Hepatoprotective Potential of Eugenol Against Pesticide Glyphosate‐Induced Liver Injury via Nrf2/HO‐1 Signaling and Modulation of Apoptosis and Inflammation in Rats

ABSTRACT

Glyphosate (GLY) is a widely used herbicide active ingredient applied in agricultural, residential, and public areas. Although the European Chemicals Agency has stated that current evidence is insufficient to classify GLY as an endocrine disruptor, increasing experimental data indicate that GLY may induce organ toxicity. This study aimed to investigate glyphosate‐induced liver toxicity and to evaluate the potential protective effects of eugenol in a rat model. Eugenol is a phenolic compound predominantly found in clove oil (Syzygium aromaticum L.) and is known for its antioxidant, anti‐inflammatory, antimicrobial, and analgesic properties. It is classified as generally recognized as safe (GRAS) and non‐mutagenic by the World Health Organization. Thirty‐five male rats were randomly assigned to five groups: Control, EU‐100, GLY, GLY + EU‐50, and GLY + EU‐100. All treatments were administered orally by gavage. Oxidative stress markers (lipid peroxidation, reduced glutathione, and superoxide dismutase), liver enzyme activities (ALT, AST, and ALP), and the expression of genes involved in antioxidant defense, apoptosis, and inflammation (HO‐1, Nrf2, CAT, GPx, Bax, Caspase‐3, Bcl‐2, COX‐2, NF‐κB, IL‐6, TNF‐α, and IL‐1β) were analyzed. Short‐term GLY exposure resulted in oxidative imbalance, inflammatory activation, and apoptosis in hepatic tissue. Eugenol administration significantly alleviated these alterations by enhancing antioxidant defenses, activating the Nrf2/HO‐1 signaling pathway, and suppressing pro‐inflammatory responses. These findings suggest that eugenol may represent a promising natural hepatoprotective agent against glyphosate‐induced liver toxicity.

Glyphosate was administered orally to rats at the specified doses. At the end of the study, liver tissues were collected for analysis. These tissues were used to perform Western blot, RT‐PCR, liver enzyme assays, and lipid peroxidation measurements.

1. Introduction

The use of agrochemicals has become indispensable worldwide for improving agricultural yields. At present, these compounds are vital not only for pest and rodent management but also for limiting a wide range of microbial diseases. Contemporary farming practices utilize a wide range of chemical agents, including herbicides, insecticides, and other pest control compounds. The increasing global demand for agricultural productivity, coupled with the achievements of the pesticide industry, has facilitated the extensive acceptance and utilization of these synthetic agents across the world [1]. The most widely used among these is glyphosate [2]. Glyphosate (N‐(phosphonomethyl) glycine) was first identified in 1970 and subsequently authorized for herbicidal use in 1974, and since then, it has emerged as one of the most extensively applied herbicides across the globe [3]. Glyphosate targets and suppresses 5 enolpyruvyl shikimate 3 phosphate synthase, an enzyme crucial for the shikimate pathway and the production of aromatic amino acids in plants, resulting in growth inhibition [3].

The widespread use of glyphosate worldwide has led to the accumulation of residues in environmental matrices, including soil and drinking water. These residues can enter the bodies of animals and humans through the food chain, aerosols, and dust particles [4]. Studies conducted in mammals have shown that glyphosate exposure may lead to numerous adverse effects, including autism‐like neurological damage, reduced sperm quality, various cancers, gastrointestinal injuries, and liver damage [5, 6, 7].

Although the systemic role of glyphosate are broad, the liver is one of the primary organs involved in its metabolism and detoxification. Consequently, hepatocytes are highly vulnerable to the direct toxic effects of this compound. Earlier investigations have indicated that glyphosate exposure can trigger multiple pathological changes in hepatic tissue, such as enhanced oxidative damage, altered enzyme activity, mitochondrial impairment, and increased inflammatory responses [8]. Concurrently, glyphosate can exacerbate hepatic damage by stimulating reactive oxygen species (ROS) generation and promoting oxidative imbalance and inflammatory signaling within diverse cell types, which in turn triggers hepatic stellate cell (HSCs) stimulation and activation and macrophages [9].

Long‐term intake of low concentrations of glyphosate or glyphosate‐containing products has been linked to oxidative DNA injury in the liver, as well as the development of steatosis, necrotic changes, and disturbances in gene expression [10]. In subacute exposure models, an increase in ROS has been reported. At the same time, pro‐inflammatory the analysis revealed higher concentrations of cytokines, including TNF‐α, IL‐6, and IL‐1β. Additionally, signs of fibrosis, including collagen deposition, indicate structural and functional disturbances in the liver [11]. Therefore, these findings suggest that under conditions of chronic exposure, glyphosate is not merely an oxidative stress agent but may also disrupt energy metabolism and cellular defense mechanisms, thereby contributing to hepatotoxicity [10, 12].

