Skip to main content
Persoonia : Molecular Phylogeny and Evolution of Fungi logoLink to Persoonia : Molecular Phylogeny and Evolution of Fungi
. 2014 May 15;33:1–40. doi: 10.3767/003158514X681981

Introducing the Consolidated Species Concept to resolve species in the Teratosphaeriaceae

W Quaedvlieg 1,✉, M Binder 1, JZ Groenewald 1, BA Summerell 2, AJ Carnegie 3, TI Burgess 4, PW Crous 1,5,6
PMCID: PMC4312929  PMID: 25737591

Abstract

The Teratosphaeriaceae represents a recently established family that includes numerous saprobic, extremophilic, human opportunistic, and plant pathogenic fungi. Partial DNA sequence data of the 28S rRNA and RPB2 genes strongly support a separation of the Mycosphaerellaceae from the Teratosphaeriaceae, and also provide support for the Extremaceae and Neodevriesiaceae, two novel families including many extremophilic fungi that occur on a diversity of substrates. In addition, a multi-locus DNA sequence dataset was generated (ITS, LSU, Btub, Act, RPB2, EF-1α and Cal) to distinguish taxa in Mycosphaerella and Teratosphaeria associated with leaf disease of Eucalyptus, leading to the introduction of 23 novel genera, five species and 48 new combinations. Species are distinguished based on a polyphasic approach, combining morphological, ecological and phylogenetic species concepts, named here as the Consolidated Species Concept (CSC). From the DNA sequence data generated, we show that each one of the five coding genes tested, reliably identify most of the species present in this dataset (except species of Pseudocercospora). The ITS gene serves as a primary barcode locus as it is easily generated and has the most extensive dataset available, while either Btub, EF-1α or RPB2 provide a useful secondary barcode locus.

Keywords: Eucalyptus, multi-locus, phylogeny, species concepts, taxonomy

INTRODUCTION

The current generic and family concepts of the Mycosphaerellaceae and the Teratosphaeriaceae (Capnodiales, Dothideomycetes) can be indirectly attributed to Crous (1998), who used morphological characteristics of cultures and asexual morphs to show that Mycosphaerella was polyphyletic. Crous (1998) suggested that the genus warranted subdivision into natural groups, defined by their asexual morphs. In contrast to these findings, the first phylogenetic trees published for Mycosphaerella (based on ITS nrDNA sequence data), showed it was monophyletic (Crous et al. 1999, 2000, 2001, Stewart et al. 1999, Goodwin et al. 2001). As more sequence data became available (especially of loci such as 28S nrDNA), this view gradually changed and Mycosphaerella is now recognised as polyphyletic (Braun et al. 2003, Schubert et al. 2007, Crous et al. 2007b, 2009b, Batzer et al. 2008, Dugan et al. 2008, Bensch et al. 2012). Although Mycosphaerella s.l. represents a complex (of genera and species) with more than 10 000 species names (Crous et al. 2000, 2001, 2004b, c, 2006, 2007a, 2009c, Crous & Braun 2003), several phylogenetic lineages remain poorly resolved due to limited sampling (Hunter et al. 2006, Crous et al. 2007a, 2009a,2009b,2009c,2009d, Quaedvlieg et al. 2011, 2012). A previous study by Verkley et al. (2004) showed that Mycosphaerella s.str. was limited to species with Ramularia asexual morphs, and that the remaining Mycosphaerella-like species were better placed in other genera.

The genus Teratosphaeria was separated from Mycosphaerella s.l. based on its ascomatal arrangement and periphysate ostioles (Müller & Oehrens 1982). Teratosphaeria was later placed in its own family, based on ascospores that turn brown and verruculose while still in their asci, the presence of pseudoparenchymatal remnants in ascomata, ascospores with mucoid sheaths, distinct asexual morphs and DNA phylogenetic data (Crous et al. 2007a). By 2012, 22 asexual extremophilic and plant pathogenic genera have been linked to the Teratosphaeriaceae, while 38 asexual genera were included in the Mycosphaerellaceae (Hyde et al. 2013). Another 11 genera have subsequently been added to the Mycosphaerellaceae (Crous et al. 2013, Quaedvlieg et al. 2013). Recent phylogenetic studies into extremophilic fungi collected by Friedman (1982) and Selbmann (2005, 2008) have shown that several genera of slow-growing melanised rock-inhabiting (extremophilic) fungi, isolated from harsh climatic conditions (e.g. the South Pole and high mountain peaks) either belong to the Teratosphaeriaceae and/or to a closely associated, unclassified, family referred to as either Teratosphaeriaceae ‘1’ or ‘2’ in Ruibal et al. (2009, 2011) and Egidi et al. (2014).

The original concept of Mycosphaerella has shifted as it became evident that the mycosphaerella-like morphology has evolved multiple times with taxa clustering in disparate families such as the Schizothyriaceae (Batzer et al. 2008), Cladosporiaceae (Schubert et al. 2007, Dugan et al. 2008, Bensch et al. 2010, 2012), Dissoconiaceae, Mycosphaerellaceae and Teratosphaeriaceae (Crous et al. 2009b, Li et al. 2012).

Numerous species are associated with Mycosphaerella leaf disease (MLD) and Teratosphaeria leaf disease (TLD) of Eucalyptus and the closely related genus Corymbia. The genus Eucalyptus (Myrtaceae) is primarily native to Australia and contains more than 700 species. Some species have exceptionally fast growth rates and relatively short rotation periods, making them ideally suited for hardwood timber, firewood, charcoal, essential oils and pulp production (Grattapaglia et al. 2012). For commercial purposes, Eucalyptus spp. have been introduced and cultivated in many other tropical, sub-tropical and temperate countries, where these species often prosper and even dominate a range of habitats, from heathlands to forests (Crous 1998, Turnbull 2000, Wingfield et al. 2001, Boland et al. 2006). Although Eucalyptus spp. exhibit many properties favourable for commercial forestry production, exotic plantations often suffer severe damage caused by the large numbers of native (host-shift) and introduced pathogens that may cause serious and epidemic diseases, often simultaneously on roots, stems or leaves (Park et al. 2000, Old et al. 2003, Slippers et al. 2005, Hunter et al. 2011). A good example of host shifting is the stem canker pathogen Teratosphaeria zuluensis, which most likely jumped from a native tree to introduced clones of E. grandis in South Africa and to E. camaldulensis in Ethiopia, where it is now a major pathogen (Wingfield et al. 1996, Gezahgne et al. 2003, Cortinas et al. 2010). Host jumping by fungal pathogens is relatively common and several other examples can be found among fungal species associated with MLD and TLD of eucalypts (Crous & Groenewald 2005, Burgess et al. 2007, Crous et al. 2007a, Arzanlou et al. 2008, Hunter et al. 2011, Pérez et al. 2013).

In total, more than 146 species in the Mycosphaerellaceae and Teratosphaeriaceae cultivated from leaf spots of eucalypts are included in this study. Species of this complex are assemblages of cryptic taxa that can co-inhabit the same lesions, making reliable species identification difficult (Crous 1998, Barnes et al. 2004, Crous et al. 2004b, c, Groenewald et al. 2005, Cheewangkoon et al. 2008, Stukenbrock et al. 2012). Species identification has been hampered by conserved sexual morphologies throughout the Mycosphaerellaceae and the Teratosphaeriaceae, turning the taxonomic and systematic focus mostly to asexual morphology (Crous et al. 2000, 2006, Verkley et al. 2013). However, similar asexual morphologies have also independently evolved in different taxa, further complicating the taxonomy of these pathogens (Crous et al. 2007a).

The introduction of routine DNA sequencing technology during the last decade has made it possible to mostly identify and classify these phytopathogens, although species boundary ambiguities still exist between phylogenetically closely related taxa. Several previous studies have used molecular sequencing techniques to analyse the diversity of MLD and TLD pathogens on Eucalyptus spp. However, these studies generally included a limited and frequently non-overlapping dataset of species and DNA loci (with ITS being used predominantly for species identification) (for example, Crous et al. 2006, Hunter et al. 2006).

We analyse 329 isolates representing 146 species of MLD- and TLD-associated fungi, using seven loci that have individually or in combination been used in the past to successfully identify species belonging to the Mycosphaerellaceae or Teratosphaeriaceae. These loci include partial sequences of the β-tubulin gene (Btub), the internal transcribed spacer regions and intervening 5.8S rDNA (ITS), actin (Act), translation elongation factor 1-alpha (EF-1α), 28S nrDNA (LSU), calmodulin (Cal) and RNA polymerase II second largest subunit gene (RPB2) (Crous et al. 2004c, Hunter et al. 2006, Quaedvlieg et al. 2011). An additional 172 isolates representing 125 species (mostly extremophiles linked to the Teratosphaeriaceae by Ruibal et al. (2009, 2011) and Egidi et al. (2014) were also investigated based on two loci, LSU and RPB2.

The primary goal of this study is to 1) resolve the main lineages in Teratosphaeriaceae into phylogenetic and morphological units, which can be assigned to single generic names using existing and newly generated LSU and RPB2 sequence data in combination with the LSU/RPB2 data of Teratosphaeriaceae associated extremophilic isolates generated by Ruibal et al. (2009, 2011) and Egidi et al. (2014). Secondary goals of this study are to 2) create a multi-locus DNA sequence dataset in order to rigorously distinguish the selected MLD- and TLD-associated fungal species; and 3) determine which loci provide the most reliable identification based on PCR efficiency and the size of the Kimura-2-parameter barcode gaps. Comparing the obtained results with existing literature, this study 4) describes novel species isolated from MLD and TLD symptoms; and 5) considers species boundaries of phylogenetically closely related taxa.

MATERIALS AND METHODS

Isolates

Isolates used for this study (Table 1) were obtained from the CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands (CBS), or from the working collection of Pedro Crous (CPC), housed at CBS. Fresh collections were made from leaves of diverse hosts by placing material in damp chambers for 1–2 d. Single conidial colonies were grown from sporulating conidiomata on Petri dishes containing 2 % malt extract agar (MEA) as described earlier by Crous et al. (1991). Leaf and stem tissue bearing ascomata were soaked in water for ± 2 h, after which they were placed in the bottom of Petri dish lids, with the top half of the dish containing MEA. Ascospore germination patterns were determined after 24 h, and single ascospore and conidial cultures were established according to Crous (1998). Colonies were sub-cultured onto potato-dextrose agar (PDA), oatmeal agar (OA) (see Crous et al. 2009e), MEA, and pine needle agar (PNA) (Smith et al. 1996), and incubated at 25 °C to promote sporulation.

Table 1.

Collection details and GenBank accession numbers of isolates included in this study.

