Skip to main content
NCBI home page
Scientific Reports logoLink to Scientific Reports
. 2026 Jul 25;16:25509. doi: 10.1038/s41598-026-61844-5

Design and transfection of CRISPR/Cas9 constructs for the myostatin gene in Labeo rohita muscle cells

Gowhar Iqbal 1, Nevil Pinto 1, Darshan Pawaskar 1, Arvind A Sonwane 1, Kiran D Rasal 1, Lukram Sushil Singh 1, Nidarshan N Chikkathimmashetty 1, Mukunda Goswami 1,✉
PMCID: PMC13476449  PMID: 42601370

Abstract

Myostatin (mstn) is a negative regulator of skeletal muscle growth and is considered as an important target for enhancing aquaculture production. The present study aimed to design and validate single-guide RNAs (sgRNAs) and CRISPR/Cas9 constructs for exon 1 of the mstnb gene in Labeo rohita, and to evaluate their transfection efficiency in the L. rohita dorsal muscle (LRDM) cell line at the 10th, 20th, and 30th passages. sgRNAs were designed and cloned into the pSpCas9(BB)-2A-GFP (PX458) vector using BbsI restriction digestion and ligation. Successful insertion and correct orientation of the sgRNAs were confirmed through Sanger sequencing. LRDM cells were revived and maintained in L-15 medium supplemented with 10% fetal bovine serum. Transfection was performed at the 10th, 20th, and 30th passages. Distinct GFP-positive cells were observed at all passages for both sgRNA constructs, indicating the ability of the developed cell line to successfully express the constructs across different passages. The study successfully established CRISPR/Cas9 plasmid constructs for the mstnb gene in L. rohita and demonstrated their transfection in LRDM cell line across multiple passages. These findings provide a basis for future studies on genome editing approaches using CRISPR/Cas9 constructs in fish muscle cell lines and highlight the potential application of CRISPR/Cas9 technology for genetic engineering applications in fish muscle cells.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-026-61844-5.

Keywords: CRISPR/Cas9, Mstnb, Transfection, pSpCas9(BB)-2A-GFP plasmid, Muscle cells, sgRNAs, Labeo rohita

Subject terms: Biological techniques, Biotechnology, Genetics, Molecular biology

Introduction

Genome editing using the CRISPR/Cas9 platform is a valuable research tool because it enables precise and targeted modifications in the genomes of species of interest1. This technology has become widely used for studying the functional roles of specific genes associated with economically and biologically important traits. Among these genes, myostatin (mstn) is of particular interest because it acts as a negative regulator of skeletal muscle growth in several mammalian species2. Studies in fish models have further highlighted the importance of mstn in muscle development3. In zebrafish inhibiting mstn leads to an increase in skeletal muscle fibres4, in Nile tilapia (Oreochromis niloticus), knockdown of mstn improves muscle quality5, while similar findings were reported in medaka6. Unlike mammals, which possess only a single mstn gene, many bony fish species contain two paralogs, mstna and mstnb. These duplicate genes have been identified in zebrafish7, channel catfish (Ictalurus punctatus)8,9, grass carp (Ctenopharyngodon idellus)10, and blunt snout bream (Megalobrama amblycephala)11. Because of its regulatory role in muscle growth, mstn knockout has been widely explored to study its effects on muscle development and growth performance in both in vivo and in vitro systems.

CRISPR/Cas9 has revolutionized genome editing due to its simplicity, robustness, efficiency, and flexibility compared with earlier technologies such as zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs)12,13. These advantages have enabled the generation of well-defined genetically modified organisms and customized gene-edited cell lines14–16. Furthermore, CRISPR/Cas9 has been extensively applied to produce gene knockout animal models17 as well as engineered cell lines including fish cell line18,19.

Fish cell lines have been developed from a wide range of tissues, including ovary, fin, spleen, swim bladder, heart, liver, eye, muscle, brain, head kidney, and skin20–22. These cell lines serve as important in vitro models and can be used for detecting viruses, as well as for studying the molecular and cellular basis of physiological processes and toxicological mechanisms23–27. Fish cell culture provides valuable insights into the basic biology of fish and has become an essential tool in modern research. It has diverse applications in biomedical research, stem cell research, production of monoclonal antibodies, cell biology, gene expression studies, vaccine development, toxicology, genome editing technology, and functional analysis of genes21,28,29.

