Sex‐Specific Anti‐Inflammatory Effects of Alternate Day Fasting via TLR4 and Leptin Signaling in Middle‐Aged Rats

ABSTRACT

Alternate‐day fasting (ADF) may exert age‐related anti‐inflammatory effects by modulating key metabolic and immune pathways. This study aimed to investigate the sex‐specific effects of ADF on inflammation in middle‐aged male and female rats and focused on the Toll‐like receptor 4 (TLR4) and leptin signaling pathways. A total of 32 rats (16 males, 16 females; 14 months old) were assigned to four groups (n = 8): ad libitum‐fed and ADF groups for each sex. The ADF protocol consisted of 24‐h fasting every other day for 2 months. Serum and hypothalamic samples were analyzed via ELISA to measure triglyceride, total cholesterol, tumor necrosis factor‐α (TNF‐α), interleukin‐6 (IL‐6), suppressor of cytokine signaling 3 (SOCS3), leptin, and ObRb levels. TLR4 gene expression in the brain and liver was assessed via qRT–PCR. Two months of ADF significantly reduced body weight and retroperitoneal fat mass compared with those of the control groups (p < 0.001). Cumulative food intake and fasting glucose levels decreased in both sexes following ADF (p < 0.001), and serum triglyceride, total cholesterol, TNF‐α, and IL‐6 levels (p < 0.001) were significantly reduced. Hypothalamic SOCS3 and leptin levels decreased, whereas ObRb expression increased (p < 0.05). Additionally, TLR4 gene expression was significantly downregulated in both tissues (p < 0.001). These findings suggest that ADF is associated with reduced age‐related inflammation and alterations in the TLR4 and leptin signaling pathways. The observed downregulation of SOCS3 and upregulation of ObRb indicate enhanced leptin sensitivity, highlighting ADF as a promising strategy to counteract sex‐specific aging‐related inflammation and leptin resistance.

ADF downregulates TLR4, reducing hypothalamic and hepatic inflammation, with stronger effects in females. ADF enhances leptin sensitivity in aging by reducing SOCS3 and upregulating ObRb, thereby improving metabolic function.

ADF reduces retroperitoneal fat and glucose levels, with females experiencing greater fat loss. ADF lowers TNF‐α, IL‐6, cholesterol, and triglyceride levels, with more effective lipid reduction in females.

Abbreviations

ADF

Alternate‐day fasting

AL

Ad libitum

BW

Body weight

DAMPs

Damage‐associated molecular patterns

ELISA

Enzyme‐linked immunosorbent assay

ILs

Interleukins

IL‐6

Interleukin‐6

MAPK

Mitogen‐activated protein kinase

NF‐κB

Nuclear factor‐κB

ObRb

Leptin receptor

PRRs

Activating pattern recognition receptors

SOCS3

Suppressor of cytokine signaling 3

TNF‐α

Tumor necrosis factor‐α

TLR4

Toll‐like receptor 4

TLRs

Toll‐like receptors

TRF

Time‐restricted feeding

T2DM

Type 2 diabetes mellitus

SASP

Senescence‐associated secretory phenotype

POMC

Pro‐opiomelanocortin

1. Introduction

Aging is associated with a progressive decline in immune function and a chronic, low‐grade inflammatory state known as inflammaging [1]. This process is characterized by cellular senescence and increased oxidative stress, which contribute to the pathogenesis of age‐related diseases [2]. A key mechanism linking aging to inflammation is the activation of innate immune pathways, particularly Toll‐like receptors (TLRs), which recognize damage‐associated molecular patterns (DAMPs) and initiate inflammatory cascades [3]. Among these, TLR4 plays a central role in mediating inflammatory responses and has been strongly implicated in the pathogenesis of metabolic diseases [4].

TLRs are transmembrane proteins that recognize microbial components and endogenous stress signals, thereby initiating immune responses and inflammatory cascades. These receptors are widely expressed in immune cells, including macrophages, monocytes, dendritic cells, and epithelial cells, where they regulate pro‐inflammatory cytokine production and immune activation [5]. Among the TLR family, TLR4 has emerged as a central mediator of aging‐associated inflammation. Its activation stimulates the production of proinflammatory cytokines, including tumor necrosis factor‐α (TNF‐α) and interleukins (ILs), contributing to systemic inflammation, oxidative stress, insulin resistance, and disturbances in lipid metabolism, particularly in metabolically active tissues such as the hypothalamus and liver [6, 7, 8, 9]. Despite its critical role, the regulation of TLR4 expression in aging and its modulation by dietary interventions remain incompletely understood.

Leptin, an adipocyte‐derived hormone, is a key regulator of energy homeostasis that acts primarily through its receptor (ObRb) in the hypothalamus [10]. In aging and obesity, leptin signaling becomes impaired, leading to leptin resistance—a state characterized by reduced central responsiveness to circulating leptin despite elevated hormone levels. This dysfunction contributes to increased food intake, insulin resistance, and the development of metabolic disorders, including type 2 diabetes mellitus (T2DM) [11]. Suppressor of cytokine signaling 3 (SOCS3), a major negative regulator of leptin signaling, inhibits ObRb phosphorylation and downstream signaling pathways and has been strongly associated with both leptin resistance and age‐related inflammation [12, 13, 14]. Increasing evidence suggests a close interaction between leptin signaling and innate immune responses, particularly TLR4‐mediated inflammation. Activation of TLR4 induces proinflammatory cytokine production, which can enhance SOCS3 expression and further impair leptin sensitivity, thereby establishing a link between chronic inflammation and metabolic dysfunction that may contribute to inflammaging [4, 7, 14].