In recent years, natural antioxidants have become an important area of research in the prevention of pesticide‐induced toxicities. Among natural bioactive compounds, eugenol is a phenolic constituent obtained from the clove plant, notable for its strong antioxidant, anti‐inflammatory, and liver‐protective actions, and it has been extensively incorporated as a functional ingredient in numerous therapeutic formulations [13, 14]. A review on eugenol reported that, in addition to its antioxidant, antiinflammatory, and hepatoprotective effects, this compound also exhibits antimicrobial, anticancer, and analgesic properties. However, it has also been emphasized that at high concentrations, eugenol may exert pro‐oxidative effects by enhancing free radical production [15, 16].

In this study, both serum biochemical parameters and molecular markers were evaluated to better elucidate the mechanisms underlying glyphosate‐induced hepatotoxicity. In addition to liver function indicators such as ALT, AST, and ALP levels, Indicators of oxidative stress including CAT, SOD, MDA and GPx were analyzed. Moreover, the levels of HO‐1 and Nrf2, key regulators of the cell‐based antioxidative response, as well as Bcl‐2, Caspase‐3 and Bax proteins involved in apoptotic pathways were examined. To gain a clearer understanding of the inflammatory process, the relative expression of IL‐1β, IL‐6, TNF‐α, COX‐2, NF‐κB, and TLR‐4 proteins was examined. These measurements were performed through the Western blot method. Through this method, the consequences of glyphosate exposure on redox status, apoptosis, and inflammation were systematically investigated.

2. Material and Methods

2.1. Chemicals

Eugenol (Catalog No: 119111000, Thermo Scientific, USA) was obtained from Thermo Scientific. Glyphosate (Roundup Star®, Bayer AG, Kaiser‐Wilhelm‐Allee 1, 51373 Leverkusen, Germany) was obtained from Bayer AG.

2.2. Experimental Animals and Housing Conditions

For this experiment, a total of 35 male Sprague‐Dawley rats, aged about 10–12 weeks and weighing between 220 and 250 g, were obtained from Atatürk University's Experimental Research Center. Prior to the study, all animals were allowed to acclimate for 1 week. During the trial, the animals were maintained in a laboratory environment under regulated conditions, where the room temperature was kept steady at 22 ± 1°C. relative humidity (around 55 ± 5%), and a 12 h light/dark rhythm. All animal procedures were carried out with the approval of the Atatürk University Animal Ethics Committee (Protocol No: 165, dated 29.07.2025).

2.3. Experimental Groups

The rats were randomly divided into five groups, with seven animals in each, as described below.

Group 1 (Control): The animals received oral physiological saline once daily for a period of 7 days.

Group 2 (EU‐100): The animals received eugenol orally through gavage at 100 mg/kg for seven consecutive days [17].

Group 3 (GLY): Glyphosate was administered to the animals by oral gavage at a dose of 150 mg/kg for seven consecutive days [18].

Group 4 (GLY + EU‐50): For seven consecutive days, rats received 50 mg/kg eugenol by oral gavage, followed 30 min later by glyphosate at a dose of 150 mg/kg.

Group 5 (GLY + EU‐100): For seven consecutive days, the animals first received 100 mg/kg eugenol by oral gavage, followed half an hour later by 150 mg/kg glyphosate.

One day after the last eugenol dose (day 8), the rats were anesthetized and sacrificed. After that, liver samples were taken. The tissues were washed with saline, dried lightly with filter paper, and put into storage at −80°C. To evaluate glyphosate‐induced liver injury and to determine the potential protective effects of eugenol, various biochemical, molecular, and histopathological analyses were performed on the collected liver samples.

2.4. Analysis of Liver Function Markers

Liver function was evaluated by measuring serum enzyme activities, including AST, ALP, and ALT. These measurements were performed with commercial kits supplied by TML Diagnostic Medical Products. The assays were carried out spectrophotometrically using a Bio Tek ELISA microplate reader, in accordance with the manufacturer's protocol. The enzyme activities of ALT, ALP, and AST were reported in units per liter (U/L).

2.5. Profiling Antioxidant Activity in Liver Samples

GSH levels in the tissue were measured following the procedure described by Sedlak and Lindsay (Sedlak and Lindsay, 1968). Liver tissues were homogenized using Tris‐HCl buffer (50 mM, pH 7.5) containing 20 mM EDTA, with a final volume adjusted to 2 ml. After adding 2 ml of ethanol to precipitate proteins, the mixture was spun down at 3000 g for 40 min at 4°C. Following centrifugation, the upper liquid fraction was utilized for GSH determination using 5,5’‐dithiobis (2‐nitrobenzoic acid) (DTNB). Absorbance readings were performed at 412 nm, and the results were expressed as nmol per gram of tissue.

