 μM Chelerythrine significantly inhibited the proliferation of C. albicans (Figure 1C), suggesting a potential direct antifungal effect. Given that clearance of fungal load is part of host defense against pathogen infection (20, 21), we further examined whether Chelerythrine influenced fungal accumulation in vivo. Interestingly, the number of fungal cells in the intestines of Chelerythrine-treated worms did not decrease compared to that in control animals (Figures 1D, E). Overall, these results suggest that Chelerythrine protects worms against C. albicans infection.

Figure 1.

Chelerythrine enhances anti-fungi immunity in C. elegans. (A) Chelerythrine chemical structure. (B) Survival of N2 hermaphrodite worms exposed to increasing concentrations of Chelerythrine following C. albicans infection (*P < 0.05, log-rank test; n > 40 per group). (C) Chelerythrine (10 μM) significantly inhibits the proliferation of C. albicans in liquid culture. Data are presented as mean ± SEM of three independent biological replicates (*P < 0.05, unpaired two-tailed Student’s t-test). (D) Chelerythrine (10 μM) did not affect the colony-forming units (CFUs) in the intestines of WT worms after C. albicans infection. Data are presented as mean ± SEM of three independent experiments. (n ≥ 20 per group. ns, not significant; unpaired two-tailed Student’s t-test). (E) Representative images of SDA agar plates showing C. albicans colonies recovered from intestinal lysates of infected worms treated with or without 10 μM Chelerythrine for 48 hours. These results are mean ± SEM of three independent experiments. NS, no significance. (*P < 0.05, unpaired t-test).

2.2. Chelerythrine increases resistance to multiple pathogens

To investigate whether Chelerythrine promotes resistance to other pathogens, we exposed worms to Listeria monocytogenes, Enterococcus faecalis, Pseudomonas aeruginosa, or Salmonella enterica in the presence of 10 μM Chelerythrine. Chelerythrine treatment significantly promoted host survival against all tested bacterial pathogens (Figures 2A–D), suggesting that Chelerythrine conferred broad-spectrum pathogen resistance. Furthermore, to test whether Chelerythrine enhances host immune responses by directly inhibiting bacterial growth, we performed bacterial growth assays. The results demonstrated that 10 μM Chelerythrine did not suppress the proliferation of L. monocytogenes, E. faecalis, P. aeruginosa, or S. enterica (Figures 2E–H). Taken together, these results suggest that Chelerythrine increases resistance to multiple pathogens through host immune modulation rather than direct antimicrobial activity.

Figure 2.

Chelerythrine increases the resistance to pathogens. Chelerythrine (10 μM) enhances the resistance of C. elegans to L. monocytogenes (A), E. faecalis (B), P. aeruginosa (C) and S. enterica (D) infection (*P < 0.05, log-rank test; n> 40 per group). Chelerythrine (10 μM) does not suppress the proliferation of L. monocytogenes (E), E. faecalis (F), P. aeruginosa (G), or S. enterica (H) in liquid culture. Data are presented as mean ± SEM of three independent biological replicates. No significant differences were detected between Chelerythrine-treated and control groups at the 24-hour endpoint (unpaired two-tailed Student’s t-test).

2.3. Transcriptomic sequencing reveals significant enrichment of differentially expressed genes in the Forkhead box O signaling pathway and fatty acid metabolism pathway

To mechanistically elucidate Chelerythrine’s protective effects, we conducted whole-transcriptome RNA sequencing. Specifically, wild-type N2 worms were infected with C. albicans and simultaneously treated with 10 μM Chelerythrine or vehicle control for 48 hours prior to RNA extraction, thereby capturing transcriptomic changes that occur during active infection. Analysis revealed significant alterations in the nematode transcriptome following Chelerythrine exposure. We identified a total of 417 differentially expressed genes (DEGs), comprising 193 upregulated and 224 downregulated genes. Genes with false discovery rate (FDR) < 0.05 and | log2FoldChange | ≥ 0.5 were considered differentially expressed. (Figures 3A, B). The Gene Ontology (GO) enrichment analysis of the DEGs revealed that Chelerythrine treatment primarily affected genes involved in three key immune-related processes: immune response, innate immune response, immune system process (Figure 3C). Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis further showed that the DEGs were significantly enriched in two key pathways: the Forkhead box O (FoxO) signaling pathway and the fatty acid metabolism pathway (Figure 3D).

Figure 3.

Transcriptomic analysis reveals enrichment of differentially expressed genes (DEGs) in C. albicans-infected worms following Chelerythrine treatment. (A) Volcano plot showing differentially expressed genes (DEGs) between Chelerythrine-treated and control groups. Genes were considered differentially expressed if FDR < 0.05 and | log₂FoldChange | ≥ 0.5. Red dots indicate upregulated genes; blue dots indicate downregulated genes. (B) Heatmap clustering of DEGs in Chelerythrine-treated worms versus controls. “Chelerythrine 1, 2, 3” and “Control 1, 2, 3” represent three independent biological replicates. (C) Gene Ontology (GO) enrichment analysis of DEGs. Enrichment significance was determined using a hypergeometric test with FDR < 0.05. (D) Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis of DEGs. Enrichment significance was determined using a hypergeometric test with FDR < 0.05.

