ABSTRACT
Background
Hepatocellular Carcinoma (HCC) is a matter of great global public health importance; however, its current therapeutic effectiveness is deemed inadequate, and the range of therapeutic targets is limited. This study aimed to explore the efficacy of Bosutinib (BOS) in HCC and the underlying molecular mechanism.
Methods
Bioinformatic analysis, machine learning, and online databases were used for screening targets and molecular docking studies. The mRNA level of mammalian polo‐like kinase 1 (PLK1) was identified via real‐time quantitative PCR. The protein expression of PLK1, PTK2, and USP9X was detected using western blot. Cell viability, apoptosis, and migration were evaluated by MTT, flow cytometry, and transwell assay. The angiogenesis capacity was determined using tube formation assay. The glucose consumption, lactate production, and ATP/ADP ratios were analysed using commercial kits. CO‐IP assay was used to confirm the interaction between PLK1 and USP9X. A mouse model was used for exploring BOS in vivo. Immunochemistry was used to examine PLK1 and USP9X expression in tumours.
Results
This study illustrated that BOS inhibited proliferation, migration, angiogenesis, and glycolysis of HCC cells. Bioinformatic analysis and machine learning identified PLK1 as a core gene related to the glycolysis of HCC. PLK1 was upregulated in HCC and correlated with an unfavourable prognosis. Further evaluation showed that the anti‐tumour effects of BOS were impaired by PLK1 overexpression. In addition, BOS treatment inhibited PLK1 protein level, while its mRNA level was not affected. Moreover, Bosutinib inhibited USP9X to reduce the deubiquitination of PLK1. CO‐IP assay indicated that reduced USP9X could enhance the ubiquitination of PLK1 and reduce protein stability. Finally, BOS showed anti‐tumour effects in a mouse model.
Conclusion
This study revealed that BOS inhibited cell proliferation, migration, angiogenesis, and glycolysis via suppressing USP9X, thus reducing deubiquitination of PLK1 in HCC, demonstrating the potential of BOS for the treatment of HCC.
Keywords: Bosutinib, deubiquitination, glycolysis, PLK1, USP9X
1. Introduction
Hepatocellular carcinoma (HCC) is among the most common and deadly cancers globally [1, 2]. Typical signs of HCC in the early stage are absent, resulting in more than half of cases being detected at advanced stages [3]. Liver transplantation and surgical excision of HCC are now viable therapeutic modalities [3]. Nevertheless, a significant postoperative recurrence limits the therapeutic advantages of surgery [4]. Furthermore, HCC exhibits poor response to chemotherapy and radiotherapy. Notwithstanding the survival advantages conferred by tyrosine kinase inhibitors, antiangiogenic treatment, and immune checkpoint inhibitors for HCC patients, the prevalence of medication resistance often leads to suboptimal clinical results [5, 6, 7]. Consequently, there is an imperative demand for enhanced therapeutic approaches for HCC.
Bosutinib (BOS) is a dual inhibitor of Src and Abl kinases [8]. It has received approval for the treatment of chronic myelogenous leukaemia (CML) by Abl inhibition [9, 10]. Bosutinib suppresses solid tumours, including head and neck, breast, biliary tract, and melanoma, in preclinical studies [11, 12, 13, 14]. A phase I clinical trial has investigated BOS in various solid tumours, including colorectal, pancreatic, and non‐small cell lung cancer [15]. BOS inhibits Src and Abl kinases, as well as Tec, c‐kit, the MAPK pathway, and EphB2 [15]. Research has shown that bosutinib inhibits the phosphorylation activation of EGFR in head and neck squamous cell carcinoma (HNSCC) [14]. The conjunction of BOS with the PI3Kα inhibitor Alpelisib exhibits a synergistic effect in vitro when PIK3CA mutations are present [14]. Nevertheless, limited research has concentrated on the anti‐tumour properties of BOS and its prospective targets in HCC.
The ubiquitin proteasome system (UPS) regulates protein stability, hence influencing the cellular abundance of proteins by directing polyubiquitinated proteins for recognition and degradation in the proteasome [16]. Conversely, deubiquitinases (DUBs) perform the contrary function of cleaving monoubiquitin or polyubiquitin chains from target proteins [17]. The harmonious interaction of these two enzyme families regulates ubiquitin‐tagged proteins, ensuring precise management of protein turnover and preserving optimal protein function [18]. Due to their essential function in modulating protein stability and activity, it is unsurprising that the dysregulation of deubiquitinating enzymes (DUBs) has been associated with numerous cancer‐related pathways, acting as both tumour promoters and suppressors [19, 20]. A multitude of DUBs have been recognised as directly facilitating cancer cell growth. For example, OTUD7B deubiquitinates essential cell cycle regulators, while USP2 has been demonstrated to stabilise cyclin D1, a recognised proto‐oncogene, resulting in abnormal cell cycle progression across several tumour types [19]. USP9x has been discovered to directly stabilise PYCR3, hence controlling the proline biosynthesis pathway and influencing lung cancer growth and progression [21].
Mammalian polo‐like kinase 1 (PLK1) is the most thoroughly investigated PLK, playing essential roles in cell cycle progression [22]. PLK1 is overexpressed in various cancer types, and elevated levels of PLK1 correlate with diminished overall and disease‐free survival [23]. Some studies have suggested that PLK1 could serve as a therapeutic target for different malignant tumours, such as triple‐negative breast cancer [24] and head and neck squamous cell carcinoma [25]. Extensive research indicates that PLK1 is a good target for cancer therapy [26, 27, 28]. This study examined the efficacy of BOS in mitigating proliferation, migration, and glycolysis of hepatocellular carcinoma cells, focusing specifically on its association with USP9x and PLK1 following bioinformatics analysis. On a molecular level, BOS compromised the stability of PLK1 via deubiquitination facilitated by reduced levels of USP9X. These results establish BOS as a viable candidate for HCC treatment and highlight the manipulation of the USP9X‐PLK1 axis as an innovative therapeutic strategy.
2. Materials and Methods
2.1. Human Specimens
The study was performed under ethical approval from the Ethics Committee of Longyan First Affiliated Hospital of Fujian Medical University. Written informed consent was obtained from all participants. Fresh tumour and adjacent liver tissues were obtained from 35 HCC patients during hepatectomy for mRNA extraction.