2.6. Assessment of Lipid Peroxidation in Hepatic Tissue

LPO formation, a marker of lipid peroxidation, was measured in tissues via the thiobarbituric acid (TBA) reaction [19]. Liver tissues were first weighed and then homogenized in a potassium chloride solution (100 g/L, 10 ml). From this homogenate, 0.5 ml was taken and combined with sodium lauryl sulfate (0.2 ml, 80 g/L), acetic acid (1.5 ml, 200 g/L), thiobarbituric acid (1.5 ml, 8 g/L), and 0.3 ml of distilled water. The prepared mixture was heated at 98°C for 1 h. After cooling, 5 ml of an n‐butanol to pyridine solution (15:1 ratio) was added, vortexed thoroughly, and centrifuged at 4000 rpm for 30 min. The absorbance of the upper phase was then determined at 532 nm using a spectrophotometer. Calibration was carried out with 1,1,3,3‐tetramethoxypropane, and recovery was found to be higher than 99%. Final results were expressed as nmol MDA per gram of tissue.

2.7. Solation of Total RNA, cDNA Preparation, and Quantitative PCR in Hepatic Tissue

RNA isolation from rat liver samples was carried out using the QIAzol Lysis Reagent (Qiagen, Catalog No ‐79306; Germany) according to the supplier's instructions. The concentration and purity of RNA were evaluated with a Nano‐Drop spectrophotometer (BIO‐TEK Epoch spektrofotometre, ABD), and sample dilutions were made when necessary. cDNA was synthesized with the iScript™ cDNA Synthesis Kit (BIO‐RAD, United States), following the manufacturer's instructions. as instructed by the supplier. The obtained cDNA was used as a template for analyzing the expression of the target genes shown in Table 1. PCR mixtures were prepared with Quanti‐Tect SYBR Green PCR Master Mix (Qiagen, Cat. No: 204143, Germany), nuclease‐free water, and cDNA, and each sample was run in triplicate on the ROTOR‐GENE‐Q system (Qiagen, Germany). GAPDH served as the normalization control, and differences in gene regulation were calculated using the 2^−ΔΔCT method described by Livak and Schmittgen [20].

Table 1.

Primer sequences.

Gene	Sequences (5′‐3′)	Length (bp)	Accession No
Nrf2	F‐TTTGTAGATGACCATGAGTCGCR‐TCCTGCCAAACTTGCTCCAT	161	NM_ 031789.2
HO‐1	F‐ATGTCCCAGGATTTGTCCGAR‐ATGGTACAAGGAGGCCATCA	144	NM_ 012580.2
Bax	F‐TTTCATCCAGGATCGAGCAGR‐AATCATCCTCTGCAGCTCCA	154	NM_ 017059.2
Bcl‐2	F‐GACTTTGCAGAGATGTCCAGR‐TCAGGTACTCAGTCATCCAC	214	NM_ 016993.2
Caspase‐3	F‐ACTGGAATGTCAGCTCGCAAR‐GCAGTAGTCGCCTCTGAAGA	270	NM_ 012922.2
CAT	F‐CTGAGAGAGTGGTACATGCAR‐AATCGGACGGCAATAGGAGT	141	NM_ 012520.2
GPx	F‐CAAGGTGCTGCTCATTGAGAR‐ATGTCCGAACTGATTGCACG	141	NM_ 030826.2
SOD	F‐AATGTGGCTGCTGGAAAGGAR‐GCTTCCAGCATTTCCAGTCT	141	NM_ 017050.1

The antioxidant status of liver samples was evaluated by determining catalase (CAT), superoxide dismutase (SOD), and glutathione peroxidase (GPx) enzyme activities. The primer sequences applied are listed in Table 1.

2.8. Western Blot Procedure

Protein levels in liver tissue were determined in accordance with methods previously described in the literature [21]. To this end, approximately 12 mg of liver tissue obtained from each rat was homogenized with RIPA lysis buffer and centrifuged to collect the upper phase. The amount of protein was determined using the Pierce™ BCA Protein Assay Kit (Smith method, Thermo‐Scientific). Afterwards, protein extracts were placed into 10% SDS‐PAGE gels, resolved through electrophoresis, and then moved onto PVDF membranes. To prevent nonspecific binding, membranes were incubated in 3% BSA for 1.5 h, rinsed three times with TBS‐T, and subsequently exposed to the selected primary antibodies at 4°C overnight. β‐Actin (sc‐517582), NF‐κB (sc‐8008), IL‐1β (sc‐32294), TNF‐α (sc‐130349), IL‐6 (sc‐32296), COX‐2 (sc‐514489), TLR‐4 (sc‐293072). All Western blot analyses were performed in three independent experimental repeats under identical conditions. Following incubation, the membranes were rinsed five‐times with TBS‐T to eliminate the primary antibodies. They were then exposed for 1.5 h to a goat anti‐mouse Ig‐G secondary antibody (Santa Cruz Biotechnology, Catalog sc‐2005, USA). After removing the secondary antibodies with additional washes in TBS‐T, detection was carried out with the aid of the Western HRP Substrate Trident Femto (Cat. No: GTX‐14698). The protein bands obtained were detected and recorded with the Gel Doc XR+ imaging system (Bio‐Rad Corp., Hercules, United States).