2.4. Chelerythrine activates the Forkhead box O transcription factor DAF-16 to enhance anti-fungi immunity in C. elegans

Previous studies have shown that activated DAF-16 plays a crucial role in innate immunity (22). We found that 10 μM Chelerythrine failed to enhance resistance to C. albicans infection in daf-16(mu86) mutants compared to WT worms, indicating that DAF-16 is essential for Chelerythrine-mediated immune enhancement (Figure 4A). To investigate whether Chelerythrine activates the FoxO transcription factor DAF-16, we monitored its cellular translocation using transgenic worms expressing a functional DAF-16::GFP fusion protein. DAF-16 localization was categorized into three distinct patterns: cytosolic (GFP signal distributed throughout the cytoplasm with little or no nuclear enrichment), intermediate (partial nuclear accumulation accompanied by residual cytosolic signal), and nuclear (strong GFP signal concentrated predominantly in the nucleus) (Figure 4B). We observed that 10 μM Chelerythrine significantly induced DAF-16 nuclear localization (Figures 4B, C). Next, we tested the expression of DAF-16 target genes, sod-3, lys-7, and thn-2 (23). Quantitative real-time PCR analysis demonstrated that these DAF-16-dependent genes were upregulated in worms treated with 10 μM Chelerythrine (Figure 4D). Furthermore, we detected sod-3 expression using transgenic worms expressing SOD-3::GFP and observed higher GFP fluorescence levels in 10 μM Chelerythrine-treated animals (Figures 4E, F). In conclusion, these findings indicate that Chelerythrine activates the Forkhead box O (FoxO) transcription factor DAF-16 in C. elegans to enhance pathogens resistance.

Figure 4.

Chelerythrine activates the FoxO transcription factor DAF-16 to promote anti-fungi immunity in C. elegans. (A) Chelerythrine (10 μM) fails to enhance resistance to C. albicans infection in daf-16(mu86) mutants (P = 0.7440, ns, not significant; n > 40 per group; log-rank test). (B) Representative fluorescence images showing the three DAF-16::GFP localization categories: cytosolic (GFP distributed throughout the cytoplasm with little or no nuclear enrichment), intermediate (partial nuclear accumulation with residual cytosolic signal), and nuclear (strong GFP signal concentrated in the nucleus). Scale bar: 50 μm. (C) Quantification of DAF-16 subcellular localization, categorized as cytosolic, intermediate, or nuclear (n ≥ 20 per group; *P < 0.05, unpaired t-test). Data are presented as mean ± SEM from three independent experiments. (D) Relative mRNA levels of DAF-16 target genes (sod-3, lys-7, and thn-2) in worms treated with or without 10 μM Chelerythrine, determined by qPCR (*P < 0.05, one-way ANOVA). Data are presented as mean ± SEM from three independent experiments. (E) Representative fluorescence images showing SOD-3::GFP expression in the SOD-3::GFP transgenic reporter strain (CF1553) treated with or without 10 μM Chelerythrine. Scale bar: 50 μm. (F) Quantification of SOD-3::GFP fluorescence intensity (n ≥ 20 per group; *P < 0.05, unpaired t-test).

2.5. Chelerythrine activates the nuclear receptor NHR-49 to enhance anti-fungi immunity in C. elegans

Our transcriptomic analysis revealed significant enrichment of genes associated with fatty acid metabolism pathways in Chelerythrine-treated worms compared with controls (Figure 3). Within the C. elegans genome, NHR-49 is the principal nuclear hormone receptor orthologous to mammalian PPARα and is established as the master transcriptional regulator of fatty acid metabolism. Based on this enrichment and the central role of NHR-49 in coordinating lipid homeostasis, we selected NHR-49 for further functional validation. To investigate whether Chelerythrine activates the nuclear receptor NHR-49, we examined the survival of nhr-49(nr2041) mutants following C. albicans infection. We found that 10 μM Chelerythrine failed to enhance resistance to C. albicans infection in nhr-49(nr2041) mutants compared to WT worms (Figure 5A), suggesting that NHR-49 is required for Chelerythrine-mediated immune enhancement. The fat-5, fat-6, and fat-7 genes encode three Δ9 fatty acid desaturases that are functionally redundant for monounsaturated fatty acid synthesis. Single mutants of these genes display only subtle changes in fatty acid composition and no visible phenotypes due to compensatory upregulation of the remaining desaturases (24), whereas the fat-5; fat-6; fat-7 triple mutant is lethal (25). Therefore, to interrogate the functional requirement of the NHR-49/fatty acid metabolism pathway in Chelerythrine-mediated immunity, we employed the viable fat-6; fat-7 double mutant—a strategy that is standard practice in the field. We further tested the core components of fatty acid metabolism, the Δ9 Desaturases of fat-5(tm420), fat-6(tm331) and fat-7(wa36), We also found that 10 μM Chelerythrine could not confer resistance to C. albicans infection in double mutants of fat-5(tm420); fat-6(tm331), fat-5(tm420); fat-7(wa36), fat-6(tm331); fat-7(wa36), compared to WT worms (Figures 5B–D). Taken together, these results indicate that NHR-49 and its downstream desaturases play a crucial role in Chelerythrine-mediated innate immunity against fungal infection. Next, we examined the expression of fatty acid metabolism-related genes using transgenic worms expressing FAT-5::GFP, FAT-6::GFP, FAT-7::GFP. We observed significantly higher GFP fluorescence levels in worms treated with 10 μM Chelerythrine compared to controls (Figures 5E–J). Additionally, quantitative real-time PCR analysis demonstrated that NHR-49-dependent genes, including nhr-49, mdt-15, fat-5, fat-6 and fat-7, were upregulated in 10 μM Chelerythrine-treated animals (Figure 5K). In conclusion, these findings demonstrate that Chelerythrine engages the nuclear receptor NHR-49 and its downstream fatty acid metabolism pathway in C. elegans, establishing their genetic requirement for enhanced pathogen resistance. Whether Chelerythrine directly alters lipid metabolism through modulation of these desaturase activities remains to be investigated by future metabolomic profiling.