Aging is also associated with changes in lipid metabolism and increased inflammation, contributing to metabolic disorders [15]. Adipose tissue‐derived factors, including leptin, free fatty acids, and cytokines, further interact with TLR4 signaling, reinforcing the link between metabolic and inflammatory pathways [9, 11, 14]. Despite growing evidence supporting this relationship, the precise role of the TLR4–SOCS3–leptin axis in aging remains incompletely understood.

Intermittent fasting (IF) is a well‐established dietary intervention recognized for its antiaging and metabolic benefits across various species, including rodents and humans [16, 17]. IF strategies can be broadly classified as: alternate‐day fasting (ADF), which involves alternating cycles of fasting and feeding, and time‐restricted feeding (TRF), where food intake is limited to a specific time window (typically 8–12 h) followed by a period of complete caloric restriction. ADF has received particular attention for its ability to improve insulin sensitivity [18, 19]. These effects are largely driven by a metabolic switch from glucose to ketone‐body utilization during fasting, which promotes mitochondrial biogenesis, enhances mitophagy, improves cellular stress resistance, and optimizes energy utilization [17, 20]. Consequently, ADF exerts beneficial effects in multiple tissues, including the brain and liver, where it attenuates oxidative stress, neuroinflammation, lipid dysregulation, and other age‐related metabolic disturbances [17, 20].

Despite the established metabolic and anti‐inflammatory benefits of ADF, its effects on aging‐related inflammatory pathways—particularly the TLR4–SOCS3–leptin axis—remain insufficiently understood. In addition, potential sex‐based differences in the response to ADF have not been fully elucidated. Although previous studies have demonstrated the beneficial impact of ADF on metabolic health and inflammation, its specific role in modulating TLR expression, leptin signaling pathways, and their interaction in the context of aging has not been clearly defined [21].

We hypothesized that ADF would attenuate age‐related inflammation and improve leptin sensitivity by modulating the TLR4–SOCS3–ObRb axis, with potential sex‐specific differences in response. Accordingly, the present study aimed to investigate the effects of ADF on metabolic and inflammatory parameters in middle‐aged male and female rats, with a particular focus on TLR4 signaling, components of the hypothalamic leptin pathway (leptin, SOCS3, and ObRb), and systemic inflammatory markers.

2. Materials and Methods

2.1. Ethics

This study was conducted in the Department of Physiology at Pamukkale University, Turkey. Animal experiments were approved by the Local Ethics Council of Animal Experiments of Pamukkale University (dated 06.03.2024 PAUHDEK‐2024/09, number: E‐60758568‐020‐502440) and performed according to the recommendations of the Guide for the Care and Use of Laboratory Animals (National Research Council, ABD).

2.2. Animal Care and Experimental Groups

Thirty‐two healthy male (n = 16) and female (n = 16) Wistar rats (14 months old) were used in this study. The animals were housed in a room with a controlled temperature (23 ± 2°C) and relative humidity (60 ± 5%) under a 12‐h light cycle (07:00 to 19:00 h). All the rats were fed standard rodent laboratory chow (Optima, Turkey), which was formulated according to the National Research Council (NRC, 1995) guidelines for laboratory rats. This diet provided approximately 300 kcal per 100 g of feed, consisting of 57.5% carbohydrates, 28.9% proteins, and 13.6% lipids. The rats were divided into four groups (n = 8 in each):

Group 1: Ad libitum (AL)‐fed middle‐aged male rats

Group 2: ADF middle‐aged male rats

Group 3: AL‐fed middle‐aged female rats

Group 4: ADF middle‐aged female rats

2.3. ADF Protocol

The IF protocol was ADF, which involves fasting every other day at a 1:1 ratio (24 h of fasting for every 24 h of feeding), repeated over 56 days. Throughout the experiment, all the rats had free access to water. The survival rate was 100% across all groups, with no observed mortality. This protocol was selected based on clinical studies [22] and studies with rodents [23], considering that the ADF protocol has also been widely used in clinical practice, as it prevents metabolic diseases without altering caloric intake [22].

2.4. Measurement of Body Weight, Average Weekly Food Intake, Visceral Fat Pad Measurements

To track changes over time, body weight (BW) was measured using a digital weighing scale at baseline (before initiation of the feeding protocol), at the 4^th week, and at the end of the 8^th week of the experiment. Body mass was measured simultaneously on the same day of the week. Food consumption was determined by subtracting the remaining food (including crumbs) from the total food provided. Average weekly food intake (g/per rat/week) was recorded, and measurements were conducted on non‐fasting days. After sacrifice, the retroperitoneal fat (adipose tissue attached to the posterior abdominal wall near the kidneys) was dissected and weighed to assess visceral adiposity.