2.9. Histopathological Examination

Initially, liver samples were placed in 10% buffered formalin for 48 h to ensure fixation. Following this step, the tissues were processed through conventional histological procedures and then embedded in paraffin blocks. Sections with a thickness of 4 μm were prepared and stained with hematoxylin and eosin. Finally, the slides were evaluated using a light microscope (Leica Flexacam i5, Germany). Evaluation of tissue sections emphasized degenerative, necrotic, and inflammatory changes in the liver. The lesions were graded on a four‐point scale: absent (−), mild (+), moderate (++), and severe (+++) [22].

2.10. Immunohistochemical Examination

Immunohistochemical procedures involved placing the sections onto poly l‐lysine–coated slides, after which they underwent routine preparation steps such as deparaffinization and dehydration. To block endogenous peroxidase, tissue sections were treated with 3% hydrogen peroxide for 10 min. Afterwards, antigen retrieval was performed by heating the samples in 1% TRIS‐EDTA buffer (pH 6.1, 100X) and subsequently allowing them to cool at room temperature. To reduce nonspecific binding, a protein block was applied for 5 min. Afterwards, the sections were treated with primary antibodies (8‐OHdG, Cat. No: sc‐66036, 1:100 dilution; AKT primary antibody, bs‐5182R, dilution 1:100, supplied by Bioss, USA) in line with the instructions provided by the supplier. After detection antibody application, 3‐Amino‐9‐Ethylcarbazole (AEC) served as the chromogen. Slides were visualized using a Leica Flexacam i5 light microscope (Germany), and immunoreactivity was quantified with ImageJ software [23].

2.11. Immunofluorescence Examination

For immunofluorescence analysis, liver sections were placed on slides coated with poly‐l‐lysine and underwent standard deparaffinization and dehydration steps. For antigen retrieval, the tissue sections were exposed to heat in citrate buffer (pH 6.1, 100X), following this step, the samples were left to reach room temperature naturally. To minimize nonspecific signals, the sections were exposed to a protein blocking agent for 5 min. They were then incubated with the target‐specific antibody (PI3K, Catalog Number: bs‐6417R, rabbit polyclonal, dilution 1:100, US) under the conditions recommended by the manufacturer.

Afterward, an FITC‐labeled secondary antibody (Catalog No: ab6717, rabbit polyclonal, dilution 1/1000) was incubated in the absence of light for 45 min. The slides were subsequently mounted with a DAPI‐containing medium (Invitrogen, cat. D1306, diluted 1:200, UK) and coverslipped following a short incubation in darkness.

Fluorescence images were obtained using a Zeiss AXIO microscope (Germany), the intensity of staining was measured using the ImageJ analysis program [24].

2.12. Statistical Analysis

Data are presented as mean ± standard deviation (SD). Normality of data distribution was assessed using the Shapiro–Wilk test, and homogeneity of variance was evaluated using Levene's test. All datasets met the assumptions required for parametric analysis (p > 0.05). One‐way analysis of variance (ANOVA) followed by Tukey's post hoc test was applied for multiple group comparisons. Effect size estimation was not included in the original statistical output and therefore could not be consistently calculated for all datasets; however, statistical robustness is supported by consistent significance patterns and biologically meaningful differences observed across experimental groups.

3. Results

3.1. Liver Enzyme Findings

In the GLY group, AST, ALP, and ALT levels were significantly elevated (p < 0.001), whereas the EU‐100 group showed no significant difference compared to the control group. Co‐administration of EU (50 and 100 mg/kg) with GLY markedly suppressed the increases in AST, ALT, and ALP levels, particularly at the higher dose (GLY + EU‐100), demonstrating a Table 2.

Table 2.

Serum AST, ALT and ALP levels.

Parameters	Control	EU‐100	GLY	GLY + EU‐50	GLY + EU‐100
AST (U/L)	42.4 ± 4.11	44.08 ± 3.98###	107.98 ± 5.26***	85.1 ± 5.17*** ###	64.79 ± 4.44***,###,✰✰
ALT (U/L)	30.1 ± 3.24	32.05 ± 3.84###	69.98 ± 5.14***	22.56 ± 5.66***	39.67 ± 4.61###,✰✰✰
ALP (U/L)	34.9 ± 2.80	25.29 ± 3.17###	86.78 ± 4.61***	65.58 ± 4.10*** ###	50.76 ± 3.46**,###,✰✰

Note: Hepatoprotective effect (p < 0.001) (Table 2). Values are given as mean ± SEM (n = 7). For comparisons, one‐way ANOVA was applied, and Tukey's test was used for post hoc evaluation.