Figure 5.

Chelerythrine activates the nuclear receptor NHR-49 to enhance anti-fungi immunity in C. elegans. (A–D) Chelerythrine (10 μM) fails to enhance resistance to C. albicans infection in nhr-49(nr2041) mutants (A) (P = 0.6033, ns, not significant), fat-5(tm420);fat-6(tm331) (B) (P = 0.8914, ns, not significant), fat-5(tm420);fat-7(wa36) (C) (P = 0.7705, ns, not significant), fat-6(tm331);fat-7(wa36) double mutants (D) (P = 0.7971, ns, not significant) after C. albicans infection. (n > 40 per group; log-rank test). (E–J) Expression of FAT-5::GFP [(E, F), strain BX150], FAT-6::GFP [(G, H), strain BX115], FAT-7::GFP [(I, J), strain BX113] was up-regulated in the respective transgenic reporter strains following exposure to Chelerythrine (10 μM). Scale bars: 50 μm. Right panels show quantification of fluorescence intensity. Data are presented as mean ± SEM of three independent experiments. (n ≥ 20 per group; *P < 0.05, unpaired two-tailed Student’s t-test). (K) qPCR analysis of fatty acid metabolism-related genes (nhr-49, mdt-15, fat-5, fat-6, fat-7) in worms treated with or without 10 μM Chelerythrine. Data are presented as mean ± SEM of three independent biological replicates. (*P < 0.05, one-way ANOVA).

2.6. Chelerythrine enhances anti-fungi immunity in C. elegans independent on canonical immune signaling pathways

To determine the molecular mechanisms by which Chelerythrine confers protection against pathogen infection, we screened several signaling pathways involved in innate immunity in C. elegans, including SBP-1/SREBP (26), P38 MAPK/PMK-1 (27), ERK MAPK/MPK-1 (28), FSHR-1 (29), ATFS-1 (30, 31), BEC-1 (32). Treatment with 10 μM Chelerythrine significantly increased the survival rate of wild-type N2 worms following C. albicans infection (Figure 6A). Notably, this protective effect was retained in mutants of the aforementioned pathways, including sbp-1(ep79), pmk-1(km25), mpk-1(n2521), fshr-1(ok778), atfs-1(gk3094) and bec-1(ok691) (Figures 6B–G). Taken together, these results demonstrate that Chelerythrine promotes anti-fungi immunity in C. elegans independent on canonical immune signaling pathways.

Figure 6.

Chelerythrine enhances anti-fungi immunity in C. elegans independent on canonical immune signaling pathways. (A–G) Chelerythrine enhances resistance to C. albicans infection independently of several canonical immune signaling pathways. Following treatment with 10 μM Chelerythrine, the survival rate of N2 wild-type worms (A), sbp-1(ep79) (B), pmk-1(km25) (C), mpk-1(n2521) (D), fshr-1(ok778) (E), atfs-1(gk3094) (F) and bec-1(ok691) (G) mutants after C. albicans infection. (n > 40 per group; *P < 0.05; log-rank test).