2.2. Cell Culture and Treatment
Two human HCC cells, including Huh‐7 and Hep3B, the human normal hepatocyte cell line (THLE‐2), and human umbilical vein endothelial cells (HUVECs) were procured from Procell (Wuhan, China). The first three types of cells were cultured in DMEM supplemented with 10% FBS and 1% penicillin–streptomycin. HUVECs were cultured in EGM‐2 supplemented with 10% FBS, 1% penicillin–streptomycin, growth factors, and 1 μg/mL hydrocortisone. All cells were kept at 37°C in a humidified environment with 5% CO2. BOS (purity ≥ 98%, Yeasen, Shanghai, China) was used to treat cells at varying concentrations (0, 0.5, 1, 2, and 4 μM) for 24 h.
2.3. MTT Assay
The assessment of Huh‐7 and Hep3B cell viability was conducted using MTT (Yeasen). 1 × 104 treated cells seeded in 96‐well plates. After cultivation for 24, 48, or 72 h, cells were mixed with MTT solution. After 4 h of incubation, 150 μL DMSO was added to dissolve the formed precipitates for 15 min. Cell absorbance at 570 nm was recorded.
2.4. Apoptosis Measurement
To identify cell apoptosis, treated cells were harvested and standardised to a concentration of 1 × 106 cells/mL. The cell suspension was stained with Annexin V‐FITC and propidium iodide following the manufacturer's technique (Yeasen). The labelled cells were quantified using a flow cytometer.
2.5. Cell Migration Assay
Huh‐7 and Hep3B cells, with or without suitable transfection, were plated in the upper chamber of transwell plates at a density of 1 × 105 cells/mL, together with either 0 or 2 μM BOS. Migratory cells that migrated to the bottom surface were fixed, stained, photographed, and counted after a 24‐h incubation period.
2.6. Tube Formation Assay
To further evaluate the inhibitory effect of BOS on angiogenesis, Huh‐7 and Hep3B cells, with or without the appropriate transfection, were treated individually with or without 2 μM BOS. The culture media were harvested after 48 h. Thereafter, HUVECs were cultured and introduced into the aforementioned media. After a 6‐h incubation, the tube formation was seen and measured.
2.7. Evaluation of Glucose Consumption, Lactate Production, and Cellular ATP/ADP Ratio
Huh‐7 and Hep3B cells, with or without corresponding transfection, were individually treated with or without 2 μM BOS for 24 h. Then the cells and culture supernatant were collected for subsequent investigation. Glucose consumption and lactate production were assessed with a glucose assay reagent (Beyotime, Shanghai, China) and Lactate Assay Kit (Solarbio, Beijing, China), respectively. Cellular ATP was measured using the ATP test kit (Beyotime). The total protein was quantified using the BCA method.
2.8. Bioinformatics
The transcriptome data of HCC in the GSE216613 dataset were downloaded from the GEO. The selection and visualisation of differentially expressed genes were conducted using online Sangerbox (http://www.sangerbox.com/login.html). The SwissTargetPrediction and GeneCard databases were searched for targets of HCC and glycolysis, respectively. The expression distribution of PLK1 and its role in the prognosis of HCC were explored in GEPIA, TCGA, TNMplot, and Kaplan–Meier Plotter. UbiBrowser and HitPredict were used for predicting proteins involved in post‐translational modifications of PLK1.
2.9. Western Blotting
Proteins were extracted from tumour tissues or collected cells with RIPA lysis buffer (Beyotime), separated by 10% SDS‐PAGE, and transferred to PVDF membranes. After blocking, membranes were incubated overnight at 4°C with primary antibodies, anti‐PLK1 (ab189139, 1:1000, Abcam, Cambridge, MA, USA), anti‐USP9X (ab19879, 1:1000, Abcam), anti‐PTK2 (ab40794, 1:1000, Abcam), and anti‐β‐actin (ab179467, 1:4000, Abcam). Signals were detected using secondary antibodies and ECL reagent (Millipore, Darmstadt, Germany).
2.10. Real‐Time Quantitative PCR (RT‐qPCR)
Total RNA was extracted using TRIzol (Tiangen, Beijing, China), and cDNA was synthesised with a reverse transcription reagent from Kangwei Century (Beijing, China). qPCR was performed using the SYBR Green PCR Kit (Takara, Tokyo, Japan). Data were normalised to β‐actin expression level. qPCR primers were presented in Table 1.
TABLE 1.
Primers sequences used for qPCR.
| Name | Primers for PCR (5′‐3′) | |
|---|---|---|
| PLK1 | Forward | CCGCAATTACATGAGCGAGC |
| Reverse | GGAGACTCAGGCGGTATGTG | |
| β‐Actin | Forward | CTTCGCGGGCGACGAT |
| Reverse | CCACATAGGAATCCTTCTGACC |
2.11. Cell Transfection
Huh‐7 or Hep3B cells were seeded in 6‐well plates and cultured for 12 h before transfection. siRNA targeting USP9X (JTS, Wuhan, China) and si‐NC (control) were chemically synthesised. The USP9X or PLK1 was cloned into the pcDNA3.1 vector for gene overexpression. Cells underwent transfection with siRNA (si‐USP9X and si‐NC) and/or plasmids (OE‐PLK1, OE‐USP9X, and OE‐NC) utilising Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer's guidelines.
2.12. Co‐IP
Cells were lysed using NP‐40 lysis buffer (Beyotime). The cell lysate was incubated with the PLK1 antibody overnight at 4°C, followed by the addition of pre‐washed protein A/G magnetic beads (Selleck, Houston, TX, USA) for 4 h. After washing the beads, the immunoprecipitated proteins were eluted with SDS‐PAGE loading buffer and subsequently analysed by Western blot.
2.13. Molecular Docking
The crystal structure of USP9X was retrieved from the Protein Data Bank (https://www.rcsb.org/). The 3D structure of BOS was obtained from the PubChem database. Molecular docking study was performed using AutoDock Vina 1.1.2 and visualised during the docking process using the PyMol software.
2.14. Cellular Thermal Shift Assay (CETSA)
Briefly, the collected Huh‐7 cell protein lysates were divided into two aliquots, followed by incubation with BOS (2 μM) or equivalent volume of DMSO at 37°C for 10 min. After incubation, 10× CaCl2 buffer was added, and the protein samples were heated at the indicated temperatures for 5 min, followed by cooling on ice for 2 min. Finally, the samples were centrifuged at 20000 g at 4°Cfor 15 min, and the supernatants were collected for the western blotting assay.