Significance was indicated by the following symbols:

^** p < 0.01

^*** p < 0.001 versus control; ^# p < 0.05, ^## p < 0.01, ^### p < 0.001 versus GLY; and ^✰ p < 0.05, ^✰✰ p < 0.01, ^✰✰✰ p < 0.001 for inter‐treatment differences.

3.2. Levels of GSH and LPO

Glyphosate exposure caused a marked reduction in hepatic GSH levels, accompanied by a significant elevation in LPO, indicating oxidative imbalance. In contrast, eugenol supplementation effectively restored antioxidant capacity, as evidenced by increased GSH and reduced LPO levels. The most pronounced protective effect was observed in the GLY + EU‐100 group, where values approached those of the control group (Figure 1).

Figure 1.

Effects of glyphosate (GLY) and eugenol (EU) on hepatic glutathione (GSH) and lipid peroxidation (LPO) levels. GSH concentrations are expressed as µmol/g tissue, whereas LPO levels are expressed as nmol/g tissue. Data are presented as mean ± SD (n = 7). Statistical analysis was performed using one‐way ANOVA followed by Tukey's post hoc test. Statistical analysis was performed using one‐way ANOVA. Significance markers: Control versus others (*p < 0.05, **p < 0.01, ***p < 0.001); GLY versus others (^# p < 0.05, ^## p < 0.01, ^### p < 0.001); GLY+EU‐50 versus GLY+EU‐100 (^✰ p < 0.05, ^✰✰ p < 0.01, ^✰✰✰ p < 0.001).

3.3. Realtime PCR Findings

Figure 2 shows that GLY exposure caused a sharp reduction in the mRNA levels of genes linked to antioxidant defense. When compared to the control animals, HO‐1, NRF‐2, SOD, GPx, and CAT expressions were significantly lower in the GLY group (p < 0.001). By contrast, EU treatment alone elevated the expression of these genes. The EU‐100 group, in particular, exhibited the highest expression values, surpassing even the control group (p < 0.001).

Figure 2.

Effects of eugenol (EU) and glyphosate (GLY) administration on NRF‐2, HO‐1, SOD, CAT, and GPx mRNA expression levels in rat liver tissue. Expression values were normalized to GAPDH. Data are presented as mean ± SD (n = 7). Statistical analysis was performed using one‐way ANOVA followed by Tukey's post hoc test. Significance indicators: control versus others (*p < 0.05, **p < 0.01, ***p < 0.001); GLY versus others (^# p < 0.05, ^## p < 0.01, ^### p < 0.001); GLY + EU50 versus GLY + EU100 (^✰ p < 0.05, ^✰✰ p < 0.01, ^✰✰✰ p < 0.001).

EU co‐administration with GLY exerted a dose‐dependent protective effect. Particularly in the GLY + EU‐100 group, the expression levels of HO‐1, NRF‐2, SOD, GPx and CAT showed a marked increase relative to the GLY group (p < 0.001). Although these values remained lower than those observed in the within the EU‐100 treatment group clear trend toward the control levels. The GLY + EU‐50 group also demonstrated similar, though less pronounced, improvement. These findings indicate that glyphosate suppresses antioxidant defense mechanisms through oxidative stress, while eugenol significantly mitigates this damage by activating the HO‐1/Nrf2 pathway and enhancing the antioxidant enzymes, GPx, CAT and SOD.

According to Figure 3, administration of GLY triggered significant upregulation of apoptotic markers (BAX, Caspase‐3) (p < 0.001) along with a marked Decreased activity of the Bcl‐2 gene (p < 0.001). In contrast, in the group treated solely with eugenol (EU‐100), compared with the control, reduced levels of BAX and Caspase‐3 were observed, whereas Bcl‐2 expression was elevated (p < 0.001). In the GLY + EU combination groups—particularly with the higher EU‐100 dose Caspase‐3 and BAX expression was significantly reduced (p < 0.001), accompanied by a pronounced recovery in Bcl‐2 changes (p < 0.001). These findings demonstrate that glyphosate induces apoptosis in hepatocytes, while eugenol mitigates this process in a dose‐dependent manner by modulating the BAX/Bcl‐2 ratio and limiting Caspase‐3 activation.

Figure 3.

Effects of eugenol (EU) and glyphosate (GLY) treatment on BAX, BCL‐2, and CASP‐3 mRNA expression levels in rat liver tissue. Expression values were normalized to GAPDH. Data are presented as mean ± SD (n = 7). Statistical analyses were performed using one‐way ANOVA followed by Tukey's post hoc test. Significance markers: Control versus others (*p < 0.05, **p < 0.01, ***p < 0.001); GLY versus others (^# p < 0.05, ^## p < 0.01, ^### p < 0.001); GLY + EU‐50 versus GLY + EU‐100 (^✰ p < 0.05, ^✰✰ p < 0.01, ^✰✰✰ p < 0.001).