3. Discussion

Candida albicans, as an opportunistic fungal pathogen, can cause a spectrum of diseases ranging from superficial mucosal infections to life-threatening systemic conditions in immunocompromised hosts (33). It is important to note that C. albicans is capable of causing monomicrobial diseases in humans, such as oropharyngeal candidiasis (thrush), in which it serves as the sole etiological agent. The widespread emergence of resistance to azole and other antifungal agents has posed escalating challenges to clinical management (33). In recent years, strategies aimed at enhancing anti-infective capacity through the modulation of host innate immunity have garnered significant attention. Within this context, the discovery of natural products with immunomodulatory properties from traditional medicinal herbs has emerged as a pivotal direction in novel drug development. Chelerythrine, a natural benzophenanthridine alkaloid, has been demonstrated to possess diverse pharmacological activities, including antitumor, anti-inflammatory (13), and antifungal effects (9). However, whether Chelerythrine enhances resistance against C. albicans infection through modulation of host immunity, and the underlying molecular mechanisms, have not been previously reported. In this study, utilizing C. elegans as a model organism, we reveal for the first time the role and molecular mechanism of Chelerythrine in enhancing host innate immunity against C. albicans. Our findings demonstrate that Chelerythrine significantly extends the lifespan of C. elegans following C. albicans infection and inhibits fungal proliferation. Notably, whereas Chelerythrine exhibits clear antifungal activity in vitro (Figure 1C), the intestinal fungal burden in the worms remains unchanged (Figures 1D, E). We attribute this apparent discrepancy to the following considerations. First, a substantial drug concentration gradient exists between the liquid culture environment and the intestinal lumen. In liquid broth, 10 μM Chelerythrine directly and uniformly contacts the C. albicans cell membrane, thereby exerting a sustained fungistatic effect. In vivo, however, the intestinal epithelium of C. elegans constitutes a natural barrier. As a small-molecule alkaloid, Chelerythrine may be metabolized by intestinal cells during absorption or become bound to food debris and proteins within the gut lumen, resulting in a free luminal drug concentration well below the effective fungistatic threshold—insufficient to inhibit fungal proliferation. Second, a distinction must be drawn between fungistatic activity and host disease tolerance. The in vitro data in Figure 1C demonstrate that Chelerythrine acts by suppressing fungal cell division and population expansion (fungistasis) rather than by direct killing (fungicidal activity). Moreover, this fungistatic effect was largely overcome after approximately 8 hours, with the growth curve of the Chelerythrine-treated group eventually approaching that of the control group. This transient nature of the inhibition is relevant to our infection assay design: C. albicans was spread onto NGM plates and incubated overnight (approximately 24 hours) to form a uniform lawn before worms were introduced. Consequently, any drug-induced suppression of fungal growth on the plate surface would have largely subsided during the 24-hour pre-incubation period, minimizing the potential confounding effect of pre-ingestion fungal inhibition. The innate immune strategies employed by C. elegans against pathogens primarily include pathogen clearance, enhanced tolerance, and avoidance behavior (34, 35). The unaltered intestinal CFU counts observed in this study directly exclude the possibility that Chelerythrine enhances intestinal clearance capacity. Instead, the marked improvement in worm survival (Figure 1B) in the absence of reduced internal pathogen load strongly points to enhanced host immune tolerance—that is, the worms withstand the pathological damage inflicted by a high fungal burden through augmentation of their intrinsic innate immune defenses. This phenotypic signature is consistent with a model in which the protective effect of Chelerythrine is mediated predominantly through host-directed mechanisms rather than through attenuation of pathogen virulence. Importantly, this tolerance phenotype is mechanistically distinct from the survival advantage conferred by classic longevity mutations. In canonical longevity mutants such as daf-2 and age-1, constitutive DAF-16 activation pre-upregulates basal immunity even in the absence of infection. Upon pathogen exposure, these mutants can rapidly clear invading microbes, resulting in reduced pathogen burden coupled with increased survival. This classic longevity-to-resistance causal chain—longevity mutation → constitutive DAF-16 activation → elevated basal immunity → enhanced pathogen clearance → reduced pathogen burden → increased survival—predicts that if Chelerythrine acted merely by extending lifespan through DAF-16, we would observe both increased survival and reduced fungal burden. The absence of CFU reduction in our study therefore argues against a simple longevity extension model and instead supports a model of infection-specific immune tolerance enhancement. Finally, although pre-ingestion contact between the drug and the pathogen on the NGM agar surface might theoretically induce a minor degree of pre-ingestion inhibition, the restricted diffusion of the drug in solid medium, the high-density inoculum effect of the fungal lawn, and the transient nature of Chelerythrine’s fungistatic activity (with growth resuming after 8 hours) render the contribution of this surface effect to the multi-day host protection phenotype negligible. We acknowledge, however, that the direct effects of Chelerythrine on C. albicans pathogenic traits such as hyphal formation, adhesion capacity, and virulence factor expression were not assessed in this study. Systematically characterizing these effects would provide a more comprehensive understanding of the host-pathogen-drug tripartite interaction and would represent a valuable direction for future investigation. Taken together, these findings indicate that the protective effect of Chelerythrine in C. elegans is governed predominantly by the enhancement of host innate immune responses rather than by direct environmental antifungal action.