2.5. Blood Sample Collection

At the end of the study, on the day before the experimental procedures, all the animals underwent an overnight fasting period with free access to water. The fasting glucose measurement was done from the tail vein using a blood glucose meter (Optima, Taiwan). Next, the rats were humanely euthanized through decapitation under the influence of combined anesthesia involving ketamine HCl and 2% xylazine HCl, which were administered at doses of 90 mg/kg and 10 mg/kg, respectively. Blood samples were collected from the abdominal aorta and transferred into plain tubes without anticoagulants. The samples were subsequently centrifuged at 1500×g for 20 min via a Hettich‐Universal 320 centrifuge (Germany). The resulting serum was stored at −80°C for subsequent enzyme‐linked immunosorbent assay (ELISA) analyses.

2.6. Total RNA Isolation and qRT–PCR

In this study, we investigated the changes in TLR4 mRNA expression in the ADF groups compared with the control groups via RT–PCR. Hypothalamus and liver tissues were homogenized in microtubes via a Tissue Lyser (rotor‐stator homogenizer, Heidolph, RZR 2021), and total RNA was isolated via the TRIzol Reagent (Invitrogen, USA) following the manufacturer's guidelines. Determination of RNA concentration and purity was performed spectrophotometrically with a NanoDrop (Thermo) device. For this purpose, changes in the mRNA expression of TLR4 and downstream targets were detected. β‐actin was used as a housekeeping gene for normalization. The reverse and forward sequences of the genes are given in Table 1. The sequences were designed using the OriGene website (https://www.origene.com/) and the Basic Local Alignment Search Tool (BLAST) software (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The reaction mixture consisted of 5.5 μL of SYBR green master mix (ABT 2x qPCR SYBR Green Master mix), 6.5 μL of nuclease‐free water, 2 μL (1 reverse + 1 forward) of primer, and 1 μL of cDNA per well, and the surface of the plate was sealed with a clear adhesive label (Applied BiosystemsTM 96‐Well Reaction plate seal). The plate was loaded into the StepOne Plus RT–PCR device and amplified for 40 cycles, 5 min at 95°C, and 1 min at 60°C.

Table 1.

The sequences of the primers used for the genes.

Gene names	Primary sequence
TLR4	F: TGCTACAGTTCATCTGGGTTTCTG
	R: CTGTGAGGTCGTTGAGGTTAGAAG

Abbreviations: TLR4: Toll‐like receptor 4, F: forward, R: reverse.

2.7. Hypothalamus and Liver Tissue Homogenization

The rats were anesthetized with xylazine (10 mg/kg, i.p.) and ketamine (90 mg/kg, i.p.) following a fasting period of 8 h. Craniotomy was performed after the rats were sacrificed under general anesthesia, and the hypothalamus was removed according to the Paxinos rat brain atlas. Hypothalamus samples were placed in PBS (pH 7.2–7.4) and rapidly frozen with liquid nitrogen. The samples were maintained at 2°C–8°C and homogenized (tissue weight (g): PBS (mL)). After centrifugation for 20 min at 1555 × g, the supernatant was removed, and the protein levels were measured via enzyme‐linked immunosorbent assay (ELISA).

2.8. Determination of Serum Lipogenic Protein, Inflammation, and Leptin‐Related Protein Levels

The levels of TNF‐α (E0764Ra), IL‐6 (E0135Ra), triglyceride (E0249Ra), and total cholesterol (E0784Ra) in the serum, as well as those of SOCS3 (E0657Ra), leptin (E0561Ra), and ObRb (E0455Ra) in the hypothalamus, were determined via commercial ELISA kits following the manufacturer's recommendations.

2.9. Statistical Analyses

A power analysis was conducted using the G‐Power 3.1 program (version 3.1.9.2; Heinrich‐Heine‐Universität Düsseldorf, Germany), available online. The effect size reported in the reference study is large (d = 1.22). The power analysis (f = 0.9) indicated that a minimum of 32 rats (at least 8 per group) would provide 80% power at 95% confidence. Consequently, a total of 32 rats were used in the study.

All the statistical analyses were performed via SPSS 25.0 (IBM SPSS Statistics 25 software (Armonk, NY: IBM Corp.)). Continuous variables are presented as the means ± standard deviations. Shapiro–Wilk tests were used to determine the normality of the distribution. For independent group comparisons, one‐way analysis of variance (ANOVA) (post hoc: Tukey method) was used when parametric test assumptions were met, whereas Kruskal–Wallis variance analysis (post hoc: Mann–Whitney U test with Bonferroni correction) was applied when parametric test assumptions were not met. The level of statistical significance was set at p ≤ 0.05.

3. Results

As shown in Figure 1, baseline BW was significantly higher in male rats (Groups 1 and 2) than in female rats (Groups 3 and 4) (p = 0.001), with a large overall effect (F = 38.24, p < 0.001, η ² = 0.852). In contrast, no significant difference was observed between the ADF and control groups within the same sex (Figure 1A).

Figure 1.