Species Isolate no.1, 2 Host Location Collector GenBank accession no.3
LSU Act Cal ITS RPB2 EF-1α Btub
Acidiella bohemica CBS 132720 Highly acidic soil Czech Republic M. Hujslová KF901984 – – – KF902178 – –
CBS 132721ET Highly acidic soil Czech Republic M. Hujslová KF901985 – – – KF902179 – –
Amycosphaerella africana CBS 110500ET of Mycosphaerella aurantia Eucalyptus globulus Australia: Western Australia A. Maxwell KF901837 KF903395 KF902554 KF901516 KF902223 KF903115 KF902818
CBS 110843 = CPC 850ET of Mycosphaerella ellipsoidea Eucalyptus cladocalyx South Africa P.W. Crous KF902049 KF903407 KF902557 KF901702 KF902226 KF903118 KF902821
CBS 116154 = CPC 794ET of Mycosphaerella africana Eucalyptus viminalis South Africa P.W. Crous KF902047 KF903480 KF902555 KF901700 KF902224 KF903116 KF902819
CBS 680.95 = CPC 796ET of Mycosphaerella africana Eucalyptus viminalis South Africa P.W. Crous KF902048 KF903589 KF902556 KF901701 KF902225 KF903117 KF902820
Apenidiella strumelloidea CBS 114484ET Carex sp. Russia S. Ozerskaya KF937229 – – – KF937266 – –
Aulographina pinorum CBS 655.86 Pinus montana Switzerland E. Müller KF902102 – – – KF902180 – –
Austroafricana associata CBS 112224 = CPC 3116 Protea lepidocarpodendron Australia: New South Wales P.W. Crous & B. Summerell KF901827 – – KF901510 KF902183 KF903090 KF902793
CBS 120730 = CPC 13119ET Corymbia henryii Australia: New South Wales A.J. Carnegie KF901824 KF903526 KF902528 KF901507 KF902177 KF903087 KF902790
CBS 120731 = CPC 13128 Corymbia variegata Australia: New South Wales A.J. Carnegie KF901828 KF903527 KF902531 KF901511 KF902184 KF903091 –
CBS 120732 = CPC 13108 Eucalyptus dunnii Australia: New South Wales A.J. Carnegie KF901829 – KF902532 KF901512 KF902185 KF903092 KF902794
CPC 13113 Eucalyptus dunnii Australia: New South Wales A.J. Carnegie KF901825 – KF902529 KF901508 KF902181 KF903088 KF902791
CPC 13375 Eucalyptus tereticornis Australia: New South Wales B. Summerell KF901826 – KF902530 KF901509 KF902182 KF903089 KF902792
A. keanei CBS 130524ET Eucalyptus globulus × camaldulensis Australia: Queensland A.J. Carnegie KF901830 – – – KF902187 – –
A. parva CBS 110503 = CMW 14459 Eucalyptus globulus Australia: Western Australia A. Maxwell KF901831 KF903398 KF902534 KF901513 KF902189 KF903094 KF902797
CBS 114761 = CPC 1217 Protea repens South Africa P.W. Crous KF902087 – KF902536 KF901740 KF902191 KF903096 KF902799
CBS 116289 = CPC 10935 Eucalyptus sp. South Africa P.W. Crous KF902025 KF903481 KF902535 KF901680 KF902190 KF903095 KF902798
CBS 119901 = CMW 10189 Eucalyptus globulus Ethiopia A. Gezahgne KF901986 KF903512 KF902537 KF901647 KF902192 KF903097 KF902800
CBS 122892 = CPC 12421EET Eucalyptus globulus Australia: Victoria I. Smith KF901832 KF903539 KF902538 KF901514 KF902193 KF903098 KF902801
CBS 122893 = CPC 14898 Protea repens South Africa L. Mostert KF902088 – KF902539 KF901741 KF902194 KF903099 KF902802
CPC 12249 Eucalyptus globulus Portugal A.J.L. Phillips KF902104 KF903612 KF902533 KF901750 KF902188 KF903093 KF902796
Austroafricana sp. CBS 113059 = CPC 4313 Eucalyptus sp. Chile P.W. Crous KF901813 KF903460 KF902527 KF901498 KF902186 KF903086 KF902795
Batcheloromyces alistairii CBS 120035 = CPC 12730ET Protea repens South Africa P.W. Crous & A. Smith KF937220 – – – KF937252 – –
B. leucadendri CBS 111577 = CPC 1838EET Leucadendron laureolum South Africa L. Swart KF937221 – – – KF937253 – –
B. proteae CBS 110696 = CPC 1518 = CPC 18701 Protea cynaroides South Africa L. Swart KF901833 – – – KF902195 – –
B. sedgefieldii CBS 112119 = CPC 3026ET Protea repens South Africa J.E. Taylor KF937222 – – – KF937254 – –
Camarosporula persooniae CBS 112494 = CPC 3350 Persoonia sp. Australia P.W. Crous & B.A. Summerell JF770460 – – – KF937255 – –
Capnodium coffeae CBS 147.52 Coffea robusta Zaire – KF902173 – – – KF902196 – –
Catenulostroma hermanusense CBS 128768 = CPC 18276ET Phaenocoma prolifera South Africa K.L. Crous & P.W. Crous KF902089 – – – KF902197 – –
Cat. protearum CBS 125421 = CPC 15370EET Leucadendron tinctum South Africa F. Roets KF902090 – – – KF902198 – –
Cercospora ariminensis CBS 137.56 Hedysarum coronarium Italy M. Ribaldi KF902004 – – – KF902199 – –
C. beticola CBS 124.31 = CPC 5070 Beta vulgaris Romania E.W. Schmidt KF902046 – – – KF902200 – –
C. capsici CBS 118712 – Fiji P. Tyler KF251800 – – – KF252302 – –
C. zebrina CBS 118790 Trifolium subterraneum Australia M.J. Barbetti KF251651 – – – KF252305 – –
Cladosporium allicinum CBS 118854 soil of Perilla field South Korea S.B. Hong KJ564335 – – – – – –
Cla. chalastosporoides CBS 125985 = CPC 13864ET Protea arborea South Africa P.W. Crous KJ564332 – – – – – –
Cla. fusiforme CBS 119414ET hypersaline water of Secovlje salterns Slovenia L. Butinar KJ564333 – – – – – –
Cla. herbarum CBS 121621 = CPC 12177ET Hordeum vulgare The Netherlands P.W. Crous KJ564331 – – – – – –
Cla. hillianum CBS 125988 = CPC 15458ET Typha orientalis New Zealand R. Beever KJ564334 – – – – – –
Cla. iridis CBS 138.40 = CPC 15458ET Iris sp. The Netherlands Boterenbrood EU167591 – – – – – –
Constantinomyces macerans TRN440 Rock sample Spain – KF310005 – – – KF310081 – –
Con. nebulosus CBS 117941 = TRN262 Rock sample Spain – KF310014 – – – KF310068 – –
Cystocoleus ebeneus L348 Rock sample Austria Hafellner & Muggia EU048580 – – – – – –
Devriesia acadiensis CBS 115874 = DAOM 232211 Heat-treated soil Canada N. Nickerson EU040226 – – – KF937251 – –
D. agapanthi CBS 132689 = CPC 19833ET Agapanthus africanus South Africa P.W. Crous JX069859 – – – KJ564346 – –
D. americana CBS 117726ET Air sample USA F.M. Dugan EU040227 – – – – – –
D. bulbillosae CBS 118285 = TRN81 Rock sample Spain: Mallorca C. Ruibal KF310029 – – – KF310102 – –
D. capensis CBS 130602 = CPC 18299ET Protea sp. South Africa P.W. Crous JN712569 – – JN712501 – – –
CPC 13981 Protea repens Portugal M.F. Moura JN712568 – – EU707887 – – –
D. compacta CBS 118294 = TRN111ET Rock sample Spain C. Ruibal GU323967 – – – KF310095 – –
D. knoxdaviesii CBS 122898 = CPC 14960ET Protea sp. South Africa P.W. & M. Crous EU707865 – – EU707865 – – –
CPC 14905 Protea sp. South Africa P.W. & M. Crous KJ564328 – – EU707866 – – –
D. lagerstroemiae CBS 125422 = CPC 14403ET Lagerstroemia indica USA: Louisiana P.W. Crous & M.J. Wingfield KF902149 – – – KF902233 – –
D. modesta CBS 137182 = CCFEE 5672ET Rock sample Italy – KF310026 – – – KF310093 – –
D. queenslandica CBS 129527 = CPC 17306ET Scaevola taccada Australia: Queensland P.W. Crous, R.G. Shivas & A.R. McTaggart KF901839 – – – KF902234 – –
D. shakazului CBS 133579 = CPC 19784ET Aloe sp. South Africa P.W. Crous KC005797 – – – KJ564347 – –
D. shelburniensis CBS 115876 = DAOM 232217 Heat-treated soil Canada N. Nickerson EU040228 – – – KF937256 – –
D. simplex CBS 137183 = CCFEE 5681ET Rock sample Italy – KF310027 – – – KF310104 – –
Devriesia sp. CPC 11876 Avicermia sp. South Africa W. Gams GQ852622 – – – KJ564341 – –
D. staurophora CBS 375.81 = ATCC 200934 = CPC 3687 Soil sample Colombia H. Valencia KF901963 – – – KF902201 – –
CBS 117873 = CPC 11198 Amelanchier lamarckii The Netherlands G. Verkley KF937223 – – – KF937257 – –
D. stirlingiae CBS 133581 = CPC 19948ET Stirlingia latifolia Australia W. Gams KC005799 – – – – – –
D. strelitziae CBS 122379 = X1037ET Strelitzia nicolai South Africa W. Gams & H. Glen GU301810 – – EU436763 GU371738 GU349049 –
D. strelitziicola CBS 122480ET Strelitzia sp. South Africa W. Gams & H. Glen GU214417 – – – – – –
D. thermodurans CBS 115878 = DAOM 225330ET Heat-treated soil Canada N. Nickerson EU040229 – – – KF937258 – –
CBS 115879 = DAOM 226677 Heat-treated soil Canada N. Nickerson KF937224 – – – KF937259 – –
Dothistroma pini CBS 116483 Pinus nigra USA G. Adams JX901825 – – – JX901949 – –
Doth. septosporum CBS 383.74 Pinus coulteri France M. Morelet KF251807 – – – KF252308 – –
Elasticomyces elasticus CBS 122538 = CCFEE 5313ET Lichen thallus (Usnea antarctica) Antarctica L. Zucconi KJ380894 – – FJ415474 – – –
CCFEE 5474 Rock sample Antarctica – KF309991 – – – KF310046 – –
CCFEE 5490 Rock sample Antarctica – KF309992 – – – KF310047 – –
CCFEE 5505 Rock sample Argentina – KF309996 – – – – – –
CCFEE 5506 Rock sample Argentina – KF309997 – – – KF310048 – –
CCFEE 5525 Rock sample Antarctica – KF309998 – – – KF310049 – –
CCFEE 5526 Rock sample Antarctica – KF309999 – – – KF310050 – –
CCFEE 5543 Rock sample India – KF309993 – – – KF310051 – –
CCFEE 5547 Rock sample Antarctica – KF310012 – – – KF310052 – –
Eupenidiella venezuelensis CBS 106.75ET Man, Tinea nigra Venezuela D. Borelli KF902163 KF903393 KF902540 KF901802 KF902202 KF903100 KF902803
Euteratosphaeria verrucosiafricana CBS 118496 = CPC 11167ET Eucalyptus sp. Indonesia M.J. Wingfield – – – DQ303056 – – –
CBS 118497 = CPC 11169 Eucalyptus sp. Indonesia M.J. Wingfield KF901992 KF903496 KF902541 KF901653 KF902204 KF903102 KF902804
CBS 118498 = CPC 11170 Eucalyptus sp. Indonesia M.J. Wingfield KF901993 KF903497 KF902542 KF901654 KF902205 KF903103 KF902805
Extremus adstrictus CBS 118292 = TRN96ET Rock sample Spain C. Ruibal KF310022 – – – KF310103 – –
Ex. antarcticus CCFEE 5312 Rock sample Antarctica – KF310020 – – – KF310086 – –
CBS 136103 = CCFEE 451ET Rock sample Antarctica – GU250360 – – – KF310085 – –
CBS 136104 = CCFEE 5207 Rock sample Antarctica – KF310021 – – – KF310087 – –
Extremus sp. CCFEE 5551 – – – KC315879 – – – – – –
Extremus sp. CBS 118300 = TRN137 Rock sample Spain C. Ruibal GU323973 – – – KF310098 – –
Extremus sp. CBS 119436 = CCFEE 5177 Rock sample Antarctica S. Onofri KJ564326 – – – – – –
Friedmanniomyces endolithicus CCFEE 5199 Rock sample Antarctica – KF310007 – – – KF310093 – –
CCFEE 5283 Rock sample Antarctica – KF310006 – – – KF310053 – –
CCFEE 5328 Rock sample Antarctica – JN885563 – – – KF310055 – –
Hortaea thailandica CBS 125423 = CPC 16651ET Syzygium siamense Thailand P.W. Crous & K.D. Hyde KF902125 – – – KF902206 – –
Lapidomyces hispanicus CBS 118764 = TRN126 Rock sample Spain – KF310016 – – – KF310076 – –
Lecanosticta brevispora CBS 133601 = CPC 18092ET Pinus sp. Mexico M. de Jesús Yáñez-Morales KF902021 – – – KF902207 – –
CPC 18092 Pinus sp. Mexico M. de Jesús Yáñez-Morales JX901855 – – – JX901979 – –
L. longispora CBS 133602 = CPC 17940EET Pinus sp. Mexico M. de Jesús Yáñez-Morales & C. Méndez-Inocencio KF902022 – – – KF902208 – –
CPC 17940 Pinus sp. Mexico M. de Jesús Yáñez-Morales & C. Méndez-Inocencio JX901857 – – – JX901981 – –
CPC 17941 Pinus sp. Mexico M. de Jesús Yáñez-Morales & C. Méndez-Inocencio JX901858 – – – JX901982 – –
Melanodothis caricis CBS 860.72ET – – – GU214431 – – – – – –
Meristemomyces frigidum CCFEE 5457 Rock sample Italy – GU250389 – – – KF310063 – –
CCFEE 5507 Rock sample Argentina – KF310013 – – – KF310066 – –
CCFEE 5508 Rock sample Argentina – GU250401 – – – KF310067 – –
Microxyphium citri CBS 451.66 Citrus sinensis Spain H.A. van der Aa KF902094 – – – KF902209 – –
Monticola elongata CCFEE 5394 Rock sample Italy – KF309995 – – – KF310062 – –
CCFEE 5492 Rock sample Italy – KF309994 – – – – – –
CCFEE 5499 Rock sample Italy – GU250398 – – – KF310065 – –
Mucomycosphaerella eurypotamii JK 5586J Juncus roemerianus USA: North Carolina B. & J. Kohlmeyer GU301852 – – – GU371722 – –
Mycosphaerella irregulari CBS 123242 = CPC 15408 = TH003ET Eucalyptus globulus Thailand R. Cheewangkoon KF902126 KF903542 KF902543 KF901769 KF902213 KF903107 KF902809
My. laricis-leptolepidis MAFF 410632 Larix leptolepis Japan T. Yokota JX901863 – – – JX901987 – –
MAFF 410081 Larix leptolepis Japan K. Ito JX901862 – – – JX901986 – –
My. madeirae CBS 112301 = CPC 3747ET Eucalyptus globulus Portugal: Madeira S. Denman KF902033 KF903453 KF902544 KF901688 – KF903108 –
CBS 112895 = CPC 3745 = CMW 14458ET Eucalyptus globulus Portugal: Madeira S. Denman KF902017 – KF902545 KF901675 KF902214 KF903109 –
My. nootherensis CBS 130522ET Corymbia intermedia Australia A.J. Carnegie KF901835 – – – KF902216 – –
My. pseudomarksii CBS 123241 = CPC 15410 = TH126ET Eucalyptus sp. Thailand R. Cheewangkoon KF902127 KF903541 KF902547 KF901770 KF902217 KF903111 KF902811
My. pseudovespa CBS 121159 = DAR 77432ET Eucalyptus biturbinata Australia A.J. Carnegie KF901836 KF903535 KF902548 – KF902218 KF903112 KF902812
My. quasiparkii CBS 123243 = CPC 15409ET Eucalyptus sp. Thailand P. Suwannawong KF902128 KF903543 KF902549 KF901771 KF902219 KF903113 KF902813
My. sumatrensis CBS 118499 = CPC 11171ET Eucalyptus sp. Indonesia M.J. Wingfield KF901994 KF903498 KF902550 KF901655 KF902220 – KF902814
CBS 118501= CPC 11175 Eucalyptus sp. Indonesia M.J. Wingfield KF901995 KF903499 KF902551 KF901656 KF902221 – KF902815
CBS 118502= CPC 11178 Eucalyptus sp. Indonesia M.J. Wingfield KF901996 KF903500 KF902552 KF901657 KF902222 – KF902816
My. vietnamensis CBS 119974 = CMW 23441 = MUCC 66ET Eucalyptus grandis hybrid Vietnam T.I. Burgess KF902171 KF903514 KF902553 KF901809 – KF903114 KF902817
Myrtapenidiella corymbia CBS 124769 = CPC 14640ET Corymbia foelscheana Australia: Northern Territory B.A. Summerell KF901838 KF903558 KF902558 KF901517 KF902227 KF903119 KF902822
CPC 14641 Corymbia foelscheana Australia: Northern Territory B.A. Summerell KF937225 – – – KF937261 – –
Myr. eucalypti CBS 123245 = CPC 15449 Eucalyptus camaldulensis Thailand R. Cheewangkoon KF902129 – – – KF902228 – –
CBS 123246 = CPC 15411ET Eucalyptus camaldulensis Thailand P. Suwannawong KF902130 KF903545 KF902559 KF901772 KF902229 KF903120 KF902823
Myr. tenuiramis CBS 124993 = CPC 13692ET Eucalyptus tenuiramis Australia: Tasmania B.A. & P. Summerell GQ852626 – – – KF937262 – –
CPC 13692 Eucalyptus tenuiramis Australia: Tasmania B.A. & P. Summerell KF901997 KF903658 KF902560 KF901658 KF902230 KF903121 KF902824
Neocatenulostroma abietis CBS 110038 Painted outdoor wall Sweden N. Hallenberg KF937226 – – – KF937263 – –
Neoc. germanicum CBS 539.88ET Rock sample Germany J. Kuroczkin KF901989 – – – KF902231 – –
Neoc. microsporum CBS 101951 = CPC 1960ET of sexual morph Protea cynaroides South Africa J.E. Taylor & S. Denman KF901814 – KF902561 KF901499 KF902232 KF903122 KF902825
CBS 110890 = CPC 1832ET of asexual morph Protea cynaroides South Africa J.E. Taylor & S. Denman EU019255 JX500130 – AY260097 – – –
CBS 111031 = CPC 1848 Protea cynaroides South Africa J.E. Taylor & S. Denman KF937227 – – – KF937264 – –
Neodevriesia hilliana CBS 123187 = CPC 15382ET Macrozamia communis New Zealand C.F. Hill GU214414 – – – – – –
Neodevriesia xanthorrhoeae CBS 128219 = CPC 17720ET Xanthorrhoea australis Australia P.W. Crous, I. Pascoe & J. Edwards HQ599606 – – – – – –
Neodevriesia sp. CBS 118302 = TRN142 Rock sample Spain: Mallorca C. Ruibal GU323975 – – – KF310100 – –
Neodevriesiaceae sp. CPC 19594 mycoparasite of Myriangium sp. Brazil H.C. Evans KJ564327 – – – KJ564349 – –
Neohortaea acidophila CBS 113389ET Lignite rock Germany U. Hölker GU323202 – – GU214636 GU357768 – –
Neopenidiella nectandrae CBS 734.87ET Nectandra coriacea Cuba R.F. Castañeda & G. Arnold KF901982 – – – KF902235 – –
Neophaeothecoidea proteae CBS 114129 = CPC 2831ET Protea repens South Africa S. Denman KF937228 – – – KF937265 – –
Neotrimmatostroma excentricum CBS 121102 = CPC 13092ET Eucalyptus agglomerata Australia: New South Wales G. Price KF901840 KF903534 KF902562 KF901518 KF902236 KF903123 KF902826
Oleoguttula mirabilis CCFEE 5522 Rock sample Antarctica – KF310019 – – – KF310070 – –
Pallidocercospora acaciigena CBS 112515 = CPC 3837ET Acacia mangium Venezuela M.J. Wingfield KF902166 KF903455 KF902564 KF901805 KF902238 KF903125 KF902828
CBS 112516 = CPC 3838ET Acacia mangium Venezuela M.J. Wingfield KF902105 KF903456 KF902563 KF901751 KF902237 KF903124 KF902827
CBS 115432 = CPC 3836ET Acacia mangium Venezuela M.J. Wingfield KF902165 – – KF901804 KF902211 KF903105 KF902807
CBS 120740 = CPC 13290 Eucalyptus sp. Australia B.A. Summerell KF901834 – – KF901515 KF902212 KF903106 KF902808
CPC 13350 Eucalyptus camaldulensis × Eucalyptus urophylla Venezuela M.J. Wingfield KF902164 – – KF901803 KF902210 KF903104 KF902806
P. colombiensis CBS 110967 = CPC 1104 = CMW 11255ET Eucalyptus urophylla Colombia M.J. Wingfield KF901968 KF903413 KF902611 KF901633 KF902295 KF903178 KF902880
CBS 110968 = CPC 1105ET Eucalyptus urophylla Colombia M.J. Wingfield KF901969 KF903414 KF902612 KF901634 KF902296 KF903179 KF902881
CBS 110969 = CPC 1106 = CMW 4944ET Eucalyptus urophylla Colombia M.J. Wingfield KF901970 KF903415 KF902613 KF901635 KF902297 KF903180 KF902882
P. crystallina CBS 110699 = CPC 2155 Leucospermum sp. USA: Hawaii P.W. Crous & M.E. Palm KF902161 KF903400 KF902566 KF901801 KF902240 KF903127 KF902830
CBS 111044 = CPC 1178 Leaf litter of Eucalyptus grandis × Eucalyptus camaldulensis South Africa M.J. Wingfield KF902050 KF903423 KF902567 KF901703 KF902241 KF903128 KF902831
CBS 111045 = CPC 1179 Leaf litter of Eucalyptus grandis × Eucalyptus camaldulensis South Africa M.J. Wingfield KF902051 KF903424 KF902568 KF901704 KF902242 KF903129 KF902832
CBS 681.95 = CPC 802 = CMW 3033ET Eucalyptus bicostata South Africa M.J. Wingfield KF902052 KF903590 KF902569 KF901705 KF902243 KF903130 KF902833
CPC 11453 Eucalyptus sp. Brazil A.C. Alfenas KF901934 KF903601 KF902565 KF901609 KF902239 KF903126 KF902829
P. heimii CBS 110682 = CPC 760 = CMW 4942ET Eucalyptus sp. Madagascar P.W. Crous KF902013 KF903399 KF902575 KF901671 KF902249 KF903136 KF902839
CPC 10992 Eucalyptus sp. Colombia M.J. Wingfield KF901964 KF903593 KF902570 KF901629 KF902244 KF903131 KF902834
CPC 11441 Eucalyptus sp. Brazil A.C. Alfenas KF901935 KF903600 KF902571 KF901610 KF902245 KF903132 KF902835
CPC 11548 Eucalyptus sp. Brazil A.C. Alfenas KF901936 KF903602 KF902572 KF901611 KF902246 KF903133 KF902836
CPC 11716 – Brazil A.C. Alfenas KF901937 KF903605 KF902573 KF901612 KF902247 KF903134 KF902837
CPC 11926 Acacia auriculiformis Thailand W. Himaman KF902131 KF903607 KF902581 KF901773 KF902257 KF903144 KF902847
CPC 13099 Eucalyptus dunnii Australia A.J. Carnegie KF901841 KF903635 KF902574 KF901519 KF902248 KF903135 KF902838
P. heimioides CBS 111190 = CPC 1312 = CMW 3046ET Eucalyptus sp. Indonesia M.J. Wingfield KF901998 KF903440 KF902576 KF901659 KF902250 KF903137 KF902840
CBS 111364 = CPC 1311 = CMW 14776 Eucalyptus sp. Indonesia M.J. Wingfield KF901815 KF903446 KF902577 KF901500 KF902251 KF903138 KF902841
P. holualoana CBS 110698 = CPC 2126ET Leucospermum sp. USA: Hawaii P.W. Crous & M.E. Palm KJ380896 – – AY260087 KJ380900 – –
P. irregulariramosa CBS 111211 = CPC 1362 = CMW 5223ET Eucalyptus saligna South Africa M.J. Wingfield KF902053 KF903441 KF902578 KF901706 KF902252 KF903139 KF902842
P. konae CBS 111028 = CPC 2125ET Leucadendron cv. ‘Safari Sunset’ USA: Hawaii P.W. Crous & M.E. Palm KF902158 KF903422 – KF901798 KF902253 KF903140 KF902843
CBS 111261 = CPC 2123ET Leucadendron cv. ‘Safari Sunset’ USA: Hawaii P.W. Crous & M.E. Palm KF902159 KF903442 – KF901799 KF902254 KF903141 KF902844
P. thailandica CBS 116367 = CPC 10547ET Acacia mangium Thailand K. Pongpanich KF902134 – – KF901776 KF902337 KF903221 KF902923
CBS 120723 = CPC 13478 Eucalyptus camaldulensis Thailand W. Himaman KF902135 KF903524 KF902648 KF901777 KF902338 KF903222 KF902924
CBS 121389 = X882 = CIRAD 81 Musa sp. Brazil – KF902023 – – KF901679 KF902339 KF903223 KF902925
CBS 121390 = X883 = CIRAD 1165 Musa sp. Cameroon – KF901956 – – KF901624 KF902340 KF903224 KF902926
Paramycosphaerella intermedia CBS 114356 = CPC 10902 = NZFS 301 K/1 Eucalyptus saligna New Zealand L. Renney KF902026 KF903466 KF902579 KF901681 KF902255 KF903142 KF902845
CBS 114415 = CPC 10922 = NZFS 301.13 Eucalyptus saligna New Zealand L. Renney KF902027 KF903468 KF902580 KF901682 KF902256 KF903143 KF902846
Pa. marksii CBS 110693 = CPC 823 Eucalyptus grandis × saligna South Africa G. Kemp DQ204758 – – DQ267597 – – –
CBS 110750 = CPC 822 = CMW 14778 Eucalyptus grandis × saligna South Africa G. Kemp KF902056 KF903404 KF902586 KF901709 KF902262 KF903149 KF902852
CBS 110920 = CPC 935 Eucalyptus globulus Australia: Victoria A.J. Carnegie KF901842 KF903410 KF902582 KF901520 KF902258 KF903145 KF902848
CBS 110963 = CPC 4632 Musa sp. South Africa K. Surridge KF902054 KF903411 KF902583 KF901707 KF902259 KF903146 KF902849
CBS 110964 = CPC 4633 Musa sp. South Africa K. Surridge KF902055 KF903412 KF902584 KF901708 KF902260 KF903147 KF902850
CBS 110981 = CPC 1073 Eucalyptus sp. Tanzania M.J. Wingfield KF902103 KF903417 KF902585 KF901749 KF902261 KF903148 KF902851
Parapenidiella pseudotasmaniensis CBS 124991 = CPC 12400ET Eucalyptus globulus Australia I.W. Smith KF901844 KF903562 KF902589 KF901522 KF902265 KF903152 KF902855
Para. tasmaniensis CBS 111687 = CMW 14780 = CPC 1555ET Eucalyptus nitens Australia: Tasmania M.J. Wingfield KF901843 KF903451 KF902587 KF901521 KF902263 KF903150 KF902853
CBS 114556 = CMW 14663 = CPC 1556ET Eucalyptus nitens Australia: Tasmania M.J. Wingfield KF902132 KF903469 KF902588 KF901774 KF902264 KF903151 KF902854
Parateratosphaeria altensteinii CBS 123539 = CPC 15133ET Encephalartos altensteinii South Africa P.W. Crous, M.K. Crous, M. Crous & K. Raath KF937230 – – – KF937267 – –
Pata. bellula CBS 111700 = CPC 1821EET Protea eximia South Africa J.E. Taylor KF937232 – – – – – –
Pata. karinae CBS 128774 = CPC 18255ET Phaenocoma prolifera South Africa K.L. Crous & P.W. Crous KF902091 – – – KF902266 – –
Pata.cf. bellula CBS 111699 = CPC 1816 Leucospermum sp. South Africa J.E. Taylor KF937231 – – – – – –
Pata. marasasii CBS 122899 = CPC 14889ET Protea sp. South Africa P.W. & M. Crous KF937233 – – – KF937268 – –
Pata. persoonii CBS 122895 = CPC 13972ET Protea sp. South Africa P.W. Crous & L. Mostert KF937234 – – – – – –
CBS 122896 = CPC 14846 = STE-U 6389 Euchaetis meridionalis South Africa A.R. Wood KF937235 – – – – – –
Passalora eucalypti CBS 111318 = CPC 1457ET Eucalyptus saligna Brazil P.W. Crous & A.C. Alfenas KF901938 KF903445 KF902590 KF901613 KF902267 KF903153 KF902856
Pas. intermedia CBS 124154 = CPC 15745 = A39ET Eucalyptus camaldulensis Madagascar M.J. Wingfield KF902014 KF903548 KF902591 KF901672 KF902268 KF903154 KF902857
Pas. leptophlebiae CBS 129524 = CPC 18480ET Eucalyptus leptophlebia Brazil P.W. Crous, A.C. Alfenas, R. Alfenas & O.L. Pereira KF901939 KF903580 – KF901614 KF902269 KF903155 KF902858
Pas. zambiae CBS 112970 = CPC 1228ET Eucalyptus globulus Zambia T. Coutinho KF902175 KF903458 KF902593 KF901811 KF902271 KF903157 –
CBS 112971 = CPC 1227ET Eucalyptus globulus Zambia T. Coutinho KF902174 KF903459 KF902592 KF901810 KF902270 KF903156 KF902859
Penidiella columbiana CBS 486.80ET Paepalanthus columbianus Colombia W. Gams KF901965 KF903587 KF902594 KF901630 KF902272 KF903158 KF902860
Petrophila incerta CBS 118287 = TRN77 Rock sample Spain C. Ruibal GU323963 – – – KF310101 – –
CBS 118608 = TRN139bET Rock sample Spain C. Ruibal KF310030 – – – KF310091 – –
Phaeophleospora eugeniae CPC 15143 Eugenia uniflora Brazil A.C. Alfenas KF901940 KF903674 KF902596 KF901615 KF902274 KF903160 KF902862
CPC 15159 Eugenia uniflora Brazil A.C. Alfenas KF902095 KF903675 KF902595 KF901742 KF902273 KF903159 KF902861
Pha. eugeniicola CPC 2557ET Eugenia klotzschiana Brazil A.C. Alfenas KF901845 – – KF901523 KF902275 – –
Pha. gregaria CBS 110501 Eucalyptus globulus Australia A. Maxwell KF901846 KF903396 KF902597 KF901524 KF902276 KF903161 KF902863
CBS 111166 = CPC 1224 Eucalyptus cladocalyx South Africa A.R. Wood KF902057 KF903433 KF902598 KF901710 KF902277 KF903162 KF902864
CBS 111167 = CPC 1225 Eucalyptus cladocalyx South Africa A.R. Wood KF902058 KF903434 KF902599 KF901711 KF902278 KF903163 KF902865
CBS 111519 = CPC 1191 Eucalyptus sp. South Africa P.W. Crous KF902059 KF903448 KF902600 KF901712 KF902279 KF903164 KF902866
CBS 114662 = CPC 1193ET of M. endophytica Eucalyptus sp. South Africa P.W. Crous KF902060 KF903470 KF902601 KF901713 KF902280 KF903165 KF902867
Pha. scytalidii CBS 118493 = CPC 10998ET Eucalyptus urophylla Colombia M.J. Wingfield KF901966 KF903493 KF902603 KF901631 KF902282 KF903167 KF902869
CBS 516.93 = CPC 653 Eucalyptus globulus Brazil F.A. Ferreira KF901941 KF903588 KF902602 KF901616 KF902281 KF903166 KF902868
Pha. stonei CBS 120830 = CPC 13330ET Eucalyptus sp. Australia P.W. Crous & J. Stone KF901847 KF903645 KF902604 KF901525 KF902283 KF903168 KF902870
Pha. stramenti CBS 118909 = CPC 11545ET Leaf litter of Eucalyptus sp. Brazil A.C. Alfenas KF901942 KF903506 KF902605 KF901617 KF902284 KF903169 KF902871
Phaeothecoidea eucalypti CBS 120831 = CPC 12918ET Eucalyptus botryoides Australia: New South Wales B.A. Summerell KF901848 – – KF901526 KF902285 KF903170 KF902872
Phaeo. intermedia CBS 124994 = CPC 13711ET Eucalyptus globulus Australia: Bruny Island B.A. Summerell, P. Summerell & A. Summerell KF902106 KF903564 KF902606 KF901752 KF902286 KF903171 KF902873
CPC 13711 Eucalyptus globulus Australia: Bruny Island B.A. Summerell, P. Summerell & A. Summerell GQ852628 – – – KF937269 – –
Phaeo. minutispora CBS 124995 = CPC 13710ET Eucalyptus globulus Australia: Bruny Island B.A. Summerell, P. Summerell & A. Summerell KF902107 – – – KF902287 – –
CPC 13710 Eucalyptus globulus Australia: Bruny Island B.A. Summerell, P. Summerell & A. Summerell KF902108 KF903659 KF902607 KF901753 KF902288 KF903172 KF902874
Piedraia hortae var. hortae CBS 480.64 Human hair Brazil A.C. Batista KF901943 – – – KF902289 – –
Piedraia hortae var. paraguayensis CBS 276.32 – – – KF901816 – – – – – –
Pie. quintanilhae CBS 327.63ET Genetta tigrina Central African Republic N. van Uden KF901957 – – – – – –
Polychaeton citri CBS 116435 Citrus aurantium Iran R. Zare & W. Gams GU214469 – – – – – –
Polyphialoseptoria tabebuiae-serratifoliae CBS 112650 = CPC 3944ET Tabebuia serratifolia Brazil A.C. Alfenas KF251716 – – – KF252218 – –
Pseudocercospora basiramifera CBS 111072 = CPC 1266ET Eucalyptus pellita Thailand M.J. Wingfield KF902028 KF903428 KF902608 KF901683 KF902291 KF903174 KF902876
CBS 114757 = CPC 1267ET Eucalyptus pellita Thailand M.J. Wingfield KF901817 KF903472 KF902609 KF901501 KF902292 KF903175 KF902877
Ps. basitruncata CBS 114664 = CPC 1202 = CMW 14914 Eucalyptus grandis Colombia M.J. Wingfield KF901967 KF903471 KF902610 KF901632 KF902293 KF903176 KF902878
Ps. chiangmaiensis CBS 123244 = CPC 15412ET Eucalyptus camaldulensis Thailand P. Suwannawong KF902133 KF903544 – KF901775 KF902294 KF903177 KF902879
Ps. crousii CBS 119487 = Lynfield 1260 Eucalyptus sp. New Zealand C.F. Hill KF902029 KF903511 KF902614 KF901684 KF902298 KF903181 KF902883
Ps. eucalyptorum CBS 110722 = CPC 15 Eucalyptus nitens South Africa P.W. Crous KF902061 KF903401 KF902618 KF901714 KF902302 KF903185 KF902887
CBS 110723 = CPC 17 Eucalyptus nitens South Africa P.W. Crous KF902062 KF903402 KF902619 KF901715 KF902303 KF903186 KF902888
CBS 110776 = CPC 12 Eucalyptus nitens South Africa P.W. Crous KF902063 KF903405 KF902620 KF901716 KF902304 KF903187 KF902889
CBS 110777 = CPC 16 = CMW 5228ET of Ps. eucalyptorum Eucalyptus nitens South Africa P.W. Crous KF901944 KF903406 KF902621 KF901618 KF902305 KF903188 KF902890
CBS 110903 = CPC 14 Eucalyptus nitens South Africa P.W. Crous KF902064 KF903408 KF902622 KF901717 KF902306 KF903189 KF902891
CBS 111268 = CPC 1195 Eucalyptus grandis Kenya T. Coutinho KF901818 KF903443 KF902623 KF901502 KF902307 KF903190 KF902892
CBS 114242 = CPC 10390 = CMW 14908ET of Ps. pseudoeucalyptorum Eucalyptus globulus Spain J.P. Mansilla KF902097 – – KF901744 KF902328 KF903212 KF902914
CBS 114866 = CPC 11 Eucalyptus nitens South Africa P.W. Crous KF902067 KF903474 KF902627 KF901720 KF902311 KF903195 KF902897
CBS 116303 = CPC 13 Eucalyptus nitens South Africa P.W. Crous KF902065 KF903482 KF902625 KF901718 KF902308 KF903192 KF902894
CBS 116304 = CPC 10 Eucalyptus nitens South Africa P.W. Crous KF902066 KF903483 KF902626 KF901719 KF902309 KF903193 KF902895
CBS 116359 = CPC 3751 Eucalyptus sp. Spain: Madeira – KF902018 KF903484 – KF901676 KF902310 KF903194 KF902896
CBS 132015 = CPC 11713 Eucalyptus globulus Spain P. Mansilla KF902096 KF903604 KF902615 KF901743 KF902299 KF903182 KF902884
CBS 132029 = CPC 12406 Eucalyptus globulus Australia I.W. Smith KF901849 KF903615 KF902616 KF901527 KF902300 KF903183 KF902885
CBS 132032 = CPC 12802 Eucalyptus globulus Portugal A.J.L. Phillips KF902034 KF903625 KF902634 KF901689 KF902322 KF903206 KF902908
CBS 132033 = CPC 12957 Eucalyptus deanei Australia B.A. Summerell KF901850 KF903630 KF902617 KF901528 KF902301 KF903184 KF902886
CBS 132034 = CPC 13455 Eucalyptus sp. Portugal P.W. Crous KF902035 KF903649 KF902638 KF901690 KJ564342 KF903210 KF902912
CBS 132035 = CPC 13769 Eucalyptus punctata South Africa P.W. Crous KF902071 KF903660 KF902635 KF901724 KF902323 KF903207 KF902909
CBS 132105 = CPC 13926 Eucalyptus sp. USA: California S. Denman KF902141 KF903669 KF902636 KF901783 KF902324 KF903208 KF902910
CBS 132114 = CPC 13816 Eucalyptus glaucescens United Kingdom S. Denman KF902140 KF903661 KF902639 KF901782 KF902327 KF903211 KF902913
CBS 132309 = CPC 12568 Eucalyptus nitens Australia: Tasmania C. Mohammed KF902109 KF903621 KF902637 KF901754 KF902325 KF903209 KF902911
Ps. flavomarginata CBS 118824 = CMW 13594ET Eucalyptus camaldulensis Thailand M.J. Wingfield KF901961 KF903505 – KF901627 KF902312 KF903196 KF902898
Ps. fori CBS 113285 = CMW 9095ET Eucalyptus grandis South Africa G.C. Hunter KF902069 KF903462 KF902629 KF901722 KF902314 KF903198 KF902900
CBS 113286 = CMW 9095 Eucalyptus sp. South Africa J. Roux KF902068 KF903463 KF902628 KF901721 KF902313 KF903197 KF902899
Ps. gracilis CBS 111189 = CPC 1315 Eucalyptus urophylla Indonesia M.J. Wingfield KF902000 KF903439 KF902632 KF901661 KF902317 KF903201 KF902903
CBS 116291 = CPC 10503 Eucalyptus globulus China A. Aptroot KF901960 – KF902624 – – KF903191 KF902893
CPC 11144 Eucalyptus sp. Indonesia M.J. Wingfield KF901971 KF903594 KF902630 KF901636 KF902315 KF903199 KF902901
CPC 11181 Eucalyptus sp. Indonesia M.J. Wingfield KF901999 KF903595 KF902631 KF901660 KF902316 KF903200 KF902902
Ps. madagascariensis CBS 124155 = CPC 14621ET Eucalyptus camaldulensis Madagascar M.J. Wingfield KF902015 KF903549 – KF901673 KF902318 KF903202 KF902904
Ps. marginalis CBS 131582 = CPC 12497ET Fraxinus rhynchophylla South Korea H.D. Shin KF902010 KF903618 KF902641 KF901668 KF902330 KF903214 KF902916
Ps. natalensis CBS 111069 = CPC 1263 = CMW 14777ET Eucalyptus nitens South Africa T. Coutinho KF902070 KF903427 – KF901723 KF902319 KF903203 KF902905
Ps. norchiensis CBS 120738 = CPC 13049ET Eucalyptus sp. Italy W. Gams KF902005 KF903531 KF902633 KF901665 KF902320 KF903204 KF902906
Ps. paraguayensis CBS 111286 = CPC 1459 = CMW 14779 Eucalyptus nitens Brazil P.W. Crous KF901945 KF903444 – KF901619 KF902321 KF903205 KF902907
Ps. pyracanthigena CBS 131589 = CPC 10808ET Pyracantha angustifolia South Korea M.J. Park KF902009 KF903591 – KF901667 KF902290 KF903173 KF902875
Ps. robusta CBS 111175 = CPC 1269 = CMW 5151ET Eucalyptus robur Malaysia M.J. Wingfield KF902020 KF903437 KF902640 KF901678 KF902329 KF903213 KF902915
Ps. schizolobii CBS 120029 = CPC 12962ET Schizolobium parahybum Ecuador M.J. Wingfield KF251826 – – – KF252326 – –
Ps. sphaerulinae CBS 112621 = CPC 4314 Eucalyptus sp. Chile P.W. Crous KF901958 – KF902642 KF901625 KF902331 KF903215 KF902917
Ps. subulata CBS 118489 = CPC 10849 Eucalyptus botryoides New Zealand M. Dick KF902030 KF903492 KF902643 KF901685 KF902332 KF903216 KF902918
Ps. tereticornis CBS 124996 = CPC 12960 Eucalyptus nitens Australia A.J. Carnegie KF901852 KF903565 KF902645 KF901530 KF902334 KF903218 KF902920
CBS 125214 = CPC 13299ET Eucalyptus tereticornis Australia P.W. Crous & B. Summerell KF901854 KF903641 KF902647 KF901532 KF902336 KF903220 KF902922
CPC 13008 Eucalyptus tereticornis Australia A.J. Carnegie KF901853 KF903631 KF902646 KF901531 KF902335 KF903219 KF902921
CPC 13315 Eucalyptus tereticornis Australia P.W. Crous & B. Summerell KF901851 KF903643 KF902644 KF901529 KF902333 KF903217 KF902919
Ps. vitis CBS 132012 = CPC 11595 Vitis vinifera South Korea H.D. Shin KF902011 KF903603 KF902649 KF901669 KF902341 KF903225 KF902927
Pseudoramichloridium brasilianum CBS 283.92ET Forrest soil Brazil D. Atilli EU041854 _ _ _ _ – –
Pso. henryi CBS 124775 = CPC 13121ET Corymbia henryi Australia A.J. Carnegie KF901857 KF903559 KF902652 KF901535 KF902344 KF903227 KF902930