2.15. Animals
C57BL/6 mice (male, aged 6–8 weeks), with comparable body weights, were sourced from SPF Biotech (Beijing, China). Mice were maintained in specialised pathogen‐free conditions and provided with a regular chow diet. 4 × 106 Hep3B cells were injected into the flanks. For the investigation of BOS in vivo, mice were randomised into two groups on day 8 post‐implantation: BOS (15 mg/kg) and control solvent. The treatments were administered intraperitoneally daily from days 8 to 28. Tumour size (length × width2 × 0.5) was measured every 5 days, and mice were euthanised on day 28 for tumour harvest. All procedures involving animals were approved by the Ethics Review Committee of Longyan First Affiliated Hospital of Fujian Medical University.
2.16. Immunohistochemistry (IHC)
Tissue sections of the HCC tumour from the mice were deparaffinised, rehydrated, and blocked before incubation with primary antibodies (1:500) overnight at 4°C. Afterward, secondary antibodies were applied at room temperature for 30 min. Visualisation was performed using DAB solution, and counterstaining was carried out with haematoxylin. Haematoxylin and eosin (HE) staining was used for morphologic examination. The sections were examined microscopically to capture pictures.
2.17. Statistical Analysis
Statistical analyses were performed using GraphPad Prism 7.0 and R software. Data are presented as mean ± SD from at least three independent experiments. Comparisons between two or multiple groups were analysed using Student's t‐test or one‐way analysis of variance (ANOVA) with Tukey's tests. p < 0.05 was considered significant.
3. Results
3.1. BOS Inhibited HCC Cell Proliferation, Migration, Angiogenic Capacity, and Glycolysis
To investigate the cytotoxicity of bosutinib on THLE‐2 cells and HCC cell lines, an MTT assay was used to evaluate cell viability. There were no significant changes in THLE‐2 cell viability after 24 h of treatment with BOS at different concentrations (0, 0.5, 1, 2, and 4 μM) (Figure 1A), indicating that BOS does not exhibit significant cytotoxicity towards non‐malignant cells. Two HCC cells (Huh‐7 and Hep3B) were treated with varying concentrations of BOS (0, 0.5, 1, 2, and 4 μM) for 24 h. BOS treatment led to growth inhibition in a dose‐dependent manner (Figure 1B). Among the five evaluated concentrations, approximately half of the cells were alive at 2 μM BOS treatment. 2 μM of the BOS was used in subsequent experiments as the most appropriate concentration. Then, Huh‐7 and Hep3B cells were treated with 2 μM BOS or without for 24, 48, and 72 h. The OD values in cells treated with BOS were significantly smaller than those of the control group without BOS (Figure 1C). Meanwhile, the addition of 2 μM BOS remarkably promoted the apoptosis rate of both cell lines (Figure 1D). Furthermore, transwell assay and tube formation assay showed reduced cell migration and tube formation after BOS treatment, indicating the inhibitory role of BOS on cancer cell migration and angiogenic capacity (Figure 1E,F). In addition, BOS addition led to diminished glucose consumption, lactate production, and ATP/ADP ratios, indicating the inhibitory effect of BOS on glycolysis (Figure 1G–I). Collectively, these findings implied that BOS could inhibit the viability, migration, angiogenic capacity, and glycolysis of Huh‐7 and Hep3B cells.
FIGURE 1.
The inhibition of BOS on HCC cells. (A) THLE‐2 cell viability was measured using MTT after BOS (0, 0.5, 1, 2, and 4 μM) treatment for 24 h. (B) Huh‐7 and Hep3B cells were treated with varying concentrations of BOS (0, 0.5, 1, 2, and 4 μM) for 24 h. The cell viability was determined using MTT. (C) Huh‐7 and Hep3B cells were treated with 2 μM BOS or without for 24, 48, and 72 h. The OD values were measured with MTT. (D) Huh‐7 and Hep3B cells were treated with 2 μM BOS for 24 h. The apoptosis rate was detected using flow cytometry. (E) Cell migration (Left) of Huh‐7 and Hep3B cells incubated with or without 2 μM BOS was analysed using the Transwell assay and quantified (Right). Scale bar = 50 μm. (F) Tube formation of HUVECs in conditioned medium from 0 or 2 μM BOS‐treated Huh‐7 and Hep3B cells (Left) and quantification (Right). Scale bar = 50 μm. (G–I) The glucose consumption, lactate production, and cellular ATP/ADP ratio in treated Huh‐7 and Hep3B cells were measured using commercial kits. *p < 0.05, **p < 0.01, ***p < 0.001, n = 3, ns: no significant.
3.2. Screening Targets of BOS
For the identification of targets of BOS, transcriptome analysis between HCC and adjacent tissues of the GSE216613 dataset from the GEO database was performed. A total of 2689 differentially expressed genes (DEGs) were identified based on the criteria of |logFC| > 2 and adjusted p < 0.05, including 1292 upregulated genes and 1397 downregulated genes (Figure 2A). The top 10 genes from the upregulated and downregulated genes were selected separately for the heat map, with red indicating upregulated genes and green indicating downregulated genes (Figure 2B). Furthermore, 100 HCC targets were obtained from the SwissTargetPrediction database, and 5371 glycolysis‐related targets were sourced from the GeneCard database (https://www.genecards.org/). The intersection of the three gene cohorts obtained 15 genes (Figure 2C). Among those genes, PTK2 and PLK1 have been reported in the glycolysis of HCC [29, 30]. Cellular validation confirmed that the protein expression of PTK2 and PLK1 was significantly inhibited by BOS treatment in both Huh‐7 and Hep3B cells (Figure 2D,E). A greater reduction of PLK1 protein was observed upon BOS treatment. Therefore, a subsequent investigation of PLK1 was conducted. PLK1 was significantly upregulated in HCC samples in the GSE216613 dataset (Figure 2F). Taken together, PLK1 was identified as a core gene related to glycolysis in HCC. PLK1 protein expression was upregulated in HCC and inhibited upon BOS treatment.
FIGURE 2.
Identification of targets. (A) Volcano plot of differentially expressed genes (DEGs) of GSE216613. (B) Heatmap of the top 10 upregulated and downregulated genes. (C) Intersection of DEGs, HCC‐related genes from the SwissTargetPrediction database, and glycolysis‐related targets from the GeneCard database. (D and E) The protein expression of PTK2 and PLK1 in treated Huh‐7 and Hep3B cells was visualised via western blot and quantified. (F) The mRNA levels of PLK1 in GSE216613 between tumour and normal tissues. *p < 0.05, ***p < 0.001, n = 3.