BW and retroperitoneal fat weight comparisons among the experimental groups. (A) Initial BW (g) of the groups. (B) BW (g) of the groups after 1 month of ADF intervention. (C) Final BW (g) of the groups after 2 months of ADF intervention. (D) Retroperitoneal fat weights (g) of the groups. The data are presented as the means ± SDs (n = 8). *p < 0.05, **p < 0.01, ***p < 0.001. (Group 1: AL‐fed middle‐aged male rats; Group 2: ADF middle‐aged male rats; Group 3: AL‐fed middle‐aged female rats; Group 4: ADF middle‐aged female rats; AL = ad libitum; BW = body weight; ADF = alternate‐day fasting.).

After 1 month, BW was significantly reduced in ADF‐treated male rats compared with control males (Group 2 vs. Group 1, p = 0.001) and in ADF‐treated female rats compared with control females (Group 4 vs. Group 3, p = 0.008), with a large overall effect (F = 44.91, p < 0.001, η ² = 0.871) (Figure 1B).

At the end of the 8‐week intervention, BW remained significantly lower in ADF‐treated groups compared with their respective controls in both sexes (Group 2 vs. Group 1, p = 0.001; Group 4 vs. Group 3, p = 0.001), with a very large overall effect (F = 103.53, p < 0.001, η ² = 0.940) (Figure 1C).

Retroperitoneal fat weight was significantly reduced in ADF‐treated male and female rats compared with their respective control groups (Group 2 vs. Group 1, p = 0.001; Group 4 vs. Group 3, p = 0.001), with a very large overall effect (F = 89.03, p < 0.001, η ² = 0.930). (Figure 1D). Notably, ADF‐induced fat reduction was more pronounced in females than in males, which may be attributed to sex‐specific differences in fat distribution and hormonal influences (particularly estrogen's role in lipid metabolism). It enhances metabolic adaptations, thereby promoting greater fat mobilization.

Figure 2 presents comparisons of average weekly food intake (g/per rat/week) and fasting blood glucose among the four groups.

Figure 2.

Comparisons of average weekly food intake and fasting blood glucose among the experimental groups. (A) The average weekly food intake (g/per rat/week) of the groups. (B) Fasting blood glucose levels (mg/dL) of the groups. The data are presented as the means ± SDs (n = 8). *p < 0.05, ***p < 0.001. (Group 1: AL‐fed middle‐aged male rats; Group 2: ADF middle‐aged male rats; Group 3: AL‐fed middle‐aged female rats; Group 4: ADF middle‐aged female rats; AL = ad libitum; ADF = alternate‐day fasting.).

ADF significantly reduced average weekly food intake in both male and female rats compared with their respective controls (Group 2 vs. Group 1, p = 0.001; Group 4 vs. Group 3, p = 0.001), with a large overall effect (F = 21.61, p < 0.001, η ² = 0.730). (Figure 2A). Control female rats consumed significantly less food than the control male rats (Group 3 vs. Group 1, p = 0.028). In contrast, no significant difference was observed between ADF‐treated males and females (Group 2 vs. Group 4, p = 0.090) (Figure 2A).

Fasting blood glucose levels were significantly reduced in ADF‐treated male and female rats compared with their respective controls (Group 2 vs. Group 1, p = 0.001; Group 4 vs. Group 3, p = 0.001), with a very large overall effect (F = 53.94, p < 0.001, η ² = 0.890) (Figure 2B). In addition, glucose levels were significantly lower in ADF‐treated females than in ADF‐treated males (Group 4 vs. Group 2, p = 0.012). In contrast, no significant difference was observed between control groups (Group 1 vs. Group 3, p = 0.871) (Figure 2B).

Comparisons of total serum total cholesterol (mmol/L) and triglyceride (mmol/L) levels among the four groups are presented in Figure 3.

Figure 3.

Comparisons of serum total cholesterol and triglyceride levels among the experimental groups. (A) Serum total cholesterol levels (mmol/L) of the groups. (B) Serum triglyceride levels (mmol/L) of the groups. The data are presented as the means ± SDs (n = 8). ** p < 0.01, *** p < 0.001. (Group 1: AL‐fed middle‐aged male rats; Group 2: ADF middle‐aged male rats; Group 3: AL‐fed middle‐aged female rats; Group 4: ADF middle‐aged female rats; AL = ad libitum; ADF = alternate‐day fasting).

ADF significantly reduced total serum cholesterol levels in both male and female rats compared with their respective controls (Group 2 vs. Group 1, p = 0.001; Group 4 vs. Group 3, p = 0.001), with a large overall effect (F = 16.51, p < 0.001, η² = 0.756). No significant difference was detected between control male and female rats (Group 1 vs. Group 3, p = 0.923) or between ADF‐treated males and females (Group 2 vs. Group 4, p = 0.679), indicating that ADF had a similar cholesterol‐lowering effect on both sexes (Figure 3A). ADF had a significant cholesterol‐lowering effect in both males and females, with no notable sex‐based differences in its impact.