Additionally, it is worth noting that in the context of C. albicans infection, 100 μM fat conferred significantly less protection than 10 μM (Figure 1B). We wish to clarify that this U-shaped dose-response profile was observed specifically under infection conditions. We acknowledge that the present study did not include a comprehensive evaluation of the basal toxicological profile of Chelerythrine. We do not assert that 100 μM is inherently toxic to uninfected worms; rather, we interpret this finding to indicate that this concentration represents the upper limit of the therapeutic window under pathogenic stress. A more detailed characterization of the dose-toxicity relationship across a broader concentration range awaits further investigation in future work.

Furthermore, we examined whether the protective effect of Chelerythrine extends beyond C. albicans to bacterial pathogens. As shown in Figures 2A–D, treatment with 10 μM Chelerythrine significantly prolonged the lifespan of C. elegans infected with Listeria monocytogenes, Enterococcus faecalis, Pseudomonas aeruginosa, and Salmonella enterica. Notably, the same concentration of Chelerythrine did not suppress the in vitro proliferation of these bacterial strains (Figures 2E–H). Collectively, these data indicate that Chelerythrine confers a broad-spectrum enhancement of host resistance. Future studies will be required to validate the specific immune mechanisms involved during bacterial infections.

More importantly, Chelerythrine promotes innate immunity in C. elegans through the conserved FoxO signaling pathway and fatty acid metabolism pathway. Deletion mutations of daf-16 and nhr-49 completely abrogate the lifespan-extending effect of Chelerythrine in infected nematodes, demonstrating their indispensable roles in the immunoenhancing activity of this compound.

DAF-16, a core transcription factor of the FoxO pathway (36) and a key downstream target of the insulin signaling pathway, plays a critical role in regulating antioxidant defense, antimicrobial peptide expression, and lifespan extension. Our study shows that Chelerythrine promotes DAF-16 nuclear translocation and upregulates the expression of its downstream target genes sod-3, thn-2, and lys-7. It is important to note that DAF-16 functions as both a key regulator of innate immunity and a well-established modulator of longevity. Nevertheless, several lines of evidence from the present study indicate that the protective effect of Chelerythrine under infection conditions primarily reflects enhanced immune tolerance rather than a simple extension of basal lifespan. First, RT-qPCR and fluorescent reporter gene assays confirmed that Chelerythrine specifically upregulates antifungal immune effectors, such as sod-3, thn-2, and lys-7, in an infection-dependent manner. Second, the cooperative involvement of the NHR-49/fatty acid metabolism pathway further supports a host metabolic reprogramming response rather than a generalized longevity reaction. Third, as discussed above, the unaltered intestinal fungal burden despite significantly improved survival is a defining feature of immune tolerance, which contrasts with the reduced pathogen burden typically observed in longevity mutants. Although we acknowledge that a lifespan assay in uninfected worms would provide a valuable baseline control—and we recognize the absence of such an experiment as a limitation of the current study—the available phenotypic data strongly support the conclusion that Chelerythrine enhances host innate immunity specifically in the context of C. albicans infection. Our KEGG pathway enrichment analysis revealed that the Chelerythrine-treated group exhibited significant enrichment of genes associated with the longevity regulating pathway, an intriguing observation that merits further investigation. Future studies will aim to delineate the impact of Chelerythrine on C. elegans healthspan in the absence of pathogenic stress.

Notably, the protective effect of Chelerythrine in nematodes is also dependent on the nuclear receptor NHR-49 (17) and its downstream desaturase genes fat-5, fat-6, and fat-7. As the functional ortholog of mammalian PPARα, NHR-49 primarily maintains lipid homeostasis by regulating fatty acid β-oxidation and desaturation, with recent studies progressively revealing its crucial role in immune regulation (37). Fatty acid metabolism not only provides energy and membrane structural foundations for immune responses, but its metabolites, such as unsaturated fatty acids, can also serve as signaling molecules directly modulating immune-related gene expression. Our finding that NHR-49 and its downstream desaturase genes mediate the immunoenhancing effects of Chelerythrine suggests that this compound may also enhance immune defense through modulation of lipid metabolism. However, we acknowledge that our functional validation of core genes was performed using only single-allele loss-of-function mutants without rescue experiments or tissue-specific RNAi verification, which represents a limitation of the current study. Although the consistency of phenotypes across multiple independent mutant alleles (nhr-49 and three distinct fat double mutant combinations) substantially reduces the likelihood of background mutation interference, future rescue experiments would further consolidate the genotype-phenotype causality. Although we have demonstrated that Chelerythrine activates NHR-49 and its downstream target genes, we fully acknowledge that the precise molecular mechanism by which Chelerythrine leads to NHR-49 activation—whether through direct ligand binding, modulation of upstream signaling cascades, or indirect metabolic sensing—remains an open and important question. Identifying the direct molecular target of Chelerythrine and elucidating the detailed mechanism of NHR-49 activation represent key directions for future investigation. Furthermore, while our data establish that the fat-5/6/7 desaturases play a critical role in mediating Chelerythrine’s antifungal immunity, and that their expression is transcriptionally upregulated by Chelerythrine treatment, whether Chelerythrine directly alters the lipid metabolic profile of C. elegans through modulation of these desaturase activities remains to be determined by future metabolomic profiling.