3.4. Western Blot Findings

Western blot analysis demonstrated that GLY treatment caused a clear rise in the levels of proinflammatory cytokines in liver tissue. When compared with the control animals, the GLY group displayed a significant increase in IL‐1β, TNF‐α, and IL‐6 proteins (p < 0.001). These findings highlight the strong inflammatory response triggered by GLY exposure. Interestingly, eugenol at the 100 mg/kg dose (EU‐100) reduced these changes, as cytokine expression in this group was nearly comparable to that of the controls. This suggests that EU supplementation exerted evidence of protection from GLY‐related inflammatory responses.

When rats were treated with both GLY and EU, the concentrations of TNF‐α, IL‐1β, and IL‐6 were considerably lower than those observed in the GLY‐only group (p < 0.001). In particular, the GLY + EU‐100 group revealed a clear reduction in these cytokines, almost reaching the control values. This outcome highlights that EU supplementation alleviates glyphosate‐driven inflammation. Moreover, the effect appeared to be dose‐dependent, with stronger suppression at higher EU doses (Figure 4).

Figure 4.

Western blot images and densitometric analyses illustrate the expression levels of TNF‐α, IL‐1β, and IL‐6 proteins in rat liver tissue. Band intensities were quantitatively analyzed using Image Lab software (version 6.1, Bio‐Rad) and normalized to β‐actin. Results are presented as fold change relative to control values. Statistical analysis was performed using one‐way ANOVA. Significance indicators: control versus others (*p < 0.05, **p < 0.01, ***p < 0.001); GLY versus others (^# p < 0.05, ^## p < 0.01, ^### p < 0.001); GLY + EU50 versus GLY + EU100 (^✰ p < 0.05, ^✰✰ p < 0.01, ^✰✰✰ p < 0.001).

Figure 5 illustrates that COX‐2 and NF‐κB expression levels were substantially higher in the GLY‐treated rats relative to controls. Treatment with EU‐100 alone resulted in a pronounced decline in these protein levels, falling even below those of the control group. In the co‐treatment sets (GLY + EU50 and GLY + EU100), COX‐2 and NF‐κB expressions were notably lower than in the GLY group, with the strongest reduction observed in GLY + EU‐100. These outcomes suggest that EU can effectively mitigate the inflammatory cascade triggered by GLY.

Figure 5.

Western blot images and densitometric analyses show the expression levels of COX‐2 and NF‐κB proteins in rat liver tissue. Band intensities were quantified using Image Lab software (version 6.1, Bio‐Rad) and normalized to β‐actin. Results are expressed as fold change relative to control. Statistical analysis was performed using one‐way ANOVA. Significance markers: Control versus others (*p < 0.05, **p < 0.01, ***p < 0.001); GLY versus others (^# p < 0.05, ^## p < 0.01, ^### p < 0.001); GLY + EU‐50 versus GLY + EU‐100 (^✰ p < 0.05, ^✰✰ p < 0.01, ^✰✰✰ p < 0.001).

3.5. Histopathological, Immunohistochemical, and Immunofluorescence Findings

Histopathological examinations of liver tissues revealed no significant alterations in the Control and EU100 groups. In contrast, the GLY group exhibited severe degenerative and necrotic changes in hepatocytes. However, in the GLY + EU50 and GLY + EU100 groups, these pathological findings isplayed a reduction that correlated with the dose (Figure 6).

Figure 6.

Histological images of liver tissue stained with H&E and IHC. Row (a) represents the control group, row (b) the GLY group, row (c) the GLY + EU50 group, row (d) the GLY + EU100 group, and row (e) the EU100 group. In the H&E column, black arrowheads indicate necrosis in hepatocytes, whereas black arrows denote degenerative changes. The staining method is hematoxylin and eosin (H&E). In the 8‐OHdG column, red arrowheads highlight the expression of 8‐OHdG in hepatocytes. In the AKT column, blue arrowheads indicate AKT expression in hepatocytes. The staining method used is IHC‐P. Scale bar: 10 µm; Objective: 20X; Zoom: 100%.

Immunohistochemical and immunofluorescence analyses revealed pronounced expression of AKT (Figure 6) and Pi3K (Figure 7), with minimal 8‐OHdG staining (Figure 1) in both the Control and EU100 groups. Rather, the GLY group displayed reduced AKT and Pi3K expression, accompanied by a substantial increase in 8‐OHdG positivity in hepatocytes. In the GLY + EU50 and GLY + EU100 groups, these alterations were partially reversed, showing a dose‐dependent recovery toward normal levels with statistically significant differences (p < 0.05). Both parametric and non‐parametric datasets obtained from histopathological, immunohistochemical, and immunofluorescence analyses, along with their statistical evaluations, are presented in Figure 8.

