Morphological and Multilocus Phylogenetic Characterization of Septoria Species from Dioscorea, Eclipta, and Taraxacum in East Asia

Abstract

More than 90 species of Septoria have been reported from Korea, but the identity of many recorded taxa remains uncertain owing to the lack of detailed morphological documentation and multilocus sequence data. In this study, isolates collected from symptomatic leaves of economically and medicinally important plants between 2006 and 2024 were examined using morphological observations and multilocus phylogenetic analyses based on six loci (internal transcribed spacer (ITS) region, actin (ACT), β-tubulin (Btub), calmodulin (CAL), elongation factor 1-alpha (EF1-α), and RNA polymerase II second largest subunit (RPB2)). The concatenated dataset resolved three well-supported lineages corresponding to Septoria dioscoreicola on Dioscorea polystachya, S. eclipticola on Eclipta prostrata, and S. miurae on Taraxacum officinale, of which S. dioscoreicola and S. eclipticola are newly recorded in Korea, whereas Korean materials previously reported as S. taraxaci on Taraxacum are re-identified here as S. miurae. Multilocus analyses further demonstrated that S. taraxaci and S. miurae represent two distinct species associated with Taraxacum, with Korean and Japanese isolates corresponding to S. miurae, whereas the third Taraxacum-associated taxon, S. taraxacicola, is regarded as a synonym of S. miurae. Given the economic and medicinal importance of these hosts involved, the occurrence of Septoria leaf spot on these species may represent a potential concern for their cultivation in East Asia. These results provide an updated taxonomic basis for Septoria species occurring in Korea and clarify species boundaries within the Taraxacum-associated complex.

1. Introduction

Septoria represents one of the largest genera of coelomycetous plant-pathogenic fungi and includes more than 2900 published names associated with leaf spot diseases on a wide range of herbaceous and woody plants worldwide [1,2]. Species of Septoria sensu stricto are characterized by immersed to subepidermal pycnidial conidiomata producing hyaline, filiform, septate conidia that are often exuded in mucilaginous cirrhi under humid conditions [3,4]. Many species are of phytopathological importance because they infect agricultural crops, ornamental plants, medicinal herbs, and wild vegetation, often reducing plant growth, yield, and marketability, e.g., S. lactucae on lettuce, S. lycopersici on tomato, and S. tritici (now, Zymoseptoria tritici) on wheat [5–7].

Traditionally, Septoria species were identified primarily on the basis of morphological characters such as conidial size, septation, pycnidial structure, and host association [8,9]. However, these characters frequently overlap among taxa and may vary depending on host and environmental conditions, making species delimitation difficult [10]. Large-scale phylogenetic studies have demonstrated that Septoria sensu lato is polyphyletic, and several distinct genera, including Parastagonospora, Sphaerulina, and Zymoseptoria, have been recognized [1,11]. Within Septoria sensu stricto, reliable species delimitation therefore requires polyphasic approaches integrating morphology, culture characteristics, host associations, and multilocus DNA phylogeny, particularly from protein-coding genes such as ACT, β-tubulin (Btub), elongation factor 1-alpha (EF1-α), and RNA polymerase II second largest subunit (RPB2) [12].

In Korea, members of the Septoria sensu lato reported to date include Caryophylloseptoria, Cercospora, Phloeospora, Septoria, Sphaerulina, Stagonospora, and Zymoseptoria [13]. Within Septoria sensu stricto, 94 species have been listed from 145 host plants [6,14]. However, most historical records were established primarily on morphological observations, and only a limited number of taxa have been supported by cultural characteristics and multilocus phylogenetic data. As a result, the identity of many previously reported taxa remains uncertain and requires reevaluation using modern systematic approaches [1].

Taxonomic complexity is particularly evident in Taraxacum officinale (common dandelion), on which three names of Septoria, including S. miurae, S. taraxaci, and S. taraxacicola, have historically been applied [15,16]. Because early descriptions were based only on morphological characters and comparative molecular data were unavailable, species boundaries within this complex have remained unclear. Clarification of their relationships requires phylogenetic comparison of Septoria materials from Europe and East Asia, where these taxa were originally described.

Field surveys conducted in Korea revealed previously undocumented Septoria-like leaf spot diseases on Dioscorea polystachya (Chinese yam) and Eclipta prostrata. Dioscorea polystachya is widely cultivated in East Asia as an important food and medicinal crop [15,16], whereas E. prostrata is a medicinal plant commonly used in traditional herbal medicine. As Septoria leaf spot has not previously been documented on Dioscorea polystachya and Eclipta prostrata in Korea, accurate identification of the causal fungi is necessary for reliable disease diagnosis and control. In addition, previous Korean samples of Septoria on Taraxacum, originally identified as S. taraxaci [6,8], are reevaluated here based on morphological comparison and multilocus phylogenetic analyses.