Importantly, our study suggests a potential functional interaction between DAF-16 and NHR-49 in response to C. albicans infection (17). Evidence indicates that DAF-16 can regulate the expression of certain lipid metabolism-related genes, while the lipid homeostasis maintained by NHR-49 provides the necessary membrane environment and signaling molecules for DAF-16-mediated stress defense (38). The concurrent activation of both pathways by Chelerythrine suggests that it may function as an upstream signal that coordinately regulates the immune-metabolic network through as-yet-undefined mechanisms. This mechanism of action differs from previously reported studies in which various natural products and pharmaceuticals extend nematode lifespan through classical immune signaling pathways. For instance, metformin enhances innate immunity in both C. elegans and mice via p38 MAPK signaling (29); luteolin promotes pathogen resistance in C. elegans in a DAF-2/DAF-16 insulin-like signaling pathway-dependent manner; sanguinarine promotes healthspan and enhances innate immunity through PMK-1/SKN-1-dependent mechanisms (39); brevilin A promotes innate immunity in C. elegans in a p38 MAPK-dependent manner (40); and aspartame enhances innate immunity and extends lifespan in C. elegans via the autophagy pathway (32). Collectively, Chelerythrine possesses a distinct mechanism of action, and future investigations are warranted to explore its direct molecular targets and the specific interactive mechanisms between DAF-16 and NHR-49.

In summary, this study demonstrates that Chelerythrine enhances the innate immune response of C. elegans against C. albicans by activating the DAF-16-mediated FoxO pathway and the NHR-49-mediated fatty acid metabolism pathway (Figure 7). Given the evolutionary conservation of the FoxO pathway and fatty acid metabolism pathways in mammals, Chelerythrine-a natural product that enhances host defense through simultaneous modulation of immune and metabolic networks-may offer greater efficacy and a lower risk of drug resistance compared to single-target agents, thereby providing novel insights for the development of therapeutic strategies against fungal infections. Subsequent studies should further validate its immunoenhancing effects and safety profile in mammalian models and explore its potential as an adjunctive therapeutic agent in clinical applications.

Figure 7.

Schematic diagram illustrates the mechanism by which Chelerythrine enhances anti-fungi immunity in C. elegans via the FoxO signaling and fatty acid metabolism pathways.

4. Materials and methods

4.1. Chemicals

Chelerythrine (purity ≥ 98%, as determined by HPLC) was obtained from Sigma Chemical Co. (St. Louis, MO, USA), and was dissolved in dimethyl sulfoxide (DMSO) as a stock solution at a 10 mM concentration and was stored in aliquots at -20 °C.

4.2. Worm strains and cultivation

Worms were maintained and propagated under standard conditions as previously described (41–43). The following nematode strains were obtained from the Caenorhabditis Genetics Center (CGC), which was funded by NIH Office of Research Infrastructure Programs (P40 OD010440): N2 Bristol wild-type, CF1038 daf-16 (mu86), STE68 nhr-49 (nr2041), CE541 sbp-1(ep79), BX110 fat-5(tm420); fat-6(tm331), BX160 fat-5(tm420); fat-7(wa36), BX156 fat-6(tm331); fat-7(wa36), KU25 pmk-1 (km25), SD184 mpk-1(n2521), RB911 fshr-1(ok778), VC3201 atfs-1(gk3094), VC517 bec-1(ok691), TJ356 (DAF-16::GFP), CF1553 (SOD-3::GFP), BX150 (FAT-5::GFP), BX115 (FAT-6::GFP), and BX113 (FAT-7::GFP). C. elegans mutants were backcrossed three times to the wild-type(N2) strain and used in the laboratory.

4.3. Infection assay

E. coli OP50, L. monocytogenes 10403S, S. enterica SL1344, E. faecalis ATCC 29212, and P. aeruginosa PA14 were grown overnight in LB broth at 37 °C. C. albicans SC5314 was grown overnight in Sabouraud Dextrose Broth (SDA) at 30 °C. For plate preparation, 500 μL of each overnight pathogen culture was spread onto 90 mm nematode growth medium (NGM) agar plates. The plates were then incubated overnight at the respective growth temperature (37 °C for bacterial pathogens, 30 °C for C. albicans) to establish a uniform microbial lawn. All cultures were then spread onto nematode growth medium (NGM) plates. All infection assays were performed on NGM agar plates or NGM plates supplemented with or without Chelerythrine (0, 1, 10, 100 μM). Chelerythrine was dissolved in dimethyl sulfoxide (DMSO) to prepare a 10 mM stock solution. For dose-screening experiments, NGM agar plates were prepared with a total volume of 50 mL per group, with the following additions to achieve the indicated final concentrations while maintaining a constant final DMSO volume of 500 μL (1%) across all groups: 0 μM Chelerythrine, 500 μL DMSO; 1 μM Chelerythrine, 5 μL stock + 495 μL DMSO; 10 μM Chelerythrine, 50 μL stock + 450 μL DMSO; 100 μM Chelerythrine, 500 μL stock (44). For all subsequent mechanistic experiments, in which only the optimal concentration of 10 μM Chelerythrine was evaluated, the DMSO volume was reduced to 50 μL per group (0.1% final concentration) for both the control (50 μL DMSO) and the 10 μM Chelerythrine group (50 μL stock) (44). This solvent compensation strategy ensures that control and treated groups are exposed to identical final DMSO concentrations within each experimental phase, thereby excluding solvent-related confounding effects. Synchronized populations of worms were cultivated on E. coli OP50 at 20 °C until the young adult stage. 30–60 worms were transferred to NGM agar plates containing L. monocytogenes 10403S, S. enterica SL1344, E. faecalis ATCC 29212, P. aeruginosa PA14, and C. albicans SC5314 at 25 °C, respectively. The number of living worms was counted at 24-hour intervals. Immobile adult worms unresponsive to touch were scored as dead (45–47). Three plates were tested per assay, and all experiments were performed three times independently.