3.3. PLK1 Was Upregulated in HCC
The expression of PLK1 was further examined in more public datasets. Compared with normal tissues, the PLK1 expression in tumour tissue of HCC was significantly upregulated in GEPIA (http://gepia.cancer‐pku.cn/), TCGA, and TNMplot (https://tnmplot.com/analysis/) (Figure 3A–3C). Online analysis using the Kaplan–Meier Plotter showed that high PLK1 expression was associated with poor prognosis in HCC (Figure 3D). Similarly, PLK1 mRNA expression was significantly upregulated in tumour tissues in clinical HCC patients (Figure 3E). Meanwhile, compared to THLE‐2 cells, PLK1 protein expression was remarkably higher in Huh‐7 and Hep3B cells (Figure 3F). Overall, these data illuminated that PLK1 was upregulated in HCC and associated with poor prognosis.
FIGURE 3.
PLK1 expression in public datasets. (A‐C) PLK1 expression in HCC from GEPIA, TCGA, and TNMplot datasets. (D) Online analysis of the PLK1 expression and prognosis using the Kaplan–Meier Plotter. (E) The mRNA levels of PLK1 between tumour and normal tissues from 35 HCC patients were measured using RT‐qPCR. (F) PLK1 expression was measured in THLE‐2, Huh‐7, and Hep3B cells via western blot. *p < 0.05, **p < 0.01, ***p < 0.001, n = 3.
3.4. The Inhibition of BOS on HCC Cells Was Hindered by PLK1 Upregulation
To further investigate the potential biological role of PLK1 on the effect of BOS in HCC, upregulation of PLK1 was analysed. Huh‐7 and Hep3B cells were transfected with OE‐PLK1 or OE‐NC. The expression of PLK1 in transfected cells was confirmed using western blot (Figure 4A). Functionally, the data of MTT assay showed that decreased cell viability upon BOS treatment was markedly attenuated by PLK1 upregulation (Figure 4B). Meanwhile, flow cytometry analysis displayed that BOS exposure could induce HCC cell apoptosis, whereas these effects were partly overturned by PLK1 overexpression (Figure 4C). Representative flow cytometry histograms of cell cycle distribution and quantitative analysis were shown in Figure S1. Furthermore, the results from the Transwell assay and tube formation assay exhibited that the overexpression of PLK1 clearly weakened the inhibitory role of BOS on Huh‐7 and Hep3B cell migration ability and angiogenic capacity (Figure 4D,E). In parallel, the reduced glucose consumption, lactate production, and ATP/ADP ratios caused by BOS treatment were partly mitigated through PLK1 upregulation (Figure 4F–H). Collectively, these findings implied that PLK1 upregulation partially hindered the anti‐tumour effect of BOS.
FIGURE 4.
PLK1 overexpression on the anti‐tumour effect of BOS. (A) Huh‐7 and Hep3B cells were transfected with OE‐PLK1 or OE‐NC. The expression of PLK1 in transfected cells was confirmed using western blot. (B) Transfected Huh‐7 and Hep3B cells were treated with 2 μM BOS or without for 24, 48, and 72 h. The OD values were measured using MTT. (C) Transfected Huh‐7 and Hep3B cells were treated with 2 μM BOS for 24 h. Apoptosis rate in treated cells was detected using flow cytometry. (D) Cell migration (Left) of treated cells was analysed using the Transwell assay and quantified (Right). Scale bar = 50 μm. (E) Tube formation of HUVECs in conditioned medium from treated cells. (F–H) The glucose consumption, lactate production, and cellular ATP/ADP ratio in treated cells were measured using commercial kits. *p < 0.05, **p < 0.01, ***p < 0.001, n = 3.
3.5. USP9X Knockdown Enhanced K48‐Linked Ubiquitination of PLK1
For further exploration of the underlying mechanism of PLK1 on BOS function, the mRNA level of PLK1 was measured in Huh‐7 and Hep3B cells. The results of RT‐qPCR showed that mRNA expression of PLK1 was stable with or without exposure to BOS (Figure 5A). The experiments demonstrated that BOS inhibited PLK1 protein expression but had no effect on PLK1 mRNA expression. A hypothesis that bosutinib may influence PLK1 expression through post‐translational modifications of the protein was formed. UbiBrowser and HitPredict showed the interaction between USP9X and PLK1 (Figure 5B). Furthermore, USP9X expression was apparently in Primary tumour samples (n = 371) in the TCGA‐LIHC database relative to the normal tissues (n = 50) (Figure S2). After transfection, USP9X silencing notably down‐regulated USP9X protein levels in both cell lines (Figure 5C). The protein level of PLK1 was diminished by USP9X silencing, while treatment with the proteasome inhibitor MG132 rescued the reduction of PLK1 protein levels (Figure 5D), indicating the proteasomal activation was involved in PLK1 protein loss. Further time‐course studies indicated that under USP9X silencing, there was an accelerated degradation of PLK1 protein (Figure 5E). Importantly Co‐IP analysis showed that K48ub accumulation in USP9X silencing cells, indicating the role of K48ub chains in PLK1 deubiquitylation (Figure 5F). Collectively, these findings demonstrated that USP9X silencing slowed K48‐linked deubiquitination of PLK1 in HCC cells.
FIGURE 5.
USP9X knockdown enhanced K48‐linked ubiquitination of PLK1. (A) The mRNA level of PLK1 was measured in Huh‐7 and Hep3B cells using RT‐qPCR. (B) Intersection of targets of PLK1 identified by UbiBrowser and HitPredict databases. (C) Huh‐7 and Hep3B cells were transfected with si‐USP9X or si‐NC. The expression of USP9X in transfected cells was confirmed using western blot. (D) Effects of 24‐h treatment with proteasomal inhibitor (MG132, 10 μM) on PLK1 protein expression in transfected Huh‐7 and Hep3B cells. (E) Time‐dependent changes in PLK1 protein levels in transfected Huh‐7 and Hep3B cells post‐cyclophosphamide (CHX, 100 μg/mL) treatment. (F) Co‐IP analysis showing Ub, K48, or K63‐linked ubiquitination levels of PLK1 in transfected cells. *p < 0.05, **p < 0.01, ***p < 0.001, n = 3.