CPC 13122 Corymbia henryi Australia A.J. Carnegie KF901855 KF903639 KF902650 KF901533 KF902342 KF903226 KF902928
Pseudoteratosphaeria flexuosa CBS 110743 = CPC 673 Eucalyptus globulus Colombia M.J. Wingfield KF902098 KF903403 KF902653 KF901745 KF902345 KF903228 KF902931
CBS 111012 = CPC 1109ET Eucalyptus globulus Colombia M.J. Wingfield KF902110 KF903421 KF902654 KF901755 KF902346 – KF902932
CBS 111048 = CPC 1199 Eucalyptus grandis Colombia M.J. Wingfield KF901978 KF903425 KF902723 KF901643 KF902433 KF903309 KF903007
CBS 111163 = CPC 1201 Eucalyptus grandis Colombia M.J. Wingfield KF901979 KF903430 KF902724 KF901644 KF902434 KF903310 KF903008
Pet. gamsii CBS 118495 = CPC 11138ET Eucalyptus sp. India W. Gams & M. Arzanlou KF901990 KF903494 KF902655 KF901650 KF902347 KF903229 KF902933
Pet. ohnowa CBS 112896 = CPC 1004ET Eucalyptus grandis South Africa M.J. Wingfield KF901946 KF903457 KF902656 KF901620 KF902348 KF903230 KF902934
CBS 112973 = CPC 1005 Eucalyptus grandis South Africa M.J. Wingfield GU214511 – – AF173299 – – –
CBS 110949 = CPC 1006 Eucalyptus grandis South Africa M.J. Wingfield – – – AY725575 – – –
CBS 113290 = CMW 9102 Eucalyptus smithii South Africa G.C. Hunter KF937236 – – – KF937270 – –
Pet. perpendicularis CBS 118367 = CPC 10983ET Eucalyptus eurograndis Colombia M.J. Wingfield KF901972 KF903491 – KF901637 KF902350 KF903232 KF902936
Pet. secundaria CBS 111002 = CPC 1112 Eucalyptus grandis Colombia M.J. Wingfield KF901858 KF903420 KF902659 KF901536 KF902352 KF903234 KF902938
CBS 115608 = CPC 504 Eucalyptus grandis Brazil A.C. Alfenas KF901859 KF903476 KF902660 KF901537 KF902353 KF903235 KF902939
CBS 118507 = CPC 11551ET Eucalyptus sp. Brazil A.C. Alfenas KF901947 KF903503 KF902661 KF901621 KF902354 KF903236 KF902940
CPC 10989 Eucalyptus sp. Colombia M.J. Wingfield KF901973 KF903592 KF902658 KF901638 KF902351 KF903233 KF902937
Pet. stramenticola CBS 118506 = CPC 11438ET Eucalyptus sp. leaf litter Brazil A.C. Alfenas KF901948 KF903502 KF902662 KF901622 KF902355 KF903237 KF902941
CBS 120737 = CPC 13373ET Eucalyptus urophylla Venezuela M.J. Wingfield KF902167 KF903530 KF902657 KF901806 KF902349 KF903231 KF902935
Queenslandipenidiella kurandae CBS 121715 = CPC 13333ET Exudates of bleeding stem cankers of unidentified trees Australia: Queensland P.W. Crous & J.K. Stone KF901860 KF903538 KF902663 KF901538 KF902356 KF903238 KF902942
Ramichloridium apiculatum CBS 400.76 Soil sample Pakistan A. Kamal EU041851 – – – KJ564337 – –
Ramularia endophylla CBS 113265EET Dead leaf of Quercus robur Netherlands G. Verkley KF902072 KF903461 KF902665 KF901725 KF902358 KF903240 KF902944
Ram. eucalypti CBS 120726 = CPC 13043ET Eucalyptus grandiflora Italy W. Gams KF902006 KF903525 – KF901666 KF902359 KF903241 KF902945
Ram. pratensis var. pratensis CPC 11294 Rumex crispus South Korea H.D. Shin KF902111 KF903599 – KF901756 KF902360 KF903242 KF902946
Ramulispora sorghi CBS 110579 = CPC 906 Sorghum bicolor South Africa D. Nowell GQ852654 – – – KF937271 – –
Readeriella angustia CBS 124997 = CPC 13608ET Eucalyptus delegatensis Australia: Tasmania B.A. Summerell KF902114 KF903566 KF902669 KF901759 KF902364 KF903246 KF902950
CBS 124998 = CPC 13618 Eucalyptus delegatensis Australia: Tasmania B.A. Summerell KF902113 KF903567 KF902668 KF901758 KF902363 KF903245 KF902949
CPC 13621 Eucalyptus regnans Australia: Tasmania B.A. Summerell, P. Summerell & A. Summerell KF902112 KF903654 KF902666 KF901757 KF902361 KF903243 KF902947
CPC 13630 Eucalyptus delegatensis Australia: Tasmania B.A. Summerell KF901819 KF903655 KF902667 KF901503 KF902362 KF903244 KF902948
Read. callista CBS 124986 = CPC 13615EET Eucalyptus sclerophylla Australia: New South Wales B.A. Summerell KF442562 – – – KF442602 – –
CPC 12841 Eucalyptus cannonii Australia: New South Wales B.A. Summerell KF901862 KF903627 KF902670 KF901540 KF902365 KF903247 KF902951
CPC 13605 Eucalyptus multicaulis Australia: New South Wales B.A. Summerell KF901863 KF903652 KF902671 KF901541 KF902366 KF903248 KF902952
CPC 13615 Eucalyptus sclerophylla Australia: New South Wales B.A. Summerell KF901974 KF903653 KF902672 KF901639 KF902367 KF903249 KF902953
Read. deanei CBS 134746 = CPC 12715ET Eucalyptus deanei Australia: New South Wales B.A. Summerell KF901864 KF903583 KF902673 KF901542 KF902368 KF903250 KF902954
Read. dendritica CBS 120032 = CPC 12709ET Eucalyptus deanei Australia: New South Wales B.A. Summerell KF901865 KF903623 KF902674 KF901543 KF902369 KF903251 KF902955
Read. dimorphospora CBS 120034 = CPC 12636ET Eucalyptus nitens Australia: Tasmania C. Mohammed KF901866 KF903622 KF902675 KF901544 KF902370 KF903252 KF902956
Read. eucalypti CBS 120079 = CPC 11184EET Eucalyptus globulus Spain M.J. Wingfield KJ380898 – – – KJ380903 – –
CPC 13401 Eucalyptus miniata Australia B.A. Summerell KF901867 KF903647 – KF901545 KF902371 KF903253 –
Read. eucalyptigena CBS 124999 = CPC 13026ET Eucalyptus dives Australia: New South Wales B.A. Summerell KF901868 KF903568 KF902676 KF901546 KF902372 KF903254 KF902957
Read. limoniforma CBS 134745 = CPC 12727ET Eucalyptus sp. Australia: New South Wales B.A. Summerell KF901869 KF903582 KF902677 KF901547 KF902373 KF903255 KF902958
Read. menaiensis CBS 125003 = CPC 14447ET Eucalyptus oblonga Australia: New South Wales B.A. Summerell KF901870 KF903572 KF902678 KF901548 KF902374 KF903256 KF902959
Read. mirabiliaffinis CBS 134744 = CPC 13611ET Eucalyptus delegatensis Australia: Tasmania P. & B.A. Summerell KF902115 – KF902679 KF901760 KF902375 – –
Read. mirabilis CBS 125000 = CPC 12370EET Eucalyptus globulus Australia: Victoria I.W. Smith KF901871 KF903569 KF902680 KF901549 KF902376 KF903257 KF902960
Read. nontingens CPC 14444 Eucalyptus oblonga Australia B.A. Summerell KF902073 KF903671 KF902682 KF901726 KF902378 KF903259 KF902962
Read. novaezelandiae CBS 114357 = CPC 10895ET Eucalyptus botryoides New Zealand M.A. Dick KF901820 KF903467 KF902683 KF901504 KF902379 KF903260 KF902963
Read. patrickii CBS 124987 = CPC 13602ET Eucalyptus amygdalina Australia: Tasmania P. & B.A. Summerell KF902001 KF903651 KF902684 KF901662 KF902380 KF903261 KF902964
Read. pseudocallista CBS 125001 = CPC 13599ET Eucalyptus prominula Australia B.A. Summerell KF901861 KF903570 KF902664 KF901539 KF902357 KF903239 KF902943
Read. readeriellophora CBS 114240 = CPC 10375ET Eucalyptus globulus Spain J.P. Mansilla KJ380899 – – AY725577 KJ380904 – –
CBS 120209 = CPC 12920 Eucalyptus sp. Australia A.J. Carnegie KF901873 KF903628 KF902685 KF901551 KF902381 KF903262 KF902965
Readeriella sp. CPC 12379 Eucalyptus sp. Australia R. Park KF901872 KF903614 KF902681 KF901550 KF902377 KF903258 KF902961
Readeriella sp. CBS 120733 = CPC 12820 Eucalyptus nitens Australia: New South Wales A.J. Carnegie KJ380897 – – – KJ380902 – –
Read. tasmanica CBS 125002 Eucalyptus delegatensis Australia: Tasmania B.A. Summerell KF902116 KF903571 KF902687 KF901761 KF902383 KF903264 KF902967
CBS 125002 = CPC 13631ET Eucalyptus delegatensis Australia: Tasmania B.A. Summerell KF902074 KF903656 KF902686 KF901727 KF902382 KF903263 KF902966
Recurvomyces mirabilis CBS 119434 = CCFEE 5264ET Sandstone sample Antarctica L. Zucconi GU250372 – – – KF310059 – –
CCFEE 5475 Rock sample Italy – KC315876 – – – KF310060 – –
Recurvomyces sp. CCFEE 5575 Rock sample UK – KF310018 – – – KF310072 – –
Schizothyrium pomi CBS 228.57 – Italy R. Ciferri KF902007 – – – KF902384 – –
CBS 486.50 Polygonum sachalinense The Netherlands J.A. von Arx KF902024 – – – KF902385 – –
Scorias spongiosa CBS 325.33 Aphid body – – KF901821 – – – – – –
Septoria eucalyptorum CBS 118505 = CPC 11282ET Eucalyptus leaf litter India W. Gams & M. Arzanlou KF901991 KF903501 KF902688 KF901651 KF902386 KF903265 KF902968
S. lysimachiae CBS 123794 Lysimachia sp. Czech Republic G.J.M. Verkley KF251972 – – – KF252465 – –
septoria-like sp. CBS 134910 = CPC 19500 Tibouchina herbacea Brazil D.F. Parreira KF302409 – – – KF302397 – –
Sonderhenia eucalypticola CPC 11251 Eucalyptus globulus Spain M.J. Wingfield KF902099 KF903596 KF902689 KF901746 KF902387 KF903266 KF902969
CPC 11252 Eucalyptus globulus Spain M.J. Wingfield KF902100 KF903597 KF902691 KF901747 KF902389 KF903268 KF902971
CBS 112502 = CPC 3749 Eucalyptus sp. Spain P.W. Crous KF902019 KF903454 KF902690 KF901677 KF902388 KF903267 KF902970
S. eucalyptorum CBS 120220 = CPC 12553 Eucalyptus coccifera Australia: Tasmania C. Mohammed KF901822 – – KF901505 KF902390 – KF902972
Sphaerulina cercidis CBS 118910 = CPC 12226ET of S. provincialis Eucalyptus sp. France P.W. Crous KF901988 KF903507 KF902692 KF901649 KF902391 KF903269 KF902973
Sph. myriadea CBS 124646 = JCM 15565 Quercus dentata Japan K. Tanaka KF251754 – – – KF252256 – –
Staninwardia suttonii CBS 120061 = CPC 13055ET Eucalyptus robusta Australia B.A. Summerell KF901874 KF903517 KF902693 KF901552 KF902392 KF903270 KF902974
Stenella araguata CBS 105.75 = ATCC 24788 = FMC 245ET Man, tinea nigra Venezuela D. Borelli KF902168 – – – KF902393 – –
Suberoteratosphaeria pseudosuberosa CBS 118911 = CPC 12085ET Eucalyptus sp. Uruguay M.J. Wingfield KF902144 KF903508 – KF901786 – KF903275 KF902979
Sub. suberosa CBS 436.92 = CPC 515ET Eucalyptus dunnii Brazil M.J. Wingfield KF901949 KF903586 – KF901623 KF902404 KF903282 –
CPC 13090 Eucalyptus agglomerata Australia: New South Wales A.J. Carnegie KF902117 KF903633 – KF901762 KF902403 KF903281 –
CPC 13091 Eucalyptus dunnii Australia: New South Wales A.J. Carnegie KF901875 KF903634 – KF901553 KF902398 KF903276 –
CPC 13104 Eucalyptus dunnii Australia: New South Wales A.J. Carnegie KF901878 KF903636 – KF901556 KF902401 KF903279 –
CPC 13106 Eucalyptus argophloia Australia: New South Wales A.J. Carnegie KF901876 KF903637 – KF901554 KF902399 KF903277 –
CPC 13111 Eucalyptus dunnii Australia: New South Wales A.J. Carnegie KF901877 KF903638 – KF901555 KF902400 KF903278 –
Sub. xenosuberosa CBS 134747 = CPC 13093ET Eucalyptus molucana Australia: Queensland A.J. Carnegie KF901879 KF903584 – KF901557 KF902402 KF903280 KF902980
Teratosphaeria agapanthi CBS 129064 = CPC 18332 Agapanthus umbellatus Portugal P.W. Crous KF902036 – – – KF902406 – –
Ter. alboconidia CBS 125004 = CPC 14598ET Eucalyptus miniata Australia: Northern Territory B.A. Summerell KF901881 KF903573 – KF901558 – KF903283 KF902981
Ter. alcornii CBS 121100 = CPC 13384EET Corymbia variegata Australia: New South Wales G. Price KF901882 KF903646 KF902698 KF901559 KF902407 – KF902982
Ter. angophorae CBS 120493 = DAR 77452ET Angophora floribunda Australia: New South Wales A.J. Carnegie KF901883 KF903523 KF902699 KF901560 KF902408 – KF902983
Ter. aurantia CBS 125243 = MUCC 668ET Eucalyptus grandis Australia: Queensland G. Whyte KF901884 KF903578 KF902700 KF901561 KF902409 KF903284 KF902984
Ter. australiensis CBS 124580 = MUCC 695 Corymbia sp. Australia: Western Australia G.E.St.J. Hardy KF901885 KF903553 KF902701 KF901562 KF902410 KF903285 KF902985
CBS 125244 = MUCC 731 Eucalyptus ficifolia Australia V. Andjic KF901886 KF903579 KF902702 KF901563 KF902411 KF903286 KF902986
Ter. biformis CBS 124578 = MUCC 693ET Eucalyptus globulus Australia: Queensland G. Whyte KF901887 KF903551 KF902703 KF901564 KF902412 KF903287 KF902987
Ter. blakelyi CBS 120089 = CPC 12837ET Eucalyptus blakelyi Australia: New South Wales B.A. Summerell KF901888 KF903518 KF902704 KF901565 KF902413 KF903288 KF902988
Ter. callophylla CBS 124584 = MUCC 700ET Corymbia sp. Australia: Western Australia K. Taylor KF901889 KF903557 KF902705 KF901566 KF902414 KF903289 –
Ter. capensis CBS 130602ET Protea sp. South Africa P.W. Crous JN712569 – – – – – –
Ter. complicata CBS 125216 = CPC 14535ET Eucalyptus miniata leaf litter Australia: Northern Territory B.A. Summerell KF901890 – – – KF902416 – –
CPC 14535 Eucalyptus miniata leaf litter Australia: Northern Territory B.A. Summerell KF902139 KF903672 KF902706 KF901781 KF902415 KF903290 KF902989
Ter. considenianae CBS 120087 = CPC 12840ET Eucalyptus consideniana Australia: New South Wales B.A. Summerell KF937238 – – – KF937272 – –
CPC 13032 Eucalyptus sp. Australia: New South Wales B.A. Summerell KF901891 KF903632 KF902707 KF901567 KF902417 KF903291 KF902990
CPC 14057 Eucalyptus stellulata Australia: New South Wales B.A. Summerell KF901892 KF903670 KF902708 KF901568 KF902418 KF903292 KF902991
Ter. corymbiae CBS 120496 = DAR 77446 Corymbia maculata Australia: New South Wales A.J. Carnegie KF937239 – – – KF937273 – –
CBS 124988 = CPC 13125 Corymbia henryi Australia: New South Wales A.J. Carnegie KF901893 KF903560 – KF901569 KF902419 KF903293 KF902992
Ter. crispata CBS 130523ET Eucalyptus bridgesiana Australia: New South Wales A.J. Carnegie KF901880 – – – KF902405 – –
Ter. cryptica CBS 110975 = CMW 3279 = CPC 936 Eucalyptus globulus Australia: Victoria A.J. Carnegie KF901897 KF903416 KF902714 KF901573 KF902425 KF903299 KF902998
CBS 111663 = CPC 1558 – – – KF901823 KF903449 KF902715 KF901506 KF902426 KF903300 KF902999
CBS 111679 = CPC 1576 Eucalyptus nitens Australia: Tasmania M.J. Wingfield KF902037 KF903450 KF902711 KF901691 KF902422 KF903296 KF902995
CPC 12415 Eucalyptus globulus Australia: Victoria I.W. Smith KF902118 KF903616 KF902709 KF901763 KF902420 KF903294 KF902993
CPC 12424 Eucalyptus globulus Australia: Victoria I.W. Smith KF901895 KF903617 KF902712 KF901571 KF902423 KF903297 KF902996
CPC 12559 Eucalyptus nitens Australia: Tasmania C. Mohammed KF901894 KF903620 KF902710 KF901570 KF902421 KF903295 KF902994
CPC 13839 Eucalyptus globulus Australia I.W. Smith KF901896 KF903667 KF902713 KF901572 KF902424 KF903298 KF902997
Ter. destructans CBS 111369 = CPC 1366ET Eucalyptus grandis Indonesia M.J. Wingfield EU019287 – – – KF937274 – –
CBS 111370 = CPC 1368ET Eucalyptus grandis Indonesia M.J. Wingfield KF901898 KF903447 KF902716 KF901574 KF902427 KF903301 KF903000
Ter. dimorpha CBS 120085 = CPC 12798 Eucalyptus nitens Australia: New South Wales A.J. Carnegie KF937240 – – – KF937275 – –
CBS 124051 = CPC 14132 Eucalyptus caesia Australia: New South Wales B.A. Summerell KF901899 KF903546 KF902717 KF901575 KF902428 KF903302 KF903001
Ter. eucalypti CBS 111692 = CMW 14910 = CPC 1582 Eucalyptus sp. New Zealand M.J. Wingfield KF902119 KF903452 KF902719 – – KF903304 –
CPC 12552 Eucalyptus nitens Australia: Tasmania C. Mohammed KF901900 KF903619 KF902718 KF901576 KF902429 KF903303 KF903002
Ter. fibrillosa CBS 121707 = CPC 13960EET Protea sp. South Africa P.W. Crous & L. Mostert KF902075 – – KF901728 – KF903305 KF903003
Ter. fimbriata CBS 120736 = CPC 13324ET Corymbia sp. Australia: Queensland P.W. Crous KF901901 KF903529 KF902720 KF901577 KF902430 KF903306 KF903004
CBS 120893 = CPC 13321 Corymbia sp. Australia: Queensland P.W. Crous KF901902 KF903533 KF902721 KF901578 KF902431 KF903307 KF903005
CPC 13321 Corymbia sp. Australia P.W. Crous KF901903 KF903644 KF902722 KF901579 KF902432 KF903308 KF903006
Ter. foliensis CBS 124581 = MUCC 670ET Eucalyptus globulus Australia: New South Wales S. Collins KF901904 KF903554 KF902725 KF901580 KF902435 KF903311 KF903009
Ter. gauchensis CBS 119465 = CMW 17545 Eucalyptus grandis Uruguay M.J. Wingfield KF902145 KF903509 KF902726 KF901787 KF902436 KF903312 KF903010
CBS 119468 = CMW 17558 Eucalyptus grandis Uruguay M.J. Wingfield KF902146 KF903510 KF902727 KF901788 KF902437 KF903313 KF903011
CBS 120303 = CMW 17331ET Eucalyptus grandis Uruguay M.J. Wingfield KF902148 KF903521 KF902729 KF901790 KF902439 KF903315 KF903013
CBS 120304 = CMW 17332ET Eucalyptus grandis Uruguay M.J. Wingfield KF902147 KF903522 KF902728 KF901789 KF902438 KF903314 KF903012
Ter. hortaea CBS 124156 = CPC 15716ET Eucalyptus camaldulensis Madagascar M.J. Wingfield KF902016 KF903550 KF902730 KF901674 KF902440 KF903316 KF903014
Ter. juvenalis CBS 110906 = CMW 13347 = CPC 40ET Eucalyptus cladocalyx South Africa P.W. Crous KF902077 KF903409 – KF901730 – – –
CBS 111149 = CPC 23 Eucalyptus cladocalyx South Africa P.W. Crous KF902012 KF903429 KF902731 KF901670 KF902441 KF903317 KF903015
CBS 116427 = CPC 10941 Eucalyptus cladocalyx South Africa P.W. Crous KF902076 KF903485 KF902732 KF901729 KF902442 KF903318 KF903016
Ter. knoxdaviesii CPC 14905 Protea sp. South Africa P.W. Crous EU707866 – – – – – –
CBS 122898 = CPC 14960ET Protea sp. South Africa P.W. Crous EU707865 – – – – – –
Ter. macowanii CBS 122901 = CPC 13899EET Protea nitida South Africa P.W. Crous & L. Mostert KF937241 – – – KF937276 – –
Ter. majorizuluensis CBS 120040 = CPC 12712ET Eucalyptus botryoides Australia: New South Wales B.A. Summerell KF901905 KF903516 KF902733 KF901581 KF902443 KF903319 KF903017
Ter. mareebensis CBS 129529 = CPC 17272ET Eucalyptus alba Australia: Queensland P.W. Crous & R.G. Shivas KF901906 KF903581 KF902734 KF901582 KF902444 KF903320 KF903018
Ter. maxii CBS 112496 = CPC 3322 Protea sp. Australia: New South Wales P.W. Crous & B. Summerell KF937242 – – – KF937277 – –
CBS 120137 = CPC 12805ET Protea repens South Africa M. & P.W. Crous KF937243 – – – KF937278 – –
Ter. mexicana CBS 110502 = CMW 14461 Eucalyptus globulus Australia: Western Australia A. Maxwell KF902176 KF903397 KF902735 KF901812 KF902445 KF903321 –
Ter. micromaculata CBS 124582 = MUCC 647ET Eucalyptus globulus Australia: Queensland G. Whyte KF901907 KF903555 – KF901583 KF902446 KF903322 KF903019
Ter. miniata CBS 125006 = CPC 14514ET Eucalyptus miniata leaf litter Australia: Northern Territory B.A. Summerell KF901908 KF903574 KF902736 KF901584 KF902447 KF903323 KF903020
CPC 14514 Eucalyptus miniata leaf litter Australia: Northern Territory B.A. Summerell KF937244 – – – KF937279 – –
Ter. molleriana CBS 110499 = CMW 14180ET of Mycosphaerella ambiphylla Eucalyptus globulus Australia: Western Australia A. Maxwell KF901910 KF903394 KF902743 KF901586 KF902454 KF903330 KF903027
CBS 111164 = CMW 4940 = CPC 1214ET of M. molleriana Eucalyptus globulus Portugal S. McCrae KF902038 KF903431 KF902737 KF901692 KF902448 KF903324 KF903021
CBS 111165 = CPC 1215ET Eucalyptus globulus Portugal S. McCrae KF902039 KF903432 KF902738 KF901693 KF902449 KF903325 KF903022
CBS 117924 = CMW 11588 Eucalyptus globulus Australia: Tasmania – KF902078 KF903486 KF902739 KF901731 KF902450 KF903326 KF903023
CBS 117925 = CMW 11559 Eucalyptus globulus Australia – KF902121 KF903487 KF902744 KF901765 KF902455 KF903331 KF903028
CBS 117926 = CMW 11563 Eucalyptus globulus Australia – KF902122 KF903488 KF902745 KF901766 KF902456 KF903332 KF903029
CBS 117927 = CMW 11564 Eucalyptus globulus Australia: Tasmania – KF902123 KF903489 KF902746 KF901767 KF902457 KF903333 KF903030
CBS 118359 = CMW 11560 Eucalyptus globulus Australia: Tasmania – KF902120 KF903490 KF902740 KF901764 KF902451 KF903327 KF903024
CBS 120746 = CPC 13398EET of T. molleriana Eucalyptus sp. Portugal P.W. Crous & A.J.L. Phillips – – – EF394844 – – –
CBS 122905 = CMW 2732 = CPC 355ET of T. xenocryptica Eucalyptus sp. Chile M.J. Wingfield KF901959 KF903540 KF902741 KF901626 KF902452 KF903328 KF903025
CPC 12232 Eucalyptus globulus Portugal A.J.L. Phillips KF901909 KF903609 KF902742 KF901585 KF902453 KF903329 KF903026
Ter. multiseptata CBS 121312 = DAR 77438ET Angophora subvelutia Australia: New South Wales A.J. Carnegie KF901911 KF903537 KF902747 KF901587 KF902458 KF903334 KF903031
Ter. nubilosa CBS 116005 = CMW 3282 = CPC 937 Eucalyptus globulus Australia: Victoria A.J. Carnegie KF902031 KF903479 KF902749 KF901686 KF902460 KF903336 KF903033
CPC 11879 Eucalyptus sp. Portugal A.J.L. Phillips KF902040 KF903606 KF902750 KF901694 KF902461 KF903337 KF903034
CPC 12235 Eucalyptus globulus Portugal A.J.L. Phillips KF902041 KF903610 KF902751 KF901695 KF902462 KF903338 KF903035
CPC 12243 Eucalyptus globulus Portugal A.J.L. Phillips KF902042 KF903611 KF902752 KF901696 KF902463 KF903339 KF903036
CPC 12830 Eucalyptus globulus Portugal A.J.L. Phillips KF902043 KF903626 KF902753 KF901697 KF902464 KF903340 KF903037
CPC 13452 Eucalyptus sp. Portugal P.W. Crous KF902044 KF903648 KF902754 KF901698 KF902465 KF903341 KF903038
CPC 13825 Eucalyptus globulus Australia I.W. Smith KF901912 KF903662 KF902755 KF901588 KF902466 KF903342 KF903039
CPC 13828 Eucalyptus globulus Australia I.W. Smith KF901913 KF903663 KF902756 KF901589 KF902467 KF903343 KF903040
CPC 13835 Eucalyptus globulus Australia I.W. Smith KF902169 KF903666 KF902748 KF901807 KF902459 KF903335 KF903032
CPC 13844 Eucalyptus globulus Australia I.W. Smith KF901914 KF903668 KF902757 KF901590 KF902468 KF903344 KF903041
Ter. ovata CBS 124052 = CPC 14632 Eucalyptus phoenicea Australia: Northern Territory B.A. Summerell KF901915 KF903547 – KF901591 KF902469 KF903345 KF903042
Ter. pluritubularis CBS 118508 = CPC 11697ET Eucalyptus globulus Spain J.P. Mansilla KF902101 KF903504 KF902758 KF901748 KF902470 KF903346 KF903043
Ter. profusa CBS 125007 = CPC 12821ET Eucalyptus nitens Australia A.J. Carnegie KF901916 – KF902759 KF901592 KF902471 KF903347 KF903044
CPC 12821 Eucalyptus nitens Australia A.J. Carnegie KF937245 – – – KF937280 – –
Ter. proteae-arboreae CPC 14963 Protea sp. South Africa P.W. & M. Crous KF937246 – – – KF937281 – –
Ter. pseudocryptica CBS 118504 = CPC 11267ET Eucalyptus sp. New Zealand J.A. Stalpers KF902032 KF903598 KF902760 KF901687 KF902472 KF903348 KF903045
CPC 11264 Corymbia henryi Australia A.J. Carnegie KF901856 KF903640 KF902651 KF901534 KF902343 – KF902929
Ter. pseudoeucalypti CBS 124577 = MUCC 607ET Eucalyptus grandis × E. ca-maldulensis Australia: Queensland G.S. Pegg KF901917 – KF902761 KF901593 KF902473 KF903349 KF903046
Ter. pseudonubilosa CPC 13831 Eucalyptus globulus Australia I.W. Smith KF901918 KF903664 KF902762 KF901594 KF902474 KF903350 KF903047
CPC 13833 Eucalyptus globulus Australia I.W. Smith KF901919 KF903665 KF902763 KF901595 KF902475 KF903351 KF903048
Ter. rubidae CBS 124579 = MUCC 658ET of T. rubidae Corymbia calophylla Australia: Western Australia P.A. Barber KF901920 KF903552 KF902764 KF901596 KF902476 KF903352 KF903049
Ter. stellenboschiana CBS 124989 = CPC 13767 Eucalyptus punctata South Africa P.W. Crous KF902079 KF903561 KF902767 KF901732 KF902486 KF903355 KF903052
CBS 125215 = CPC 13764 Eucalyptus punctata South Africa P.W. Crous KF937247 – – – KF937282 – –
CBS 125215 Eucalyptus punctata South Africa P.W. Crous KF902080 KF903577 KF902768 KF901733 KF902487 KF903356 KF903053
CPC 12283 Eucalyptus sp. France: Corsica J. Dijksterhuis KF901981 KF903613 KF902766 KF901646 KF902485 KF903354 KF903051
Ter. suttonii CBS 110907 = CPC 63 Eucalyptus grandis South Africa P.W. Crous KF937248 – – – KF937283 – –
CBS 119973 = CMW 23439ET of Mycosphaerella obscuris Eucalyptus pellita Vietnam T.I. Burgess KF902142 KF903513 KF902771 KF901784 KF902489 KF903359 KF903055
CPC 12218 Eucalyptus sp. Indonesia M.J. Wingfield KF902003 KF903608 KF902769 KF901664 KF902488 KF903357 KF903054
CPC 12352 Eucalyptus sp. USA: Hawaii W. Gams KF902162 – KF902770 – – KF903358 –
Ter. syncarpiae CBS 121160 = DAR 77433ET Syncarpia glomulifera Australia: New South Wales A.J. Carnegie & M.J. Wingfield KF901922 KF903536 KF902772 KF901598 KF902490 KF903360 KF903056
Ter. tinara CBS 124583 = MUCC 666ET Corymbia sp. Australia: Queensland T.I. Burgess KF901923 KF903556 KF902773 KF901599 KF902491 – KF903057
Ter. toledana CBS 113313 = CMW 14457ET Eucalyptus sp. Spain P.W. Crous & G. Bills KF902081 KF903464 KF902774 KF901734 KF902492 KF903361 KF903058
CBS 115513 = CPC 10840 Eucalyptus sp. Spain P.W. Crous & G. Bills KF901924 KF903475 KF902775 KF901600 KF902493 KF903362 KF903059
Ter. veloci CBS 124061 = CPC 14602ET Eucalyptus miniata Australia: Northern Territory B.A. Summerell KF937249 – – – KF937284 – –
CPC 14600 Eucalyptus miniata Australia: Northern Territory B.A. Summerell KF901925 KF903673 KF902776 KF901601 – KF903363 KF903060
Ter. verrucosa CBS 113621 = CPC 42ET Eucalyptus cladocalyx South Africa P.W. Crous KF901980 KF903465 KF902778 KF901645 KF902495 KF903365 KF903062
CPC 12949 Eucalyptus sp. South Africa P.W. Crous KF902124 KF903629 KF902777 KF901768 KF902494 KF903364 KF903061
Ter. viscidus CBS 121157 = MUCC 453ET Eucalyptus grandis Australia: Queensland T.I. Burgess, G.E.St.J Hardy, A.J. Carnegie & G. Pegg KF901927 – – – – KF903367 –
CBS 124992 = CPC 13306 Eucalyptus sp. Australia: Queensland B.A. Summerell & P.W. Crous KF901926 KF903563 KF902779 KF901602 KF902496 KF903366 KF903063
Ter. zuluensis CBS 120301 = CMW 17321EET Eucalyptus grandis South Africa M.J. Wingfield KF902082 KF903519 KF902780 KF901735 KF902497 KF903368 KF903064
CBS 120302 = CMW 17322EET Eucalyptus grandis South Africa M.J. Wingfield KF902083 KF903520 KF902781 KF901736 KF902498 KF903369 KF903065
Teratosphaericola pseudoafricana CBS 111168 = CPC 1231 Eucalyptus globulus Zambia T. Coutinho KF902045 KF903435 KF902782 KF901699 KF902499 KF903370 KF903066
CBS 114782 = CPC 1230ET Eucalyptus globulus Zambia T. Coutinho KF902084 KF903473 KF902783 KF901737 KF902500 KF903371 KF903067
Teratosphaeriopsis pseudoafricana CBS 111171 = CPC 1261 Eucalyptus sp. South Africa P.W. Crous KF902085 KF903436 KF902784 KF901738 KF902501 KF903372 KF903068
Teratosphaeriaceae sp. CBS 117937 = TRN211 Rock sample Spain – GU323978 – – – KF310038 – –
Teratosphaeriaceae sp. CBS 120744 = CPC 12349 Eucalyptus sp. USA: Hawaii W. Gams KF902160 KF903532 KF902546 KF901800 KF902215 KF903110 KF902810
Teratosphaeriaceae sp. CBS 131961 Ant body Brazil A.P.M. Duarte, N.C. Baron & pseudoafricana KF902172 – – – KF902478 – –
Teratosphaeriaceae sp. CBS 131960 Ant body Brazil A.P.M. Duarte, N.C. Baron & D.A. de Angelis KF901950 – – – KF902479 – –
Teratosphaeriaceae sp. CBS 131962 Ant body Brazil A.P.M. Duarte, N.C. Baron & D.A. de Angelis KF901951 – – – KF902480 – –
Teratosphaeriaceae sp. CBS 131963 Ant body Brazil A.P.M. Duarte, N.C. Baron & D.A. de Angelis KF901952 – – – KF902481 – –
Teratosphaeriaceae sp. CBS 131976 Ant body Brazil A.P.M. Duarte, N.C. Baron & D.A. de Angelis KF901953 – – – KF902482 – –
Teratosphaeriaceae sp. CBS 131977 Ant body Brazil A.P.M. Duarte, N.C. Baron & D.A. de Angelis KF901954 – – – KF902483 – –
Teratosphaeriaceae sp. CBS 131979 Ant body Brazil A.P.M. Duarte, N.C. Baron & D.A. de Angelis KF901955 – – – KF902484 – –
Teratosphaeriaceae sp. CCFEE 5569 Rock sample Italy – KF310015 – – – KF310071 – –
Teratosphaeriaceae sp. CPC 13680 Eucalyptus placita Australia B.A. Summerell KF901921 KF903657 KF902765 KF901597 KF902477 KF903353 KF903050
Teratosphaeriaceae sp. TRN232 Rock sample Spain – KF310011 – – – KF310079 – –
Teratosphaeriaceae sp. TRN450 Rock sample Spain – KF937237 – – – – – –
Toxicocladosporium irritans CBS 128777 = CPC 18471ET Phaenocoma prolifera South Africa K. L. & P.W. Crous JF499868 – – – KJ564345 – –
Tox. protearum CBS 126499 = CPC 15254ET Protea burchellii South Africa F. Roets HQ599587 – – – KJ564344 – –
Tox. rubrigenum CBS 124158 = CPC 15735ET Eucalyptus camaldulensis Madagascar M. J. Wingfield FJ790305 – – – KJ564338 – –
Tripospermum myrti CBS 437.68 Citrus sp. Java J.H. van Emden KF902008 – – – KF902502 – –
Undescribed species CCFEE 5772 Rock sample France D. Tesei KJ380895 – – – KJ380901 – –
Undescribed species CBS 118301 = TRN138 Rock sample Spain C. Ruibal GU323974 – – – KJ564343 – –
Undescribed species CBS 118305 = TRN62 Rock sample Spain C. Ruibal GU323961 – – – KF310084 – –
Undescribed species CPC 16833 Pinus koraiensis The Netherlands W. Quaedvlieg KJ564329 – – – KJ564350 – –
Undescribed species CPC 16832 Pinus koraiensis The Netherlands W. Quaedvlieg KJ564330 – – – – – –
Undescribed species CBS 136110 = CCFEE 5764 Rock sample Italy – KF310028 – – – – – –
Uwebraunia australiensis CBS 120729 = CPC 13282ET Eucalyptus platyphylla Australia P.W. Crous GQ852588 – – – KJ564339 – –
Uwe. commune CBS 110809 = CPC 830ET Eucalyptus nitens South Africa P.W. Crous KJ564336 – – – KJ564351 – –
Uwe. dekkeri CPC 13264 Eucalyptus molucana Australia B.A. Summerell GQ852593 – – – KJ564340 – –
Vermiconia foris CBS 136106 = CCFEE 5459ET Rock sample Italy – GU250390 – – – KF310088 – –
Von. antarctica CBS 136107 = CCFEE 5488ET Rock sample Antarctica – KJ564324 – – – KF310089 – –
CBS 136108 = CCFEE 5489 Rock sample Antarctica – GU250395 – – – – – –
Von. flagrans CBS 118283 = TRN124ET Rock sample Spain C. Ruibal GU323971 – – – – – –
CBS 118284 = TRN104 Rock sample Spain C. Ruibal KJ564325 – – – KF310089 – –
CBS 118296 = TRN114ET Rock sample Spain C. Ruibal KF310024 – – – KF310096 – –
Verrucisporota daviesiae CBS 116002 = VPRI31767 Daviesia mimosoides (≡ D. cormybosa var. mimosoides) Australia V. & R. Beilharz KF901928 KF903477 KF902785 KF901603 KF902503 KF903373 KF903069
Verr. proteacearum CBS 116003 = VPRI31812 Grevillea sp. Australia V. Beilharz KF901929 KF903478 – KF901604 KF902504 – KF903070
Xenomycosphaerella elongata CBS 120735 = CPC 13378ET Eucalyptus camaldulensis × urophylla Venezuela M.J. Wingfield KF902170 KF903528 KF902786 KF901808 KF902505 KF903374 KF903071
Xenom. yunnanensis CBS 119975 = CMW 23443 = MUCC 410 = PAB 05.05 B2ET Eucalyptus urophylla China B. Dell KF901962 KF903515 KF902787 KF901628 KF902506 KF903375 KF903072
Xenopenidiella rigidophora CBS 314.95ET Smilax sp. leaf litter Cuba R.F. Castañeda KF901983 – – – KF902507 – –
Xenophacidiella pseudocatenata CBS 128776 = CPC 18472ET Phaenocoma prolifera South Africa K.L. & P.W. Crous KF902092 – – – KF902508 – –
Xenoteratosphaeria jonkershoekensis CBS 122897 = CPC 13984EET Protea sp. South Africa P.W. Crous & L. Mostert KF937250 – – – KF937285 – –
Zasmidium aerohyalinosporum CBS 125011 = CPC 14636ET Eucalyptus tectifica Australia B.A. Summerell KF901930 KF903576 KF902788 KF901605 KF902509 KF903376 KF903073
Z. anthuriicola CBS 118742ET Anthurium sp. Thailand C.F. Hill FJ839662 – – – KF252287 – –
Z. citri CBS 116366 = CPC 10522 = CMW 11730 Acacia mangium Thailand K. Pongpanich KF902138 – – KF901780 KF902519 KF903386 KF903080
CBS 116426 Musa sp. USA: Florida J. Cavaletto KF901987 – – KF901648 KF902520 KF903387 KF903081
CBS 122455 Citrus sp. USA: Florida R.C. Ploetz KF902156 – – KF901797 KF902521 KF903388 KF903082
CPC 10522 Acacia mangium Thailand K. Pongpanich KF902136 – – KF901778 KF902511 KF903378 KF903074
CPC 13467 Eucalyptus sp. Thailand W. Himaman KF902137 KF903650 – KF901779 KF902512 KF903379 KF903075
CPC 15285 Citrus sp. USA: Florida – KF902150 – – KF901791 KF902513 KF903380 KF903076
CPC 15289 Citrus sp. USA: Florida – KF902151 – – KF901792 KF902514 KF903381 –
CPC 15291 Citrus sp. USA: Florida – KF902152 KF903676 – KF901793 KF902515 KF903382 KF903077
CPC 15293 Citrus sp. USA: Florida – KF902153 – – KF901794 KF902516 KF903383 –
CPC 15294 Citrus sp. USA: Florida – KF902154 – – KF901795 KF902517 KF903384 KF903078
CPC 15296 Citrus sp. USA: Florida – KF902155 – – KF901796 KF902518 KF903385 KF903079
CPC 15300 Citrus sp. Indonesia – KF902086 – – KF901739 KF902510 KF903377 –
Z. eucalypti CBS 121101 = CPC 13302ET Eucalyptus tereticornis Australia: Queensland P.W. Crous KF901931 KF903642 – KF901606 KF902522 KF903389 KF903083
Z. eucalyptorum CBS 118500 = CPC 11174ET Eucalyptus sp. Indonesia M.J. Wingfield – KF903495 – KF901652 KF902203 KF903101 –
Z. lonicericola CBS 125008 = CPC 11671EET Lonicera japonica South Korea H.D. Shin KF902093 – – – KF902523 – –
Z. nabiacense CBS 125010 = CPC 12748ET Eucalyptus sp. Australia A.J. Carnegie KF901933 KF903575 – KF901608 KF902525 KF903391 KF903085
CPC 12748 Eucalyptus sp. Australia A.J. Carnegie KF901932 KF903624 – KF901607 KF902524 KF903390 KF903084
Z. nocoxi CBS 125009 = CPC 14044ET Twig debris USA: Virginia P.W. Crous KF902157 – – – KF902526 – –
Z. parkii CBS 387.92 = CPC 353ET Eucalyptus grandis Brazil M.J. Wingfield KF902143 KF903585 KF902789 KF901785 – KF903392 –
Z. pseudoparkii CBS 110988 = CPC 1090 Eucalyptus grandis Colombia M.J. Wingfield KF901975 KF903418 KF902694 KF901640 KF902394 KF903271 KF902975
CBS 110999 = CPC 1087ET Eucalyptus grandis Colombia M.J. Wingfield KF901977 KF903419 KF902696 KF901642 KF902396 KF903273 KF902977
CBS 111049 = CPC 1089 Eucalyptus grandis Colombia M.J. Wingfield KF901976 KF903426 KF902695 KF901641 KF902395 KF903272 KF902976
Z. xenoparkii CBS 111185 = CPC 1300ET Eucalyptus grandis Indonesia M.J. Wingfield KF902002 KF903438 KF902697 KF901663 KF902397 KF903274 KF902978
Zymoseptoria verkleyi CBS 133618 Poa annua The Netherlands S. Videira KC005802 – – – KJ564348 – –