4.4. Fungal proliferation assay

C. albicans SC5314 was grown overnight in Sabouraud Dextrose Broth at 30 °C with shaking at 200 rpm. The overnight culture typically reached an OD₆₀₀ of approximately 1.0–1.5. The culture was then diluted 1,000-fold in fresh SDA (pH 7.0) (48, 49) to a starting OD₆₀₀ of ~0.001–0.0015. This diluted culture was aliquoted into microtiter plates, and 10 μM Chelerythrine or an equivalent volume of DMSO (vehicle control) was added. Plates were incubated at 30 °C with continuous shaking at 200 rpm. Absorbance at 600 nm was measured every 2 hours over a 24-hour period using a microplate reader. All OD₆₀₀ values were corrected by subtracting the absorbance of a blank well containing SDA medium only. Data were collected from three independent replicates for each condition.

4.5. Bacterial proliferation assay

Bacterial strains were grown overnight in LB broth at 37 °C with shaking at 180 rpm. The typical OD₆₀₀ of overnight cultures prior to dilution was as follows: approximately 1.0–1.5 for L. monocytogenes, P. aeruginosa, and S. enterica; approximately 0.5 for E. faecalis. Cultures were then diluted 1,000-fold in fresh LB (pH 7.0) (50, 51) to an estimated starting OD₆₀₀ of ~0.001–0.0015 for most strains, and ~0.0005 for E. faecalis. The diluted cultures were aliquoted into microtiter plates, and 10 μM Chelerythrine or an equivalent volume of DMSO (vehicle control) was added. Plates were incubated at 37 °C with continuous shaking at 180 rpm. Absorbance at 600 nm was measured every 2 hours over a 24-hour period. All OD₆₀₀ values were corrected by subtracting the absorbance of a blank well containing LB medium only. Data were collected from three independent replicates for each condition.

4.6. Quantification of intestinal fungal loads

Synchronized populations of worms were cultivated on E. coli OP50 at 20 °C until the young adult stage. C. albicans were grown in SDA liquid medium at 30 °C overnight. For plate preparation, 500 μL of the overnight C. albicans culture was spread onto 90 mm NGM agar plates, and the plates were incubated overnight at 30 °C to establish a uniform fungal lawn. Worms were then transferred to NGM agar plates (supplemented with or without 10 μM Chelerythrine) containing C. albicans for 48 h at 25 °C (52, 53). To eliminate the C. albicans from the surface of worms, worms were transferred to NGM agar plate seeded with E. coli OP50 for 20 min, and this step was repeated three times (54). Twenty worms were transferred into 200 μl PBS plus 0.1% Triton and ground (54). The lysates were spread onto SDA agar plates and incubated at 30 °C. After two days of incubation at 30 °C, colonies of C. albicans were counted. Three plates were tested per assay and all experiments were performed three times independently.

4.7. RNA-seq data analysis

For RNA-sequencing, samples were collected under C. albicans infection conditions. Specifically, wild-type N2 worms were infected with C. albicans and simultaneously treated with 10 μM Chelerythrine or vehicle control for 48 hours prior to RNA extraction, thereby capturing transcriptomic changes that occur during active infection. Briefly, synchronized L4-stage wild-type N2 worms were transferred to NGM plates containing a C. albicans lawn supplemented with 10 μM Chelerythrine or vehicle control and incubated at 25 °C for 48 hours. Approximately 500 μL of packed worms were collected per replicate for each sample, and three independent biological replicates were prepared for each treatment group. Total RNA was extracted using Trizol reagent (ThermoFisher, 15596018) following the manufacturer’s instructions. The average insert size for the final cDNA libraries were 300 ± 50 bp. Finally, 2 × 150 bp paired-end sequencing (PE150) was performed on an Illumina NovaSeq 6000 platform (LC-BioTechnology CO., Ltd., Hangzhou, China) according to the vendor’s recommended protocol. This Illumina paired-end RNA-seq method generated millions of 2 × 150 bp paired-end reads. All transcriptomes from all samples were merged to reconstruct a comprehensive transcriptome using gffcompare software. After the final transcriptome was generated, StringTie and ballgown were used to estimate the expression levels of all transcripts and to calculate mRNA expression abundance based on FPKM (fragments per kilobase of transcript per million mapped reads) values. Differential gene expression analysis was conducted using DESeq2 for group comparisons and edgeR for individual sample comparisons. Genes with false discovery rate (FDR) < 0.05 and | log₂FoldChange | ≥ 0.5 were considered differentially expressed. Differentially expressed genes were then subjected to Gene Ontology (GO) functional enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis. The raw sequencing data have been submitted to the NCBI Gene Expression Omnibus (GEO) under the accession number PRJNA1401773.