The objective of this study is to characterize Septoria species associated with Dioscorea polystachya, Eclipta prostrata, and Taraxacum officinale in Korea using morphological observations, cultural characteristics, and multilocus phylogenetic analyses based on six loci (internal transcribed spacer (ITS), actin (ACT), Btub, calmodulin (CAL), EF1-α, and RPB2). In addition, the taxonomic relationships among Taraxacum-associated taxa were reassessed through phylogenetic comparison of East Asian materials, and the nomenclatural status of S. taraxacicola was evaluated in relation to S. miurae.

2. Materials and methods

2.1. Fungal isolates

Leaves exhibiting typical Septoria-like leaf spot symptoms were collected from diverse locations in Korea between 2006 and 2024. Sampling sites were distributed across Gyeonggi-do, Gangwon-do, and Jeollabuk-do provinces, and included forest margins, mountain trails, and cultivated fields. Collections were conducted primarily between May and October. All voucher specimens were deposited at the herbaria of Korea University (KUS-F) and Kunsan National University (KSNUH). Detailed information on the host plant, geographic origin, collection date, voucher numbers, and living cultures is provided in Table 1.

Table 1.

Information on Septoria isolates used in the present study.

Species	Isolate no.	Host	Collection date	Origin	GenBank accession no.
					EF1-α	β-Tubulin	RPB2	ITS	ACT	CAL
Septoria anthurii	CBS 148.41	Anthurium sp.	–	–	KF253287	KF252812	KF252341	KF251340	KF253644	KF253992
S. anthurii	CBS 346.58	Anthurium sp.	–	Germany	KF253288	KF252813	KF252342	KF251341	KF253645	KF253993
S. callistephi	CBS 128590	Callistephus chinensis	August 2006	Pocheon-si, South Korea	KF253305	KF252830	KF252359	KF251358	KF253662	KF254010
S. callistephi	CBS 128594	Callistephus chinensis	September 2007	Hongcheon-gun, South Korea	KF253306	KF252831	KF252360	KF251359	KF253663	KF254011
S. chelidonii	CBS 128607	Chelidonium majus	May 2006	Namyangju-si, South Korea	KF253319	KF252844	KF252373	KF251372	KF253676	KF254024
S. chelidonii	CPC 12337	Chelidonium majus	September 2007	Yangpyeong-gun, South Korea	KF253320	KF252845	KF252374	KF251373	KF253677	KF254025
S. chromolaenae	CBS 113373	Chromolaena odorata	October 1997	Cuba	KF253321	KF252846	KF252375	KF251374	KF253678	KF254026
S. codonopsidis	CBS 128609	Codonopsis lanceolata	June 2006	Hongcheon-gun, South Korea	KF253332	KF252857	KF252386	KF251385	KF253689	KF254037
S. codonopsidis	CBS 128620	Codonopsis lanceolata	September 2007	Yanggu-gun, South Korea	KF253333	KF252858	KF252387	KF251386	KF253690	KF254038
S. crepidis	CBS 128608	Crepis japonica	May 2006	Yangpyeong-gun, South Korea	KF253337	KF252862	KF252391	KF251390	KF253694	KF254042
S. crepidis	CBS 128619	Youngia japonica	September 2007	Namyangju-si, South Korea	KF253338	KF252863	KF252392	KF251391	KF253695	KF254043
S. crepidis	CPC 12539	Youngia japonica	–	South Korea	KF253339	KF252864	KF252393	KF251392	KF253696	KF254044
S. cretae	CBS 135095	Nerium oleander	July 2012	Greece	–	KF252720	KF252238	KF251233	–	–
S. dioscoreicola	KACC 411317	Dioscorea polystachya	July 2024	Namyangju-si, South Korea	PZ049316	PZ049324	–	PZ052499	PZ065598	PZ065607
S. eclipticola	CBS 136118	Eclipta prostrata	2012	Iran	MK531751	MK531759	MK531761	MK531729	MK531743	–
S. eclipticola	CCTU 1153.2	Eclipta prostrata	–	Iran	MK531752	MK531760	MK531762	MK531730	MK531744	–
S. eclipticola	KACC 410927	Eclipta prostrata	August 2024	Wanju-gun, South Korea	PZ049314	PZ049322	PZ049307	PZ052497	PZ065597	PZ065605
S. eclipticola	KACC 411037	Eclipta prostrata	October 2023	Chuncheon-si, South Korea	PZ049313	PZ049321	PZ049306	PZ052496	PZ065596	PZ065604