Serum triglyceride levels were significantly reduced in ADF‐treated female rats compared with control females (Group 4 vs. Group 3, p = 0.008). Control female rats exhibited significantly higher triglyceride levels than control males (Group 3 vs. Group 1, p = 0.003), with a large overall effect (F = 9.48, p = 0.001, η² = 0.640). No significant differences were observed between ADF‐treated males and controls (Group 2 vs. Group 1, p = 0.976) or between ADF‐treated males and females (Group 2 vs. Group 4, p = 0.764) (Figure 3B). ADF significantly lowered triglyceride levels in females. In contrast, it had no notable effect on males. These findings suggest that female rats respond more effectively to ADF‐induced changes in lipid metabolism.

Figure 4 compares the serum TNF‐α (ng/mL) and IL‐6 (ng/L) levels of the four groups.

Figure 4.

Comparisons of serum TNF‐α and IL‐6 levels among the experimental groups. A Serum TNF‐α levels (pg/mL) of the groups. B Serum IL‐6 levels (ng/L) of the groups. The data are presented as the means ± SDs (n = 8). *p < 0.05, **p < 0.01. (Group 1: AL‐fed middle‐aged male rats; Group 2: ADF middle‐aged male rats; Group 3: AL‐fed middle‐aged female rats; Group 4: ADF middle‐aged female rats; TNF‐α = tumor necrosis factor‐alpha; IL‐6 = interleukin‐6; AL = ad libitum; ADF = alternate‐day fasting).

ADF significantly reduced serum TNF‐α levels in both male and female rats compared with their respective controls (Group 2 vs. Group 1, p = 0.018; Group 4 vs. Group 3, p = 0.002), with a large overall effect (F = 12.64, p < 0.001, η ² = 0.703). ADF effectively lowered TNF‐α levels in both sexes, with no significant sex‐based differences in its overall impact. No significant differences were observed between ADF‐treated males and females (Group 2 vs. Group 4, p = 0.502) or between control groups (Group 1 vs. Group 3, p = 0.343), suggesting that sex did not influence TNF‐α levels under AL feeding conditions. These findings suggest that ADF has a general anti‐inflammatory effect by reducing TNF‐α levels, with a slightly greater effect on females (Figure 4A).

Similarly, ADF significantly reduced serum IL‐6 levels in both male and female rats compared with their respective controls (Group 2 vs. Group 1, p = 0.041; Group 4 vs. Group 3, p = 0.003) (Figure 4B). Control female rats exhibited significantly higher IL‐6 levels than control males (Group 3 vs. Group 1, p = 0.004), with a large overall effect (F = 17.01, p < 0.001, η ² = 0.761). In contrast, no significant difference was observed between ADF‐treated males and females (Group 2 vs. Group 4, p = 0.052), indicating a potential sex‐based difference in baseline inflammatory responses under A feeding conditions. These findings suggest that ADF effectively reduces IL‐6 levels in both males and females, with control females displaying a naturally greater inflammatory state than males (Figure 4B).

Figure 5 compares hypothalamic leptin (ng/mL), ObRb (ng/mL), and SOCS3 (ng/mL) levels across the four groups.

Figure 5.

Hypothalamic leptin, ObRb, and SOCS3 levels among experimental groups. (A) Hypothalamic leptin levels (ng/mL) of the groups. (B) Hypothalamic ObRb levels (ng/mL) of the groups. C Hypothalamic SOCS3 levels (ng/mL) of the groups. The data are presented as the means ± SDs (n = 8). *p < 0.05, **p < 0.01, **p < 0.00. (Group 1: AL‐fed middle‐aged male rats; Group 2: ADF middle‐aged male rats; Group 3: AL‐fed middle‐aged female rats; Group 4: ADF middle‐aged female rats; ObRb = Long‐form Leptin Receptor; SOCS3 = Suppressor of Cytokine Signaling 3; AL = ad libitum; ADF = alternate‐day fasting).

ADF significantly reduced hypothalamic leptin levels in male and female rats compared with their respective controls (Group 2 vs. Group 1, p = 0.009; Group 4 vs. Group 3, p = 0.001) (Figure 5A), with a large overall effect (F = 13.41, p < 0.001, η ² = 0.715). No significant difference was observed between control groups (Group 1 vs. Group 3, p = 0.926) or between ADF‐treated groups (Group 2 vs. Group 4, p = 0.865) (Figure 5A).

Hypothalamic ObRb levels were significantly increased in ADF‐treated male and female rats compared with their respective controls (Group 2 vs. Group 1, p = 0.001; Group 4 vs. Group 3, p = 0.028) (Figure 5B), with a large overall effect (F = 10.95, p < 0.001, η ² = 0.578). In contrast, no significant difference was observed between ADF‐treated males and females (Group 2 vs. Group 4, p = 0.090). These findings suggest that while ADF improves leptin receptor expression, its effect is not significantly different between males and females (Figure 5B)

ADF significantly reduced SOCS3 expression in both male and female rats compared with their respective controls (Group 2 vs. Group 1, p = 0.001; Group 4 vs. Group 3, p = 0.001) (Figure 5C), with a large overall effect (F = 23.06, p < 0.001, η ² = 0.776), indicating a potential alleviation of leptin resistance. Control female rats exhibited significantly higher SOCS3 levels than control males (Group 3 vs. Group 1, p = 0.030), whereas no significant difference was observed between ADF‐treated males and females (Group 2 vs. Group 4, p = 0.337).