1 ATCC: American Type Culture Collection, Virginia, USA; CBS: CBS Fungal Biodiversity Centre, Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands; CCFEE: Culture collection from extreme environments of the Dipartimento di Scienze Ambientali, University of Tuscia, Viterbo, Italy; CIRAD: Centre de Coopération Internationale en Recherche Agronomique pour le Développement, UMR-BGPI, Montpellier, France; CMW: Culture collection of the Forestry and Agricultural Biotechnology Institute (FABI) of the University of Pretoria, Pretoria, South Africa; CPC: Collection Pedro Crous, housed at CBS; DAOM: Plant Research Institute, Department of Agriculture (Mycology), Ottawa, Canada; DAR: Plant Pathology Herbarium, Orange Agricultural Institute, Forest Road, Orange. NSW 2800, Australia; MAFF: NIAS Genebank, Microorganism Section, Japan; MUCC: Murdoch University Culture Collection, Murdoch, Australia; NZFS: Forest Research Culture Collection, Private Bag 3020, Rotorua, New Zealand; STE-U: Department of Plant Pathology, University of Stellenbosch, South Africa; TRN: T. Ruibal private collection; VPRI: Victorian Department of Primary Industries, Knoxfield, Australia; X: Working collection of Mahdi Arzanlou.

2 EET: ex-epitype; ET: ex-type.

3 Act: Actin; Btub: β-tubulin; Cal: Calmodulin; EF-1α: Translation elongation factor 1-alpha; ITS: internal transcribed spacer regions of the nrDNA operon; LSU: 28S large subunit of the nrRNA gene; RPB2: RNA polymerase II second largest subunit.

Multi-locus DNA screening

Genomic DNA was extracted from mycelium growing on MEA (Table 1), using the UltraCleanTM Microbial DNA Isolation Kit (Mo Bio Laboratories, Inc., Solana Beach, CA, USA). All strains were screened for seven loci (ITS, LSU, Act, Cal, EF-1α, RPB2 and Btub) using the primer sets listed in Table 2. The PCR amplifications were performed in a total volume of 12.5 μL solution containing 10–20 ng of template DNA, 1× PCR buffer, 0.7 μL DMSO (99.9 %), 2 mM MgCl2, 0.4 μM of each primer, 25 μM of each dNTP and 1.0 U BioTaq DNA polymerase (Bioline GmbH Luckenwalde, Germany). PCR conditions were set as follows: an initial denaturation temperature of 96 °C for 2 min, followed by 40 cycles of denaturation temperature of 96 °C for 45 s, primer annealing at the temperature stated in Table 2, primer extension at 72 °C for 90 s and a final extension step at 72 °C for 2 min. The resulting fragments were sequenced using the PCR primers and the BigDye Terminator Cycle Sequencing Kit v. 3.1 (Applied Biosystems, Foster City, CA, USA). Sequencing reactions were performed as described by Cheewangkoon et al. (2008).

Table 2.

Primer combinations used during this study for generic amplification and sequencing.

Locus Primer Primer sequence 5’ to 3’ Annealing temperature (°C) Orientation Reference
Translation elongation factor-1α EF1-728F CATCGAGAAGTTCGAGAAGG 52 Forward Carbone & Kohn (1999)
EF-2 GGARGTACCAGTSATCATGTT 52 Reverse O’Donnell et al. (1998)
β-tubulin T1 AACATGCGTGAGATTGTAAGT 52 Forward O’Donnell & Cigelnik (1997)
β-Sandy-R GCRCGNGGVACRTACTTGTT 52 Reverse Stukenbrock et al. (2012)
RNA polymerase II second largest subunit fRPB2-5F GAYGAYMGWGATCAYTTYGG 49 Forward Liu et al. (1999)
fRPB2-414R ACMANNCCCCARTGNGWRTTRTG 49 Reverse Quaedvlieg et al. (2011)
LSU LSU1Fd GRATCAGGTAGGRATACCCG 52 Forward Crous et al. (2009a)
LR5 TCCTGAGGGAAACTTCG 52 Reverse Vilgalys & Hester (1990)
ITS ITS5 GGAAGTAAAAGTCGTAACAAGG 52 Forward White et al. (1990)
ITS4 TCCTCCGCTTATTGATATGC 52 Reverse White et al. (1990)
Actin ACT-512F ATGTGCAAGGCCGGTTTCGC 52 Forward Carbone & Kohn (1999)
ACT2Rd ARRTCRCGDCCRGCCATGTC 52 Reverse Groenewald et al. (2013)
Calmodulin CAL-235F TTCAAGGAGGCCTTCTCCCTCTT 50 Forward Quaedvlieg et al. (2012)
CAL2Rd TGRTCNGCCTCDCGGATCATCTC 50 Reverse Groenewald et al. (2013)

Phylogenetic analysis

An initial alignment of the obtained sequence data was first done using MAFFT v. 7 (http://mafft.cbrc.jp/alignment/server/index.html; Katoh et al. 2002) and whenever indicated, manually improved in BioEdit v. 7.0.5.2 (Hall 1999). To check the congruency of the datasets, a 70 % Neighbour-Joining (NJ) reciprocal bootstrap method with maximum likelihood distance was performed on each individual locus (Mason-Gamer & Kellogg 1996) (resulting trees not shown). Bayesian analyses (critical value for the topological convergence diagnostic set to 0.01) were performed on the five locus (ITS, LSU, RPB2, EF-1α and Btub) TLD (Fig. 1) and MLD (Fig. 2) trees, as well as on the two-locus, Teratosphaeriaceae and families LSU/RPB2 (Fig. 3, 4) concatenated datasets using MrBayes v. 3.2.1 (Ronquist et al. 2011) as described by Crous et al. (2006). Appropriate gene models were selected using MrModeltest v. 2.3 (Nylander 2004) and applied to each gene partition. The substitution models for each locus are listed in Table 3. Staninwardia suttonii (CBS 120061) served as an outgroup for both MLD and TLD five-locus multigene phylogenetic analyses; Aulographina pinorum (CBS 655.86) was used as outgroup for the LSU/RPB2 Teratosphaeriaceae tree and Parastagonospora nodorum (CBS 110109) was used as an outgroup for the families tree.

Fig. 1.

Fig. 1

A Bayesian 50 % majority rule consensus tree based on a combined ITS, LSU, RPB2, EF-1α and Btub alignment, containing all isolates associated with Teratosphaeria leaf disease of Eucalyptus available at the CBS. Bayesian posterior probabilities support values for the respective nodes are displayed in the tree. The tree was rooted to Staninwardia suttonii. The scale bar indicates 0.1 expected changes per site.

Fig. 2.

Fig. 2

A Bayesian 50 % majority rule consensus tree based on a combined ITS, LSU, RPB2, EF-1α and Act alignment, containing all isolates associated with Mycosphaerella leaf disease of Eucalyptus available at the CBS. Bayesian posterior probabilities support values for the respective nodes are displayed in the tree. The tree was rooted to Staninwardia suttonii. The scale bar indicates 0.1 expected changes per site.

Fig. 3.

Fig. 3

Fig. 3

A Bayesian 50 % majority rule consensus tree based on the LSU/RPB2 alignment and containing all isolates associated with the Teratosphaeriaceae available at the CBS. Bayesian posterior probabilities support values for the respective nodes are displayed in the tree. The tree was rooted to Aulographina pinorum. The scale bar indicates 0.1 expected changes per site.

Fig. 4.

Fig. 4

A Bayesian 50 % majority rule consensus tree based on a LSU/RPB2 alignment and containing isolates that where previously associated with ‘Teratosphaeria 1’ and ‘2’, plus representatives of closely related families, available at the CBS. Bayesian posterior probabilities support values for the respective nodes are displayed in the tree. The tree was rooted to Parastagonospora nodorum. The scale bar indicates 0.2 expected changes per site.

Table 3.

Amplification success, phylogenetic data and the substitution models used in the phylogenetic analyses, per locus.

Locus Act Cal EF1 RPB2 Btub ITS LSU
Amplification succes (%) 90 84 98 95 97 100 100
Number of characters 558 593 490 340 306 594 758
Unique site patterns 334 386 388 195 211 334 174
Substitution model used GTR-I-gamma HKY-I-gamma HKY-I-gamma GTR-I-gamma HKY-I-gamma GTR-I-gamma GTR-I-gamma

Kimura-2-parameter values

The available sequence data from the seven individual loci within the two Teratosphaeriaceae and single Mycosphaerellaceae datasets were individually pooled together and realigned using MAFFT to generate seven single locus alignments. MEGA v. 4.0 (Tamura et al. 2007) was then used to generate both inter- and intra-specific Kimura-2-parameter distance values for these seven datasets using the pair-wise deletion model. Microsoft Excel 2007 was then used to sort these distance values into distribution bins (from distance 0–1 with intervals of 0.05 between bins) and the frequency of entries for each individual bin was subsequently plotted against the Kimura-2-parameter distance of each bin (Fig. 5).

Fig. 5.

Fig. 5

The frequency distribution graphs of the Kimura-2-parameter distances (barcoding gaps) for the seven individual gene loci. The grey asterix (*) marks the average interspecific variation per locus while red inverted chevrons (V) mark the average intraspecific variation per locus.

Genealogical concordance phylogenetic species recognition analysis

Phylogenetically related but ambiguous species were analysed separately using the Genealogical Concordance Phylogenetic Species Recognition (GCPSR) model (as described by Taylor et al. 2000) by performing a pairwise homoplasy index (Φw) test. GCPSR is a pragmatic tool for the assessment of species limits, as the concordance of gene genealogies is a valuable method for evaluating the significance of gene flow between groups within an evolutionary timescale (Koufopanou et al. 1997, Geiser et al. 1998, Taylor et al. 2000, Starkey et al. 2007). A Pairwise homoplasy index (PHI) test (Philippe & Bryant 2006) was performed in SplitsTree4 (Huson 1998, Huson & Bryant 2006) (www.splitstree.org) in order to determine the recombination level within phylogenetically closely related species using a five-locus concatenated dataset of closely related species (Fig. 1 and 2, clade A–K). If the pairwise homoplasy index results were below a 0.05 threshold (Φw < 0.05), it was indicative for significant recombination present in the dataset. The relationships between these eleven, closely related, species groups were visualised by constructing splits graphs (Fig. 6) from the five-locus concatenated datasets, using both the LogDet transformation and splits decomposition options.

Fig. 6.

Fig. 6

The results of the pairwise homoplasy index (PHI) test of closely related species using both LogDet transformation and splits decomposition. PHI test results (Φw) < 0.05 indicate significant recombination within the dataset.

Morphology

Morphological descriptions were made on slide preparations mounted in clear lactic acid from colonies sporulating on MEA, PDA and OA (noted in taxonomic descriptions). Observations were made with a Zeiss V20 Discovery stereo-microscope and with a Zeiss Axio Imager 2 light microscope using differential interference contrast (DIC) illumination and a MRc5 camera and ZEN imaging software. Colony characters and pigment production were noted after 1 mo of growth on MEA, PDA and OA incubated at 25 °C. Colony colours (surface and reverse) were rated according to the colour charts of Rayner (1970). Sequences derived in this study were lodged at GenBank, the alignment in TreeBASE (www.treebase.org) and taxonomic novelties in MycoBank (www.MycoBank.org; Crous et al. 2004a).

RESULTS

Amplification rate of test loci

The amplification success scores of the seven test loci varied from 100 % for LSU and ITS to 84 % for Cal. The remaining four test loci (Act, RPB2, Btub and EF-1α) produced PCR success scores of 90, 95, 97 and 98 %, respectively (Table 3).

Congruency testing

The results of the congruency test (trees not shown) showed that the seven gene regions were incongruent in both the MLD and TLD trees. In the TLD Teratosphaeriaceae tree (Fig. 1), the Act and Cal loci were incongruent with the other five loci, while in the MLD Mycosphaerellaceae tree (Fig. 2), the Btub and Cal loci were incongruent with the other five loci. In both these datasets, the terminal clades representing genera were the same for all gene regions, however the higher order clustering deviated for the incongruent loci. For this reason, the conflicting loci were not included in the published trees.

Kimura-2-parameter values

The Kimura-2-parameter (K2P) distribution graphs (Fig. 5) visualise the inter- and intraspecific distances per locus corresponding to the barcoding gap (Hebert et al. 2003). A useful barcoding locus should have no overlap between inter- and intraspecific K2P distances. The individual test loci showed varying degrees of overlap in their K2P distribution graphs. In this dataset, both ITS and LSU have a higher K2P overlap than the other five test loci suggesting they are more conserved making them less suitable to serve as a reliable identification locus for MLD and TLD pathogens across the whole scale of tested sequences. Of the remaining five loci (Btub, Act, RPB2, EF-1α and Cal), Btub, EF-1α and RPB2 have the lowest K2P overlap. Although these latter loci are less conserved, they show greater natural variation between different species than the other four loci.

Phylogenetic results

Based on the phylogenetic data (Fig. 1, 2, 3, 4) generated during this study, we were able to make a start at delineating the Teratosphaeriaceae. Recognised clades, as well as novel species, genera and families are described and discussed in the Taxonomy section below.

The four datasets consisted of 2 468 characters for the TLD tree (753 characters for LSU, 485 for EF-1α, 589 for ITS, 301 for Btub and 340 for RPB2), 2 950 characters for the MLD tree (563 characters for Act, 752 for LSU, 573 for EF-1α, 728 for ITS and 334 for RPB2), 1 129 characters for the Teratosphaeriaceae tree (817 characters for LSU and 312 for RPB2) and 956 characters for the families tree (688 for LSU and 268 for RPB2).

The respective alignments included 1 361 parsimony-informative characters for the TLD tree (223 for LSU, 388 for EF-1α, 334 for ITS, 221 for Btub and 195 for RPB2), 1 398 parsimony-informative characters for the MLD tree (293 for Act, 179 for LSU, 382 for EF-1α, 355 for ITS and 189 for RPB2), 647 parsimony-informative characters for the Teratosphaeriaceae tree (457 for LSU and 190 for RPB2) and 511 parsimony-informative characters for the families tree (287 for LSU and 224 for RPB2).

After topological convergence of the Bayesian runs at 0.01, the following numbers of trees where generated and subsequently sampled (using a burn in fraction of 0.25 and indicated after the slash) in order to generate the three Bayesian phylogenies, 960/720 for TLD, 1102/828 for MLD, 76126/57096 for Teratosphaeriaceae and 9172/6879 for the families tree. The resulting phylogenetic trees of all three individual combined datasets showed consistent clustering of all MLD and TLD taxa over all four trees, and these results are treated below. There were some problems with the clustering position of the Piedraiaceae, and this issue is addressed in the Discussion.

TAXONOMY

Extremaceae

Extremaceae Quaedvlieg & Crous,fam. nov. — MycoBank MB808049

Type genus. Extremus Quaedvlieg & Crous.

Asexual morphs variable, filamentous, lichenicolous or yeast-like. Conidiophores pigmented, solitary to sporodochial, proliferating sympodially, or with a terminal rachis that can be subdenticulate. Conidia brown, solitary or in short mostly unbranched chains, subcylindrical to narrowly fusoid-ellipsoidal or obclavate, rarely with 1–2 transverse septa, frequently with mucoid sheath; hila not to slightly darkened, somewhat thickened and refractive or not.

Notes — Members of Extremaceae occur in extreme habitats, and are ecologically highly diverse, ranging from lichenocolous to epiphyllous, acidophilic, rock inhabiting, endophytic, saprobic or plant pathogenic, representing part of ‘Teratosphaeriaceae 2’ (now Neodevriesiaceae and Extremaceae) sensu Ruibal et al. (2009).

Extremus Quaedvlieg & Crous, gen. nov. — MycoBank MB808050

Type species. Extremus adstrictus (Egidi & Onofri) Quaedvlieg & Crous.

Etymology. Named after its ecologically extreme, rock-inhabiting habitat.

Hyphomycetous, rock-inhabiting. Colonies with brown, branched, thick-walled, septate hyphae. Conidiogenous cells integrated in hyphal chains, brown, subcylindrical to ellipsoid, smooth to rough, proliferating sympodially. Conidia medium brown, smooth to rough, subcylindrical to ellipsoid, thick-walled, in chains, with or without darkened median septa, at times with oblique septa; hila not to slightly darkened. Sexual morph unknown.

Notes — Extremus is introduced as novel genus to accommodate fungal species isolated from rocks. Presently its morphology is only known from culture, where it appears to be extremely slow-growing, forming brown hyphae with disarticulating conidial chains. It clusters as a sister clade that are devriesia-like in morphology, namely D. americana (isolated from air, USA) and D. compacta (isolated from rocks, Spain), suggesting that these rock-inhabiting species could be aerially dispersed.

Extremus adstrictus (Egidi & Onofri) Quaedvlieg & Crous, comb. nov. — MycoBank MB808051

Basionym. Devriesia adstricta Egidi & Onofri, Fung. Diversity 65: 150. 2014.

Specimen examined. SPAIN, Mallorca, from rock, holotype CBS 118292 = TRN96, preserved in liquid nitrogen and in dried condition.

Extremus antarcticus (Selbmann & de Hoog) Quaedvlieg & Crous, comb. nov. — MycoBank MB808052

Basionym. Devriesia antarctica Selbmann & de Hoog, Fung. Diversity 65: 150. 2014.

Specimen examined. ANTARCTICA, Linnaeus Terrace, from rock, holotype CBS 136103 = CCFEE 451, preserved in liquid nitrogen and in dried condition.

Incertae sedis (Capnodiales)

Mucomycosphaerella Quaedvlieg & Crous, gen. nov. — MycoBank MB807791

Type species. Mucomycosphaerella eurypotami (Kohlm., Volkm.-Kohlm. & O.E. Erikss.) Quaedvlieg & Crous.

Etymology. Resembling the genus Mycosphaerella, except ascospores have mucoid sheaths.

Foliicolous. Ascomata pseudothecial, depressed ellipsoidal, immersed becoming erumpent, with central ostiole lacking periphyses, brown, dark brown at the ostiole, solitary or in clusters of two or more joined together; wall of textura angularis, consisting of 4–6 layers at the top, but only 2–3 layers at the sides and bottom. Hamathecium sparse, composed of branched and anastomosing septate pseudoparaphyses embedded in a gelatinous matrix. Asci ellipsoidal to ovoid, 8-spored, indistinctly pedicellate, bitunicate, fissitunicate, thick-walled, with a thin, tough ectotunica and a thick gelatinous, expanding endotunica. Ascospores bi- to triseriate, elongate ellipsoidal, sometimes inequilateral, 1-septate, with one additional pseudoseptum in each cell, slightly constricted at the septum, hyaline, guttulate, surrounded by a gelatinous sheath that is constricted around the septum.

Mucomycosphaerella eurypotami (Kohlm., Volkm.-Kohlm. & O.E. Erikss.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807792

Basionym. Mycosphaerella eurypotami Kohlm., Volkm.-Kohlm. & O.E. Erikss., Bot. Mar. 42, 6: 505. 1999.

Specimen examined. USA, North Carolina, Virginia, Carteret County, Broad Creek, N34°43', W76°55'07", on senescent leaves of Juncus roemerianus, 21 May 1996, B. & J. Kohlmeyer (holotype JK5586 in IMS, culture ex-type JK5586J).

Notes — Mucomycosphaerella is distinguished from Mycosphaerella s.str. by having well developed, persistent mucoid sheaths around its ascospores, and the absence of Ramularia asexual states. Its ascomata are depressed, and have a pale, thin-walled lower half, and a hamathecium of loosely branched, anastomosing hyphae in a hymenial gel, with hyaline ascospores (Kohlmeyer et al. 1999). Mucomycosphaerella eurypotami was included in Mycosphaerella as a temporary measure, until a formal revision of the genus (Kohlmeyer et al. 1999), which has been ongoing since the epitypification of the type species (Verkley et al. 2004), and the segregation of various allied genera and families (Crous et al. 2007b, 2009b).

The genus Mucomycosphaerella appears to represent a distinct family in the Capnodiales, sister to the Schizothyriaceae. More collections of additional taxa are needed to determine the extent of morphological variation before a formal family can be introduced.

Mycosphaerellaceae

Neopenidiella Quaedvlieg & Crous, gen. nov. — MycoBank MB807778

Type species. Neopenidiella nectandrae (Crous, U. Braun & R.F. Castañeda) Quaedvlieg & Crous.

Etymology. Named after its morphological similarity to the genus Penidiella.

Foliicolous. Conidiophores erect, straight, filiform, pluriseptate throughout, brown, darker below and paler above, thin-walled, smooth, apex penicillate, terminal cell of the conidiophore with short denticle-like loci giving rise to sets of conidiogenous cells or ramoconidia that then form a sequence of new sets of ramoconidia at different levels. Conidiogenous loci terminal or subterminal, usually 1–3(–4), subdenticulate, conical, apically truncate, mostly unthickened, slightly darkened-refractive. Ramoconidia with truncate base, barely or distinctly attenuated at the truncate base, aseptate, with 2–3(–4) subdenticulate hila at the apex, subcylindrical, pale olivaceous to olivaceous-brown or brown, thin-walled, smooth to faintly verruculose. Conidia in long acropetal chains, narrowly ellipsoid-ovoid, fusiform to cylindrical aseptate, pale olivaceous to olivaceous-brown or brown, thin-walled, smooth to faintly rough-walled; hila unthickened or almost so, slightly darkened-refractive.

Neopenidiella nectandrae (Crous, U. Braun & R.F. Castañeda) Quaedvlieg & Crous, comb. nov. — MycoBank MB807779

Basionym. Penidiella nectandrae Crous, U. Braun & R.F. Castañeda, Stud. Mycol. 58: 20. 2007.

Specimen examined. CUBA, Matanzas, San Miguel de los Baños, isolated from living leaves of Nectandra coriacea (Lauraceae), 24 Jan. 1987, R.F. Castañeda & G. Arnold, holotype INIFAT C87/45, culture ex-type CBS 734.87, and HAL 2018F.

Notes — Similar to Penidiella, but distinct in that conidiophores are long and filiform, ending in a subdenticulate apical cell that gives rise to sets of penicillate conidiogenous cells or ramoconidia. Ramoconidia and conidia are aseptate, pale olivaceous and consistently narrow. Penidiella has penicillate conidiophores with well-developed apical branches, and wider, 0–1-septate ramoconidia and conidia.

Amycosphaerella Quaedvlieg & Crous, gen. nov. — MycoBank MB807780

Type species. Amycosphaerellaafricana (Crous & M.J. Wingf.) Quaedvlieg & Crous.

Etymology. Named after the genus Mycosphaerella, to which it is morphologically similar.

Foliicolous, plant pathogenic Ascomata pseudothecial, amphigenous, solitary, black, subepidermal, globose, with central apical ostioles, becoming papillate; walls of 2–3 layers of medium brown textura angularis, subhymenium of 1–2 layers of hyaline cells. Asci obovoid to broadly ellipsoidal, straight or incurved, 8-spored. Ascospores bi- to triseriate, overlapping, hyaline, guttulate, straight, fusoid-ellipsoidal with obtuse ends, widest in middle of apical cells, medianly 1-septate, tapering toward both ends, but more prominently toward base.

Notes — Similar to species of Mycosphaerella based on morphology, distinct in that it does not produce a Ramularia asexual morph. Amycosphaerella is reliably distinguished from other genera in the family based on its DNA phylogeny, and either ITS or LSU sequence data differentiates these genera.

Amycosphaerella africana (Crous & M.J. Wingf.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807781

Basionym. Mycosphaerella africana Crous & M.J. Wingf., Mycologia 88, 3: 450. 1996.

≡Teratosphaeria africana (Crous & M.J. Wingf.) Crous & U. Braun, Stud. Mycol. 58: 8. 2007.

= Mycosphaerella ellipsoidea Crous & M.J. Wingf., Mycologia 88: 452. 1996.

= Mycosphaerella aurantia A. Maxwell, Mycol. Res. 107: 353. 2003.