3.6. The Inhibitory Effect of USP9X Knockdown on HCC Cells Was Reversed by PLK1 Overexpression
The gain‐of‐function analysis was conducted to investigate the association between USP9X and PLK1. Huh‐7 and Hep3B cells were co‐transfected with OE‐PLK1 and si‐USP9X. By conducting cell function assays, the results clarified that USP9X silencing weakened viability and boosted apoptosis of Huh‐7 and Hep3B cells, which was reversed by PLK1 overexpression (Figure 6A,B). Besides, the cell migration and tube formation capacity of cells were inhibited by USP9X knockdown, and then the inhibiting role was strongly offset by PLK1 up‐regulation (Figure 6C–E). USP9X silencing effectively lowered glucose consumption, lactate production, and ATP/ADP ratios, while the above effects were partially impaired by PLK1 overexpression (Figure 6F–H). Consistently, the results of the RT‐qPCR assay showed that PLK1 addition could partially relieve the suppressive role of USP9X deficiency on the expression of key rate‐limiting enzymes (HK2, PKM2, or LDHA) in HCC cells (Figure S3). Collectively, these findings confirmed the interaction between USP9X and PLK1.
FIGURE 6.
The inhibitory effect of USP9X knockdown on HCC cells was reversed by PLK1 overexpression. Huh‐7 and Hep3B cells were transfected with si‐NC, si‐USP9X, si‐USP9X + OE‐NC, or si‐USP9X + OE‐PLK1. (A) Transfected Huh‐7 and Hep3B cells were cultured for 24, 48, and 72 h. The OD values were measured using MTT. (B) Apoptosis rate of transfected cells was detected using flow cytometry. (D and E) Cell migration of transfected cells was analysed using Transwell assay and quantified. Scale bar = 50 μm. (E) Tube formation of HUVECs in conditioned medium from transfected cells. (F–H) The glucose consumption, lactate production, and cellular ATP/ADP ratio in transfected cells were measured using commercial kits. *p < 0.05, **p < 0.01, ***p < 0.001, n = 3.
3.7. BOS Exerted Anti‐Tumour Effects via Inhibiting USP9X
To investigate whether BOS provided anti‐tumour effects through USP9X‐dependent mechanisms, USP9X‐overexpressing cells subjected to BOS treatment were examined. Huh‐7 and Hep3B cells were treated with BOS, BOS + OE‐NC, BOS + OE‐USP9X, or without (Control). The inhibition of USP9X protein expression under BOS treatment was partially mitigated by USP9X overexpression (Figure 7A). Cell function assays showed that BOS effectively inhibited cell proliferation, migration, tube formation, glucose consumption, lactate production, and ATP/ADP ratios, and increased cell apoptosis, which were reversed by USP9X upregulation (Figure 7B–H). Furthermore, molecular docking simulations via the CB‐DOCK2 database indicated that USP9X had high‐binding affinity for BOS, as evidenced by the binding energy of −6.5 kcal/mol (Figure 7I). In addition, the CETSA assay was applied to further the interaction between BOS and USP9X in Huh‐7 cells. Western blot assay exhibited that in the BOS pre‐incubation group, USP9X showed apparently higher levels of thermal denaturation between 49°C and 61°C than the control group (Figure S4). These data suggested that BOS specifically stabilises USP9X protein and prevents it from denaturation upon heating. All these results demonstrated that BOS exerted anti‐tumour effects via inhibiting USP9X.
FIGURE 7.
BOS exerted anti‐tumour effects via inhibiting USP9X. Huh‐7 and Hep3B cells were treated with BOS, BOS + OE‐NC, BOS + OE‐USP9X, or without (Control). (A) The expression of USP9X in treated cells was detected using western blot. (B) Transfected Huh‐7 and Hep3B cells were treated with 2 μM BOS or without for 24, 48, and 72 h. The OD values were monitored using MTT. (C) Cell apoptosis rate in treated cells was detected using flow cytometry. (D) Cell migration (Left) of treated cells was analysed using Transwell assay and quantified (Right). Scale bar = 50 μm. (E) Relative tube formation of HUVECs in conditioned medium from treated cells. (F–H) The glucose consumption, lactate production, and cellular ATP/ADP ratio in treated cells were analysed using commercial kits. (I) Molecular docking analysis and diagram of BOS with PLK1. *p < 0.05, **p < 0.01, ***p < 0.001, n = 3.
3.8. BOS Inhibited Tumour Growth In Vivo
To explore the anti‐tumour effects of BOS in vivo, an HCC mouse model was established using Hep3B cells. Mice were administered BOS at a dosage of 15 mg/kg daily for a duration of 3 weeks. There was no difference in body weight data over time between the BOS group and the control group (Figure 8A). Furthermore, BOS treatment remarkably inhibited tumour growth and final tumour weight (Figure 8B,C). Meanwhile, BOS administration significantly reduced PLK1 and USP9X protein expression (Figure 8D). In parallel, HE staining was conducted to examine histopathological changes in removed tumour samples, and HE staining showed lower Ki67 (proliferation marker), USP9X, and PLK1 expression in BOS‐treated tumour tissues (Figure 8E). Collectively, these data suggested BOS inhibited tumour growth via downregulating PLK1 and USP9X expression in vivo.
FIGURE 8.
BOS inhibited tumour growth in a mouse model. The HCC mouse model was established using Hep3B cells. Mice were administered with BOS at a dosage of 15 mg/kg every 48 h for a duration of 3 weeks. (A) Animal weight data changing over time was shown. (B) Tumour volume was measured every 5 days. (C) Tumour weight was detected. (D) PLK1 and USP9X protein expression in tumours was analysed using western blot. (E) Representative images of HE in each group. The positive expression rate of Ki67, PLK1, and USP9X was gauged in xenografts using IHC staining. ***p < 0.001, ns: no significant.
4. Discussion
The traditional treatments for liver cancer are significantly limited by the low incidence of surgical resection, high postoperative recurrence rates, poor response to chemotherapy and radiotherapy, and the scarcity of liver transplantation options [31, 32]. In recent years, molecular targeted treatment has garnered significant attention [6, 33]. This work clarified the anti‐tumour effects of BOS in HCC, showing its ability to suppress cell proliferation, migration, tube formation, and glycolysis, while enhancing cell death via a new USP9X‐PLK1 axis. The results identify BOS as a potential therapeutic agent for HCC, while revealing an unrecognised mechanism of PLK1 instability.