S. eclipticola	KACC 43079	Eclipta prostrata	September 2007	Namyangju-si, South Korea	PZ049319	PZ049327	PZ049311	PZ052502	PZ065599	PZ065610
S. ekmaniana	CBS 113385	Chromolaena odorata	–	Mexico	KF253354	KF252878	–	KF251407	KF253711	KF254059
S. ekmaniana	CBS 113612	Chromolaena odorata	–	Mexico	KF253355	KF252879	–	KF251408	KF253712	KF254060
S. eucalyptorum	CBS 118505	Eucalyptus sp.	–	India	KF253365	KF252889	KF252415	KF251417	KF253721	KF254069
S. justiciae	CBS 128610	Justicia procumbens	September 2006	Anyang-si, South Korea	KF253384	KF252908	KF252433	KF251436	KF253740	KF254088
S. justiciae	CBS 128625	Justicia procumbens	November 2007	Jeju-si, South Korea	KF253385	KF252909	KF252434	KF251437	KF253741	KF254089
S. leptostachyae	CBS 128613	Phryma leptostachya	May 2007	Yangpyeong-gun, South Korea	KF253399	KF252923	KF252448	KF251451	KF253755	KF254103
S. leptostachyae	CBS 128628	Phryma leptostachya	June 2008	Hongcheon-gun, South Korea	KF253400	KF252924	KF252449	KF251452	KF253756	KF254104
S. linicola	CBS 316.37	Linum usitatissimum	–	Argentina	KF253408	KF252932	KF252457	KF251460	KF253764	KF254112
S. pachyspora	CBS 128652	Zanthoxylum schinifolium	August 2005	Hongcheon-gun, South Korea	KF253437	KF252958	KF252485	KF251488	KF253792	KF254141
S. passifloricola	CBS 102701	Passiflora edulis	–	New Zealand	KF253442	KF252963	KF252490	KF251493	KF253797	KF254146
S. passifloricola	CBS 129431	Passiflora edulis	–	Australia	KF253443	KF252964	–	KF251494	KF253798	KF254147
S. sisyrinchii	CBS 112096	Sisyrinchium sp.	–	New Zealand	KF253499	KF253019	KF252545	KF251551	KF253854	KF254203
S. taraxaci	CBS 567.75	Taraxacum sp.	July 1975	Armenia	KF253524	KF253045	KF252570	KF251577	KF253878	KF254229
S. miurae	CBS 128650; KACC 42451	Taraxacum officinale	May 2006	Hoengseong-gun, South Korea	KF253504	KF253024	KF252550	KF251556	KF253859	KF254208
S. miurae	KACC 410958	Taraxacum officinale	October 2024	Gapyeong-gun, South Korea	PZ049315	PZ049323	PZ049308	PZ052498	–	PZ065606
S. miurae	KACC 411139	Taraxacum officinale	May 2025	Hongcheon-gun, South Korea	PZ049317	PZ049325	PZ049309	PZ052500	PZ065601	PZ065608
S. miurae	KACC 42901	Taraxacum officinale	June 2007	Gangneung-si, South Korea	PZ049318	PZ049326	PZ049310	PZ052501	PZ065600	PZ065609
S. miurae	MUCC 1604; MAFF 237805	Taraxacum officinale	July 1998	Fukushima, Japan	PZ049312	PZ049320	PZ049305	PZ052495	PZ065602	PZ065603
Sphaerulina aceris	CBS 183.97	Acer pseudoplatanus	May 1996	Netherlands	KF253540	–	KF252586	KF251593	KF253895	KF254246

Isolates shown in bold were newly collected in the present study.

Single-spore isolation was performed using fresh conidial masses (cirrhi) extruded from pycnidia on naturally infected leaves. Conidial masses were carefully placed onto a drop of sterile distilled water on a slide glass and gently dispersed to obtain a dilute suspension. The suspension was streaked onto potato dextrose agar (PDA; Difco, Detroit, MI) supplemented with streptomycin sulfate (200 ppm; Kisanbio, Seoul, South Korea) to suppress bacterial growth. Plates were incubated at 25 °C in the dark for 3–5 days. Germinating single conidia were transferred onto fresh PDA plates and cultured for morphological observation and DNA extraction. Representative Korean isolates were preserved in the Korean Agricultural Culture Collection (KACC) and the Westerdijk Fungal Biodiversity Institute (CBS) (Table 1). For comparison, the Japanese strain MAFF 237805, isolated from Taraxacum officinale and deposited in the MAFF Genebank (Research Center of Genetic Resources, National Agriculture and Food Research Organization, Tsukuba, Japan), was included in the phylogenetic analysis of the Taraxacum-associated Septoria complex in East Asia.