Figure 7.

Immunofluorescence (IF) staining images of liver tissues are presented. Row (a) represents the control group, row (b) the GLY group, row (c) the GLY + EU50 group, row (d) the GLY + EU100 group, and row (e) the EU100 group. PI3K expression in hepatocytes is indicated by white arrowheads. The staining was performed using IF. FITC: Fluorescein isothiocyanate‐labeled secondary antibody; DAPI: 4′,6‐diamidino‐2‐phenylindole, nuclear counterstain; MERGED: overlay of FITC and DAPI images. Scale bar: 50 µm, Objective: 40×, Zoom: 100%.

Figure 8.

The parametric and non‐parametric data obtained from histopathological, immunohistochemical, and immunofluorescence staining, along with their statistical analyses, are presented. For the evaluation of degeneration and necrosis, the Kruskal–Wallis test was applied, and the Mann–Whitney U test was used to determine intergroup differences. For the parametric immunohistochemical and immunofluorescence data, one‐way ANOVA was conducted, followed by Tukey's post hoc test. Letters a, b, c, and d indicate statistical differences, with all letters other than “a,” which represents the GLY group, denoting significance (p < 0.05). Data are expressed as mean ± SD.

4. Discussion

The findings of the present study suggest that eugenol may hold potential translational relevance as a dietary bioactive compound or therapeutic adjunct for mitigating pesticide‐induced hepatic injury. Given its natural origin and reported safety at appropriate doses, eugenol could be considered as a candidate for hepatoprotective strategies aimed at reducing oxidative stress–related liver damage. However, it should be emphasized that these results are derived from an experimental animal model, and direct clinical application requires further validation through chronic exposure studies, pharmacokinetic evaluations, and well‐designed human investigations.

In this study, the biochemical, histopathological, and molecular effects of GLY‐induced hepatotoxicity, as well as the possible protective effects of EU, were evaluated. The results of our study revealed that GLY treatment markedly enhanced oxidative imbalance, apoptotic activity, and inflammatory signaling within hepatic tissue, while EU supplementation mitigated these harmful outcomes in a concentration‐dependent fashion.

Several previous studies have reported the protective effects of eugenol against a variety of toxic agents, including heavy metals, pharmaceuticals, and different classes of pesticides, primarily through its antioxidant and anti‐inflammatory properties. However, these studies have largely focused on toxicants other than glyphosate and often emphasized general oxidative stress markers without detailed investigation of specific redox‐sensitive signaling pathways. In contrast, the present study specifically addresses glyphosate‐induced hepatotoxicity, a model that has been relatively underexplored in the context of eugenol intervention [25, 26]. Moreover, our findings provide mechanistic insight by demonstrating the involvement of the Nrf2/HO‐1 signaling axis and its association with reduced oxidative stress, inflammation, and apoptosis in a dose‐dependent manner. Thus, this study extends existing knowledge by positioning eugenol within a defined molecular framework relevant to glyphosate toxicity and highlights its potential hepatoprotective role under conditions of pesticide‐induced oxidative injury.

In the GLY group, MDA levels were found to be elevated. Simultaneously, a decline was observed in the activities of antioxidant enzymes such as SOD, GPx, and CAT. These results suggest that glyphosate alters the oxidative balance by stimulating the generation of ROS. As previously reported by Kong et al. (2025) and Han et al. (2024), GLY exposure induces lipid peroxidation, thereby compromising cell membrane integrity and contributing to hepatocellular injury [27, 28]. The degeneration and necrosis detected in histopathological analyses are consistent with these biochemical alterations.

An increase in Caspase‐3 and the increase in Bax expression, coupled with reduced Bcl‐2 levels, suggest that GLY triggers the mitochondrial apoptotic pathway. This imbalance points to enhanced apoptotic signaling within hepatocytes. Supporting this, Zhang et al. (2024) observed that GLY exposure disrupts mitochondrial function. Likewise, Wu et al. (2023) demonstrated that GLY can promote apoptotic cell death through similar mechanisms [29, 30]. In our study, the GLY group showed increased expression of COX‐2, IL‐1β, TNF‐α, NF‐κB, and TLR4. This result suggests that glyphosate exposure intensifies the pro‐inflammatory response.

Previous studies have demonstrated that upstream signaling pathways such as PI3K/AKT and MAPK play critical roles in the regulation of Nrf2 activation and nuclear translocation. Activation of the PI3K/AKT pathway has been shown to promote Nrf2 stabilization and enhance HO‐1 expression, thereby contributing to cytoprotective and anti‐apoptotic effects. Moreover, members of the MAPK family, including ERK, JNK, and p38, have been reported to modulate Nrf2 activity in response to oxidative stress [31, 32, 33]. Therefore, the activation of the Nrf2/HO‐1 axis observed in the present study may be partially mediated through these upstream signaling cascades, providing additional mechanistic insight into the anti‐apoptotic effects observed.