The anti‐tumour actions of BOS encompass enhanced G1 cell‐cycle arrest and apoptosis, as well as diminished migration, invasion, and epithelial‐mesenchymal transition indicators [11, 12, 34]. The current investigation showed that BOS had comparable inhibitory effects in HCC cells, encompassing reduced cell proliferation, migration, tube formation, and glycolysis, alongside enhanced cell death. The suppression of glycolysis by BOS is infrequently documented in prior research, prompting an investigation into the molecular mechanism. Bioinformatic study and machine learning identified PLK1 as a pivotal gene involved in the glycolysis of HCC. PLK1 was overexpressed in HCC and correlated with unfavourable prognosis, consistent with findings in other malignancies [23]. The anti‐tumour benefits of BOS were negated by the overexpression of PLK1. Notably, BOS suppressed PLK1 protein expression without influencing PLK1 mRNA expression. Subsequent bioinformatic analysis and experimental validation corroborated the interaction between BOS and USP9X, as well as the deubiquitination of PLK1 by USP9X. BOS is authorised for the treatment of CML patients exhibiting a positive Philadelphia chromosome [10]. In addition to Src/Abl, other studies have investigated the anti‐tumour properties of BOS in various solid tumours by inhibiting Tec, EGFR, c‐kit, FYN, the MAPK pathway, or EphB2 [14, 35]. This study reveals a distinct mechanism that differentiates BOS from traditional medicines, specifically its capacity to destabilise PLK1 by blocking USP9X‐mediated deubiquitination.
The interaction between USP9X and PLK1 in HCC enhances comprehension of protein quality control in tumours. PLK1 is a conserved serine/threonine kinase and a major regulator of the cell cycle [22]. PLK1 expression, at both the mRNA and protein levels, is elevated in actively proliferating tumour cells relative to normal cells [23]. This heightened expression is a prevalent characteristic of human cancer, evident in various tumours, including melanoma, HNSCC, HCC, sarcomas, and colon, pancreatic, and prostate cancer [36, 37, 38, 39, 40]. Furthermore, the overexpression of PLK1 correlates with elevated tumour grade and unfavourable patient prognosis [37]. USP9X is a prominent member of the ubiquitin‐specific processing enzyme family, capable of removing ubiquitin molecules from big proteins, hence diminishing the degradation of target proteins and playing a crucial role in protein regulation [41]. USP9X‐mediated deubiquitination has been reported in various diseases, including cancer [42, 43, 44]. Reports indicate that USP9X is significantly expressed in lymphoma and stabilises the MCL1 protein, hence promoting cancer cell proliferation [45]. The current work revealed that BOS may suppress the protein levels of USP9X, hence hindering the K48‐linked deubiquitination of PLK1 in HCC. Prior research indicates that PLK1 may undergo deubiquitination by USP7 or USP10 [46, 47]. The present study discovered USP9X as a novel deubiquitinating enzyme for PLK1, thereby broadening the deubiquitination regulatory network of PLK1.
Nonetheless, owing to the availability of clinical data, this work exclusively investigated the mRNA expression of PLK1 in clinical samples. Subsequent research should involve the collection of sufficient HCC and normal tissues to investigate the protein levels of PLK1 and USP9X.
5. Conclusion
In summary, this study established BOS as a multifaceted anti‐cancer agent that suppressed the proliferation, migration, angiogenesis, and glycolysis of HCC via USP9X‐mediated PLK1 deubiquitination. Future research should evaluate the efficacy of BOS in large‐animal models to expedite its transition to clinical trials.
Author Contributions
Tiantian Cao and Zirong Li designed and performed the research. Fobao Lai analysed the data. Cuiping Lu wrote the manuscript. All authors read and approved the final manuscript.
Funding
The authors have nothing to report.
Ethics Statement
All human disease tissue research was approved by the Institutional Review Board of Longyan First Affiliated Hospital of Fujian Medical University and complied with the Declaration of Helsinki.
All nude mouse xenograft experiments were approved by the Institutional Animal Care and Use Committee of Longyan First Affiliated Hospital of Fujian Medical University. Animal procedures followed the ARRIVE guidelines and 3Rs principle. Anaesthesia was used in all surgeries, and humane euthanasia was applied to reduce animal distress, which fully complied with relevant ethical standards.
Consent
Written informed consent was obtained from all patients, and all samples were de‐identified to protect patient privacy.
Conflicts of Interest
The authors declare no conflicts of interest.
Supporting information
Figure S1: Representative flow cytometry histograms of cell cycle distribution and quantitative analysis. *p < 0.05, **p < 0.01, ***p < 0.001.
Figure S2: cep70147‐sup‐0002‐FigureS2.tif. USP9X expression in HCC from TCGA‐LIHC datasets. **p < 0.01.
Figure S3: The effects of USP9X knockdown and PLK1 overexpression on the expression of key rate‐limiting enzymes (HK2, PKM2, or LDHA) in HCC cells. (A and B) HK2, PKM2, and LDHA mRNA levels were detected in Huh‐7 and Hep3B cells transfected with si‐NC, si‐USP9X, si‐USP9X + OE‐NC, or si‐USP9X + OE‐PLK1 using RT‐qPCR. *p < 0.05, **p < 0.01, ***p < 0.001.
Figure S4: Cellular thermal shift assay (CETSA) was used to confirm the stabilising effect of BOS on the enrichment of USP9X. Huh‐7 cell lysates incubated with BOS or DMSO (control) were heated at the indicated temperatures. After cooling, samples were centrifuged to separate the soluble fractions from precipitated proteins. The presence of USP9X in the soluble fraction was then determined using western blot assay. The intensity of the USP9X bands was quantified using ImageJ software. **p < 0.01.
Acknowledgements
The authors have nothing to report.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.