2.2. Morphological and cultural characterization

Morphological characteristics were examined using both fresh symptomatic materials and dried herbarium specimens. Fresh samples were mounted in sterile distilled water for observation of conidiomata and conidia, whereas dried specimens were mounted in lactic acid and gently heated before examination. Conidia used for measurements were obtained from sporulation occurring naturally on infected host tissues. At least 30 conidia were measured for each specimen and presented as minimum–maximum ranges. Hand sections of symptomatic tissues were prepared to examine the structure of conidiomata, ostioles, and conidiogenous cells. Microscopic observations were performed using a differential interference contrast (DIC) microscope (Zeiss Imager M2 AX10; Carl Zeiss, Jena, Germany) equipped with an AxioCam MRc5 camera (Carl Zeiss, Jena, Germany) at magnifications of ×40, ×63, and ×100. Digital images were captured and processed using Zeiss imaging software. Measurements are reported as (minimum–) standard deviation toward the minimum–mean–standard deviation toward the maximum (–maximum).

Cultural characteristics were examined on PDA after incubation at 25 °C in the dark for four weeks. Colony diameter, color, texture, margin characteristics, aerial mycelium development, and production of exudates were recorded.

2.3. DNA extraction, PCR amplification, and sequencing

Genomic DNA was extracted from mycelium harvested from PDA cultures using the MagListo 5M Plant Genomic DNA Extraction Kit (Bioneer, Daejeon, South Korea). PCR amplification targeted six loci: the ITS region, ACT, Btub, CAL, translation EF1-α, and the RPB2. Primer pairs used for amplification are listed in Table 2. PCR reactions were performed using AccuPower^® PCR PreMix (Bioneer, Daejeon, South Korea). Amplification conditions followed a previously published protocol [11], with minor adjustments. PCR products were visualized on 1.5% agarose gels and purified using the AccuPrep^® PCR/Gel Purification Kit (Bioneer, Daejeon, South Korea). Purified amplicons were sequenced bidirectionally by Macrogen (Seoul, South Korea). Forward and reverse sequences were assembled and edited using DNASTAR Lasergene software version 7.1.0 (DNASTAR, Inc., Madison, WI) [27]. Consensus sequences were deposited in GenBank, and accession numbers are provided in Table 1.

Table 2.

Sequences and references of primers used in this study.

		Primer sequence 5′ to 3′	Reference
ITS	ITS5	GGAAGTAAAAGTCGTAACAAGG	[17]
	ITS4	TCCTCCGCTTATTGATATGC
EF1-α	EF1-728F	CATCGAGAAGTTCGAGAAGG	[18]
	EF-983R-nd	ATGAAATCACGGTGACCTGGGGC	This study
	EF-2	GGARGTACCAGTSATCATGTT	[19]
β-Tubulin	T1	AACATGCGTGAGATTGTAAGT	[20]
	β-Sandy-R	GCRCGNGGVACRTACTTGTT	[21]
ACT	ACT512F	ATGTGCAAGGCCGGTTTCGC	[18]
	ACT783R	TACGAGTCCTTCTGGCCCAT
	ACT2Rd	ARRTCRCGDCCRGCCATGTC	[22]
RPB2	fRPB2-5F	GAYGAYMGWGATCAYTTYGG	[23]
	RPB2-F4	GAYYTBGCIGGICCIYTIATGGC	[11]
	fRPB2-414R	ACMANNCCCCARTGNGWRTTRTG	[24]
	fRPB2-414R-nd	ACAAGTCCCCAATGCGTATTGTG	[25]
	fRPB2-7CR	CCCATRGCTTGYTTRCCCAT	[23]
CAL	CAL-235F	TTCAAGGAGGCCTTCTCCCTCTT	[26]
	CAL2Rd	TGRTCNGCCTCDCGGATCATCTC	[22]

2.4. Molecular phylogenetic analysis

Multilocus phylogenetic analyses were conducted using a concatenated dataset consisting of ITS, ACT, Btub, CAL, EF1-α, and RPB2 sequences. Reference sequences of Septoria species were retrieved from GenBank based on previously published phylogenetic studies (Table 1). Sequences of each locus were aligned individually using MAFFT v7 [28] with the default algorithm and manually inspected for alignment errors. The individual alignments were concatenated using SequenceMatrix v1.8 [29] to produce a combined dataset of the six markers. Maximum-likelihood (ML) phylogenetic analyses were performed using the IQ-TREE v1.6.12 [30] with a partitioned dataset. The best-fit nucleotide substitution models for each partition were selected using ModelFinder [31]. Branch support was assessed using the ultrafast bootstrap method with 1000 replicates [32]. Sphaerulina aceris (CBS 183.97) was selected as the outgroup based on its placement outside Septoria sensu stricto in a previous phylogenetic study [12]. The inferred phylogenetic tree was visualized using iTOL v7 [33].