Figure 6 presents the fold change in TLR4 mRNA expression in the hypothalamus and liver among the four groups.

Figure 6.

Fold changes in hypothalamic and hepatic TLR4 mRNA expression fold change among the experimental groups. (A) TLR4 mRNA fold change in the hypothalamus. (B) TLR4 mRNA fold change in the liver. The data are presented as the means ± SDs (n = 8). p < 0.001. (Group 1: AL‐fed middle‐aged male rats; Group 2: ADF middle‐aged male rats; Group 3: AL‐fed middle‐aged female rats; Group 4: ADF middle‐aged female rats; TLR4 = Toll‐like receptor 4; AL = ad libitum; ADF = alternate‐day fasting).

ADF significantly downregulated hypothalamic TLR4 mRNA expression in male and female rats compared with their respective controls (Group 2 vs. Group 1, p < 0.001; Group 4 vs. Group 3, p < 0.001), with a very large overall effect (F = 207.98, p < 0.001, η ² = 0.975) (Figure 6A). ADF led to a more significant reduction in TLR4 expression in females than in males, suggesting that ADF might have a more pronounced suppressive effect on TLR4‐related inflammatory signaling in females. (Figure 6A)

Similarly, hepatic TLR4 mRNA expression was significantly reduced in ADF‐treated male and female rats compared with their respective controls (Group 2 vs. Group 1, p < 0.001; Group 4 vs. Group 3, p < 0.001), with a very large overall effect (F = 175.88, p < 0.001, η ² = 0.971) (Figure 6B).

ADF significantly downregulated TLR4 mRNA expression in both the hypothalamus and liver, demonstrating its anti‐inflammatory potential by suppressing TLR4 signaling. ADF‐induced suppression of TLR4 expression was more pronounced in females than in males, suggesting that females may be more responsive to ADF in terms of TLR4‐mediated inflammatory regulation.

4. Discussion

The aging process is characterized by progressive cellular and physiological decline accompanied by a chronic, low‐grade inflammatory state known as inflammaging. This process is driven by increased oxidative stress, immune dysregulation, and persistent activation of innate immune pathways, particularly TLR4 signaling [24]. Given the central role of inflammaging in metabolic dysfunction and age‐related diseases, dietary interventions such as IF, particularly ADF, have attracted attention for their potential to mitigate these adverse effects [25]. However, the precise impact of ADF on key inflammatory pathways, particularly the TLR4/leptin axis, remains poorly understood, particularly regarding sex‐dependent responses.

In the present study, ADF significantly improved metabolic and inflammatory parameters in middle‐aged rats. Specifically, ADF reduced BW, retroperitoneal fat mass, and food intake while improving glucose metabolism in both sexes. In parallel, serum TNF‐α and IL‐6 levels decreased, hypothalamic SOCS3 and leptin levels were reduced, and ObRb expression increased. Notably, ADF suppressed TLR4 expression in both the hypothalamus and liver, indicating a broad anti‐inflammatory effect. These findings suggest that ADF is associated with improvements in metabolic and inflammatory homeostasis as well as alterations in the TLR4–SOCS3–leptin axis.

Aging is associated with increased adiposity and systemic inflammation, contributing to metabolic decline. Consistent with previous studies showing that ADF improves BW, fat distribution, and glucose metabolism [25, 26], we observed similarly significant reductions in BW in middle‐aged male and female rats after 8 weeks of ADF. This effect is likely mediated by reduced energy intake and enhanced fat oxidation, which are key mechanisms of IF. In parallel, ADF significantly decreased retroperitoneal fat mass, with a more pronounced effect in females, possibly reflecting sex‐related differences in adipose metabolism and hormonal regulation [27]. Given the strong link between visceral fat, insulin resistance, and inflammation, this reduction likely contributed to improved metabolic outcomes. Accordingly, fasting glucose levels were significantly lower in both sexes, consistent with previous findings [25, 28]. ADF also reduced weekly food intake, which may have partially contributed to the observed metabolic and anti‐inflammatory effects, consistent with reports of spontaneous caloric restriction during ADF [29]. Therefore, some of the beneficial effects observed in the present study may be attributable not only to the fasting pattern itself but also to reduced overall caloric intake.

Although some studies have reported hyperphagia and increased adiposity in juvenile female rats following IF [30], such compensatory behaviors were not evident in middle‐aged rats. This discrepancy may be explained by differences in age, health status, and the duration of the fasting protocol. In our study, the experimental design followed widely established ADF protocols based on alternating fasting and ad libitum refeeding rather than matched caloric intake, as described in previous studies [31, 32]. Importantly, growing evidence suggests that the metabolic effects of IF extend beyond caloric restriction and involve distinct adaptive mechanisms. One key mechanism is the metabolic switch from glucose to ketone‐body utilization during fasting [17, 33]. This transition promotes cellular stress resistance and metabolic efficiency. In particular, ketone bodies such as β‐hydroxybutyrate act not only as alternative energy substrates but also as signaling molecules that regulate inflammatory pathways and support mitochondrial function [33]. Nevertheless, because a pair‐fed control group was not included in the present study, the relative contribution of reduced caloric intake versus ADF‐specific mechanisms could not be fully distinguished.