Gene editing using in vitro methods helps optimize experimental procedures before proceeding to in vivo studies, thereby saving both time and cost. Despite the successful application of CRISPR/Cas9 gene editing in fish embryos through microinjection, its use in cultured fish cells has remained limited, possibly due to the low efficiency of delivering CRISPR/Cas9 constructs into fish cells30,31 However, the transfection efficiency of mammalian cells is generally higher than that of fish cells due to difference in the cell membrane fluidity24,32,33. The present study aims to develop CRISPR/Cas9 constructs for exon 1 of the mstnb gene in the LRDM cell line and to evaluate their efficiency at the 10th, 20th, and 30th passages.

Material and methods

Ethical statement

All experimental protocols in the study were approved by the Institutional Animal Ethics Committee (IAEC) and Board of Studies (BoS) of the Fish Genetics and Biotechnology Division, ICAR-Central Institute of Fisheries Education, Mumbai, India. All methods were carried out in accordance with relevant guidelines and regulations approved by the committee under code no. 524/GO/ReRcBiBit/S/02/CCSEA dated 25.09.2023.

Design of sgRNAs for the mstnb gene

The mstnb gene of L. rohita consists of 3 exons and 2 introns. For this study, the mstnb gene sequence was retrieved from the National Center for Biotechnology Information (NCBI) database having reference sequence: NC_066877.1. Two sgRNAs were designed to target the exon 1 and were analysed using the using the IDT sgRNA design tool as shown in Table 1. sgRNAs were chosen based on scores such as minimum off-targets, high efficiency, optimum GC content, low self-complementarity, and also low possibility of secondary structures formation (heterodimer, self-dimer, and hairpin). The pSpCas9-(BB)-2A-GFP allows the expression of the sgRNA under the control of the human U6 promoter, which requires a “G” base at the transcription start site. Therefore, a “G” was added at the start of the sgRNA sequence. All the designed sgRNAs were predicted for secondary structures before being selected for downstream process.

Table 1.

Sequences of the designed sgRNAs along with their corresponding exon targets.

Oligo name Oligo sequence (5′–3′) Exon
LR-mstnb-E1-g1-Fw caccgTTGCAACAACTTCTGGATCA 01
LR-mstnb-E1-g1-Rv aaacTGATCCAGAAGTTGTTGCAAc
LR-mstnb-E1-g2-Fw caccgACTCAAACAGGCTCCAAACA 01
LR-mstnb-E1-g2-Rv aaacTGTTTGGAGCCTGTTTGAGTc
Open in a new tab

Lowercase nucleotide sequences represent cloning overhangs used for PX458 vector ligation, whereas uppercase nucleotide sequences indicate the sgRNAs target sequences specific to exon 1 of the mstnb gene.

Preparation of the sgRNAs oligos inserts

The designed sgRNAs were synthesised as DNA nucleotide sequences and cloned into the digested (pSpCas9(BB)-2A-GFP plasmid). The sense and antisense oligonucleotides (oligos) of each sgRNA were resuspended in IDTE buffer (Integrated DNA Technologies, USA) to a final concentration of 100 μM) and stored at − 20 °C. To phosphorylate and anneal the diluted oligos, 1 μl of sgRNA forward oligo (100 μM), 1 μl of sgRNA reverse (100 μM) oligo was mixed with 1ul of T4 ligation buffer, 1 μl of T4 polynucleotide kinase (T4 PNK) (New England Biolabs, Ipswich, MA, USA) and 6 μl of ddH2O to obtain a final volume of 10 μl. The mixture was incubated in a thermocycler using the following parameters: 37 °C for 30 min; 95 °C for 5 min; and ramped down to 25 °C at 5 °C/min. The annealed and phosphorylated oligos were diluted 1:200 by adding 1 μl of oligo to 199 μl of room temperature ddH2O.