Eugenol administration significantly reversed the biochemical and histopathological alterations induced by GLY. Notably, the GLY + EU‐100 group exhibited results closest to the control values for oxidative stress markers and antioxidant enzyme activities. This finding is consistent with the potent free radical scavenging properties of eugenol [13, 34].

It has previously been reported by Mittal et al. (2014) that eugenol enhances antioxidant defense by activating the HO‐1/Nrf2 pathway and suppresses the inflammatory response [35]. Our study also demonstrated that eugenol administration led to an upregulation of HO‐1 and Nrf2 expression, a reduction in the Bax/Bcl‐2 ratio, and a reduction in the levels of proinflammatory cytokines, thereby supporting this mechanism.

Eugenol is known to exhibit a dual redox behavior depending on dose and cellular context. At low to moderate concentrations, eugenol functions predominantly as an antioxidant by scavenging reactive oxygen species and activating cytoprotective signaling pathways, including Nrf2‐mediated antioxidant responses. However, accumulating evidence suggests that at higher concentrations, eugenol may exert pro‐oxidant effects by promoting redox imbalance and mitochondrial dysfunction. Recent molecular studies have demonstrated that excessive eugenol exposure can induce oxidative stress–related signaling cascades and alter mitochondrial redox homeostasis, thereby contributing to cellular damage [36, 37]. In this context, the hepatoprotective effects observed in the present study appear to be dose‐dependent, with the selected eugenol doses maintaining redox equilibrium and effectively mitigating glyphosate‐induced oxidative damage. These findings underscore the importance of dose optimization when considering eugenol as a hepatoprotective agent and provide mechanistic support for its beneficial effects within a defined therapeutic window.

This study demonstrates that even short‐term exposure to GLY can induce hepatotoxicity characterized by oxidative stress, inflammation, and apoptosis, whereas eugenol can effectively mitigate these adverse effects. Our findings are consistent with recent reports highlighting the hepatoprotective and eugenol's anti‐inflammatory capacity [38, 39, 40].

Although glyphosate exposure in environmental and occupational settings is often chronic or sub‐chronic, the 7‐day exposure period used in the present study was designed to model acute to short‐term repeated exposure. Such exposure scenarios may occur during intensive agricultural application periods, occupational handling, or accidental exposure events. Short‐term experimental models are commonly employed to investigate early toxicological responses to glyphosate, including oxidative stress, inflammatory signaling, and initiation of apoptotic pathways, which represent critical early events in the development of long‐term toxicity. Moreover, this exposure duration allows for the evaluation of early protective and modulatory effects of therapeutic compounds, such as eugenol, without the confounding adaptations associated with prolonged exposure. Nevertheless, it should be acknowledged that chronic and sub‐chronic exposure models are necessary to fully elucidate the long‐term effects of glyphosate and to confirm the sustained protective efficacy of eugenol, which should be addressed.

The observed dose‐dependent protection indicates that eugenol has strong hepatoprotective potential. These findings support its possible role as a natural compound for preventing pesticide‐related liver injury.

5. Conclusion

This study demonstrated that even short‐term exposure to GLY induces significant hepatotoxicity characterized by oxidative stress, inflammation, and apoptosis, while EU markedly attenuates these adverse effects. GLY administration led to elevated MDA levels, reduced antioxidant enzyme activities, increased pro‐inflammatory cytokine expression, and histopathological findings of hepatocellular degeneration and necrosis. EU treatment, especially at higher doses, helped to reduce the damage. The effect was associated with activation of HO‐1/Nrf2, stronger antioxidant activity, better control of Bax/Bcl‐2 expression, and lower inflammation.

These results indicate that eugenol could act as a powerful natural compound with antioxidant and anti‐inflammatory properties, mitigating glyphosate‐induced liver toxicity. These findings emphasize the promise of plant‐derived protective agents in lowering the health risks linked to exposure from agricultural chemicals and offer support for further research exploring the therapeutic potential of eugenol.

Author Contributions

Esra Aktas Senocak: conceptualization, investigation, visualization, formal analysis. Omercan Alat: software, resources, visualization, writing – original draft. Ismail Bolat: visualization, formal analysis. Burak Batuhan Lacin: methodology, validation. Samet Tekin: methodology, data curation. Aslıhan Atasever: data curation, methodology, formal analysis. Merve Bolat: formal analysis, validation, methodology. Mesut Bunyami Halici: methodology, writing – review and editing, conceptualization.

Funding

The authors have nothing to report.

Ethics Statement

The authorization for animal experimentation was granted by the Atatürk University Committee on Local Animal Ethics (Approval No: 165, Date: 29.07.2025).

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Supporting File

Data Availability Statement

The data that supports the findings of this study are available in the supplementary information of this article.