Specimens examined. AUSTRALIA, Western Australia, Bunbury, Summerlea plantation of Western Australian Chip and Pulp (WACAP), E115°37', S33°40', on E. globulus, 1 May 2000, A. Maxwell (holotype of M. aurantia, PERTH 05849543, culture ex-type CBS 110500). – SOUTH AFRICA, Western Cape Province, Stellenbosch, Stellenbosch Mountain, leaves of E. viminalis, Oct. 1994, P.W. Crous (holotype of M. africana, PREM 51917, cultures ex type CPC 794–796 = CBS 116154, 116155, 680.95); Western Cape Province, Pampoenvlei, on leaves of E. cladocalyx, Nov. 1994, P.W. Crous (holotype of M. ellipsoidea, PREM 51924, cultures ex-type CPC 849–851, 850 = CBS 110843).

Notes — Mycosphaerella ellipsoidea and M. aurantia are morphologically identical, and synonymous with Amycosphaerella africana. Amycosphaerella africana was originally described from small, 1–2 mm diam, pale brown leaf spots. Subsequent collections have shown that leaf spots can be 2–10 mm diam. Furthermore, ascospores were described as fusoid-ellipsoidal, constricted at its septum, (7–)8–10(–11) × (2–)2.5–3 μm, germinating at angles to the long axis of the spore, and turn brown and distorted upon germination (Crous & Wingfield 1996), though the latter observation appears to have been incorrect. Additional collections have shown ascospores to also be up to 15 μm in length, not always constricted at septa, and in some cases germinate from polar ends with germ tubes parallel to the long axis, remain hyaline, and develop lateral branches (Maxwell et al. 2003).

Paramycosphaerella Crous, Persoonia 31: 245. 2013.

Paramycosphaerella intermedia (M.A. Dick & K. Dobbie)

Quaedvlieg & Crous, comb. nov. — MycoBank MB807782

Basionym. Mycosphaerella intermedia M.A. Dick & K. Dobbie, New Zealand J. Bot. 39: 272. 2001.

Specimen examined. NEW ZEALAND, Bay of Plenty, Rotoehu Forest, Kohekohe Road, on living leaves of E. saligna, 30 June 1998, L. Renney (holotype NZFR1-M 3831, cultures ex-type NZFS 301.10 = CBS 114356, 114415).

Notes — The synonymy of M. intermedia with M. marksii, as proposed by Hunter et al. (2006), is not supported. Although morphologically similar, these two species are phylogenetically distinct, and better accommodated as two separate species in the genus Paramycosphaerella (Crous et al. 2013).

Paramycosphaerella marksii (Carnegie & Keane) Quaedvlieg & Crous, comb. nov. — MycoBank MB807783

Basionym. Mycosphaerella marksii Carnegie & Keane, Mycol. Res. 98: 414. 1994.

Specimens examined. AUSTRALIA, Victoria, Briagolong, on leaves of E. globulus, 14 Oct. 1994, A. Carnegie, culture CPC 935 = CBS 110920. – SOUTH AFRICA, Northern Province, Tzaneen, Magoebaskloof, on leaves of E. grandis × saligna hybrid, Oct. 1994, G. Kemp (holotype of P. epispermogonia, PREM 51936, cultures of a Paramycosphaerella sp. possibly related to the asexual morph are CPC 822 = CBS 110750, CPC 823 = CBS 110693).

Notes — Paramycosphaerella marksii is a common pathogen of eucalypts. However, Pseudocercospora epispermogonia was found only once, sporulating on the outside of spermatogonia associated with leaf spots of Paramycosphaerella marksii on eucalypts (Crous & Wingfield 1996). Cultures of P. marksii are homothallic, and have failed to produce an asexual morph in culture, despite incubation on numerous media and under a range of growth conditions. The cultures associated with the type of Pseudocercospora epispermogonia were generated from ascospores of M. marksii. The synonymy proposed by Hunter et al. (2006) is premature, as it appears that there are no ex-type cultures of Pseudocercospora epispermogonia.

Phaeophleospora Rangel, Arq. Mus. Nac. Rio de Janeiro 18: 162. 1916

Notes — The genus Phaeophleospora is based on P. eugeniae, which occurs on leaf spots of Eugenia uniflora (Myrtaceae) in Brazil (Crous et al. 1997). For several years this genus represented species that are presently accommodated in Teratosphaeria (= Kirramyces) (Andjic et al. 2007, Crous et al. 2007a). The taxa allocated to Phaeophleospora here are sexual, and lack any asexual state, but are placed in Phaeophleospora based on phylogenetic inference.

Phaeophleospora gregaria (Carnegie & Keane) Quaedvlieg & Crous, comb. nov. — MycoBank MB807784

Basionym. Mycosphaerella gregaria Carnegie & Keane, Mycol. Res. 101: 843. 1997.

≡ Mycosphaerella aggregata Carnegie & Keane, Mycol. Res. 98: 415. 1994. Nom. illegit (Art. 53.1).

Specimen examined. AUSTRALIA, Victoria, Nowa Nowa, on leaves of E. grandis, 11 Nov. 1990, A.J. Carnegie (holotype IMI 353729b, isotype VPRI 20739a, culture ex-type DAR 72368).

Phaeophleospora scytalidii (Crous & M.J. Wingf.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807785

Basionym. Mycosphaerella scytalidii Crous & M.J. Wingf., Stud. Mycol. 55: 120. 2006.

Specimen examined. COLOMBIA, Angela Maria, on leaves of E. urophylla, Jan. 2004, M.J. Wingfield (holotype CBS H-19696, culture ex-type CBS 118493 = CPC 10998).

Phaeophleospora stramenti (Crous & Alfenas) Quaedvlieg & Crous, comb. nov. — MycoBank MB807786

Basionym. Mycosphaerella stramenti Crous & Alfenas, Stud. Mycol. 55: 123. 2006.

Specimen examined. BRAZIL, Minas Gerais, Belo Oriente, on leaf litter of Eucalyptus sp., 24 Jan. 2004, A.C. Alfenas (holotype CBS H-19698, culture ex-type CBS 118909 = CPC 11545–11547).

Pseudocercospora eucalyptorum Crous, M.J. Wingf., Marasas & B. Sutton, Mycol. Res. 93: 394. 1989

= Pseudocercospora pseudoeucalyptorum Crous, Stud. Mycol. 50: 210. 2004.

Specimens examined. SOUTH AFRICA, Western Cape Province, Stellenbosch, Stellenbosch Mountain, on leaves of E. nitens, 21 Dec. 1987, P.W. Crous (holotype of P. eucalyptorum, PREM 49112, cultures ex-type CPC 16 = CBS 110777). – SPAIN, Pontevedra, Lourizán, Areeiro, on leaves of E. globulus, 2003, J.P. Mansilla (holotype of P. pseudoeucalyptorum, CBS H-9893, culture ex-type CPC 10390 = CBS 114242).

Notes — The synonymy of P. pseudoeucalyptorum under P. eucalyptorum was discussed by Crous et al. (2013), and is again confirmed in the present study, which incorporates yet more gene loci.

Xenomycosphaerella Quaedvlieg & Crous, gen. nov. — MycoBank MB807787

Type species. Xenomycosphaerella elongata (Crous & M.J. Wingf.) Quaedvlieg & Crous.

Etymology. Resembling Mycosphaerella, but phylogenetically distinct.

Foliicolous, plant pathogenic. Ascomata pseudothecial, dark brown, subepidermal to erumpent, globose, with an apical ostiole; wall of 2–3 layers of medium brown textura angularis. Asci aparaphysate, fasciculate, bitunicate, subsessile, obovoid to broadly ellipsoidal, straight to slightly curved, 8-spored. Ascospores bi- to multiseriate, overlapping, hyaline, thin- or thick-walled, straight to slightly curved, fusoid-ellipsoidal with obtuse ends, widest in middle of the apical cell, medianly or unequally 1-septate, tapering towards both ends, but more prominently towards the lower end. The genus Xenomycosphaerella is only distinguishable from Mycosphaerella based on DNA sequence data. Either ITS or LSU sequence data can easily differentiate between these genera.

Notes — Xenomycosphaerella is morphologically a typical species of Mycosphaerella s.l., but is phylogenetically distinct. Presently no asexual morphs are known, and the only distinguishing characters from Mycosphaerella are to be found in its DNA sequences.

Xenomycosphaerella elongata (Crous & M.J. Wingf.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807788

Basionym. Mycosphaerella elongata Crous & M.J. Wingf., Fung. Diversity 26: 163. 2007.

Specimen examined. VENEZUELA, El Piñal Lotes farm near Acarigua, on leaves of Eucalyptus camaldulensis × urophylla, Oct. 2006, M.J. Wingfield (holotype CBS-H 19824, cultures ex-type CPC 13378 = CBS 120735, CPC 13379–13380).

Xenomycosphaerella yunnanensis (Barber & T.I. Burgess) Quaedvlieg & Crous, comb. nov. — MycoBank MB807789

Basionym. Mycosphaerella yunnanensis Barber & T.I. Burgess, Fung. Diversity 24: 150. 2007.

Specimen examined. CHINA, Yunnan, Lancang, leaves of Eucalyptus urophylla, May 2005, B. Dell (holotype MURU 407, culture ex-type CBS 119975 = CMW 23443).

Zasmidium Fr., Summa Veg. Scand., section Post. (Stockholm): 407. 1849

Zasmidium eucalyptorum (Crous & M.J. Wingf.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807790

Basionym. Mycosphaerella eucalyptorum Crous & M.J. Wingf., Stud. Mycol. 55: 112. 2006.

Specimen examined. INDONESIA, on leaves of Eucalyptus sp., Mar. 2004, M.J. Wingfield (holotype CBS H-19689, culture ex-type CBS 118496 = CPC 11174).

Neodevriesiaceae

Neodevriesiaceae Quaedvlieg & Crous, fam. nov. — MycoBank MB807766

Type genus. Neodevriesia Quaedvlieg & Crous.

Ascomata when present pseudothecial, black, immersed, sub-stomatal on leaves; wall with 2–3 layers of medium brown textura angularis. Asci aparaphysate, fasciculate, bitunicate, subsessile, obovoid to broadly ellipsoid, straight to slightly curved, 8-spored. Ascospores tri- to multiseriate, overlapping, hyaline, non-guttulate, thick-walled, straight, fusoid-ellipsoidal with obtuse ends, medianly 1-septate; germinating ascospores on MEA become brown and verruculose. Asexual morphs variable, filamentous. Conidiophores pigmented, proliferating sympodially. Conidia brown, solitary or in short mostly unbranched chains, subcylindrical to narrowly fusoid-ellipsoidal or obclavate, rarely septate, solitary conidia composed of a central stalk and two lateral arms with 1–2 transverse septa.

Notes — Members of Neodevriesiaceae are foliicolous, saprobic or plant pathogenic, and form part of which Ruibal et al. (2009) referred to as ‘Teratosphaeriaceae 2’ (now Neodevriesiaceae), in their DNA phylogenies. Several genera await to be described in this family, pending further collections. Morphologically, Neodevriesiaceae is similar to Teratosphaeriaceae, but further sampling is needed to highlight the ecological differences between the two families.

Neodevriesia Quaedvlieg & Crous, gen. nov. — MycoBank MB807768

Type species. Neodevriesia hilliana (Crous & U. Braun) Quaedvlieg & Crous.

Etymology. Named after its morphological similarity to Devriesia.

Hyphomycetous, foliicolous. Conidiophores dimorphic or not, solitary, medium brown, unbranched, smooth- and thick-walled, flexuous, septate. Conidiogenous cells terminal, medium brown, subcylindrical, smooth, proliferating sympodially; hila flattened, unthickened, somewhat darkened. Ramoconidia 0(–1)-septate if present, guttulate, subcylindrical, smooth, pale brown; hila somewhat thickened and darkened. Conidia medium brown, smooth, subcylindrical to narrowly fusoid-ellipsoidal or obclavate, apical conidium with obtuse apex, additional conidia with truncate ends, conidia straight to irregularly bent, mostly in unbranched chains; hila slightly darkened.

Notes — The genus Devriesia was introduced for a group of cladosporium-like heat tolerant hyphomycetes that are soil-inhabiting, with slightly darkened, planate, unthickened conidial scars, forming chlamydospores in culture (Seifert et al. 2004). Since then, several devriesia-like species were isolated from leaf litter or leaf spots, and placed in this genus based on molecular phylogenies, pending the sampling of more taxa, that would allow resolution of this generic complex.

Ecologically, the devriesia-like species do not exhibit heat resistance and also do not form chlamydospores (other than odd hyphal swellings in older cultures), which differs from Devriesia. Neodevriesia is also distinct from Devriesia s.str. in that conidiophores are medium brown and unbranched (pale brown and branched in Devriesia), conidia are thick-walled, medium brown, rarely septate, and conidial chains are short and mostly unbranched.

Neodevriesia hilliana (Crous & U. Braun) Quaedvlieg & Crous, comb. nov. — MycoBank MB807771

Basionym. Devriesia hilliana Crous & U. Braun, Stud. Mycol. 64: 37. 2009.

Specimen examined. NEW ZEALAND, Auckland, Auckland University Campus, Princes Street, on Macrozamia communis, 20 Apr. 2008, C.F. Hill, holotype CBS H-20340, culture ex-type CPC 15382 = CBS 123187.

Neodevriesia xanthorrhoeae (Crous, Pascoe & Jacq. Edwards) Quaedvlieg & Crous, comb. nov. — MycoBank MB808061

Basionym. Devriesia xanthorrhoeae Crous, Pascoe & Jacq. Edwards, Persoonia 25: 155. 2010.

Specimen examined. AUSTRALIA, Victoria, Grampians, S37°37'7.5" E142° 19'32.3" on leaves of Xanthorrhoea australis (Xanthorrhoeaceae), 21 Oct. 2009, P.W. Crous, I.G. Pascoe & J. Edwards, holotype CBS-H 20500, cultures ex-type CPC 17721, 17720 = CBS 128219.

Teratosphaeriaceae

Austroafricana Quaedvlieg & Crous, gen. nov. — MycoBank MB807793

Type species. Austroafricana associata (Crous & Carnegie) Quaedvlieg & Crous.

Etymology. Named after its occurrence in the Southern Hemisphere.

Foliicolous, plant pathogenic. Ascomata pseudothecial, black, subepidermal to erumpent, globose, with central apical ostiole; wall consisting of 2–3 layers of medium brown textura angularis. Asci aparaphysate, but with remains of hamathecium visible, fasciculate, bitunicate, subsessile, obovoid to ellipsoidal, straight to slightly curved, 8-spored. Ascospores tri- to multiseriate, overlapping, hyaline, guttulate, thick-walled, straight, fusoid-ellipsoidal with obtuse ends, medianly 1-septate, tapering towards both ends, but more prominently towards the lower end; ascospores with or without persistent mucus sheath. Germinating ascospores become either verruculose, brown and distorted, or remain hyaline and undistorted.

Notes — Morphologically, Austroafricana resembles species of Teratosphaeria, and we have been unable to find characters to separate them. An ecological distinction is that species of Austroafricana co-colonise lesions of hosts with other ascomycetes, and have a wide host range. Austroafricana parva, for example, has been well documented as a pathogen of Eucalyptus and Proteaceae (Crous et al. 2008). Either ITS or LSU sequence data differentiate Austroafricana and Teratosphaeria.

Austroafricana associata (Crous & Carnegie) Quaedvlieg & Crous, comb. nov. — MycoBank MB807794

Basionym. Mycosphaerella associata Crous & Carnegie, Fung. Diversity 26: 159. 2007.

≡ Teratosphaeria associata (Crous & Carnegie) Crous & U. Braun, Stud. Mycol. 58: 9. 2007.

Specimen examined. AUSTRALIA, New South Wales, South Grafton, Grafton City Council Landfill Plantation, E152°54'38", S29°46'21", on leaves of Corymbia henryii, 16 Feb. 2006, A.J. Carnegie (holotype CBS-H 19833, isotype DAR 78031, cultures ex-type CPC 13119 = CBS 120730, CPC 13120, occurring with Lembosina sp.).

Austroafricana keanei (Carnegie & G.S. Pegg) Quaedvlieg & Crous, comb. nov.— MycoBank MB807795

Basionym. Teratosphaeria keanei Carnegie & G.S. Pegg, Australas.Pl. Pathol. 40: 368. 2011.

Specimen examined. AUSTRALIA, Queensland, Kingaroy, Berry’s Plantation, on living leaves of E. globulus × E. camaldulensis, 14 Feb. 2004, A.J. Carnegie (holotype BRIP 52593b, culture ex-type CBS 130524).

Austroafricana parva (R.F. Park & Keane) Quaedvlieg & Crous, comb. nov. — MycoBank MB807796

Basionym. Mycosphaerella parva R.F. Park & Keane, Trans. Brit. Mycol. Soc. 79: 99. 1982.

≡ Teratosphaeria parva (R.F. Park & Keane) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

= Mycosphaerella grandis Carnegie & Keane, Mycol. Res. 98: 414. 1994.

Specimen examined. SOUTH AFRICA, Western Cape Province, Stellenbosch, on leaves of Eucalyptus sp., Dec. 2003, P.W. Crous, CPC 10935 = CBS 116289.

Eupenidiella Quaedvlieg & Crous, gen. nov. — MycoBank MB807797

Type species. Eupenidiella venezuelensis (Crous & U. Braun) Quaedvlieg & Crous.

Etymology. Named after its similarity to the genus Penidiella.

Hyphomycetous, associated with opportunistic human infections. Mycelium consisting of branched, septate, smooth to finely verruculose, thin-walled, subhyaline, pale olivaceous to medium brown hyphae. Conidiophores solitary, erect, subcylindrical, straight to flexuous to once geniculate, septate, pale to medium olivaceous-brown or brown, thin-walled, terminally penicillate, branched portion composed of true branchlets and/or a single set or several sets of ramoconidia, branchlets; occasionally with a few additional conidiophores reduced to conidiogenous cells. Conidiogenous cells terminal and intercalary, unbranched, subcylindrical, medium brown, smooth to finely verruculose, with 1–3(–4) flat-tipped, loci slightly thickened and darkened-refractive loci, often subdenticulate. Conidia ellipsoid-ovoid, subcylindrical, pale to medium olivaceous-brown or brown, finely verruculose, in branched chains; ramoconidia 0–1(–3)-septate, with 1–3 subdenticulate apical hila; secondary conidia 0(–1)-septate, ellipsoid, obovoid to irregular, hila sometimes slightly thickened and darkened-refractive.

Notes — Eupenidiella is similar to Penidiella, but differs in having dimorphic conidiophores, and conidiogenous loci that are subdenticulate, and slightly darkened-refractive. In contrast, they are barely darkened-refractive in Penidiella, and not subdenticulate.

Eupenidiella venezuelensis (Crous & U. Braun) Quaedvlieg & Crous, comb. nov. — MycoBank MB807798

Basionym. Penidiella venezuelensis Crous & U. Braun, Stud. Mycol. 58: 24. 2007.

Specimen examined. VENEZUELA, isolated from man with tinea nigra, Jan. 1975, D. Borelli (holotype CBS H-19934, culture ex-type CBS 106.75).

Euteratosphaeria Quaedvlieg & Crous, gen. nov. — MycoBank MB807799

Type species. Euteratosphaeria verrucosiafricana (Crous & M.J. Wingf.) Quaedvlieg & Crous.

Etymology. Named after the genus Teratosphaeria.

Foliicolous, plant pathogenic.Ascomata pseudothecial, solitary, black, immersed becoming erumpent, globose; ostiole apical, central; wall of 2–3 layers of medium brown textura angularis. Asciaparaphysate, fasciculate, bitunicate, subsessile, obovoid to narrowly ellipsoid, straight or slightly incurved, 8-spored. Ascospores tri- to multiseriate, overlapping, hyaline, guttulate, thin-walled, straight, ellipsoid with obtuse ends, medianly 1-septate, tapering towards both ends, but more prominently towards the lower end.

Notes — Euteratosphaeria is morphologically similar to species of Teratosphaeria. The type species, E. verrucosiafricana, is distinct from species in Teratosphaeria in that ascospores turn brown and verruculose upon germination, but germinate with more than two germ tubes (which remain hyaline), and grow irregular to the long axis of the spore. More taxa need to be collected to determine if this is a feature of value at species or generic level. Colonies in culture remain sterile, have sparse aerial mycelium, and form chains of dark brown, thick-walled chlamydospores that aggregate into small microsclerotia.

Euteratosphaeria verrucosiafricana (Crous & M.J. Wingf.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807800

Basionym. Mycosphaerella verrucosiafricana Crous & M.J. Wingf., Stud. Mycol. 55: 125. 2006.

Specimen examined. INDONESIA, Northern Sumatra, on leaves of Eucalyptus sp., Feb. 2004, M.J. Wingfield (holotype CBS H-19705, culture ex-type CBS 118496 = CPC 11167, CBS 118497 = CPC 11169, CBS 118498 = CPC 11170).

Myrtapenidiella Quaedvlieg & Crous, gen. nov. — MycoBank MB807801

Type species. Myrtapenidiella tenuiramis (Crous & Summerell) Quaedvlieg & Crous.

Etymology. Named after its similarity to the genus Penidiella and the host plant family, Myrtaceae.

Hyphomycetous, foliicolous, saprobic. Mycelium consisting of branched, septate, smooth to slightly verruculose or warty, pale to dark brown hyphae. Conidiophores dimorphic. Microconidiophores reduced to conidiogenous cells, lateral on hyphae, with or without a basal septum. Macroconidiophores erect, arising as lateral branches from superficial hyphae, or as terminal ends of creeping hyphae, variable in length, pale to dark brown, smooth to finely verruculose. Conidiogenous cells terminal, rarely intercalary, cylindrical, tapering to a flattened apical region, finely verruculose, medium brown, paler toward the apex, with up to two conidiogenous loci, often apical, sometimes situated on small lateral shoulders, loci truncate, not denticulate; scars slightly thickened, darkened, visible as small dark circles when viewed directly from above. Ramoconidia subcylindrical or obovoid, 0–3-septate, base subtruncate to slightly rounded, but not coronate, pale to medium brown, finely verruculose, slightly thick-walled; hila thickened and darkened. Conidia in branched acropetal chains, broadly fusiform to obovoid or subcylindrical, 0–1-septate, pale to medium brown; wing-like mucoid sheaths present in some species. Chlamydospores globose to subovoid, dark brown, thin-walled, terminal or intercalary, mostly 1-celled, rarely septate, produced from narrow hyphae.

Notes — Myrtapenidiella is distinguished from Penidiella by having dimorphic conidiophores with irregular branching patterns, septate ramoconidia, with hila that are slightly thickened and darkened. Some species of Myrtapenidiella form chlamydospores, or have wing-like mucoid sheaths on conidia, although these do not appear to be generic features shared by all taxa. All species presently known occur on members of the Myrtaceae.

Myrtapenidiella corymbia (Cheew. & Crous) Quaedvlieg & Crous, comb. nov. — MycoBank MB807802

Basionym. Penidiella corymbia Cheew. & Crous, Persoonia 23: 72. 2009.

Specimen examined. AUSTRALIA, Northern Territory, Emerald Springs, S13°37'13.3" E131°36'40", on Corymbia foelscheana, 22 Sept. 2007, coll. B.A. Summerell, isol. P.W. Crous (holotype CBS H-20288, culture ex-type CPC 14640 = CBS 124769, CPC 14641, 14642).

Myrtapenidiella eucalypti (Cheew., K.D. Hyde & Crous)

Quaedvlieg & Crous, comb. nov. — MycoBank MB807803

Basionym. Penidiella eucalypti Cheew., K.D. Hyde & Crous, Persoonia 21: 86. 2008.

Specimens examined. THAILAND, Payakpoompisai, Mahasarakam, on leaves of E. camaldulensis, July 2007, P. Suwannawong (holotype CBS H-20136, cultures ex-type CBS 123246 = CPC 15411, AGI064.1, AGI064.2; occurring on a lesion in association with Harknessia sp.); Satuk, Burirum, on leaves of E. camaldulensis, July 2007, R. Cheewangkoon, cultures CBS 123245, CPC 15449 (occurring on a lesion in association with several microfungi).

Myrtapenidiella tenuiramis (Crous & Summerell) Quaedvlieg & Crous, comb. nov. — MycoBank MB807804

Basionym. Penidiella tenuiramis Crous & Summerell, Persoonia 23: 127. 2009.

Specimen examined. AUSTRALIA, Tasmania, Tasman Peninsula, Brown Mountain walk, S43°11'13.9" E147°51'00.8", on leaves of E. tenuiramis, 14 Oct. 2006, coll. B.A. Summerell & P. Summerell (holotype CBS H-20253, isol. P.W. Crous, cultures ex-type CPC 13692 = CBS 124993, CPC 12693, 13694).

Neocatenulostroma Quaedvlieg & Crous, gen. nov. — MycoBank MB807805

Type species. Neocatenulostroma microsporum (Joanne E. Taylor & Crous) Quaedvlieg & Crous.

Etymology. Named after the genus Catenulostroma.

Plant pathogenic (foliicolous) and saprobic. Mycelium immersed, pale brown, septate, smooth. Ascomata amphigenous, immersed, substomatal, subepidermal, with small or no papilla, globose to slightly subglobose, with periphysate central ostiole. Peridium comprising two strata, the outer stratum of thick-walled, medium brown small-celled textura angularis, becoming thinner-walled and hyaline in the inner stratum. Asci obclavate to globose, bitunicate, sessile, narrowing to a rounded apex, 8-spored. Ascospores broadly fusiform, medianly 1-septate, hyaline to pale brown, smooth, eguttulate, with obtuse apices, with or without a mucilaginous sheath. Colonies sporodochial, pulvinate, dry, dark brown to black. Conidiophores macronematous, mainly straight, caespitose, closely packed, emerging through stomata forming the sporodochia, short, smooth, olivaceous-brown. Conidiogenous cells irregularly cylindrical, terminal, holoblastic, delimitation of conidium by a single septum, with retrogressive delimitation of next conidium, giving an unconnected chain of conidia, secession schizolytic. Conidia variously shaped, cylindrical, Y-shaped, ellipsoidal, straight or curved, with rounded or truncated apices, catenate in branched basipetal chains, which are schizogenous, olivaceous to red-brown, multiseptate, with transverse and often longitudinal or oblique septa.

Notes — Species of Trimmatostroma s.str. are genetically distinct from Catenulostroma. Furthermore, they are also ecologically different, in that Trimmatostroma includes taxa that are saprobic, and occur on dead twigs and branches, and not associated with leaf spots (Crous et al. 2007a). Catenulostroma presently contains several undescribed genera in the Teratosphaeriaceae. They share colonies that are sporodochial, pulvinate, dry, dark brown to black, giving rise to chains of multiseptate, brown conidia.

Neocatenulostroma includes species that are plant pathogenic (N. abietis, N. microsporum) or occur on rocks (N. germanicum). Although N. abietis and N. microsporum were considered plant pathogenic (Butin et al. 1996, Taylor & Crous 2000), N. abietis has since been isolated from a range of substrates, commonly as either a saprobe or endophyte in pine needles. The genus Catenulostroma is based on C. protearum, which is associated with dead leaves of Proteaceae, and probably is not plant pathogenic (Crous et al. 2009b). Morphologically, Catenulostroma s.str. contains colonies that produce muriform eu- or distoseptate conidia in branched chains. Neocatenulostroma on the other hand, has chains of irregularly branched conidia with transverse, longitudinal or oblique septa, variously shaped, from cylindrical to Y-shaped or ellipsoidal.

Neocatenulostroma abietis (Butin & Pehl) Quaedvlieg & Crous, comb. nov. — MycoBank MB807806

Basionym. Trimmatostroma abietis Butin & Pehl, Antonie van Leeuwenhoek 69: 204. 1996.

≡ Catenulostroma abietis (Butin & Pehl) Crous & U. Braun, Stud. Mycol. 58: 15. 2007.

Specimen examined. SWEDEN, Götenborg, isolated from outdoor painted walls, culture CBS 110038.

Neocatenulostroma germanicum (Crous & U. Braun) Quaedvlieg & Crous, comb. nov. — MycoBank MB807807

Basionym. Catenulostroma germanicum Crous & U. Braun, Stud. Mycol. 58: 16. 2007.

Specimen examined. GGERMANY (former West-Germany), isolated from stone, Oct. 1988, J. Kuroczkin (holotype CBS H-19936, culture ex-type CBS 539.88).

Neocatenulostroma microsporum (Joanne E. Taylor & Crous) Quaedvlieg & Crous, comb. nov. — MycoBank MB807808

Basionym. Trimmatostroma microsporum Joanne E. Taylor & Crous, Mycol. Res. 104: 631. 2000.

≡ Catenulostroma microsporum (Joanne E. Taylor & Crous) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

= Teratosphaeria microspora Joanne E. Taylor & Crous, Mycol. Res. 104: 631. 2000.

Specimens examined. SOUTH AFRICA, Western Cape Province, Somerset West, Hilly Lands Farm, on a living leaf of a Protea cynaroides, 21 July 1998, S. Denman & J.E. Taylor (holotype of Teratosphaeria microspora, PREM 56207a, culture ex-type CPC 1960 = CBS 101951; holotype of Trimmatostroma microspora, PREM 56207b, CPC 1832 = CBS 110890).

Neohortaea Quaedvlieg & Crous, gen. nov. — MycoBank MB807809

Type species. Neohortaea acidophila (Hölker, Bend, Pracht, Tetsch, Tob. Müll., M. Höfer & de Hoog) Quaedvlieg & Crous.

Etymology. Named after its morphological similarity to the genus Hortaea.

Colonies smooth, mucilaginous, black. Mycelium consisting of pale olivaceous, thin-walled hyphae that become dark brown with thick walls, producing copious mucus. Conidiogenous cells integrated on hyphae, reduced to conidiogenous loci, with several minute percurrent proliferations. Conidia initially subhyaline, smooth, thin-walled, ellipsoidal, becoming dark brown, broadly ellipsoid to clavate, septum median, hilum truncate with minute marginal frill; conidiation microcyclic.

Notes — Morphologically similar to Hortaea (Teratosphaeriaceae), except that the latter has prominently annellate conidiogenous loci, and conidia that develop several septa, forming chlamydospores with age (de Hoog et al. 2000, Plemenitas et al. 2008).