3. Results

3.1. Phylogeny

The concatenated six-locus dataset comprised 37 ingroup taxa and 2214 aligned nucleotide positions, including ITS (498 bp), ACT (206 bp), Btub (305 bp), CAL (473 bp), EF1-α (390 bp), and RPB2 (344 bp). The ML phylogeny resolved three well-supported lineages corresponding to Septoria dioscoreicola, S. eclipticola, and S. miurae, each clearly separated from other representatives of Septoria sensu stricto included in the analysis (Figure 1).

Figure 1.

Maximum-likelihood phylogenetic tree inferred from a concatenated dataset of six loci (ITS, ACT, β-tubulin, CAL, EF1-α, and RPB2) representing species of Septoria sensu stricto. Bootstrap support values (1000 replicates) greater than 70% are shown at the nodes. Isolates obtained in the present study are indicated in bold. The three focal taxa, Septoria miurae, S. eclipticola, and S. dioscoreicola, are highlighted. Sphaerulina aceris (CBS 183.97) was used as the outgroup. The scale bar indicates substitutions per site.

The isolate KACC 411317, obtained from Dioscorea polystachya, was located in an independent basal lineage of a major clade, composed of Septoria sensu stricto. Although no directly comparable dataset of Septoria species on D. polystachya was available in public databases, its distinct phylogenetic position, together with morphological agreement with the original description, supports the identification of the Korean isolate as S. dioscoreicola.

Septoria eclipticola isolates obtained from E. prostrata, including three Korean isolates (KACC 43079, 410927, and 411037) and two Iranian reference isolates (CCTU 1153.2 and CBS 136118), formed a strongly supported clade corresponding to S. eclipticola. No sequence divergence was detected between Korean and Iranian isolates across the six loci analyzed.

Four Korean isolates (KACC 42901, 410958, 411139, and CBS 128650) obtained from Taraxacum officinale, together with the Japanese isolate MAFF 237805, formed a well-supported monophyletic clade. No sequence divergence was detected among these isolates across the six loci analyzed. This clade was clearly separated from Septoria taraxaci CBS 567.75 isolated from Taraxacum sp. in Armenia and from other Asteraceae-associated species of Septoria included in the analysis. This lineage corresponds to the taxon previously reported from Korea as Septoria taraxaci and is identified here as S. miurae based on combined morphological comparison and multilocus phylogenetic evidence.

3.2. Taxonomy

• Septoria dioscoreicola G.Z. Lu & J.K. Bai [as “dioscoricola”], in Lu, Bai & Liu, Mycosystema 6: 72, 1993 (Figure 2)

Figure 2.

Septoria dioscoreicola on Dioscorea polystachya. (A, B) Leaf spot symptoms on naturally infected leaves; (C) lesion surface showing immersed pycnidia and conidial horns (arrows); (D) pycnidial conidioma in optical section; (E) colonies on PDA after 4 weeks at 25 °C; (F) conidia on PDA; (G) conidia on dried herbarium specimen.

MycoBank: MB 362706.

Description: Lesions on the upper leaf surface scattered, sometimes confluent, irregular to subcircular, brown to dark brown, commonly surrounded by yellowish discoloration of adjacent tissues. Conidiomata pycnidial, scattered, epiphyllous, brown to dark brown, globose, immersed, 73.1–106.3 µm diameter, producing conidia exuded in white cirrhi; ostioles central, circular, surrounded with darker cells; conidiogenous cells hyaline, ampulliform, holoblastic, proliferating sympodially, 6.5–16.6 μm long. Conidia hyaline, filiform to cylindrical, straight to slightly curved, truncate at the basal end, gradually attenuated distally to a rounded or slightly narrowed apex, (29.7–)36.0–45.6–55.3(–71.7) × (2.7–)3.1–3.7–4.1(–4.7) μm, 2–6-septate, not or only indistinctly constricted at the septa. Colonies on PDA reaching 10 mm diameter after 4 weeks at 25 °C, olivaceous black and slightly elevated at the center; aerial mycelium wooly, mouse gray to dark mouse gray; pale whitish droplets of conidial slime occasionally present.

Host plant in Korea: Dioscorea polystachya Turcz. (Dioscoreaceae).

Specimens examined: Korea, Namyangju-si, July 2024, by H.D. Shin (KSNUH 2257; living culture KACC 411317).