Chronic low‐grade inflammation is a defining feature of aging‐related metabolic dysfunction and is largely driven by the sustained activation of innate immune pathways, particularly TLR4 signaling. TLR4 activation by DAMPs initiates proinflammatory cascades, leading to increased cytokine production, including TNF‐α and IL‐6, and contributing to systemic metabolic impairment [34, 35]. Through activation of downstream pathways, including MAPK and NF‐κB, TLR4 contributes to inflammation‐associated physiological dysfunction and insulin resistance [36, 37]. In the present study, ADF reduced TLR4 expression in both the hypothalamus and liver, accompanied by lower circulating TNF‐α and IL‐6 levels, suggesting attenuation of age‐related inflammatory signaling. However, further protein‐level and pathway‐specific analyses are required to clarify the underlying mechanisms.

In addition, endogenous ligands, such as free fatty acids, further activate TLR4, linking adiposity to chronic inflammation and reinforcing the interaction between metabolic and immune pathways [38]. ADF also significantly reduced serum TNF‐α and IL‐6 levels, supporting its role in attenuating chronic inflammation. These results are consistent with studies showing that caloric restriction and fasting protocols can suppress proinflammatory cytokine production by inhibiting TLR4 activation [39]. The hypothalamus, a key regulator of energy homeostasis, is particularly susceptible to age‐related inflammation, as increased expression of TLR4 and TNF‐α contributes to metabolic dysregulation [40]. Notably, in our study, the anti‐inflammatory effects of ADF were more pronounced in female rats, as reflected by greater reductions in TLR4 expression and circulating cytokines, which may be partly attributed to the known inhibitory effects of estrogen on TLR4 signaling [34]. However, the animals were middle‐aged (~ 14 months old), corresponding to a phase of reproductive senescence in rats, characterized by disrupted or absent estrous cyclicity and attenuated hormonal fluctuations [41]. In this context, estrogen levels may remain relatively stable, and their relationship with leptin is not necessarily linear [42]. Moreover, leptin itself functions as an immunomodulatory hormone linking adipose tissue mass, and age‐related alterations in adipokine secretion may further contribute to variability in inflammatory outcomes [43]. Taken together, these findings suggest that the observed sex‐related differences likely reflect a complex interplay among hormonal status, adiposity, and inflammatory signaling rather than acute estrous fluctuations. However, these results should be interpreted with caution, as the study was not specifically powered to detect sex‐by‐intervention interactions, and inherent sex‐dependent variability in BW and fat distribution may have influenced the outcomes. Therefore, future studies with larger sample sizes and sex‐stratified designs are warranted to clarify these mechanisms more definitively.

Leptin, free fatty acids, TNF‐α, and IL‐6 derived from adipose tissue play important roles in metabolic regulation and immune function. Elevated TNF‐α levels contribute to insulin resistance and β‐cell dysfunction, whereas inhibition of TNF‐α has been shown to improve insulin sensitivity in obesity models [44, 45]. Consistent with these findings, ADF significantly reduced serum TNF‐α levels in our study. Chronic overstimulation of leptin receptors, driven by persistent inflammatory signaling, particularly from saturated fatty acids, can lead to leptin resistance. SOCS3, a key inhibitor of the leptin‐JAK2‐STAT3 pathway, disrupts leptin receptor function in the hypothalamus, impairing appetite regulation and metabolic control [46, 47]. In our study, ADF significantly reduced hypothalamic SOCS3 expression while increasing ObRb expression, indicating improved leptin sensitivity in middle‐aged rats. However, the SOCS3–TLR4 relationship remains controversial. While some reports show that SOCS3 inhibits TLR4 activation, others suggest it enhances inflammation by downregulating the TGF‐β1/Smad3 pathway [13]. Our data indicate that ADF suppressed TLR4 expression in both the hypothalamus and liver and decreased serum TNF‐α and IL‐6 levels, which aligns with previous reports that caloric restriction reduces age‐related inflammatory responses [39].

Leptin resistance, a hallmark of obesity, is impaired leptin signaling despite elevated plasma leptin levels [48]. In our study, circulating leptin levels were lower in ADF‐applied rats, likely due to reductions in retroperitoneal fat mass, as leptin levels strongly correlate with adipose tissue mass [49]. Importantly, reduced leptin levels do not necessarily indicate diminished anorexigenic signaling, as leptin responsiveness depends not only on hormone concentration but also on receptor availability and downstream signaling efficiency. The coexistence of lower leptin levels with reduced food intake in our study may be explained by improved hypothalamic leptin sensitivity. Specifically, the observed increase in ObRb level alongside decreased SOCS3 levels suggests enhanced receptor responsiveness and reduced inhibitory signaling [50, 51].