Neohortaea acidophila (Hölker, Bend, Pracht, Tetsch, Tob. Müll., M. Höfer & de Hoog) Quaedvlieg & Crous, comb. nov. — MycoBank MB807810

Basionym. Hortaea acidophila Hölker, Bend, Pracht, Tetsch, Tob. Müll., M. Höfer & de Hoog, Antonie van Leeuwenhoek 86: 293. 2004.

Specimen examined. GERMANY, Bergheim, from lignite, May 2001, U. Hölker, culture ex-type CBS 113389.

Neophaeothecoidea Quaedvlieg & Crous, gen. nov. — MycoBank MB807811

Type species. Neophaeothecoidea proteae (Crous) Quaedvlieg & Crous.

Etymology. Named after its similarity to the genus Phaeothecoidea.

Hyphomycetous, saprobic. Hyphaein vitro creeping, brown, verruculose, branched, septate, becoming swollen, verruculose, dark brown, or forming a mucoid capsule filled with endoconidia derived from hyphal cells that turn brown and become thick-walled; end cells divide into several endoconidia, which are released upon rupture of the cell wall. Endoconidia medium to dark brown, verruculose to verrucose to warty, thick-walled, ellipsoid to obovoid or obclavate; after liberation swelling, becoming transversely 1-septate, or with several oblique septa, again forming endoconidia, becoming warty with age, the outer layer peels off after endoconidia are released.

Notes — Neophaeothecoidea proteae was initially described in Phaeothecoidea as it clustered close to other species of Phaeothecoidea s.str. However, N. proteae was originally isolated as a coelomycete. In culture, it grew like a yeast, and was thought to represent Coniothyrium leucospermi (= Coniozyma leucospermi; Swart et al. 1998, Taylor & Crous 2001, Marincowitz et al. 2008). Based on present data, it appears to represent a distinct genus.

Neophaeothecoidea proteae (Crous) Quaedvlieg & Crous, comb. nov. — MycoBank MB807812

Basionym. Phaeothecoidea proteae Crous, Persoonia 20: 71. 2008.

Specimen examined. SOUTH AFRICA, Western Cape Province, Stellenbosch, Elsenburg Farm, on leaves of Protea repens, 23 July 1999, S. Denman (holotype CBS H-20092, cultures ex-type CPC 2828–2830, 2831 = CBS 114129).

Neotrimmatostroma Quaedvlieg & Crous, gen. nov. — MycoBank MB807813

Type species. Neotrimmatostroma excentricum (B. Sutton & Ganap.) Quaedvlieg & Crous.

Etymology. Named after its similarity to the genus Trimmatostroma.

Foliicolous, plant pathogenic. Ascomata pseudothecial, separate, dark brown, subepidermal, becoming erumpent, globose; ostiole apical, central, frequently opening by irregular rupture; wall of 2–3 layers of dark brown, thick-walled textura angularis. Asci fasciculate, bitunicate, aparaphysate (remains of the hamathecium observed in some ascomata), 8-spored, obovoid to broadly ellipsoidal, straight to slightly incurved. Ascospores tri- to multiseriate, fusoid-ellipsoidal with obtuse ends, hyaline, smooth, pale brown and verruculose in old asci, becoming 3-septate, not constricted at median septum, thick-walled, guttulate, widest in the middle of the apical cell, with persistent mucous sheath. Conidiomata sporodochial, at times concentrically arranged, dark brown to black, dry, powdery, confined to the lesions. Conidiophores branched at base, pale brown, smooth, loosely aggregated, pale brown. Conidiogenous cells terminal, cylindrical to doliiform, holothallic, pale brown. Conidia formed in basipetal chains, smooth, medium brown, 4-celled, consisting of two basal cells with truncate lateral sides (adhesion scars present when catenulate), each giving rise to a secondary globose apical cell, that may extend and develop two additional septa; septa dark brown and thick-walled between the primary and secondary cells.

Notes — Neotrimmatostroma is distinguished from Teratosphaeria in that its ascospores become brown and up to 3-septate in older asci, have a persistent mucoid sheath, and frequently have remnants of the hamathecium in the ascomatal cavity. The asexual morph is distinguished from Trimmatostroma in that it is plant pathogenic, and conidiogenous cells give rise to 4-celled conidia with two basal cells that have truncate lateral sides and two globose apical cells, separated by dark brown, thick-walled septa. Although there are presently no cultures available of Trimmatostroma bifarium, which is also pathogenic to Eucalyptus, the latter fungus is clearly congeneric with N. excentricum.

Neotrimmatostroma bifarium (Gadgil & M.A. Dick) Quaedvlieg & Crous, comb. nov. — MycoBank MB807814

Basionym. Trimmatostroma bifarium Gadgil & M.A. Dick, New Zealand J. Bot. 21: 49. 1983.

Description and illustration — Gadgil & Dick 1983, Park et al. 2000.

Specimen examined. NEW ZEALAND, Kinleith, on leaves of E. regnans, Sept. 1981, D.J. Rawcliffe (holotype NZFRI, isotype PDD 42845).

Neotrimmatostroma excentricum (B. Sutton & Ganap.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807815

Basionym. Trimmatostroma excentricum B. Sutton & Ganap., New Zealand J. Bot. 16: 529. 1978.

≡ Catenulostroma excentricum (B. Sutton & Ganap.) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

= Mycosphaerella excentrica Crous & Carnegie, Fung. Diversity 26: 164. 2007.

≡ Teratosphaeria excentrica (Crous & Carnegie) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

Description and illustration — Sutton & Ganapathi 1978, Crous et al. 2007c.

Specimen examined. AUSTRALIA, New South Wales, Mackenzie Creek Road, Kempsey, Byrne Plantation, E152°27'47" S30°53'15", on leaf spots of E. agglomerata, 13 Apr. 2005, G. Price (holotype of sexual morph CBS H-19829, isotype DAR 78033, culture ex-type CPC 13092 = CBS 121102).

Apenidiella Quaedvlieg & Crous, gen. nov. — MycoBank MB807816

Type species. Apenidiella strumelloidea (Milko & Dunaev) Quaedvlieg & Crous.

Etymology. Named after its similarity to the genus Penidiella.

Hyphomycetous, saprobic. Mycelium consisting of branched, septate, smooth, hyaline to pale olivaceous, hyphae, sometimes constricted at dark septa. Conidiophores solitary, erect, arising from superficial mycelium, reduced to conidiogenous cells or macronematous, subcylindrical, straight to slightly curved, sometimes attenuated towards the apex, septate, medium brown, smooth, apex with a terminal conidiogenous cell giving rise to a single set of ramoconidia. Conidiogenous cells terminal, integrated, subcylindrical, straight, pale brown, thin-walled, smooth, apex obtusely rounded to somewhat clavate; loci terminal, occasionally subterminal or lateral, unthickened to slightly thickened and darkened, not refractive. Conidia in branched chains; ramoconidia subcylindrical, with 1–3 terminal loci, olivaceous-brown, smooth; secondary conidia ellipsoidal, with one side straight and the other convex, straight to slightly curved, subhyaline to olivaceous-brown, smooth, thin-walled; hila unthickened to slightly thickened and darkened, not refractive.

Notes — Apenidiella is distinct from Penidiella in that conidiophores end with a solitary conidiogenous cell that gives rise to a single set of ramoconidia (thus not penicillate with branches as in Penidiella s.str.). Ramoconidia and conidia are aseptate, smooth and thin-walled, subhyaline to olivaceous-brown. Nosrati et al. (2010) reported this fungus to be pathogenic to greenhouse cucumbers in Iran. However, based on their illustrations, they appear to have been working with a species of Cladosporium (brown conidia with darkened, thickened, refractive scars; see Bensch et al. 2012).

Apenidiella strumelloidea (Milko & Dunaev) Quaedvlieg & Crous, comb. nov. — MycoBank MB807817

Basionym. Cladosporium strumelloideum Milko & Dunaev, Novosti Sist. Nizsh. Rast. 23: 134. 1986.

≡ Penidiella strumelloidea (Milko & Dunaev) Crous & U. Braun, Stud. Mycol. 58: 23. 2007.

Specimen examined. RUSSIA, Yaroslavl Region, Rybinsk Reservoir, mouth of Sutka River, isolated from leaf of Carex sp. (Cyperaceae), from stagnant water, S. Ozerskaya (holotype BKMF-2534, culture ex-type CBS 114484).

Parateratosphaeria Quaedvlieg & Crous, gen. nov. — MycoBank MB807818

Type species. Parateratosphaeria bellula (Crous & M.J. Wingf.) Quaedvlieg & Crous.

Etymology. Named after its similarity to the genus Teratosphaeria.

Foliicolous, plant pathogenic. Ascomata amphigenous, immersed, substomatal, black, singular, gregarious; pyriform or globose, with a non-periphysate to periphysate papillate ostiole, becoming erumpent through the stomatal pore. Peridium with 3–4 layers of compressed textura angularis that comprise an outer stratum of dark brown thick-walled cells with large lumina that become hyaline and thin-walled in the inner stratum. Paraphyses absent. Asci obclavate to cylindrical, pedicel short, straight, tapering to a narrow rounded apex with an indistinct ocular chamber, 8-spored, bitunicate with fissitunicate dehiscence. Ascospores overlapping bi- to multiseriate, 1-septate, fusiform to ellipsoidal, with obtuse ends, straight, hyaline, guttulate, surrounded by an inconspicuous mucilaginous sheath. Germinating ascospores become brown and verruculose.

Notes — Parateratosphaeria is morphologically indistinguishable from Teratosphaeria. Ascospores turn brown and verruculose during germination and some species also have a mucoid sheath, though these features also occur in some taxa of Teratosphaeria s.str. The genus Parateratosphaeria is only distinguishable from Teratosphaeria based on DNA sequence data. Either ITS or LSU sequence data differentiates these genera.

Parateratosphaeria altensteinii (Crous) Quaedvlieg & Crous, comb. nov. — MycoBank MB807819

Basionym. Teratosphaeria altensteinii Crous, Persoonia 21: 139. 2008.

Specimen examined. SOUTH AFRICA, Western Cape Province, Kirstenbosch Botanical Garden, on living leaves of Encephalartos altensteinii, 6 Jan. 2008, P.W. Crous, M.K. Crous, M. Crous & K. Raath (holotype CBS H-20162, culture ex-type CPC 15133 = CBS 123539, CPC 15134–15135).

Parateratosphaeria bellula (Crous & M.J. Wingf.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807820

Basionym. Mycosphaerella bellula Crous & M.J. Wingf., Mycotaxon 46: 20. 1993.

≡ Teratosphaeria bellula (Crous & M.J. Wingf.) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

Specimen examined. SOUTH AFRICA, Western Cape Province, Stellenbosch, J.S. Marais Botanical Garden, on leaves of Protea eximia, Apr. 1998, J.E. Taylor (epitype CBS H-20094, culture ex-epitype CPC 1821 = CBS 111700).

Parateratosphaeria karinae (Crous) Quaedvlieg & Crous, comb. nov. — MycoBank MB807821

Basionym. Teratosphaeria karinae Crous, Persoonia 26: 80. 2011.

Specimen examined. SOUTH AFRICA, Western Cape Province, Hermanus, Fernkloof Nature Reserve, S34°23'38" E19°16'9.7", on leaf bracts of Phaenocoma prolifera, 2 May 2010, K.L. Crous & P.W. Crous (holotype CBS H-20534, cultures ex-type CPC 18256, 18255 = CBS 128774).

Parateratosphaeria marasasii (Crous) Quaedvlieg & Crous, comb. nov. — MycoBank MB807822

Basionym. Teratosphaeria marasasii Crous, Persoonia 20: 79. 2008.

Specimen examined. SOUTH AFRICA, Western Cape Province, Kirstenbosch Botanical Garden, on living leaves of Protea sp., 6 Jan. 2008, P.W. Crous & M. Crous (holotype CBS H-20105, cultures ex-type CBS 122899 = CPC 14889, CPC 14890, 14891; on leaf spots in association with Coleroa senniana).

Parateratosphaeria persoonii (Crous & L. Mostert) Quaedvlieg & Crous, comb. nov. — MycoBank MB807823

Basionym. Teratosphaeria persoonii Crous & L. Mostert, Persoonia 20: 80. 2008.

Specimen examined. SOUTH AFRICA, Western Cape Province, Jonkershoek, S33°59'4.2" E18°57'16.1", on living leaves of Protea sp., 1 Apr. 2007, P.W. Crous & L. Mostert (holotype CBS H-20102, cultures ex-type CPC 13972 = CBS 122895, CPC 13973, 13974; on leaf spots in association with T.jonkershoekensis = Xenoteratosphaeria jonkershoekensis).

Pseudoteratosphaeria Quaedvlieg & Crous, gen. nov. — MycoBank MB807824

Type species. Pseudoteratosphaeria perpendicularis (Crous & M.J. Wingf.) Quaedvlieg & Crous.

Etymology. Named after its morphological similarity to the genus Teratosphaeria.

Foliicolous, plant pathogenic or saprobic. Ascomata pseudothecial, epiphyllous, single, black, subepidermal, globose; ostiole central, apical; wall of 2–3 layers of medium brown textura angularis. Asci aparaphysate, fasciculate, bitunicate, subsessile, obovoid to broadly ellipsoid, slightly incurved, 8-spored. Ascospores multiseriate, overlapping, hyaline, guttulate, thin-walled, straight, fusoid-ellipsoidal, ellipsoidal or obovoid with obtuse ends, medianly 1-septate, widest in the middle of the apical cell, constricted at the septum, tapering towards both ends, but more prominently towards the lower end.

Notes — Pseudoteratosphaeria is morphologically similar to species of Teratosphaeria and can only be distinguished based on DNA phylogeny. No asexual morphs are presently known for Pseudoteratosphaeria. Either ITS or LSU sequence data differentiates these genera.

Pseudoteratosphaeria flexuosa (Crous & M.J. Wingf.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807825

Basionym. Mycosphaerella flexuosa Crous & M.J. Wingf., Mycol. Mem. 21: 58. 1998.

≡ Teratosphaeria flexuosa (Crous & M.J. Wingf.) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

Specimen examined. COLOMBIA, La Selva, leaves of E. globulus, May 1995, M.J. Wingfield (holotype PREM 54401, cultures ex-type STE-U 1107– 1109 = CBS 111012).

Pseudoteratosphaeria gamsii (Crous) Quaedvlieg & Crous, comb. nov. — MycoBank MB807826

Basionym. Mycosphaerella gamsii Crous, Stud. Mycol. 55: 113. 2006.

≡ Teratosphaeria gamsii (Crous) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

Specimen examined. INDIA, Palampur, on leaves of Eucalyptus sp., Mar. 2004, W. Gams & M. Arzanlou (holotype CBS H-19690, culture ex-type CBS 118495 = CPC 11138–11140).

Pseudoteratosphaeria ohnowa (Crous & M.J. Wingf.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807827

Basionym. Mycosphaerella ohnowa Crous & M.J. Wingf., Stud. Mycol. 50: 206. 2004.

≡ Teratosphaeria ohnowa (Crous & M.J. Wingf.) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

Specimen examined. SOUTH AFRICA, Mpumalanga, Hazy View, on leaves of E. grandis, 27 Mar. 1995, M.J. Wingfield (holotype PREM 51912, cultures ex-type CPC 1004 = CBS 112896, CPC 1005 = CBS 112973, CPC 1006 = CBS 110949).

Pseudoteratosphaeria perpendicularis (Crous & M.J. Wingf.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807828

Basionym. Mycosphaerella perpendicularisCrous & M.J. Wingf., Stud. Mycol. 55: 113. 2006.

≡ Teratosphaeria perpendicularis (Crous & M.J. Wingf.) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

Specimen examined. COLOMBIA, Suiza, on leaves of Eucalyptus eurograndis, Jan. 2004, M.J. Wingfield (holotype CBS H-19691, cultures ex-type CBS 118367 = CPC 10983–10985).

Pseudoteratosphaeria secundaria (Crous & Alfenas) Quaedvlieg & Crous, comb. nov. — MycoBank MB807829

Basionym. Mycosphaerella secundaria Crous & Alfenas, Stud. Mycol. 55: 122. 2006.

≡ Teratosphaeria secundaria (Crous & Alfenas) Crous & U. Braun, Stud. Mycol. 58: 11. 2007.

Specimen examined. BRAZIL, Bahia, Teixeira de Freitas, on leaves of Eucalyptus sp., 8 June 2004, A.C. Alfenas (holotype CBS H-19697, culture ex-type CBS 118507 = CPC 11551–11553).

Pseudoteratosphaeria stramenticola (Crous & Alfenas) Quaedvlieg & Crous, comb. nov. — MycoBank MB807830

Basionym. Mycosphaerella stramenticola Crous & Alfenas, Stud. Mycol. 55: 123. 2006.

≡ Teratosphaeria stramenticola (Crous & Alfenas) Crous & U. Braun, Stud. Mycol. 58: 11. 2007.

= Mycosphaerella parkiiaffinis Crous & M.J. Wingf., Fung. Diversity 26: 168. 2007.

≡ Teratosphaeria parkiiaffinis (Crous & M.J. Wingf.) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

Specimens examined. BRAZIL, Bahia, Eunapolis, on leaf litter of Eucalyptus sp., 23 May 2004, A.C. Alfenas (holotype of M. stramenticola, CBS H-19699, cultures ex-type CBS 118506 = CPC 11438–11440). – VENEZUELA, near Acarigua, on leaves of Eucalyptus urophylla, Oct. 2006, M.J. Wingfield (holotype of M. parkiiaffinis, CBS H-19823, cultures ex-type CPC 13373 = CBS 120737, CPC 13374).

Notes — Pseudoteratosphaeria stramenticola was isolated from leaf litter of a Eucalyptus sp. in Brazil (Crous et al. 2006). Ascospores were fusoid-ellipsoidal, (8–)9–10(–11) × 3(–3.5) μm. In contrast, Mycosphaerella parkiiaffinis was associated with well-defined leaf spots of E. urophylla in Venezuela, and its ascospores were fusoid-ellipsoidal, (8–)9–10 × 3(–3.5) μm (Crous et al. 2007c). These two species are also identical based on their DNA phylogeny, which provides further evidence that some of these pathogens are endophytes.

Queenslandipenidiella Quaedvlieg & Crous, gen. nov. — MycoBank MB807831

Type species. Queenslandipenidiella kurandae (Crous & J.K. Stone) Quaedvlieg & Crous.

Etymology. Named after its occurrence in Queensland, Australia, and morphological similarity to the genus Penidiella.

Hyphomycetous. Mycelium consisting of smooth, brown, thick-walled, branched, hyphae. Conidiophores macronematous, erect, arising from superficial hyphae, branching penicillate, septate. Conidiogenous apparatus consisting of several sets of branches; primary branches subcylindrical, brown, smooth, 0–1-septate, giving rise to 1–2 conidiogenous cells or secondary branches; secondary branches 0–1-septate. Conidiogenous cells doliiform to subcylindrical, brown, smooth, with 1–2 apical scars that are flattened, not darkened, refractive nor thickened. Ramoconidia brown, smooth, with 2–3 apical loci, narrowly ellipsoidal to subcylindrical. Conidia occurring in short chains, brown, smooth, ellipsoidal, apex obtuse, base subtruncate with or without a flattened inconspicuous hilum.

Notes — Queenslandipenidiella was placed in Penidiella based on having penicillate conidiophores that produce brown conidia with inconspicuous hila, as well as phylogenetic placement in the Teratosphaeriaceae (Crous et al. 2007c). Ecologically it is very interesting, as it colonises the exudates of bleeding cankers that are common on many of the trees lining a rainforest walking trail at Kuranda in northern Queensland. Whether it is the cause of the cankers, or simply a secondary invader on the exudates, remains unknown. Queenslandipenidiella can be distinguished from Penidiella s.str. by its well defined penicillate conidiophores, with clear branching structure, which is less apparent in species of Penidiella s.str. (Crous et al. 2007a, c).

Queenslandipenidiella kurandae (Crous & J.K. Stone)

Quaedvlieg & Crous, comb. nov. — MycoBank MB807832

Basionym. Penidiella kurandae Crous & J.K. Stone, Fungal Planet 16. 2007.

Specimens examined. AUSTRALIA, Queensland, Cairns, Kuranda, Kuranda walking trail, S16°49'24.6" E145°38'2.6", from exudates of stem cankers on unidentified rainforest tree, 30 Aug. 2006, P.W. Crous & J.K. Stone (holotype CBS H-19932, culture ex-type CPC 13333 = CBS 121715, CPC 13334; ditto, S16°49'29" E145°38'28.6", paratype CBS H-19924, CPC 13335).

Readeriella Syd. & P. Syd., Ann. Mycol. 6, 5: 484. 1908

Readeriella deanei Quaedvlieg, Summerell & Crous, sp. nov. — MycoBank MB807833; Fig. 7

Fig. 7.

Fig. 7

Readeriella deanei (CPC 12715). a. Colony sporulating on OA; b–e. conidiogenous cells with percurrent proliferation; f. conidia. –– Scale bars = 10 μm.

Etymology. Name refers to the host from which it was isolated, Eucalyptus deanei.

Description on OA. Conidiomata pycnidial, brown, globose to subglobose, up to 250 μm diam; wall consisting of 2–3 layers of brown textura angularis. Conidiophores reduced to conidiogenous cells, or with a supporting cell. Conidiogenous cells discrete, doliiform to ampulliform, pale brown, finely verruculose, proliferating several times percurrently near apex, 5–8 × 4–6 μm. Conidia solitary, aseptate, ellipsoid to limoniform, tapering towards a bluntly rounded, subobtuse, thickened apex, base subtruncate and thickened, hyaline becoming medium to golden brown, finely verruculose, (8–)9–10(–11) × 4(–5) μm.

Culture characteristics — Colonies erumpent, spreading, with lobate, feathery margins and sparse aerial mycelium on OA and PDA; fluffy to woolly on MEA, 5 cm diam after 2 wk. On MEA surface olivaceous-grey, reverse iron-grey. On PDA and OA, surface and reverse iron-grey.

Specimen examined. AUSTRALIA, New South Wales, Wollemi National Park, on leaves of Eucalyptus deanei, 9 Feb. 2006, B. Summerell (holotype CBS H-21136, culture ex-type CPC 12715 = CBS 134746).

Notes — Morphologically similar to R. readeriellophora (conidiomata up to 130 μm diam, conidiogenous cells 8–15 × 3–4 μm, conidia (5–)6–7(–9) × (3–)4(–4.5) μm; Crous et al. 2004b). However, conidiomata of R. deanei are larger, conidiogenous cells wider and conidia longer and wider.

Readeriella limoniforma Quaedvlieg, Summerell & Crous, sp. nov. — MycoBank MB807834; Fig. 8

Fig. 8.

Fig. 8

Readeriella limoniforma (CPC 12727). a. Colony sporulating on PDA; b, c. conidiogenous cells with percurrent proliferation; f. conidia. –– Scale bars = 10 μm.

Etymology. Name refers to its conidia, which are characteristically limoniform in shape.

Description on OA. Conidiomata pycnidial, brown, globose to subglobose, up to 150 μm diam, ostiole central, up to 60 μm diam; wall consisting of 2–3 layers of brown textura angularis. Conidiophores reduced to conidiogenous cells. Conidiogenous cells discrete, doliiform to subcylindrical, hyaline to pale brown, smooth to finely verruculose, monophialidic, proliferating several times percurrently near apex, 5–8 × 3–4 μm. Conidia solitary, aseptate, ellipsoid to limoniform, tapering towards a bluntly rounded, subobtuse, thickened apex, base subtruncate, hyaline becoming medium to golden brown, finely verruculose, (6–)7–8(–10) × 3(–4) μm.

Culture characteristics — Colonies erumpent, spreading, with lobate, feathery margins and moderate to fluffy aerial mycelium, reaching 4 cm diam after 2 wk. On MEA surface smoke-grey, outer region purplish grey, reverse fuscous-black. On PDA surface iron-grey, and pale olivaceous-grey in centre; reverse iron-grey.

Specimen examined. AUSTRALIA, New South Wales, Wollemi National Park, on leaves of Eucalyptus sp., 9 Feb. 2006, B. Summerell (holotype CBS H-21135, cultures ex-type CPC 12727–12729 = CBS 134745).

Notes — Morphologically R. limoniforma is similar to R. callista (conidia ellipsoid to fusoid, 7–11 × 3–5.5 μm; Crous et al. 2009d), but conidia are more limoniform in shape and slightly wider than those of R. callista.

Readeriella mirabiliaffinis Quaedvlieg, Summerell & Crous, sp. nov. — MycoBank MB807835; Fig. 9

Fig. 9.

Fig. 9

Readeriella mirabiliaffinis (CPC 13611). a. Colony sporulating on PDA; c, e, g. conidiogenous cells with percurrent proliferation; b, d, f. conidia. –– Scale bars = 10 μm.

Etymology. Name refers to its similarity to R. mirabilis.

Description on OA. Conidiomata pycnidial, brown, globose, up to 300 μm diam; wall consisting of 2–3 layers of brown textura angularis. Conidiophores 0–1-septate, pale brown, finely verruculose, ampulliform to doliiform, 10–20 × 4–6 μm. Conidiogenous cells pale brown, finely verruculose, ampulliform to doliiform, proliferating several times percurrently near apex, mono- or polyphialidic, 8–10 × 4–6 μm. Conidia solitary, medium brown, aseptate, smooth, granular, base truncate, with three apical, lateral, obtuse projections, deltoid, thick-walled, with darker pigmentation in the lateral projections, but with more prominent constriction between the projections and the base, (9–)10–11(–12) μm long, (8–)9–10(–11) μm wide at apex.

Culture characteristics — Colonies spreading, erumpent with lobate, feathery margins and moderate aerial mycelium. On OA, MEA and PDA surface olivaceous-grey with patches of pale olivaceous-grey; reverse iron-grey; after 2 wk reaching 55 mm diam.

Specimen examined. AUSTRALIA, Tasmania, Tasman Peninsula, Brown Mountain walk, S43°11'13.9" E147°50'50.7", on leaves of E. delegatensis, 14 Oct. 2006, P. Summerell & B. Summerell (holotype CBS H-21134, culture ex-type CPC 13611 = CBS 134744).

Notes — Morphologically similar to R. mirabilis (conidia (7–)9–10(–11) μm long, (7–)8–9(–10) μm wide at apex), although the conidia of R. mirabiliaffinis are larger.

Suberoteratosphaeria Quaedvlieg & Crous, gen. nov. — MycoBank MB807836

Type species. Suberoteratosphaeria suberosa (Crous, F.A. Ferreira, Alfenas & M.J. Wingf.) Quaedvlieg & Crous.

Etymology. Named after its similarity to the genus Teratosphaeria and association with corky leaf spots.

Foliicolous and caulicolous, plant pathogenic. Ascomata pseudothecial, solitary or aggregated, black, superficial to subepidermal, globose, glabrous; ostiole apical, central, papillate, lined with periphyses; wall of 3–4 layers of medium brown textura angularis, subhymenium of 3–5 layers of hyaline cells. Asci fasciculate, bitunicate, aparaphysate, subsessile, 8-spored, ellipsoid to obclavate, straight or curved. Ascospores bi- to triseriate or irregularly arranged, oblique, overlapping, straight ellipsoidal, obtuse at each end, hyaline to pale brown, smooth, 1-septate, guttulate, with or without mucoid sheath. Germinating ascospores become brown and verruculose.

Notes — Suberoteratosphaeria is plant pathogenic, associated with corky leaf spots, but also on stems and leaf petioles. The genus has ascospores that are hyaline to pale brown (as found in several species of Teratosphaeria s.str.). Suberoteratosphaeria is distinguished from Teratosphaeria by its corky lesions, and less so by ascospores that become brown, verruculose and germinate by two or multiple germ tubes.

Suberoteratosphaeria pseudosuberosa (Crous & M.J. Wingf.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807838

Basionym. Mycosphaerella pseudosuberosa Crous & M.J. Wingf., Stud. Mycol. 55: 118. 2006.

≡ Teratosphaeria pseudosuberosa (Crous & M.J. Wingf.) Crous & U. Braun, Stud. Mycol. 58: 11. 2007.

Specimen examined. URUGUAY, on leaves and petioles of Eucalyptus sp., Apr. 2005, M.J. Wingfield (holotype CBS H-19695, culture ex-type CBS 118911 = CPC 12085).

Suberoteratosphaeria suberosa (Crous, F.A. Ferreira, Alfenas & M.J. Wingf.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807839

Basionym. Mycosphaerella suberosa Crous, F.A. Ferreira, Alfenas & M.J. Wingf., Mycologia 85, 4: 707. 1993.

≡ Teratosphaeria suberosa (Crous, F.A. Ferreira, Alfenas & M.J. Wingf.) Crous & U. Braun, Stud. Mycol. 58: 11. 2007.

Specimen examined. BRAZIL, Espírito Santo, Santa Catarina, on leaves of E. dunnii, Aug. 1992, M.J. Wingfield (holotype PREM 51082, culture ex type CPC 515 = CBS 436.92).

Suberoteratosphaeria xenosuberosa Quaedvlieg, Carnegie & Crous, sp. nov. — MycoBank MB807840; Fig. 10

Fig. 10.

Fig. 10

Suberoteratosphaeria xenosuberosa (CPC 13093). a. Colony sporulating on PDA; b. broken asci; c. ascospores. –– Scale bars = 10 μm.

Etymology. Name refers to its similarity to Suberoteratosphaeria suberosa.

Leaf spots similar to those reported for T. suberosa, corky, and erumpent. Description on PDA (homothallic). Ascomata black, erumpent, punctiform, globose, up to 150 μm diam; apical ostiole 10–15 μm diam; wall consisting of 2–3 layers of medium brown textura angularis. Asci obovoid to broadly ellipsoid, aparaphysate, fasciculate, subsessile, bitunicate, 8-spored, straight to slightly incurved, 50–75 × 10–12 μm. Ascospores bi- to triseriate, hyaline, ellipsoidal with rounded ends, medianly 1-septate, constricted at the septum, straight to slightly curved, guttulate, thick-walled, widest in middle of apical cell, (10–)11–13(–15) × (4–)4.5(–5) μm. Ascospores brown and verruculose at germination.