Notes: Two species of Septoria have previously been recorded on Dioscorea spp., namely S. dioscoreicola and S. versicolor [34,35]. In addition, Phyllosticta dioscoreae Cooke (often treated as Septoria dioscoreae in earlier literature) has also been reported on Dioscorea, but is now considered taxonomically distinct from Septoria [36,37]. Lu et al. [34] described S. dioscoreicola from China, with conidia measuring 33–70 × 2.5–3 μm, whereas S. versicolor, described from Romania, is characterized by markedly smaller conidia (16.5–30 × 1.5–2 μm). The Korean isolate produced conidia measuring 29.7–71.7 × 2.7–4.7 μm, which closely correspond to the published dimensions of S. dioscoreicola but clearly differ from those of S. versicolor. Although the conidia in the Korean isolates are slightly wider than previously reported for S. dioscoreicola, the overall agreement in conidial length and septation, together with its phylogenetic placement as an independent lineage in the multilocus phylogeny (Figure 1), supports identification of the Korean isolate as S. dioscoreicola.

• Septoria eclipticola Bakhshi & Crous, in Bakhshi, Arzanlou, Zare, Groenewald & Crous, Mycologia 111(6): 1063, 2019 (Figure 3)

Figure 3.

Septoria eclipticola on Eclipta prostrata. (A, B) Leaf spot symptoms on naturally infected plants; (C, D) close-up view of lesions showing immersed pycnidia (arrows); (E) pycnidial conidioma in optical section; (F) colonies on PDA after 4 weeks at 25 °C; (G) conidia.

MycoBank: MB 831410.

Description: Lesions on the upper leaf surface scattered, sometimes confluent, irregular to nearly circular, dark brown to black. Conidiomata pycnidial, scattered, epiphyllous, brown to dark brown, globose, immersed, 96–170 µm diameter, releasing conidia in white cirrhi; ostioles circular, central, surrounded by darker cells; conidiogenous cells hyaline, ampulliform, holoblastic, proliferating sympodially, 6.9–15.0 μm long. Conidia hyaline, filiform, straight to curved, subtruncate at the base, tapered gradually toward the apex, obtuse at the apex, containing several small guttules and granules, (20.1–)26.7–34.1–41.5(–49.1) × (2.0–)2.0–2.2–2.4(–2.7) µm, 3–6-septate, not or indistinctly constricted at the septa. Colonies on PDA reaching 23 mm diameter after 4 weeks at 25 °C, olivaceous black at the center, thin and slightly watery on the surface, lacking aerial mycelium; margin even to slightly undulate, olivaceous; the reverse olivaceous black.

Host plant in Korea: Eclipta prostrata (L.) L. (Asteraceae).

Specimens examined: Korea, Chuncheon-si, on Eclipta prostrata (L.) L., October 2023, by H.D. Shin (KSNUH 2155; living culture KACC 411037), Korea, Wanju-gun, August 2024, by I.Y. Choi (JBNU 0438; living culture KACC 410927), Korea, Namyangju-si, September 2007, by H.D. Shin (KUS-F22832; living culture KACC 43079).

Notes: Two species of Septoria have been recorded from Eclipta spp. S. eclipticola was originally described from Iran in 2019 [38], and no additional records have been published since then. The morphological measurements provided in the original description correspond well with those of Korean materials. However, the conidial dimensions illustrated in the original figure were approximately twice as large as those values in the text, suggesting a likely illustration error rather than true morphological divergence. S. ecliptae described from Japan [39] has smaller conidiomata (68–94 × 71–112 μm) and conidia (21.7–38.3 × 1.5–2 μm) with fewer septa (1–4) than those of Korean samples. In the multilocus phylogenetic analyses, the three Korean isolates formed a clade with the Iranian reference strains CCTU 1153.2 and CBS 136118, with no sequence divergence across the six loci examined. This is the first record of S. eclipticola in Korea.

• Septoria miurae Trotter, Syll. Fung. 25: 418, 1931 (Figure 4)

Figure 4.

Septoria miurae on Taraxacum officinale. (A, B) Leaf spot symptoms on T. officinale, showing scattered circular to subcircular dark brown lesions, often with concentric zonation and purplish margins; (C, D) surface view of lesions with immersed pycnidia and conidial horns (arrows); (E, F) pycnidial conidioma in optical section; (G) conidia; (H) colonies on PDA after 4 weeks at 25 °C.

MycoBank: MB 546108.

≡ Septoria taraxaci Syd. & P. Syd., Ann. Mycol. 11: 116 (1913), nom. illeg. [later homonym of Septoria taraxaci Hollós, Ann. Hist.-Nat. Mus. Natl. Hung. 5: 462 (1907)].