Furthermore, previous studies have demonstrated that leptin action within the central nervous system does not depend strictly on high local hormone concentrations. Experimental models involving region‐specific leptin modulation have shown that even relatively modest leptin levels within discrete brain regions are sufficient to activate downstream signaling pathways and influence feeding behavior [52]. These findings highlight that signaling competence, rather than absolute leptin concentration, is a key determinant of leptin efficacy. In addition, the reduction in TLR4 expression indicates the attenuation of hypothalamic inflammation, a key contributor to leptin resistance. If paradigms have been shown to remodel central energy homeostasis and improve metabolic flexibility, allowing lower leptin concentrations to remain biologically effective in the regulation of energy balance [33, 53, 54]. Therefore, under ADF conditions, reduced leptin levels likely reflect decreased adiposity, while improved receptor signaling enables effective appetite regulation despite lower hormone availability. Leptin receptor dysfunction is linked to systemic impairment, as hypothalamic ObRb ablation increases body fat and susceptibility to high‐fat diets [55]. Our findings indicate that ADF improves leptin sensitivity. This effect is likely mediated by reduced hypothalamic inflammation, reflected by lower SOCS3 and TLR4 expression and increased ObRb levels.

Hypothalamic inflammation is strongly linked to obesity‐related pathophysiological dysfunction [56]. The hypothalamus integrates peripheral signals related to energy to regulate food intake and energy balance, with leptin acting as a key regulator [57]. Our findings suggest that ADF reduces hypothalamic inflammation and enhances leptin signaling, potentially mitigating age‐related functional decline. Previous studies have shown that hypothalamic proinflammatory markers are closely linked to obesity progression, with leptin signaling playing a critical role [56]. Leptin receptors in the arcuate nucleus of the hypothalamus regulate food intake by interacting with neuropeptide Y and proopiomelanocortin (POMC) neurons [57, 58]. Leptin signaling is mediated through STAT3 activation, which also induces SOCS3 as a negative feedback mechanism [59, 60]. Thus, leptin signaling in the hypothalamus provides critical feedback on adipose tissue status, regulating food intake by decreasing NPY and stimulating POMC activity [61].

Our study is the first to comprehensively evaluate the interplay between TNF‐α, SOCS3, and ObRb in aging and ADF, highlighting novel insights into inflammatory and metabolic interactions. The effects of ADF on these specific markers of leptin signaling and inflammation in aging remain insufficiently elucidated.

This study has certain limitations that should be acknowledged. First, the sample size was relatively small, which may limit the generalizability of our findings. Second, the study was primarily powered to detect main effects rather than interaction effects between sex and intervention, which may limit the ability to evaluate sex‐specific responses fully. Third, the study focused solely on middle‐aged rats, making it unclear whether similar effects would be observed in younger or older populations. The rats' estrous cycles were not monitored, which may represent a potential confounding factor in interpreting sex‐related differences. However, hormonal fluctuations are expected to be attenuated in middle‐aged rats. Furthermore, the molecular mechanisms underlying the observed sex differences remain poorly understood, underscoring the need for further research. Another limitation is that the long‐term sustainability of the metabolic and inflammatory changes induced by ADF was not assessed. The absence of a pair‐fed control group also limits the ability to clearly differentiate effects directly related to the ADF regimen from those associated with reduced caloric intake. Therefore, some of the observed metabolic and anti‐inflammatory improvements may partially reflect caloric restriction‐related effects rather than ADF‐specific mechanisms alone. Finally, caution should be exercised when translating findings from rodent models to human physiology, as species‐specific differences in metabolism, hormonal regulation, and aging processes may affect the clinical applicability of these findings. Future studies, including pair‐fed control groups, larger sample sizes, diverse age groups, extended follow‐up periods, and translational clinical approaches, are needed to further validate and clarify these findings.

5. Conclusion

This study demonstrated that ADF significantly reduced BW, retroperitoneal fat mass, and fasting glucose levels, and was associated with alterations in leptin signaling and reduced TLR4‐mediated inflammatory responses in middle‐aged male and female rats. The observed reductions in SOCS3, TNF‐α, and IL‐6 levels, and increased ObRb level suggest that ADF enhances leptin sensitivity and mitigates age‐related metabolic dysfunction. Notably, the anti‐inflammatory and metabolic benefits of ADF were more pronounced in female rats, potentially due to hormonal influences, including estrogen's known anti‐inflammatory effects. Our findings support a potential association between ADF and improved metabolic and inflammatory regulation; however, further mechanistic studies are needed to clarify the direct causal relationships underlying the TLR4–SOCS3–leptin axis.

Author Contributions

Ozgen Kilic‐Erkek: conceptualization, methodology, data curation, investigation, writing – original draft. Gulsah Gundogdu: conceptualization, methodology, data curation, investigation, writing – original draft, writing – review and editing. Abdullah Coguplugil: investigation. Yavuz Dodurga: methodology, investigation. All authors approved the final article.

Funding

The authors have nothing to report.

Ethics Statement

Animal experiments were approved by the Local Ethics Council of Animal Experiments of Pamukkale University (dated 06.03.2024 PAUHDEK‐2024/09, number: E‐60758568‐020‐502440) and performed by the recommendations of the Guide for the Care and Use of Laboratory Animals (National Research Council, ABD).

Consent

The authors have nothing to report.

Conflicts of Interest

The authors declare no conflict of interest.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.