Ligation and cloning of the pSpCas9(BB)-2A-GFP plasmid backbone and sgRNA insert

sgRNAs was cloned into pSpCas9 (BB)-2A-GFP (PX458) (Addgene plasmid ID: 48138) using the BbsI restriction enzyme as per the protocol described by Ran and colleagues34. Ligation reactions for each sgRNA were performed by mixing 0.5 μl (100 ng/μl) of pSpCas9(BB) 0.5 μl of diluted phosphorylated and annealed oligos, 2 μl of 10 × Tango buffer, 1 μl of 10 mM DTT, 1 μl of 10 mM ATP, 1 μl of FastDigest BbsI (New England Biolabs, USA), 0.5 μl of T7 ligase, and 13.5 μl of ddH2O to make a final reaction volume of 20 μl. The plasmid pSpCas9(BB) without insert was used as a negative control for the ligation reaction. The ligation mixture was incubated at 37 °C for 1 h, using a thermal cycling protocol (Bio-Rad, USA) of 37 °C for 5 min followed by 21 °C for 5 min, repeated for 1 to 6 cycles. The ligation reaction was treated with PlasmidSafe exonuclease to digest any residual linearized DNA. For this, the 11 μl of ligation reaction, 1.5 μl of PlasmidSafe buffer (10 ×), 1.5 μl of 10 mM ATP, and 1.5 μl of plasmidSafe exonuclease were mixed to obtain a total volume of 15 μl. The mixture was then incubated at 37 °C for 30 min, followed by 70 °C for 30 min to inactivate the enzyme.

Transformation and screening of colonies

The recombinant plasmid mixtures were transformed into chemically competent Escherichia coli DH5α cells using the QIAGEN PCR Cloning Kit (Cat. No. 23112) following the manufacturer’s protocol. Plating was done on agar plates where ampicillin was added as a selection marker and kept overnight in an incubator at 37 °C. Ligation of BbsI-digested pSpCas9(BB) alone, without the annealed sgRNA oligo insert, was used as a negative control plate. Three individual colonies were randomly chosen from the plate and inoculated into 5 mL of sterile LB broth supplemented with ampicillin (100 µg/mL; Sigma-Aldrich, USA). The cultures were shaken at 180 rpm and incubated overnight at 37 °C.

Plasmid isolation and assessment quality of plasmid DNA

Plasmid DNA was purified from the overnight bacterial culture using a plasmid isolation kit (Qiagen, Cat. No. 12145) according to the manufacturer’s instructions, with minor adjustments made to maximize yield and purity. The quality and integrity of the isolated plasmid were assessed by gel electrophoresis using a 0.8% agarose gel. The quantity of plasmid DNA was estimated using a spectrophotometer (NanoDrop, Thermo Fisher Scientific, USA).

Verification of the sgRNAs insert by using Sanger sequencing

The isolated plasmid containing the target insert was sent to Eurofins Scientific for Sanger sequencing in triplicates using the 10 µM U6 forward primer (GGACTATCATATGCTTACCGTAACTTGA) to confirm the presence and orientation of the desired gRNA insert. The concentrations of the plasmids were adjusted to 150–200 ng/µl. After obtaining the sequencing data, chromatograms were analysed using FinchTV to confirm the presence of inserts. The quality of the base calls was assessed based on peak form and signal clarity.

Cell culture

The LRDM cells, developed from the dorsal muscle tissue of Labeo rohita by Iqbal and colleagues, was used in the present study35. Cells at the 10th, 20th, and 30th passages were revived and utilized for subsequent transfection experiments. Briefly, cryovial was thawed in a water bath at 32–35 °C. The cell suspension was then centrifuged at 1000 rpm for 5 min at room temperature. After centrifugation, the pellet was resuspended in L-15 medium supplemented with 10% fetal bovine serum (FBS) and seeded into a 25 cm2 tissue culture flask, followed by incubation at 28 °C in BOD.

Transfection

Prior to transfection LRDM cells at the 10th, 20th, and 30th passages were seeded into 24 well culture plates and allowed to reach approximately 80–90% confluency. The plates were kept in a BOD incubator for 14–18 h, after which the cells were transfected. Transfection was carried out using Lipofectamine 3000 (Cat. No L3000008; Invitrogen, USA) following the manufacturer’s recommended protocol with minor modifications. Briefly, Lipofectamine 3000 reagent (1.5 µl) was diluted in 25 µl Opti-MEM medium. Separately, a plasmid DNA master mix containing 500 ng/µl of sequence-verified CRISPR/Cas9 constructs carrying sgRNA-1 and sgRNA-2, along with 2 µl of P3000 reagent in 50 µl Opti-MEM medium, was prepared. Subsequently, 25 µl of the DNA master mix was added to the diluted Lipofectamine 3000 reagent, mixed gently, and incubated at room temperature for 20–30 min to allow complex formation. The transfection complexes (50 µl) were then added dropwise to each well of the 24 well plate and incubated at 28 °C in a BOD incubator for 48 h. Transfection efficiency was observed after 48 h post-transfection by observing GFP fluorescence under a fluorescence inverted microscope (Nikon, Japan).