References
- 1. Bray F., Laversanne M., Sung H., et al., “Global Cancer Statistics 2022: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries,” CA: A Cancer Journal for Clinicians 74, no. 3 (2024): 229–263. [DOI] [PubMed] [Google Scholar]
- 2. Singh S. P., Madke T., and Chand P., “Global Epidemiology of Hepatocellular Carcinoma,” Journal of Clinical and Experimental Hepatology 15, no. 2 (2025): 102446. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Vogel A., Meyer T., Sapisochin G., Salem R., and Saborowski A., “Hepatocellular Carcinoma,” Lancet 400, no. 10360 (2022): 1345–1362. [DOI] [PubMed] [Google Scholar]
- 4. Portolani N., Coniglio A., Ghidoni S., et al., “Early and Late Recurrence After Liver Resection for Hepatocellular Carcinoma: Prognostic and Therapeutic Implications,” Annals of Surgery 243, no. 2 (2006): 229–235. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Chakraborty E. and Sarkar D., “Emerging Therapies for Hepatocellular Carcinoma (HCC),” Cancers (Basel) 14, no. 11 (2022): 2798. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Zheng J., Wang S., Xia L., et al., “Hepatocellular Carcinoma: Signaling Pathways and Therapeutic Advances,” Signal Transduction and Targeted Therapy 10, no. 1 (2025): 35. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Yang Y., Tang H., Mai C., Zhang X., Kuang J., and Tang Y., “Analysis of the Safety and Effectiveness of Lenvatinib + TACE‐HAIC + PD‐1 Inhibitor for Intermediate and Advanced Hepatocellular Carcinoma,” Letters in Drug Design & Discovery 21, no. 11 (2024): 2035–2045. [Google Scholar]
- 8. Abbas R. and Hsyu P. H., “Clinical Pharmacokinetics and Pharmacodynamics of Bosutinib,” Clinical Pharmacokinetics 55, no. 10 (2016): 1191–1204. [DOI] [PubMed] [Google Scholar]
- 9. Boschelli F., Arndt K., and Gambacorti‐Passerini C., “Bosutinib: A Review of Preclinical Studies in Chronic Myelogenous Leukaemia,” European Journal of Cancer 46, no. 10 (2010): 1781–1789. [DOI] [PubMed] [Google Scholar]
- 10. Kantarjian H. M., Jabbour E. J., Lipton J. H., Castagnetti F., and Brümmendorf T. H., “A Review of the Therapeutic Role of Bosutinib in Chronic Myeloid Leukemia,” Clinical Lymphoma, Myeloma & Leukemia 24, no. 5 (2024): 285–297. [DOI] [PubMed] [Google Scholar]
- 11. Vultur A., Buettner R., Kowolik C., et al., “SKI‐606 (Bosutinib), a Novel Src Kinase Inhibitor, Suppresses Migration and Invasion of Human Breast Cancer Cells,” Molecular Cancer Therapeutics 7, no. 5 (2008): 1185–1194. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Nam A.‐R., Kim J.‐W., Park J. E., et al., “Src as a Therapeutic Target in Biliary Tract Cancer,” Molecular Cancer Therapeutics 15, no. 7 (2016): 1515–1524. [DOI] [PubMed] [Google Scholar]
- 13. Homsi J., Cubitt C. L., Zhang S., et al., “Src Activation in Melanoma and Src Inhibitors as Therapeutic Agents in Melanoma,” Melanoma Research 19, no. 3 (2009): 167–175. [DOI] [PubMed] [Google Scholar]
- 14. Segrelles C., Contreras D., Navarro E. M., et al., “Bosutinib Inhibits EGFR Activation in Head and Neck Cancer,” International Journal of Molecular Sciences 19, no. 7 (2018): 1824. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Daud A. I., Krishnamurthi S. S., Saleh M. N., et al., “Phase I Study of Bosutinib, a Src/Abl Tyrosine Kinase Inhibitor, Administered to Patients With Advanced Solid Tumors,” Clinical Cancer Research 18, no. 4 (2012): 1092–1100. [DOI] [PubMed] [Google Scholar]
- 16. Song L. and Luo Z. Q., “Post‐Translational Regulation of Ubiquitin Signaling,” Journal of Cell Biology 218, no. 6 (2019): 1776–1786. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Clague M. J., Urbé S., and Komander D., “Breaking the Chains: Deubiquitylating Enzyme Specificity Begets Function,” Nature Reviews. Molecular Cell Biology 20, no. 6 (2019): 338–352. [DOI] [PubMed] [Google Scholar]
- 18. Lange S. M., Armstrong L. A., and Kulathu Y., “Deubiquitinases: From Mechanisms to Their Inhibition by Small Molecules,” Molecular Cell 82, no. 1 (2022): 15–29. [DOI] [PubMed] [Google Scholar]
- 19. Dewson G., Eichhorn P. J. A., and Komander D., “Deubiquitinases in Cancer,” Nature Reviews. Cancer 23, no. 12 (2023): 842–862. [DOI] [PubMed] [Google Scholar]
- 20. Fu Z., Wei B., Huang Y., Yang L., and Sun W., “Research on the Mechanism by Which Quercetin Affects Ferroptosis in Breast Cancer Cells Through Regulating USP9X/PIAS4,” Letters in Drug Design & Discovery 22, no. 10 (2025): 100169. [Google Scholar]
- 21. Becirovic T., Zhang B., Lindskog C., et al., “Deubiquitinase USP9x Regulates the Proline Biosynthesis Pathway in Non‐Small Cell Lung Cancer,” Cell Death Discovery 10, no. 1 (2024): 342. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Kalous J. and Aleshkina D., “Multiple Roles of PLK1 in Mitosis and Meiosis,” Cells 12, no. 1 (2023): 187. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. de Cárcer G., Venkateswaran S. V., Salgueiro L., et al., “Plk1 Overexpression Induces Chromosomal Instability and Suppresses Tumor Development,” Nature Communications 9, no. 1 (2018): 3012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Grimsley H. E., Antczak M., Reddin I. G., et al., “Using a Novel Panel of Drug‐Resistant Triple‐Negative Breast Cancer Cell Lines to Identify Candidate Therapeutic Targets and Biomarkers,” Cancer Letters 624 (2025): 217754. [DOI] [PubMed] [Google Scholar]