Culture characteristics — Colonies spreading, erumpent, with sparse aerial mycelium and feathery margins, reaching 15 mm diam after 2 mo on PDA; surface olivaceous-grey, reverse iron-grey.

Specimen examined. AUSTRALIA, Queensland, Coolabunia Plantation, Kingaroy, on E. mollucana, 14 Feb. 2004, A.J. Carnegie (holotype CBS H-21138, culture ex-type CPC 13093 = CBS 134747 = NSWF 005175).

Notes — Teratosphaeria xenosuberosa was originally identified as T. suberosa based on the similar corky leaf spots it induces on E. mollucana. Although the specimen was lost, the fungus can be described morphologically, as it is homothallic and sporulates in culture. Teratosphaeria xenosuberosa is distinguished from T. suberosa (ascospores 10–)12–16(–17) × (3–)3.5–5(–6) μm (Crous et al. 1993) by a mean ascospore length that is shorter than found in T. suberosa.

Teratosphaeria molleriana (Thüm.) Crous & U. Braun, Stud. Mycol. 58: 10. 2007

Basionym. Sphaerella molleriana Thüm., Revista Inst. Sci. Lit. Coimbra 28: 31. 1881.

Mycosphaerella molleriana (Thüm) Lindau, Nat. Pfanzenfam. 1: 424. 1897.

= Colletogloeopsis molleriana Crous & M.J. Wingf., Canad. J. Bot. 75: 670. 1997.

Readeriella molleriana (Crous & M.J. Wingf.) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

= Mycosphaerella vespa Carnegie & Keane, Mycol. Res. 102: 1275. 1998.

= Mycosphaerella ambiphylla A. Maxwell, Mycol. Res. 107: 354. 2003.

= Teratosphaeria xenocryptica Crous & M.J. Wingf., Persoonia 23: 139. 2009.

Specimens examined. AUSTRALIA, Tasmania, on leaves of E. globulus, BOT 2823 = CBS 117924 (identified as M. vespa); Western Australia, Manjimup, Boorara plantation of WACAP, E116°10' S34°45', on E. globulus, 16 Feb. 2000, A. Maxwell (holotype of M. ambiphylla, PERTH 05849608, culture ex-type CBS 110499). – CHILE, on leaves of Eucalyptus sp., 1994, M.J. Wingfield (holotype of T. xenocryptica deposited at PREM, culture ex-type CPC 355 = CBS 122905). – PORTUGAL, Lisbon, N40°00'39" W8°'2.3", 77 m, on leaves of Eucalyptus sp., 13 Oct. 2006, P.W. Crous & A.J.L. Phillips (epitype of T. molleriana, CBS H-19826, cultures ex-epitype CPC 13398 = CBS 120746, CPC 13399–13400).

Notes — Hunter et al. (2006) reduced M. vespa and M. ambiphylla to synonymy under M. molleriana (= Teratosphaeria). Based on the multigene data generated here, T. xenocryptica (Wingfield et al. 1995, Crous et al. 2009b) also falls within the variation observed in T. molleriana.

Teratosphaericola Quaedvlieg & Crous, gen. nov. — MycoBank MB807841

Type species. Teratosphaericola pseudoafricana (Crous & T.A. Cout.) Quaedvlieg & Crous.

Etymology. Named after its similarity to the genus Teratosphaeria.

Foliicolous, plant pathogenic. Ascomata pseudothecial, solitary, black, immersed becoming erumpent, globose; ostiole apical, central; wall of 2–3 cell layers of medium brown textura angularis. Asci aparaphysate, fasciculate, bitunicate, subsessile, narrowly ellipsoid to subcylindrical, slightly incurved, 8-spored. Ascospores tri- to multiseriate, overlapping, hyaline to pale brown, guttulate, thin-walled, straight to slightly curved, smooth to finely roughened, fusoid-ellipsoidal with subobtuse ends, medianly 1-septate. Spermatogonia similar to the ascomata in morphology. Spermatia hyaline, smooth, rod-shaped with rounded ends.

Notes — Teratosphaericola is similar to Teratosphaeria in morphology, and can only be distinguished based on DNA phylogeny. Ascospores become darkened and verruculose at germination, but this is also known for several species of Teratosphaeria. Either ITS or LSU sequence data differentiate these genera.

Teratosphaericola pseudoafricana (Crous & T.A. Cout.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807842

Basionym. Mycosphaerella pseudoafricana Crous & T.A. Cout. (as pseudafricana), Stud. Mycol. 55: 115. 2006.

≡ Teratosphaeria pseudoafricana (Crous & T.A. Cout.) Crous & U. Braun, Stud. Mycol. 58: 11. 2007.

Specimen examined. ZAMBIA, on leaves of E. globulus, Aug. 1995, T. Coutinho (holotype PREM 54973, culture ex-type CPC 1229, 1231, 1230 = CBS 114782).

Teratosphaeriopsis Quaedvlieg & Crous, gen. nov. — MycoBank MB807843

Type species. Teratosphaeriopsis pseudoafricana Quaedvlieg & Crous.

Etymology. Named after its morphological similarity to the genus Teratosphaeria.

Foliicolous, plant pathogenic. Ascomata black, erumpent, globose, solitary or in clusters of up to three, with papillate apex and central ostiole; wall consisting of 2–3 layers of medium brown textura angularis. Asci obovoid to broadly ellipsoid, aparaphysate, fasciculate, subsessile, bitunicate, 8-spored, straight to slightly incurved. Ascospores tri- to multiseriate, hyaline, obovoid with rounded ends, medianly 1-septate, slightly constricted at the septum, straight to slightly curved, guttulate, thin-walled, widest in middle of apical cell; ascospores brown and verruculose at germination.

Notes — Teratosphaeriopsis is best distinguished from Teratosphaeria based on phylogenetic data, as several species in Teratosphaeria are morphologically similar.

Teratosphaeriopsis pseudoafricana Quaedvlieg & Crous, sp. nov. — MycoBank MB807844; Fig. 11

Fig. 11.

Fig. 11

Teratosphaeriopsis pseudoafricana(CBS 111171). a. Colony sporulating on PDA; b, c. ascomata; c–e. asci with ascospores. –– Scale bars: a = 250 μm; b = 120 μm; c–e = 10 μm; d applies to e.

Etymology. Name refers to its morphological similarity to M. africana.

Description on OA (homothallic). Ascomata black, erumpent, globose, solitary or in clusters of up to three, up to 120 μm diam, with papillate apex and central ostiole; wall consisting of 2–3 layers of medium brown textura angularis. Asci obovoid to broadly ellipsoid, aparaphysate, fasciculate, subsessile, bitunicate, 8-spored, straight to slightly incurved; apical chamber 1.5–2 μm diam, 25–50 × 8–10 μm. Ascospores tri- to multiseriate, hyaline, obovoid with rounded ends, medianly 1-septate, slightly constricted at the septum, straight to slightly curved, guttulate, thin-walled, widest in middle of apical cell, (8–)9(–10) × (3–)3.5(–4) μm. Ascospores brown and verruculose at germination.

Culture characteristics — Colonies on OA iron-grey, spreading with moderate aerial mycelium in centre. On MEA and PDA erumpent, spreading, with folded surface, and moderate aerial mycelium, and even, lobed margin; centre olivaceous-grey, outer region iron-grey, reverse iron-grey; reaching 40 mm diam after 1 mo.

Specimen examined. SOUTH AFRICA, KwaZulu-Natal, on leaves of Eucalyptus sp., 23 Nov. 1995, P.W. Crous (holotype CBS H-21137, culture ex-type CBS 111171 = CPC 1261).

Notes — Teratosphaeriopsis pseudoafricana was originally identified as Amycosphaerella africana (= Mycosphaerella africana) based on morphology. Phylogenetically it is distinct from the taxa presently known to occur on eucalypts. Although the specimen has been lost, the fungus can still be described morphologically, as it is homothallic and sporulates in culture. Ascospores of T. pseudoafricana are obovoid, and shorter and wider than those of Amycosphaerella africana, which are fusoid-ellipsoidal, (7–)8–10(–11) × (2–)2.5–3 μm (Crous & Wingfield 1996).

Xenopenidiella Quaedvlieg & Crous, gen. nov. — MycoBank MB807845

Type species. Xenopenidiella rigidophora (Crous, R.F. Castañeda & U. Braun) Quaedvlieg & Crous.

Etymology. Named after the genus Penidiella, but distinct in having dimorphic conidiophores.

Hyphomycetous, saprobic on leaf litter. Mycelium consisting of strongly branched, septate, smooth, pale olivaceous to medium brown, guttulate, hyphae. Conidiophores dimorphic. Macronematous conidiophores separate, erect, subcylindrical, predominantly straight to slightly curved, terminally loosely branched; base neither lobed nor swollen, lacking rhizoids, septate, medium to dark brown. Micronematous conidiophores erect, subcylindrical, septate, pale to medium brown (concolorous with hyphae). Conidiogenous cells predominantly terminal, rarely intercalary, medium brown, smooth, subcylindrical, but frequently swollen at apex, loci flat-tipped, sub-denticulate or not, barely to slightly thickened and darkened-refractive. Conidia in branched chains, medium brown, verruculose, ellipsoid to cylindrical-oblong, turning dark with age; hila sometimes slightly thickened and darkened, not refractive.

Notes — Xenopenidiella is superficially similar to Penidiella, but distinct in that conidiophores are dimorphic, not truly penicillate (rather loosely branched at apex), and conidiogenous cells often appear subdenticulate.

Xenopenidiella rigidophora(Crous, R.F. Castañeda & U. Braun) Quaedvlieg & Crous, comb. nov. — MycoBank MB807846

Basionym. Penidiella rigidophora Crous, R.F. Castañeda & U. Braun, Stud. Mycol. 58: 21. 2007.

Specimen examined. CUBA, isolated from leaf litter of Smilax sp. (Smilacaceae), 6 Nov. 1994, R.F. Castañeda (holotype CBS H-19938, culture ex-type CBS 314.95).

XenoteratosphaeriaQuaedvlieg & Crous, gen. nov. — MycoBank MB807847

Type species. Xenoteratosphaeria jonkershoekensis (P.S. van Wyk, Marasas & Knox-Dav.) Quaedvlieg & Crous.

Etymology. Resembling the genus Teratosphaeria, but with distinct culture characteristics.

Foliicolous, plant pathogenic. Ascomata immersed, substomatal, black, singular, gregarious, immersed, becoming erumpent through the stomatal pore, pyriform or globose with a papillate periphysate ostiole. Asci obclavate, straight, subsessile or with a small pedicel, narrowing slightly to a rounded apex with a distinctive ocular chamber, 8-spored, bitunicate with fissitunicate dehiscence. Ascospores bi- to multiseriate, fusiform, tapering gradually to the rounded ends, widest in the middle of the upper cell, with the lower cell slightly narrower and longer, straight, hyaline, becoming pale brown with age, medianly septate.

Notes — Xenoteratosphaeria is morphologically similar to Teratosphaeria (also with ascospores becoming brown and verruculose in asci), but distinct in that in culture hyphae terminate in brown, multicellular chlamydospore-like structures, not observed in Teratosphaeria s.str. (see Crous et al. 2000, f. 18, 19, 25).

Xenoteratosphaeria jonkershoekensis (P.S. van Wyk, Marasas & Knox-Dav.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807848

Basionym. Mycosphaerella jonkershoekensis P.S. van Wyk, Marasas & Knox-Dav., S. African J. Bot. 41: 234. 1975.

≡ Teratosphaeria jonkershoekensis (P.S. van Wyk, Marasas & Knox-Dav.) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

Specimen examined. SOUTH AFRICA, Western Cape Province, Jonkershoek, S33°59'4.2" E18°57'16.1", on living leaves of Protea sp., 1 Apr. 2007, P.W. Crous & L. Mostert (epitype CBS H-20095, culture ex-epitype CBS 122897 = CPC 13984).

DISCUSSION

The genus Mycosphaerella s.l. is one of the largest genera of ascomycetes with thousands of species (Crous 2009). However, the Mycosphaerella morphology evolved in many lineages independently, and the separation of the Teratosphaeriaceae from the Mycosphaerellaceae (Crous et al. 2007a) was an important step towards delimitation of taxa within the Mycosphaerella complex.

Mycosphaerella Leaf Disease

Mycosphaerella Leaf Disease is a serious impediment for the cultivation of eucalypts worldwide (Crous et al. 2009d, Hunter et al. 2011). Throughout the years numerous species of Mycosphaerellaceae and Teratosphaeriaceae have been described from eucalypt leaves, several of which have been associated with MLD and TLD. The present study provides a multigene DNA comparison of more than 146 taxa isolated from eucalypt leaves, and is the most comprehensive multigene DNA phylogeny generated to date for these fungi, following a previous study by Hunter et al. (2006). Numerous species examined here were originally described without isolation or preservation of ex-type strains, and consequently had to be recollected to enable DNA comparisons. Even though partial gene sequences of the ITS and LSU loci have been obtained for many of these fungi in recent years comprehensive multigene phylogenetic comparisons have mostly been lacking.

Lineages within the Teratosphaeriaceae

Schoch et al. (2006) placed the Piedraiaceae in the Dothideomycetes, and Crous et al. (2009b) showed it clustered within the Teratosphaeriaceae. Ruibal et al. (2011) discussed this placement in depth and suggested that it was possibly due to long branch attraction and poor taxon sampling (these long branches are clearly visible in Fig. 3 derived from our LSU/RPB2 dataset). Although we have been unable to resolve the placement of the Piedraiaceae in the present study, we still regard it as a separate family based on its unique morphology and ecology. Furthermore, the Piedraiaceae clade was the only unstable clade in this dataset; e.g. it clustered as sister to different clades within the Teratosphaeriaceae depending on the addition/deletion of additional families to the dataset (results not shown) and was the only Teratosphaeriaceae-associated clade which actually clustered outside of the Teratosphaeriaceae while running preliminary Neighbour joining trees on our LSU/RPB2 dataset (results not shown). We await further insights on the correct placement of the Piedraiaceae, which appears to be sensitive to sampling and different algorithms used for phylogenetic reconstruction.

Not all extremophiles could previously be accommodated in the Teratosphaeriaceae as some isolates clustered in closely related, but undescribed, separate families. Ruibal et al. (2009) resorted to referring to these rock-inhabiting isolates as being members of Teratosphaeriaceae (‘clade 2’). Although the introduction of the Neodevriesiaceae and Extremaceae (Fig. 5) within the present study provide families for many of these extremophilic genera, the resulting Teratosphaeriaceae LSU/RPB2 tree (Fig. 3) is still not fully resolved. Overall, these results underline the fact that the Teratosphaeriaceae (Fig. 3) is still too broadly defined. A more robust dataset is needed to address this issue, within the wider context of what is now seen as the Capnodiales.

With the narrow circumscriptions of Ramularia (= Mycosphaerella) and Teratosphaeria (= Kirramyces), 23 novel genera have to be introduced to accommodate other monophyletic lineages in this complex. Although the present study presents a sound road map for future work on the Teratosphaeriaceae, it also illustrates that we are approaching the limits of purely morphology-based classification for species and genera within the Mycosphaerellaceae and Teratosphaeriaceae. Several genera that are readily identifiable based even on a single locus, are virtually impossible to distinguish by morphological means (e.g. Parateratosphaeria and Teratosphaeria) and this will pose problems for forest pathologists wanting to identify these taxa in the field.

Best genes to distinguish species in Mycosphaerellaceae and Teratosphaeriaceae

From the DNA sequence data we conclude that any of the five coding loci tested in this study (Btub, Act, RPB2, EF-1α and Cal) will reliably identify most of the species studied. The only exception was species of Pseudocercospora, which were difficult to identify based on a single locus, although this had already been demonstrated (Crous et al. 2013). The Act, Cal and Btub genes were incongruent with the other loci in the two five-locus datasets. However, this does not exclude these genes as barcoding loci for species identification within the MLD and TLD complexes, as these loci resolve the terminal clades in their derived trees, if not their higher order clustering. These ‘aberrant’ loci should not be combined with other loci within these two datasets, if the intention is to draw taxonomic conclusions about the relationships of these species to one another. This incongruency can be caused by several factors, including differing rates of evolution, and different selection pressures.

As none of the coding gene loci had a 100 % amplification success rate, none of these loci alone are ideal for species identification in a generic protocol. The two loci that did have a 100 % success rate (LSU and ITS) lack species resolution power for a large number of species, and are thus not independently reliable as an identification tool. The Btub and EF-1α loci have the highest Kimura-2-parameter distances, with RPB2 in the third place (i.e. they show the highest natural variation between species) for the species used in this dataset, but these loci have the disadvantage that they only have amplification success rates of 97, 98 and 95 %, respectively (Table 3).

To compensate for both this lack of amplification success and the limited amount of available reference data for these protein coding loci in public databases, we recommend a combination of a primary and a secondary locus to provide a more reliable identification result. The ITS locus is a prime candidate as the primary locus as the ITS locus has recently been proposed as the primary fungal barcoding locus (Schoch et al. 2012), and ITS sequence data are easily obtained and are a good starting point to rapidly identify genera and often species. If an unknown genus or species is not represented in a curated database such as Q-bank (www.q-bank.eu), then GenBank should be used to supplement the data. As a secondary identification locus, either Btub, EF-1α or even RPB2, suffice for many species of Mycosphaerellaceae or Teratosphaeriaceae. We recommend EF-1α, followed by Btub and then RPB2, as the most effective way of identifying many species within these genera. As with all molecular-based identification approaches, care needs to be taken with the interpretation of results arising from such analyses, as many mistakes occur in uncurated public nucleotide databases such as GenBank.

Species concepts within the fungal kingdom

Ever since Darwin (1859) published his species concept in ‘On the Origin of Species’, scientists have been struggling with how to define and recognise species, i.e., when has a lineage diverged far enough to be considered a species. Numerous authors have since considered a multitude of taxonomic characters as essential elements to define novel species. Authors com-monly disagree about species numbers and species boundaries. Species delimitation and conceptualisation has become increasingly confused by disagreements about species concepts (de Queiroz 2007, Costello et al. 2013).

Some of the more ambiguous phylogenetic conclusions in the present study demonstrate the problems experienced when defining species. For example, Fig. 1, clade C reveals that the four tested T. gauchensis isolates (Cortinas et al. 2006) have extensive natural variation within the seven loci tested, which causes them to overlap with two other, morphologically distinct species, T. stellenboschiana and T. foliensis. Does this mean that these eight Teratosphaeria isolates belong to one, two or more different taxa?

Traditionally, five previously described species concepts have been used in mycology to distinguish taxa. The Biological Species Concept (BSC) emphasizes reproductive isolation (Wright 1940, Mayr 1942), the Morphological Species Concept (MSC) emphasizes morphological divergence, the Ecological Species Concept (ESC) emphasizes adaptation to a particular ecological niche (van Valen 1976), the Phylogenetic Species Concept (PSC) emphasizes nucleotide (non) divergence (Hennig 1966) and the Genealogical Concordance Phylogenetic Species Recognition (GCPSR) (an adaptation of the PSC) uses the phylogenetic concordance of unlinked genes to indicate a lack of genetic exchange and thus, evolutionary independence of lineages (O’Donnell et al. 1998, Taylor et al. 2000, Dettman et al. 2003a, 2003b, de Queiroz 2007).

During the last decade a sixth, polyphasic approach to species recognition has evolved within the mycological community. This polyphasic method grades the MSC, ESC and PSC characteristics with a variable weight in order to reach a conclusion on the proposition that a taxon represents a separate species. Conclusions based on the molecular similarity between different taxa in a robust multi-locus DNA dataset (PSC) are generally unbiased and warrant a high weight in any CSC analysis conclusion. Differences in morphology (MSC) and ecology (ESC) are given less weight in reaching a CSC conclusion. This approach has become generally accepted during the last decade as a functional species concept within the mycological community, without ever officially having been described as such (Frisvad & Samson 2004, Crous & Groenewald 2005, Samson et al. 2006, Leslie & Summerell 2006, Cai et al. 2009, Groenewald et al. 2013). To remedy this, we propose to formally name this widely used, polyphasic method for identifying species within the fungal kingdom, as the Consolidated Species Concept (CSC) (derived from a discussion with Keith Seifert about how to describe the polyphasic identification approach at the ‘One Fungus = Which Name’ symposium, held in Amsterdam in April 2012).

Even with the use of these six species concepts, successfully distinguishing between two or more closely related taxa can still be daunting and open to debate. The generated phylogenetic trees (Fig. 1, 2, 3, 4) show several of these closely related isolates (clades A–K) that have previously been identified as belonging to different taxa. These clades will therefore be discussed in more detail under the listed species concepts.

As we did not perform mating compatibility tests on this dataset, we have no data regarding the BSC concept for most of these isolates. However, we can discuss the implications of the five remaining species concepts (MSC, ESC, PSC, GCPSR and CSC) on this dataset.

Different conclusions can be drawn about speciation, when applying these five species concepts individually to clade C (Fig. 1). Clade C contains seven isolates that were previously identified as either one of two closely related Teratosphaeria species (T. gauchensis or T. stellenboschiana). Each one of these two species has a distinct morphology (Crous et al. 2004b, 2009a, Andjic et al. 2010), was isolated from a different host (E. grandis and E. punctata) and collected from different continents (Africa and South America). So, according to both the MSC and the ESC concepts, there is very good support for the proposition that they should be regarded as separate species. However, the PSC concept is inconclusive in this case as the four T. gauchensis isolates show a wide genetic drift while the T. stellenboschiana isolates are relatively conserved.

When applying the GCPSR concept to this dataset, the taxa within this dataset are tested for genetic exchange to indicate their evolutionary independence (a pairwise homoplasy index (PHI or Φw) score below 0.05 is considered proof for the presence of significant recombination within the dataset). The GCPSR test revealed that there was no significant genetic recombination within this dataset (Φw = 0.1) (Fig. 6c). There are still common (but not significant) recombination events present within this dataset, as is apparent by the relative low Φw and the conflicting phylogenetic splits (another indicator of recombination) observed in the split tree decomposition network for the T. gauchensis and T. stellenboschiana isolates (Fig. 6c). According to the GCPSR species concept, there is no support for the proposition that these isolates belong to the same species, as there was no significant recombination between T. gauchensis and T. stellenboschiana.

When applying the CSC concept to clade C, we can take into account that the phylogenetic data regarding T. stellenboschiana and T. gauchensis is ambiguous as the variation within the T. gauchensis isolates more or less overlaps with the T. stellenboschiana isolates, but the ecological and morphological criteria support the proposition that these isolates belong to two distinct taxa. So when combining the MSC, ESC and PSC characteristics into a CSC conclusion on speciation, we can conclude that there is good support for the proposition that these isolates actually belong to two distinct taxa.

We can now also apply the CSC concept to the rest of the clades, marked A to K, in Fig. 1 and 2.

Clade A

contains 12 isolates previously identified as either belonging to closely related Teratosphaeria nubilosa or T. pseudonubilosa (including the ex-type of T. nubilosa, CBS 116005) and were isolated from either Eucalyptus globulus or Eucalyptus sp. hosts from the same continent (Australia). These two species show very little morphological variation and cannot be separated by morphological characteristics. Differentiation of these species is based on SNPS in 29, seperatly anaysed gene regions, and on four nucleotide characters in the ITS and six nucleotides in the Btub loci (Pérez et al. 2013). These two species are phylogenetically distinct over the five test loci (Fig. 1) (which also includes the ITS and Btub loci). When applying the GCPSR concept to these 12 isolates, we detect no significant recombination events shared between these isolates (Φw = 0.07) (Fig. 6a). This lack of significant recombination does not mean that there are no shared recombination events. As the Φw value approximates 0.05, this indicates that there are some shared insignificant recombination events between these isolates. This example also shows the limitations of the GCPSR concept, which looks for significant recombination events in a black and white way, ignoring borderline cases. When applying the CSC concept to clade A, we conclude that there is reasonable support for the proposition that these isolates belong to different taxa even as the morphological and ecological criteria are inconclusive as we have a clear phylogenetic separation between these two Teratosphaeria taxa.

Clade B

contains three isolates that were previously classified as either closely related to T. destructans (ex-type CBS 111370) or T. viscidus (ex-type CBS 124992), which were isolated from either Eucalyptus grandis or E. nitens, from two different continents (Indonesia and Australia). These two species can be separated by morphological characteristics (Andjic et al. 2007). Both species are phylogenetically (Fig. 1) distinct over the five test loci and when applying the GCPSR concept to these isolates, we did not detect significant recombination between the isolates (Φw = 1) (Fig. 6b). Because the Φw test requires a minimum of four isolates, an isolate of T. eucalypti was added to this dataset. When applying the CSC concept to clade B, we can take into account that the MSC, ESC and PSC characteristics all support the two species proposition so we conclude that there is full support for the proposition that T. destructans and T. viscidus represent two different taxa.

Clade D

contains two isolates that were previously identified as either belonging to the closely related T. pluritubularis and T. profusa (including the respective ex-type isolates CBS 118508 and CBS 125007; Crous et al. 2006), which were isolated from either E. globulus or E. nitens from different continents (Spain and Australia). Both species have distinct morphological variation and can be separated based on morphological characteristics (Crous et al. 2009b). These two species are phylogenetically (Fig. 1D) very closely related but distinct over the five test loci. However, when applying the GCPSR concept to these isolates, we detect significant recombination between these isolates (Φw = < 0.001) (Fig. 6d). To obtain a minimum of four isolates, isolates of T. complicata and T. caesia were added to this dataset. Multiple combinations of closely related Teratosphaeria species were tested, but only the combinations that included both the T. pluritubularis and T. profusa isolates showed significant recombination in their Φw (results not shown). When applying the CSC concept to clade D, the MSC, ESC and PSC characteristics all support the two species proposition so we conclude that there is full support for the proposition that T. pluritubularis and T. profusa represent two different taxa. These results conflict, as we have two morphologically and ecologically distinct taxa that have very strong and recent family ties (as shown by the GCPSR test results). It is possible that these two species recently underwent speciation and that the loci selected for molecular comparison have not evolved sufficiently individually to provide higher phylogenetic support.

Clade E

contains eight isolates that were previously identified as Austroafricana parva (= T. parva) based on limited morphology and ITS sequence data. Strains were isolated from both Eucalyptus and Protea hosts located on three different continents (Australia, Egypt, Portugal, South Africa). Although these isolates are morphologically very similar and have a high degree of conservation in their ITS sequences, they are phylogenetically very distinct over the five test loci and even form four to five subclades (indicating that this might actually be a species complex). When applying the GCPSR concept to these isolates, we detect significant recombination between these isolates (Φw = < 0.001) (Fig. 6e). Multiple combinations of these eight isolates were tested and significant recombination was detected within two separate groups. Group one consists of CBS 119901, 116289, 122892 and CPC 12249, while group two consists of CBS 122893 and 114761 (results not shown). These results correspond to the phylogenetic tree (Fig. 1E) in which the isolates within these two groups are closely related. When applying the CSC concept to clade E, we see only limited (MSC) support for the single species proposition and much stronger (ESC and PSC) support for the proposition that these isolates actually represent four to five different taxa. But more detailed morphological future work is needed to confirm this proposition.

Clade F

contains six isolates that had previously been identified as Austroafricana associata (= A. associata) based on limited morphological characters and ITS sequence data. These isolates were isolated from different Eucalyptus and Corymbia hosts in Australia and they are phylogenetically highly distinct over the five test loci, and even form five to six subclades (indicating that this might actually be a species complex). When applying the GCPSR concept to these isolates, we detect significant recombination between these isolates (Φw = < 0.001) (Fig. 6f). Multiple combinations of these six isolates were tested and this significant recombination was limited between two isolates (CBS 112224 and CPC 13113) (results not shown). When applying the CSC concept to clade F, we see only limited (MSC) support for the single species proposition and much stronger (ESC and PSC) support for the proposition that these isolates actually represent five or six different taxa. But more detailed morphological future work is needed to confirm this proposition.

Clade G

contains two isolates that had previously been identified as Pseudoteratosphaeria parkiiaffinis (ex-type CBS 120737) or Pet. stramenticola (ex-type CBS 118506). Both strains were isolated from Eucalyptus hosts (E. urophylla and Eucalyptus sp.) from South America (Venezuela and Brazil). Both species are morphologically similar to one another (Crous et al. 2006, 2007c), and are phylogenetically indistinguishable over the five test loci (Fig. 1). When applying the GCPSR concept to these isolates, we detect significant recombination between these two isolates (Φw = 0.03) (Fig. 6g). Because the Φw test requires a minimum of four isolates, isolates of Pet. perpendicularis and Pet. gamsii were added to this dataset. Multiple combinations of closely related Pseudoteratosphaeria species were tested, but only the combinations that included both the Pet. parkiiaffinis and Pet. stramenticola isolates showed significant recombination in their Φw (results not shown). When applying the CSC concept to clade G, we get full support for the proposition that these isolates actually belong to the same taxon. The CSC data suggests that these two isolates actually belong to the same taxon and this could be confirmed with more detailed morphological work and these species are subsequently synonymised.

Clade H

contains six isolates that were previously identified as either belonging to closely related Pallidocercospora thailandica (ex-type CBS 120723) or P. colombiensis (ex-type CBS 110967). All P. colombiensis isolates where isolated from E. urophylla in Colombia while the P. thailandica isolates had a mixed host range from Acacia and Musa to E. camaldulensis in Thailand, Brazil and Cameroon. Both species are morphologically distinct (Crous et al. 2004c) but are phylogenetically difficult to distinguish over the five tested loci (Fig. 2H). When applying the GCPSR concept to these isolates, we detect no significant recombination among these isolates (Φw = 1.0) (Fig. 6h). When applying the CSC concept to clade H, we see no support for the single species proposition and stronger (ESC and MSC) support for the proposition that these isolates indeed represent two different taxa.