Statistical analyses

Data were analyzed using one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison test in SPSS software version 22.0 (IBM Corp., USA). All results are expressed as mean ± standard deviation (SD), and differences were considered statistically significant at p < 0.05.

Results

Design of sgRNAs for the mstnb gene for pSpCas9-(BB)-2A-GFP (PX458 plasmid)

The single-guide RNAs (sgRNAs) used in this study were designed for exon 1 of the mstnb gene in L. rohita using the using the IDT sgRNA design tool to ensure high specificity for the mstnb locus and are provided in the supplementary material (SM1). CasOFFinder software was used to observe the off-target effects for the designed oligos. Both designed gRNAs showed a single predicted target site with zero mismatches and no DNA/RNA bulges, indicating high target specificity and minimal off-target potential (Fig. 1). Selected sgRNAs was confirmed for the predication of secondary structures by using RNA web server (Fig. 2). Both forward and reverse oligonucleotides for all the sgRNAs were chemically synthesized, dissolved in 1 × IDTE buffer (pH 8.0), and subsequently annealed to generate double-stranded, phosphorylated inserts suitable for cloning.

Fig. 1.

Fig. 1

Open in a new tab

Off-target effects prediction for the designed single-guide RNAs (sgRNAs) (A) sgRNA-1; (B) sgRNA-2.

Fig. 2.

Fig. 2

Open in a new tab

Predicted secondary structures of the designed single-guide RNAs (sgRNAs). (A) sgRNA-1; (B) sgRNA-2.

Ligation, cloning and transformation of the pSpCas9(BB)-2A-GFP plasmid backbone and sgRNA insert

Single-guide RNAs (sgRNAs) for the mstnb gene of L. rohita were successfully cloned into the pSpCas9(BB)-2A-GFP (PX458) vector. A ligation reaction containing only the BbsI-digested plasmid backbone without sgRNA insert served as a negative control. After ligation, the recombinant plasmid mixtures were transformed into competent E. coli DH5α cells. The transformed cultures were plated onto LB agar plates containing ampicillin (100 μg/ml). Following overnight incubation at 37 °C, distinct ampicillin-resistant colonies were obtained for each sgRNA construct and no colonies was observed in negative control (Fig. 3).

Fig. 3.

Fig. 3

Open in a new tab

Transformation results of the designed sgRNAs. (A) sgRNA-1; (B) sgRNA-2; (N) Negative control.

Plasmid isolation and quantification

Following overnight incubation at 37 °C, distinct ampicillin-resistant colonies were obtained for each gRNA construct. Three well-isolated colonies per construct were selected and inoculated into 5 mL LB broth supplemented with ampicillin, followed by incubation at 37 °C with shaking at 180 rpm. Plasmids were isolated from each broth tube (Fig. 4). Glycerol stock containing 300 µl of glycerol and 700 µl of overnight culture broth was maintained at − 80 °C for future use.

Fig. 4.

Fig. 4

Open in a new tab

Plasmid isolated from pSpCas9(BB)-2A-GFP (PX458) vector and sgRNAs. Lane M: 1 kb DNA ladder (Gene Ruler); (N) pSpCas9(BB)-2A-GFP (PX458); (A–L) sgRNAs.

Verification of the gRNA insert by using Sanger sequencing

The isolated plasmids were subjected to sanger sequencing to verify the successful insertion of the respective sgRNA sequences. Sequencing analysis confirmed correct insertion in all the colonies. The sequencing data are provided in the supplementary material (SM2). Sequencing chromatograms confirmed the presence and correct orientation of all the sgRNAs inserts in the vector (Figs. 5 and 6).

Fig. 5.

Fig. 5

Open in a new tab

Confirmation of the presence of the sgRNA-1 in the pSpCas9(BB)-2A-GFP (PX458) vector. (A) LR-mstnb-E1-g1-Fw represents the forward target sequence; (B) LR-mstnb-E1-g1-Rw represents the reverse target sequence.

Fig. 6.

Fig. 6

Open in a new tab

Confirmation of the presence of the sgRNA-2 in the pSpCas9(BB)-2A-GFP (PX458) vector. (A) LR-mstnb-E2-g2-Fw represents the forward target sequence; (B) LR-mstnb-E2-g2-Rw represents the reverse target sequence.