- 25. Shah P. A., Mazumdar T., Ghosh S., et al., “Polo‐Like Kinase 1 Inactivation Enhances PI3K Inhibition‐Mediated Apoptosis of NOTCH1‐Mutant Head and Neck Squamous Cell Carcinoma,” Cancer Letters 625 (2025): 217814. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Chapagai D., Strebhardt K., Wyatt M. D., and McInnes C., “Structural Regulation of PLK1 Activity: Implications for Cell Cycle Function and Drug Discovery,” Cancer Gene Therapy 32, no. 6 (2025): 608–621. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Su S., Chhabra G., Singh C. K., Ndiaye M. A., and Ahmad N., “PLK1 Inhibition‐Based Combination Therapies for Cancer Management,” Translational Oncology 16 (2022): 101332. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Cunningham C. E., Vizeacoumar F. S., Zhang Y., et al., “Identification of Targetable Vulnerabilities of PLK1‐Overexpressing Cancers by Synthetic Dosage Lethality,” Cell Genomics 5, no. 6 (2025): 100876. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Li Z., Li J., Bi P., et al., “Plk1 Phosphorylation of PTEN Causes a Tumor‐Promoting Metabolic State,” Molecular and Cellular Biology 34, no. 19 (2014): 3642–3661. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Zhang S., Lu Y., Jiang H. Y., et al., “CircC16orf62 Promotes Hepatocellular Carcinoma Progression Through the miR‐138‐5p/PTK2/AKT Axis,” Cell Death & Disease 12, no. 6 (2021): 597. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Wang Y. and Deng B., “Hepatocellular Carcinoma: Molecular Mechanism, Targeted Therapy, and Biomarkers,” Cancer Metastasis Reviews 42, no. 3 (2023): 629–652. [DOI] [PubMed] [Google Scholar]
- 32. Bruno S., Roberta A., Luca T., et al., “Mechanism, Potential, and Concerns of Immunotherapy for Hepatocellular Carcinoma and Liver Transplantation,” Current Molecular Pharmacology 17 (2024): 1–13. [DOI] [PubMed] [Google Scholar]
- 33. Ermi A. G., Younis R. M., Rodriguez K., and Sarkar D., “Gene Therapy Strategies for Hepatocellular Carcinoma (HCC): Current Landscape and Future Directions,” Cancers (Basel) 17, no. 22 (2025): 3608. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Messersmith W. A., Rajeshkumar N. V., Tan A. C., et al., “Efficacy and Pharmacodynamic Effects of Bosutinib (SKI‐606), a Src/Abl Inhibitor, in Freshly Generated Human Pancreas Cancer Xenografts,” Molecular Cancer Therapeutics 8, no. 6 (2009): 1484–1493. [DOI] [PubMed] [Google Scholar]
- 35. Mosharaf M. P., Reza M. S., Gov E., Mahumud R. A., and Mollah M. N. H., “Disclosing Potential Key Genes, Therapeutic Targets and Agents for Non‐Small Cell Lung Cancer: Evidence From Integrative Bioinformatics Analysis,” Vaccines (Basel) 10, no. 5 (2022): 771. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Zhang Z., Cheng L., Li J., et al., “Targeting Plk1 Sensitizes Pancreatic Cancer to Immune Checkpoint Therapy,” Cancer Research 82, no. 19 (2022): 3532–3548. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Weichert W., Schmidt M., Gekeler V., et al., “Polo‐Like Kinase 1 Is Overexpressed in Prostate Cancer and Linked to Higher Tumor Grades,” Prostate 60, no. 3 (2004): 240–245. [DOI] [PubMed] [Google Scholar]
- 38. Weichert W., Kristiansen G., Schmidt M., et al., “Polo‐Like Kinase 1 Expression Is a Prognostic Factor in Human Colon Cancer,” World Journal of Gastroenterology 11, no. 36 (2005): 5644–5650. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Tang Q., Hu G., Sang Y., et al., “Therapeutic Targeting of PLK1 in TERT Promoter‐Mutant Hepatocellular Carcinoma,” Clinical and Translational Medicine 14, no. 5 (2024): e1703. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Kneisel L., Strebhardt K., Bernd A., Wolter M., Binder A., and Kaufmann R., “Expression of Polo‐Like Kinase (PLK1) in Thin Melanomas: A Novel Marker of Metastatic Disease,” Journal of Cutaneous Pathology 29, no. 6 (2002): 354–358. [DOI] [PubMed] [Google Scholar]
- 41. Wang Q., Tang Y., Xu Y., et al., “The X‐Linked Deubiquitinase USP9X Is an Integral Component of Centrosome,” Journal of Biological Chemistry 292, no. 31 (2017): 12874–12884. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Zhang Z., Yu X., Wen L., et al., “USP9X Integrates TGF‐β and Hypoxia Signalings to Promote Ovarian Cancer Chemoresistance via HIF‐2α‐Maintained Stemness,” Cell Death & Disease 16, no. 1 (2025): 312. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Xu W., Zhang Y., Su Y., et al., “USP9X Regulates the Proliferation, Survival, Migration and Invasion of Gastric Cancer Cells by Stabilizing MTH1,” BMC Gastroenterology 24, no. 1 (2024): 239. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Gao H., Chen Z., Zhao L., Ji C., and Xing F., “Cellular Functions, Molecular Signalings and Therapeutic Applications: Translational Potential of Deubiquitylating Enzyme USP9X as a Drug Target in Cancer Treatment,” Biochimica Et Biophysica Acta. Reviews on Cancer 1879, no. 3 (2024): 189099. [DOI] [PubMed] [Google Scholar]
- 45. Chen X., Zhou G., Yuan T., et al., “Tectorigenin Attenuates Cardiac Hypertrophy via USP9X/MCL1‐Mediated Mitochondrial Stabilization,” Redox Biology 86 (2025): 103855. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Du X., Yu R., Yan C., et al., “USP10 Promotes the Progression and Attenuates Gemcitabine Chemotherapy Sensitivity via Stabilizing PLK1 in PDAC,” Cell Death & Disease 16, no. 1 (2025): 449. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Peng Y., Liu Y., Gao Y., et al., “USP7 Is a Novel Deubiquitinase Sustaining PLK1 Protein Stability and Regulating Chromosome Alignment in Mitosis,” Journal of Experimental & Clinical Cancer Research 38, no. 1 (2019): 468. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Figure S1: Representative flow cytometry histograms of cell cycle distribution and quantitative analysis. *p < 0.05, **p < 0.01, ***p < 0.001.
Figure S2: cep70147‐sup‐0002‐FigureS2.tif. USP9X expression in HCC from TCGA‐LIHC datasets. **p < 0.01.
Figure S3: The effects of USP9X knockdown and PLK1 overexpression on the expression of key rate‐limiting enzymes (HK2, PKM2, or LDHA) in HCC cells. (A and B) HK2, PKM2, and LDHA mRNA levels were detected in Huh‐7 and Hep3B cells transfected with si‐NC, si‐USP9X, si‐USP9X + OE‐NC, or si‐USP9X + OE‐PLK1 using RT‐qPCR. *p < 0.05, **p < 0.01, ***p < 0.001.
Figure S4: Cellular thermal shift assay (CETSA) was used to confirm the stabilising effect of BOS on the enrichment of USP9X. Huh‐7 cell lysates incubated with BOS or DMSO (control) were heated at the indicated temperatures. After cooling, samples were centrifuged to separate the soluble fractions from precipitated proteins. The presence of USP9X in the soluble fraction was then determined using western blot assay. The intensity of the USP9X bands was quantified using ImageJ software. **p < 0.01.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.