Clade I

contains three isolates previously identified as either closely related (Crous et al. 2013) Pseudocercospora fori (ex-type CBS 113285) or Ps. natalensis (ex-type CBS 111069). Both taxa were described from Eucalyptus species (E. grandis and E. nitens) collected in South Africa. Morphologically, they are distinguishable based on the number of conidial septa (Crous 1998, Hunter et al. 2004) but phylogenetically they are difficult to distinguish over the five tested loci (Fig. 2i). Application of the GCPSR concept, showed no significant recombination (Φw = 0.11) (Fig. 6i). Because the Φw test requires a minimum of four isolates, an isolate of Ps. subulata was added to this dataset. When applying the GCPSR concept to clade I, we see no support for the single species proposition and good support (ESC, PSC and MSC) for the proposition that these isolates indeed represent two different taxa.

Clade J

contains 24 isolates that were previously identified as either belonging to Pseudocercospora gracilis (ex-type CBS 111189) or Ps. eucalyptorum (ex-type CBS 114866). Both species were described from several Eucalyptus hosts. While Ps. eucalyptorum occurs in Europe, Africa and Australia, Ps. gracilis is only known from South-East Asia. The two species are morphologically distinct based on differences in their conidial morphology (Crous et al. 1989, Crous & Alfenas 1995) and also phylogenetically distinguishable over the five tested loci (Fig. 2J). When applying the GCPSR concept to these isolates, we detect no significant recombination between these isolates (Φw = 0.8) (Fig. 6j). When applying the CSC concept to clade J, we see full (MSC, ESC and PSC) support for the two species, so we conclude that there is full support for the proposition that P. eucalyptorum and P. gracilis represent two different taxa.

Clade K

contains 12 isolates previously identified as Zasmidium citri based on limited morphology and ITS sequence data. These isolates where isolated from a mixed host range (Acacia, Musa, Citrus and Eucalyptus) from both South-East Asia and North America. These isolates are phylogenetically distinct over the five test loci and even form five to six subclades (indicating that this is actually a species complex) (Fig 2K). When applying the GCPSR concept to these 12 isolates, we detect significant recombination between these isolates (Φw = < 0.001) (Fig. 6k). However, Φw testing of multiple isolate combinations within the 12 species dataset showed that the significant recombination in the pairwise homoplasy index were limited to four isolates most likely comprising two separate species (CPC 15289 / CPC 15296 and CPC 10522 / CBS 116366) (data not shown). When applying the CSC concept to clade K, we only see low (MSC) support for the proposition that these isolates actually belong to the same taxon, and much higher (PSC and ESC) support for the proposition that these isolates actually belong to the different taxa, but more detailed morphological work is needed to confirm this proposition.

In the present study we introduced the Consolidated Species Concept to distinguish species of Teratosphaeriaceae identified via a polyphasic approach, combining morphological, ecological and phylogenetic species concepts. We also tried to provide a better phylogenetic backbone for the Teratosphaeriaceae, which contains numerous plant and human pathogens, but also saprobes, endophytes, and rock-inhabiting fungi. Although we were able to introduce the Extremaceae and Neodevriesiaceae to accommodate a group of extremophilic fungi that occur on a range of diverse substrates, we were unable to resolve the phylogenetic position of the Piedraiaceae in relation to the Teratosphaeriaceae. At a generic level, Mycosphaerella and Teratosphaeria are now well defined, with an additional 23 genera being introduced for distinct phylogenetic lineages. Many lineages remain yet unresolved and are treated as either Teratosphaeria sp. or Teratosphaeriaceae, awaiting further collections to hopefully add additional morphological characters to these unnamed generic clades, many which remain poorly understood, and greatly undersampled.

Acknowledgments

We thank the technical staff, Arien van Iperen (cul-tures) and Marjan Vermaas (photographic plates) for their invaluable assistance. Numerous forest pathologists and mycologists have made material available to us for examination, without which this study would not have been possible.

REFERENCES

  1. Andjic V, Barber PA, Carnegie AJ, Pegg GS, Hardy GE, et al. 2007. Kirramyces viscida sp. nov, a new eucalypt pathogen from tropical Australia closely related to the serious leaf pathogen, Kirramyces destructans. Australasian Plant Pathology 36: 478–487. [Google Scholar]
  2. Andjic V, Whyte G, Hardy G, Burgess T. 2010. New Teratosphaeria species occurring on eucalypts in Australia. Fungal Diversity 43: 27–38. [Google Scholar]
  3. Arzanlou M, Groenewald JZ, Fullerton RA, Abeln ECA, Carlier J, et al. 2008. Multiple gene genealogies and phenotypic characters differentiate several novel species of Mycosphaerella and related anamorphs on banana. Persoonia 20: 19–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Barnes I, Crous PW, Wingfield BD, Wingfield MJ. 2004. Multigene phylogenies reveal that red band needle blight of Pinus is caused by two distinct species of Dothistroma, D. septosporum and D. pini. Studies in Mycology 50: 551–565. [Google Scholar]
  5. Batzer JC, Arias MMD, Harrington TC, Gleason ML, Groenewald JZ, Crous PW. 2008. Four species of Zygophiala (Schizothyriaceae, Capnodiales) are associated with the sooty blotch and flyspeck complex on apple. Mycologia 100: 246–258. [DOI] [PubMed] [Google Scholar]
  6. Bensch K, Braun U, Groenewald JZ, Crous PW. 2012. The genus Cladosporium. Studies in Mycology 72: 1–401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bensch K, Groenewald JZ, Dijksterhuis J, Starink-Willemse M, Andersen B, et al. 2010. Species and ecological diversity within the Cladosporium cladosporioides complex (Davidiellaceae, Capnodiales). Studies in Mycology 67: 1–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Boland DJ, Brooker IH, Chippendale GM, McDonald MW. 2006. Forest trees of Australia: CSIRO Publishing. [Google Scholar]
  9. Braun U, Crous PW, Dugan F, Groenewald JZ, Hoog GS de . 2003. Phylogeny and taxonomy of Cladosporium-like hyphomycetes, including Davidiella gen. nov., the teleomorph of Cladosporium s.str. Mycological Progress 2: 3–18. [Google Scholar]
  10. Burgess TI, Barber PA, Sufaati S, Xu D, Hardy GES, Dell B. 2007. Mycosphaerella spp. on Eucalyptus in Asia: new species, new hosts and new records. Fungal Diversity 24: 135–157. [Google Scholar]
  11. Butin H, Pehl L, Hoog GS de, Wollenzien U. 1996. Trimmatostroma abietis sp. nov. (hyphomycetes) and related species. Antonie Van Leeuwenhoek 69: 203–209. [DOI] [PubMed] [Google Scholar]
  12. Cai L, Hyde KD, Taylor PWJ, Weir BS, Waller JM, et al. 2009. A polyphasic approach for studying Colletotrichum. Fungal Diversity 39: 183–204. [Google Scholar]
  13. Carbone I, Kohn LM. 1999. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91: 553–556. [Google Scholar]
  14. Cheewangkoon R, Crous PW, Hyde KD, Groenewald JZ, To-anan C. 2008. Species of Mycosphaerella and related anamorphs on Eucalyptus leaves from Thailand. Persoonia 21: 77–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Cortinas MN, Barnes I, Wingfield MJ, Wingfield BD, 2010. Genetic diversity in the Eucalyptus stem pathogen Teratosphaeria zuluensis. Australasian Plant Pathology 39: 383–393. [Google Scholar]
  16. Cortinas MN, Crous PW, Wingfield BD, Wingfield MJ. 2006. Multi-gene phylogenies and phenotypic characters distinguish two species within the Colletogloeopsis zuluensis complex associated with Eucalyptus stem cankers. Studies in Mycology 55: 133–146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Costello MJ, May RM, Stork NE. 2013. Can we name earth’s species before they go extinct? Science 339: 413–416. [DOI] [PubMed] [Google Scholar]
  18. Crous PW. 1998. Mycosphaerella spp. and their anamorphs associated with leaf spot diseases of Eucalyptus. Mycologia Memoir 21: 1–170 APS Press, MN, USA. [Google Scholar]
  19. Crous PW. 2009. Taxonomy and phylogeny of the genus Mycosphaerella and its anamorphs. Fungal Diversity 38: 1–24. [Google Scholar]
  20. Crous PW, Alfenas AC. 1995. Mycosphaerella gracillis and other species of Mycosphaerella associated with leaf spot of Eucalyptus in Indonesia. Mycologia 87: 121–126. [Google Scholar]
  21. Crous PW, Aptroot A, Kang JC, Braun U, Wingfield MJ. 2000. The genus Mycosphaerella and its anamorphs. Studies in Mycology 45: 107–121. [Google Scholar]
  22. Crous PW, Braun U. 2003. Mycosphaerella and its anamorphs: 1. Names published in Cercospora and Passalora. CBS Biodiversity Series No 1. Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands. [Google Scholar]
  23. Crous PW, Braun U, Groenewald JZ. 2007a. Mycosphaerella is polyphyletic. Studies in Mycology 58: 1–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Crous PW, Braun U, Hunter GC, Wingfield MJ, Verkley GJM, et al. 2013. Phylogenetic lineages in Pseudocercospora. Studies in Mycology 75: 37–114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Crous PW, Braun U, Schubert K, Groenewald JZ. 2007b. Delimiting Cladosporium from morphologically similar genera. Studies in Mycology 58: 33–56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Crous PW, Ferreira FA, Alfenas A, Wingfield MJ. 1993. Mycosphaerella suberosa associated with corky leaf spots on Eucalyptus in Brazil. Mycologia 85: 705–710. [Google Scholar]
  27. Crous PW, Ferreira FA, Sutton BC. 1997. A comparison of the fungal genera Phaeophleospora and Kirramyces (coelomycetes). South African Journal of Botany 63: 111–115. [Google Scholar]
  28. Crous PW, Gams W, Stalpers JA, Robert V, Stegehuis G. 2004a. MycoBank: an online initiative to launch mycology into the 21st century. Studies in Mycology 50: 19–22. [Google Scholar]
  29. Crous PW, Groenewald JZ. 2005. Hosts, species and genotypes: opinions versus data. Australasian plant pathology 34: 463–470. [Google Scholar]
  30. Crous PW, Groenewald JZ, Mansilla JP, Hunter GC, Wingfield MJ. 2004b. Phylogenetic reassessment of Mycosphaerella spp. and their anamorphs occurring on Eucalyptus. Studies in Mycology 50: 195–214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Crous PW, Groenewald JZ, Pongpanich K, Himaman W, Arzanlou M, Wingfield MJ. 2004c. Cryptic speciation and host specificity among Mycosphaerella spp. occurring on Australian Acacia species grown as exotics in the tropics. Studies in Mycology 50: 457–469. [Google Scholar]
  32. Crous PW, Groenewald JZ, Summerell BA, Wingfield BD, Wingfield MJ. 2009a. Co-occurring species of Teratosphaeria on Eucalyptus. Persoonia 22: 38–48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Crous PW, Hong L, Wingfield MJ, Wingfield BD, Kang JC. 1999. Uwebraunia and Dissoconium, two morphologically similar anamorph genera with different teleomorph affinity. Sydowia 51: 155–166. [Google Scholar]
  34. Crous PW, Kang JC, Braun U. 2001. A phylogenetic redefinition of anamorph genera in Mycosphaerella based on ITS rDNA sequence and morphology. Mycologia 93: 1081–1101. [Google Scholar]
  35. Crous PW, Schoch CL, Hyde KD, Wood AR, Gueidan C, Hoog GS de, Groenewald JZ. 2009b. Phylogenetic lineages in the Capnodiales. Studies in Mycology 64: 17–47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Crous PW, Summerell BA, Carnegie AJ, Mohammed C, Himaman W, Groenewald JZ. 2007c. Foliicolous Mycosphaerella spp. and their anamorphs on Corymbia and Eucalyptus. Fungal Diversity 26: 143–185. [Google Scholar]
  37. Crous PW, Summerell BA, Carnegie AJ, Wingfield MJ, Groenewald JZ. 2009c. Novel species of Mycosphaerellaceae and Teratosphaeriaceae. Persoonia 23: 119–146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Crous PW, Summerell BA, Carnegie AJ, Wingfield MJ, Hunter GC, et al. 2009d. Unravelling Mycosphaerella: do you believe in genera? Persoonia 23: 99–118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Crous PW, Summerell BA, Mostert L, Groenewald JZ. 2008. Host specificity and speciation of Mycosphaerella and Teratosphaeria species associated with deaf spots of Proteaceae. Persoonia 20: 59–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Crous PW, Verkley GJM, Groenewald JZ, Samson RA. (eds). 2009e. Fungal Biodiversity. CBS Laboratory Manual Series 1: 1–269 Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands. [Google Scholar]
  41. Crous PW, Wingfield MJ. 1996. Species of Mycosphaerella and their anamorphs associated with leaf blotch disease of Eucalyptus in South Africa. Mycologia 88: 441–458. [Google Scholar]
  42. Crous PW, Wingfield MJ, Mansilla J, Alfenas AC, Groenewald JZ. 2006. Phylogenetic reassessment of Mycosphaerella spp. and their anamorphs occurring on Eucalyptus. Studies in Mycology 55: 99–131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Crous PW, Wingfield MJ, Marasas WFO, Sutton BC. 1989. Pseudocercospora eucalyptorum sp. nov. on Eucalyptus leaves. Mycological Research 93: 394–398. [Google Scholar]
  44. Crous PW, Wingfield MJ, Park RF. 1991Mycosphaerella nubilosa, a synonym of M. molleriana. Mycological Research 95: 628–632. [Google Scholar]
  45. Darwin C. 1859. On the origin of species. London, John Murray. [Google Scholar]
  46. Dettman JR, Jacobson DJ, Taylor JW. 2003a. A multilocus genealogical approach to phylogenetic species recognition in the model eukaryote Neurospora. Evolution 57: 2703–2720. [DOI] [PubMed] [Google Scholar]
  47. Dettman JR, Jacobson DJ, Turner E, Pringle A, Taylor JW. 2003b. Reproductive isolation and phylogenetic divergence in Neurospora: Comparing methods of species recognition in a model eukaryote. Evolution 57: 2721–2741. [DOI] [PubMed] [Google Scholar]
  48. Dugan FM, Braun U, Groenewald JZ, Crous PW. 2008. Morphological plasticity in Cladosporium sphaerospermum. Persoonia 21: 9–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Egidi E, Hoog GS de, Isola D, Onofri S, Stielow B, Quaedvlieg W, Zucconi L, Selbmann L. 2014. Phylogeny and taxonomy of meristematic rock-inhabiting black fungi in the Dothidemycetes based on multi-locus phylogenies. Fungal Diversity 65: 127–165. [Google Scholar]
  50. Friedmann EI. 1982. Endolithic microorganisms in the Antarctic cold desert. Science 215: 1045–1053. [DOI] [PubMed] [Google Scholar]
  51. Frisvad JC, Samson RA. 2004. Polyphasic taxonomy of Penicillium subgenus Penicillium – A guide to identification of food and air-borne terverticillate penicillia and their mycotoxins. Studies in Mycology 49: 1–173. [Google Scholar]
  52. Gadgil PD, Dick M. 1983. Fungi Eucalyptorum novazelandiae: Septoria pulcherrima sp. nov. and Trimmatostroma bifarium sp. nov. New Zealand Journal of Botany 21: 49–52. [Google Scholar]
  53. Geiser DM, Pitt JI, Taylor JW. 1998. Cryptic speciation and recombination in the aflatoxin-producing fungus Aspergillus flavus. Proceedings of the National Academy of Sciences of the United States of America 95: 388–393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Gezahgne A, Roux J, Wingfield MJ. 2003. Diseases of exotic Eucalyptus and Pinus species in Ethiopian plantations. South African Journal of Science 99: 29–33. [Google Scholar]
  55. Goodwin SB, Dunkle LD, Zismann VL. 2001. Phylogenetic analysis of Cercospora and Mycosphaerella based on the internal transcribed spacer region of ribosomal DNA. Phytopathology 91: 648–658. [DOI] [PubMed] [Google Scholar]
  56. Grattapaglia D, Vaillancourt R, Shepherd M, Thumma B, Foley W, et al. 2012. Progress in Myrtaceae genetics and genomics: Eucalyptus as the pivotal genus. Tree Genetics & Genomes 8: 463–508. [Google Scholar]
  57. Groenewald JZ, Nakashima C, Nishikawa J, Shin H-D, Park J-H, et al. 2013. Species concepts in Cercospora: spotting the weeds among the roses. Studies in Mycology 75: 115–170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Groenewald M, Groenewald JZ, Crous PW. 2005. Distinct species exist within the Cercospora apii morphotype. Phytopathology 95: 951–959. [DOI] [PubMed] [Google Scholar]
  59. Hall TA. 1999. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98. [Google Scholar]
  60. Hebert PDN, Cywinska A, Ball SL, DeWaard JR. 2003. Biological identifications through DNA barcodes. Proceedings of the Royal Society of London Series B-Biological Sciences 270: 313–321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Hennig W. 1966. Phylogenetic systematics.University of Illinois Press, Urbana, USA. [Google Scholar]
  62. Hoog GS de, Guarro J, Gené J, Figueras MJ. 2000. Atlas of clinical fungi, 2nd ed Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands; University Rovira i Virgili, Reus, Spain. [Google Scholar]
  63. Hunter GC, Crous PW, Carnegie AJ, Burgess TI, Wingfield MJ. 2011. Mycosphaerella and Teratosphaeria diseases of Eucalyptus; easily confused and with serious consequences. Fungal Diversity 50: 145–166. [Google Scholar]
  64. Hunter GC, Roux J, Wingfield BD, Crous PW, Wingfield MJ. 2004. Mycosphaerella species causing leaf disease in South African Eucalyptus plantations. Mycological Research 108: 672–681. [DOI] [PubMed] [Google Scholar]
  65. Hunter GC, Wingfield BD, Crous PW, Wingfield MJ. 2006. A multi-gene phylogeny for species of Mycosphaerella occurring on Eucalyptus leaves. Studies in Mycology 55: 147–161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Huson DH. 1998. SplitsTree: analyzing and visualizing evolutionary data. Bioinformatics 14: 68–73. [DOI] [PubMed] [Google Scholar]
  67. Huson DH, Bryant D. 2006. Application of phylogenetic networks in evolutionary studies. Molecular Biology and Evolution 23: 254–267. [DOI] [PubMed] [Google Scholar]
  68. Hyde KD, Jones EBG, Lui J-K, Ariyawansa H, Boehm E, et al. 2013. Families of Dothideomycetes. Fungal Diversity 63: 1–313. [Google Scholar]
  69. Katoh K, Misawa K, Kuma K, Miyata T. 2002. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research 30: 3059–3066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Kohlmeyer J, Volkmann-Kohlmeyer B, Eriksson OE. 1999. Fungi on Juncus roemerianus 12. Two new species of Mycosphaerella and Paraphaeosphaeria (Ascomycotina). Botanica Marina 42: 505–511. [Google Scholar]
  71. Koufopanou V, Burt A, Taylor JW. 1997. Concordance of gene genealogies reveals reproductive isolation in the pathogenic fungus Coccidioides immitis. Proceedings of the National Academy of Sciences of the United States of America 94: 5478–5482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Leslie JF, Summerell BA. 2006. The Fusarium laboratory manual. Blackwell Publishing, Ames, USA. [Google Scholar]
  73. Li HY, Sun GY, Zhai XR, Batzer JC, Mayfield DA, Crous PW, Groenewald JZ, Gleason ML. 2012. Dissoconiaceae associated with sooty blotch and flyspeck on fruits in China and the United States. Persoonia 28: 113–125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Marincowitz S, Crous PW, Groenewald JZ, Wingfield MJ. 2008. Microfungi occurring on Proteaceae in the Fynbos. CBS Biodiversity Series 7: 1–166 CBS Fungal Biodiversity Centre, Utrecht, The Netherlands. [Google Scholar]
  75. Mason-Gamer RJ, Kellogg EA. 1996. Testing for phylogenetic conflict among molecular data sets in the tribe Triticeae (Gramineae). Systematic Biology 45: 524–545. [Google Scholar]
  76. Maxwell A, Dell B, Neumeister-Kemp HG, Hardy GEStJ. 2003. Mycosphaerella species associated with Eucalyptus in south-western Australia: new species, new records and a key. Mycological Research 107: 351–359. [DOI] [PubMed] [Google Scholar]
  77. Mayr E. 1942. Systematics and the origin of species. Columbia University Press, New York, USA. [Google Scholar]
  78. Müller E, Oehrens E. 1982. On the genus Teratosphaeria (Ascomycetes). Sydowia 35: 38–42. [Google Scholar]
  79. Nosrati S, Esmailzadeh-Hosseini SA, Sarpeleh A. 2010. First report of Penidiella strumelloidea as a pathogen of greenhouse cucumbers in Iran. Phytoparasitica 38: 95–97. [Google Scholar]
  80. Nylander JAA. 2004. MrModeltest v2. Program distributed by the author. Evolutionary Biology Centre Uppsala University; 2: 1–2. [Google Scholar]
  81. O’Donnell K, Cigelnik E. 1997. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Molecular Phylogenetics and Evolution 7: 103–116. [DOI] [PubMed] [Google Scholar]
  82. O’Donnell K, Kistler HC, Cigelnik E, Ploetz RC. 1998. Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proceedings of the National Academy of Sciences of the United States of America 95: 2044–2049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  83. Old KM, Wingfield MJ, Yuan ZQ. 2003. A manual of diseases of eucalypts in South-East Asia. Centre for International Forestry Research, Jakarta, Indonesia. [Google Scholar]
  84. Park RF, Keane PJ, Wingfield MJ, Crous PW. 2000. Fungal diseases of eucalypt foliage. In: Keane PJ, Kile GA, Podger FD, Brown BN. (eds), Diseases and pathogens of eucalypts: 153–239 CSIRO Publishing, Australia. [Google Scholar]
  85. Pérez G, Burgess T, Slippers B, Carnegie A, Wingfield B, Wingfield M. 2013. Teratosphaeria pseudonubilosa sp. nov., a serious Eucalyptus leaf pathogen in the Teratosphaeria nubilosa species complex. Australasian Plant Pathology 43: 67–77. [Google Scholar]
  86. Philippe H, Bryant D. 2006. A simple and robust statistical test for detecting the presence of recombination. Genetics 172: 2665–2681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  87. Plemenitas A, Vaupotic T, Lenassi M, Kogej T, Gunde-Cimerman N. 2008. Adaptation of extremely halotolerant black yeast Hortaea werneckii to increased osmolarity: a molecular perspective at a glance. Studies in Mycology 61: 67–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  88. Quaedvlieg W, Groenewald JZ, Jesús Yáñez-Morales M de, Crous PW. 2012. DNA barcoding of Mycosphaerella species of quarantine importance to Europe. Persoonia 29: 101–115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  89. Quaedvlieg W, Kema GHJ, Groenewald JZ, Verkley GJM, Seifbarghi S, et al. 2011. Zymoseptoria gen. nov.: a new genus to accommodate Septoria-like species occurring on graminicolous hosts. Persoonia 26: 57–69. [DOI] [PMC free article] [PubMed] [Google Scholar]
  90. Quaedvlieg W, Verkley GJM, Shin H-D, Barreto RW, Alfenas AC, et al. 2013. Sizing up Septoria. Studies in Mycology 75: 307–390. [DOI] [PMC free article] [PubMed] [Google Scholar]
  91. Queiroz K de. 2007. Species concepts and species delimitation. Systematic Biology 56: 879–886. [DOI] [PubMed] [Google Scholar]
  92. Rayner RW. 1970. A mycological colour chart. Commonwealth Mycological Institute and British Mycological Society, Surrey, UK. [Google Scholar]
  93. Ronquist F, Teslenko M, Mark P van der, Ayres DL, Darling A, et al. 2011. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  94. Ruibal C, Gueidan C, Selbmann L, Gorbushina AA, Crous PW, et al. 2009. Phylogeny of rock-inhabiting fungi related to Dothideomycetes. Studies in Mycology 64: 123–133S7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  95. Ruibal C, Millanes AM, Hawksworth DL. 2011. Molecular phylogenetic studies on the lichenicolous Xanthoriicola physciae reveal Antarctic rock-inhabiting fungi and Piedraia species among closest relatives in the Teratosphaeriaceae. IMA Fungus 2: 97–103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  96. Samson RA, Hong S-B, Frisvad JC. 2006. Old and new concepts of species differentiation in Aspergillus. Medical Mycology 44: S133–S148. [DOI] [PubMed] [Google Scholar]
  97. Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, et al. 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for fungi. Proceedings of the National Academy of Sciences of the United States of America 109: 6241–6246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  98. Schoch CL, Shoemaker RA, Seifert KA, Hambleton S, Spatafora JW, Crous PW. 2006. A multigene phylogeny of the Dothideomycetes using four nuclear loci. Mycologia 98: 1041–1052. [DOI] [PubMed] [Google Scholar]
  99. Schubert K, Groenewald JZ, Braun U, Dijksterhuis J, Starink M, et al. 2007. Biodiversity in the Cladosporium herbarum complex (Davidiellaceae, Capnodiales), with standardisation of methods for Cladosporium taxonomy and diagnostics. Studies in Mycology 58: 105–156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  100. Seifert KA, Nickerson NL, Corlett M, Jackson ED, Louis-Seize G, Davies RJ. 2004. Devriesia, a new hyphomycete genus to accommodate heat-resistant, cladosporium-like fungi. Canadian Journal of Botany 82: 914–926. [Google Scholar]
  101. Selbmann L, Hoog GS de, Zucconi L, Isola D, Ruisi S, et al. 2008. Drought meets acid: three new genera in a dothidealean clade of extremotolerant fungi. Studies in Mycology 61: 1–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  102. Selbmann L, Hoog GS de, Mazzaglia A, Friedmann EI, Onofri S. 2005. Fungi at the edge of life: cryptoendolithic black fungi from Antarctic desert. Studies in Mycology 51: 1–32. [Google Scholar]
  103. Slippers B, Stenlid J, Wingfield MJ. 2005. Emerging pathogens: fungal host jumps following anthropogenic introduction. Trends in Ecology & Evolution 20: 420–421. [DOI] [PubMed] [Google Scholar]
  104. Smith H, Wingfield MJ, Crous PW, Coutinho TA. 1996. Sphaeropsis sapinea and Botryosphaeria dothidea endophytic in Pinus spp. and Eucalyptus spp. in South Africa. South African Journal of Botany 62: 86–88. [Google Scholar]
  105. Starkey DE, Ward TJ, Aoki T, Gale LR, Kistler HC, et al. 2007. Global molecular surveillance reveals novel Fusarium head blight species and trichothecene toxin diversity. Fungal Genetics and Biology 44: 1191–1204. [DOI] [PubMed] [Google Scholar]
  106. Stewart EL, Liu ZW, Crous PW, Szabo LJ. 1999. Phylogenetic relationships among some cercosporoid anamorphs of Mycosphaerella based on rDNA sequence analysis. Mycological Research 103: 1491–1499. [Google Scholar]
  107. Stukenbrock EH, Quaedvlieg W, Javan-Nikhah M, Zala M, Crous PW, McDonald BA. 2012. Zymoseptoria ardabilia and Z. pseudotritici, two progenitor species of the septoria tritici leaf blotch fungus Z. tritici (synonym: Mycosphaerella graminicola). Mycologia 104: 1397–1407. [DOI] [PubMed] [Google Scholar]
  108. Sutton BC, Ganapathi A. 1978. Trimmatostroma excentricum sp. nov. on Eucalyptus from New-Zealand and Fiji. New Zealand Journal of Botany 16: 529–533. [Google Scholar]
  109. Swart L, Crous PW, Denman S, Palm ME. 1998. Fungi occurring on Proteaceae. South African Journal of Botany 64: 137–145. [Google Scholar]
  110. Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596–1599. [DOI] [PubMed] [Google Scholar]
  111. Taylor JE, Crous PW. 2000. Fungi occurring on Proteaceae: new anamorphs for Teratosphaeria, Mycosphaerella and Lembosia, and other fungi associated with leaf spots and cankers of proteaceous hosts. Mycological Research 104: 618–636. [Google Scholar]
  112. Taylor JE, Crous PW. 2001. Morphological variation and cultural characteristics of Coniothyrium leucospermi associated with leaf spots of Proteaceae. Mycoscience 42: 265–271. [Google Scholar]
  113. Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, et al. 2000. Phylogenetic species recognition and species concepts in fungi. Fungal Genetics and Biology 31: 21–32. [DOI] [PubMed] [Google Scholar]
  114. Turnbull JW. 2000. Economic and social importance of eucalypts. CSIRO Publishing, Australia. [Google Scholar]
  115. Valen L van. 1976. Ecological species, multispecies and oaks. Taxon 25: 233–239. [Google Scholar]
  116. Verkley GJM, Crous PW, Groenewald JZ, Braun U, Aptroot A. 2004. Mycosphaerella punctiformis revisited: morphology, phylogeny, and epitypification of the type species of the genus Mycosphaerella (Dothideales, Ascomycota). Mycological Research 108: 1271–1282. [DOI] [PubMed] [Google Scholar]
  117. Verkley GJM, Quaedvlieg W, Shin H-D, Crous PW. 2013. A new approach to species delimitation in Septoria. Studies in Mycology 75: 213–305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  118. Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238–4246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  119. White TJ, Bruns T, Lee J, Taylor SB. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ. (eds), PCR protocols: a guide to methods and applications: 315–322 Academic Press, San Diego, California, USA. [Google Scholar]
  120. Wingfield MJ, Crous PW, Coutinho TA. 1996. A serious canker disease of Eucalyptus in South Africa caused by a new species of Coniothyrium. Mycopathologia 136: 139–145. [DOI] [PubMed] [Google Scholar]
  121. Wingfield MJ, Crous PW, Peredo HL. 1995. A preliminary, annotated list of foliar pathogens of Eucalyptus spp. in Chile. South African Forestry Journal 173: 53–57. [Google Scholar]
  122. Wingfield MJ, Roux J, Coutinho T, Govender P, Wingfield BD. 2001. Plantation disease and pest management in the next century. South African Forestry Journal 190: 67–71. [Google Scholar]
  123. Wright S.1940The new systematics.Oxford University Press, London, UK. [Google Scholar]

Articles from Persoonia : Molecular Phylogeny and Evolution of Fungi are provided here courtesy of Naturalis Biodiversity Center & Centraalbureau voor Schimmelcultures

RESOURCES