4.8. Fluorescence microscopy

Synchronized L1 worms of the DAF-16::GFP, SOD-3::GFP, FAT-5::GFP, FAT-6::GFP and FAT-7::GFP strains were cultivated on NGM plates seeded with E. coli OP50 at 20 °C until they reached the L4 stage. L4-stage worms were then transferred to NGM agar plates containing a C. albicans lawn (prepared as described in Section 4.3) supplemented with or without 10 μM Chelerythrine and incubated at 25 °C for 12 hours. Images were obtained using a Zeiss Axioskop 2 plus fluorescence microscope (Carl Zeiss, Jena, Germany) equipped with a digital camera. Fluorescence intensity was quantified using the ImageJ (55) software (NIH). Three plates with approximately 30 animals per plate were examined per assay, and all experiments were performed independently three times.

4.9. Quantitative real-time PCR

Nematodes were synchronized and treated for 2 days with or without 10 μM Chelerythrine starting at the L4 larval stage. Total RNA was extracted from worms using TRIzol Reagent (Invitrogen) as previously described (55, 56). Random-primed cDNAs were generated by reverse transcription of the total RNA samples with SuperScript II (Invitrogen). qPCR was performed using SYBR Premix Ex Tag (Takara, Dalian, China) on an Applied Biosystems Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). Using pmp-3 for an internal control as previously described (57). The following primers were used in this study:

pmp-3 primers:

pmp-3-F: TGGATTGTCATTGGCGTCG.

pmp-3-R: GTTGTCGCAGAGTGGTGTTT.

sod-3 primers:

sod-3-F: TCCAAGCACACTCTCCCAGAT.

sod-3-R: TCTCCACCATCCTTAGCCAAG.

thn-2 primers:

thn-2-F: GCTCGCACCATCACTATCTAC.

thn-2-R: CACATCCAGTTCTTGCCCAA.

lys-7 primers:

lys-7-F: ATGACTCCACAGCCCGTTT.

lys-7-R: GGCGAAGTGACCTGAATCCA.

nhr-49 primers:

nhr-49-F: GTCGTTATTGTCGCTTTCAA

nhr-49-R: TCCGACACCGTTGCTGTTTC

mdt-15 primers:

mdt-15-F: CGTAGCAACAACACAGGCATCAAC

mdt-15-R: AACAGCAGCAGTGGCAGAAGC

fat-5 primers:

fat-5-F: GGGCTACAGTTGGATGGGTATT

fat-5-R: CGGGTCAGCATCAGTATCCG

fat-6 primers:

fat-6-F: AAGATTGAGAAGGACGGCGG

fat-6-R: TCACGGTTTGCCATTTTGCC

fat-7 primers:

fat-7-F: AAGGAGCATGGAGGCAAACT

fat-7-R: TTCTCAACGGCGGAAACAGA

4.10. Statistics

Data were presented as mean ± SEM. Statistical analyses for all data except for survival assays was carried out using Student’s t-test (unpaired, two-tailed) or ANOVA after testing for equal distribution of the data and equal variances within the data set. Survival data were analyzed by using the log-rank (Mantel-Cox) test. All statistical analyses and data plotting were performed using GraphPad Prism (GraphPad Software, San Diego, CA, USA). P < 0.05 was considered significant. .

Funding Statement

The author(s) declared that financial support was received for this work and/or its publication. This work was supported by the Guizhou Province Science and Technology Plan Project (Guizhou Science and Technology Foundation-ZK [2024] General 279); the Zunyi City Science and Technology Program Project (ZSKH SYS[2025]1); the “12345 Future Talent Training Plan” of Zunyi Medical University Future Teaching Master (No.20221028).

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: https://www.ncbi.nlm.nih.gov/geo/, PRJNA1401773.

Author contributions

SF: Investigation, Writing – original draft. GB: Conceptualization, Writing – original draft. TZ: Investigation, Writing – original draft. YX: Conceptualization, Data curation, Supervision, Writing – review & editing. YT: Conceptualization, Funding acquisition, Supervision, Writing – review & editing.

Conflict of interest

The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declared that generative AI was not used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.