= Septoria taraxacicola Miura, Flora of Manchuria and East Mongolia, III Cryptogams, Fungi (Industr. Contr. S. Manch. Rly 27): 472 (1928).

Description: Lesions on the upper leaf surface scattered, sometimes confluent, irregular to nearly circular, dark brown to black, frequently with concentric zones delimited by darker borders; surrounding host tissue often exhibiting reddish discoloration. Conidiomata pycnidial, scattered, epiphyllous, brown to dark brown, globose, immersed, 35.0–64.7 µm diameter, releasing conidia in white cirrhi; ostioles central, circular, surrounded with darker cells; conidiogenous cells hyaline, ampulliform, holoblastic, proliferating sympodially 7.7–16.3 μm. Conidia hyaline, filiform, straight to slightly curved, subtruncate at the basal end, gradually attenuated to a rounded or slightly pointed apex, (21.6–)26.0–31.7–37.5(–44.6) × (1.8–)2.0–2.2–2.4(–2.6) μm, 1–4-septate, not or indistinctly constricted at the septa. Colonies on PDA, growing relatively rapidly, reaching 53 mm diameter after 4 weeks at 25 °C; colony surface centrally folded and radially striate, densely covered with pale pink to nearly white aerial mycelium; abundant exudate droplets present on the colony surface with irregular black margin.

Type: Japan, Hokkaido, Sapporo, on Taraxacum officinale F.H.Wigg. var. glaucescens Koch., 1907 May 13, by M. Miura (S: F63127). [type of Septoria taraxaci Syd. & P. Syd.].

Host plant in Korea and Japan: Taraxacum officinale F.H.Wigg. (Asteraceae).

Specimens examined: Korea, Gapyeong-gun, Oct 2024, by H.D. Shin (KSNUH 2292; living culture KACC 410958), Korea, Hoengseong-gun, by H.D. Shin (KUS-F 21800; living culture CBS 128650), Korea, Hongcheon-gun, May 2025, by H.D. Shin (KSNUH 2458; living culture KACC 411139), Korea, Gangneung-si, June 2007, by H.D. Shin (KUS-F22666; living culture KACC 42901).

Notes: Septoria taraxaci Hollós, originally described from Europe, has pycnidia of 100–120 μm in diameter and conidia of 16–24 × 1 μm [40]. In contrast, the Korean materials examined in the present study produced smaller pycnidia of 35.0–64.7 μm and longer, wider conidia of 21.6–44.6 × 1.8–2.6 μm, clearly differing from the morphology of S. taraxaci. These characters correspond closely with those reported for East Asian Taraxacum-associated Septoria described under the names S. taraxacicola and S. miurae [15,16]. Multilocus phylogenetic analyses further demonstrated that Korean isolates formed a strongly supported clade together with the Japanese reference isolate MAFF 237805, deposited as S. taraxacicola with conidiomata of 42.5–60 μm and conidia of 17.5–35 × 2 μm and were clearly separated from S. taraxaci Hollós. The Septoria species occurring on Taraxacum in East Asia, including Japan and Korea, is therefore appropriately identified as S. miurae Trotter. A detailed morphological comparison with these species is provided in Table 3. Previous Korean records of Septoria taraxaci on Taraxacum officinale correspond morphologically and phylogenetically to this species and are therefore re-identified here as S. miurae. Further nomenclatural considerations regarding S. taraxaci and related names are discussed below.

Table 3.

Morphological comparison of Septoria dioscoreicola, Septoria eclipticola, and Septoria miurae with the morphologically similar species.

Character		Septoria dioscoreicola	Septoria eclipticola	Septoria miurae	Septoria taraxaci	Septoria miurae
Conidiomata (µm)		73.1–106.3	96–170	35.0–64.7	100–120	50–70
Conidiogenous cells (µm)		6.5–16.6	6.9–15.0	7.7–16.3	N/A	N/A
Conidia (µm)	Size	(29.7–)36.0–45.6–55.3(–71.7) × (2.7–)3.1–3.7–4.1(–4.7)	(20.1–)26.7–34.1–41.5(–49.1) × (2.0–)2.0–2.2–2.4(–2.7)	(21.6–)26.0–31.7–37.5(–44.6) × (1.8–)2.0–2.2–2.4(–2.6)	16–24 × 1	20–38 × 0.75–1
	Shape	Hyaline, filiform to cylindrical, straight to slightly curved, truncate at the basal end, gradually attenuated distally to a rounded or slightly narrowed apex, 2–6-septate	Hyaline, filiform, straight to curved, subtruncate at the base, tapered gradually toward the apex, obtuse at the apex, containing several small guttules and granules, 3–6-septate	Hyaline, filiform, straight to slightly curved, subtruncate at the basal end, gradually attenuated to a rounded or slightly pointed apex, 1–4-septate	Acicular, straight to slightly curved, aseptate, hyaline	Filiform, very slender, straight or slightly curved, hyaline
Reference		This study	This study	This study	[40]	[16]

4. Discussion

The present study confirms the occurrence of three species of Septoria, namely S. dioscoreicola on Dioscorea polystachya, S. eclipticola on Eclipta prostrata, and S. miurae on Taraxacum officinale, in Korea based on combined morphological observations and multilocus phylogenetic analyses. Septoria dioscoreicola and S. eclipticola are newly recorded in Korea, whereas previous Korean records of S. taraxaci on Taraxacum officinale are shown here to represent S. miurae. Multilocus phylogenetic analyses clearly separated S. taraxaci and S. miurae, despite their occurrence on the same host genus and partially overlapping morphological characters.

The confirmation of S. dioscoreicola on Dioscorea polystachya is noteworthy because molecular data for Septoria species associated with Dioscorea remain scarce. Earlier records were based mainly on conidial morphology, which partially overlaps among two species reported from this host genus [34]. The availability of multilocus sequence data for Korean material therefore provides an important reference for future taxonomic and comparative studies of Dioscorea-associated Septoria-like fungi. Given the agricultural and medicinal importance of D. polystachya in East Asia, accurate identification of the causal species is also essential for evaluating potential phytopathological risks.

The record of S. eclipticola from Korea extends the known distribution of this species, which had previously been documented only in Iran. The similarity of sequences across all six loci between Korean and Iranian isolates, including the ex-type, suggests that S. eclipticola is a stable species with a broader distribution than previously recognized. This finding highlights the importance of direct comparison with authenticated reference isolates when documenting newly recorded taxa within a genus that lacks characters on those morphological distinctions, such as Septoria.

The most taxonomically significant result concerns Septoria species associated with Taraxacum officinale. Multilocus phylogenetic analyses clearly separated S. taraxaci and S. miurae as two independent species despite their occurrence on the same host genus and partially overlapping morphological characters. The consistent clustering of Korean and Japanese isolates confirms that S. miurae represents an East Asian lineage distinct from the European species S. taraxaci. These findings demonstrate that host association alone does not provide sufficient resolution for species delimitation within Septoria.

Nomenclatural clarification further supports recognition of S. miurae as the correct name for the East Asian taxon associated with Taraxacum. S. taraxaci Hollós (1907) remains the earliest legitimate name for a Septoria species on Taraxacum in European countries, whereas two later homonyms, Septoria taraxaci Syd. & P. Syd. (1913) from Japan and Septoria taraxaci J.W. Ellis from the UK (1914), are illegitimate under ICN Art. 53.1. S. taraxacicola Miura (1928) had been recognized as a validly published name for a new species from Manchuria, mainland China. However, judging from his notes in the protologue, S. taraxacicola is an avowed substitute name (ICN Art. 6.11) of S. taraxaci Syd. & P. Syd. described based on the specimens, which he collected from Aomori, Japan [15]. That is, he proposed “a new species” cited with S. taraxaci Syd. & P. Syd. as a synonym, although he would propose “a new name”. In addition, the type locality of S. taraxaci Syd. & P. Syd. in the protologue and specimens’ records in the herbarium S (https://herbarium.nrm.se/specimens/F63127) is Sapporo, Hokkaido Island, not Aomori, Honshu Island. This may be his mistake. S. miurae Trotter (1931) was proposed as a new name (avowed substitute) based on the type of S. taraxaci Syd. & P. Syd. collected by Miura and cited S. taraxaci Syd. & P. Syd. as the replaced synonym. Therefore, as a legitimate name, S. miurae is applicable to the East Asian lineage confirmed in this study.

The present study refines the taxonomic circumscription of three Septoria species occurring in Korea, including the re-identification of Korean Taraxacum-associated material previously referred to S. taraxaci as S. miurae, and provides multilocus reference data for taxa that had previously been poorly characterized at the molecular level. These results contribute to a more stable species framework for Septoria in East Asia and provide a foundation for future studies addressing host specificity, geographic distribution, and disease epidemiology of septorioid fungi.

Funding Statement

This study was supported by funding from the Plant Quarantine Technology Center in Animal and Plant Quarantine Agency (PQ20241B012) to YJC, and the Institute for Fermentation, OSAKA (IFO) and KAKENHI 26K08895 to CN.

Disclosure statement

No potential conflict of interest was reported by the author(s).