Cell culture

LRDM cells revived at the 10th, 20th, and 30th passages were used for transfection studies using the developed CRISPR/Cas9 constructs (Fig. 7). Cells were maintained in L-15 medium supplemented with 10% fetal bovine serum (FBS) without antibiotic.

Fig. 7.

Fig. 7

Open in a new tab

Revival of LRDM cells at different passages. Scale bar: 100 μm. (A) Cells at 10th passage (10X), (B) Cells at 20th passage (10X), (C) Cells at 30th passage (10X).

Transfection of designed CRISPR/Cas9 construct containing single-guide RNA-1 (sgRNA-1)

The LRDM cells was transfected with the designed CRISPR/Cas9 construct containing single-guide RNA-1 (sgRNA-1). Transfection experiments were performed at the 10th, 20th, and 30th passages. Distinct green fluorescence was observed in LRDM cell line after 48 h (Fig. 8). A significant increase in fluorescence intensity of sgRNA-1 was observed in the 20th and 30th passages, labelled ‘b’, compared to the 10th passage, labelled ‘a’ (p < 0.05). However, no significant difference was observed between the 20th and 30th passages (p > 0.05) (Fig. 9).

Fig. 8.

Fig. 8

Open in a new tab

Transfection of a LRDM cells using the CRISPR/Cas9 containing sgRNA-1 at 10th (P10), 20th (P20) and 30th (P30) passages. Scale bar: 300 μm. Bright-field, Fluorescence, and Merged images are shown for cells transfected at the 10th passage (A–C), 20th passage (D–F), and 30th passage (G–I), respectively.

Fig. 9.

Fig. 9

Open in a new tab

The mean GFP fluorescence intensity was quantified using ImageJ. Data is presented as means ± SD of three independent replicates. Different lowercase letters (a, b) above the bars indicate significant differences among passages (p < 0.05).

Transfection of designed CRISPR/Cas9 construct containing single-guide RNA-2 (sgRNA-2)

The LRDM cells was transfected with the designed pSpCas9(BB)-2A-GFP construct containing single-guide RNA-2 (sgRNA-2). After 48 h distinct green fluorescence was observed under a fluorescence inverted microscope (NIKON-Japan) in transfected LRDM cell line (Fig. 10). The fluorescence intensity of sgRNA-2 transfected LRDM cells was evaluated at the 10th, 20th and 30th passages. A significant increase in fluorescence intensity was observed in the 20th and 30th passages, labelled ‘b’, compared to the 10th passage, labelled ‘a’ (p < 0.05). However, no significant difference was observed between the 20th and 30th passages (p > 0.05) (Fig. 11).

Fig. 10.

Fig. 10

Open in a new tab

Transfection of a LRDM cells using the CRISPR/Cas9 containing sgRNA-2 at 10th (P10), 20th (P20) and 30th (P30) passages. Scale bar: 300 μm. Bright-field, Fluorescence, and Merged images are shown for cells transfected at the 10th passage (A–C), 20th passage (D–F), and 30th passage (G–I), respectively.

Fig. 11.

Fig. 11

Open in a new tab

The mean GFP fluorescence intensity was quantified using ImageJ. Data is presented as means ± SD of three independent replicates. Different lowercase letters (a, b) above the bars indicate significant differences among passages (p < 0.05).

Discussion

The present study successfully designed and validated sgRNAs for exon 1 of the mstnb gene in L. rohita, along with their transfection into the previously established L. rohita dorsal muscle cell line (LRDM) reported by Iqbal et al.35. The mstnb gene of L. rohita consists of 3 exons and 2 introns however; exon 1 of the mstnb gene was selected as CRISPR/Cas9 target region in L. rohita because CRISPR/Cas9-mediated insertions or deletions in exon 1 can generate frameshift mutations and premature stop codons, resulting in truncated and non-functional protein. Similarly, Khalil et al.36 targeted exon 1 of the mstn gene for the generation of myostatin gene edited channel catfish (Ictalurus punctatus) using the CRISPR/Cas9 technology. Zhong et al.37 also targeted exon 1 of the mstn gene in common carp (Cyprinus carpio). Various genome editing tools, including ZFN, TALEN, and CRISPR/Cas9, have been used for genome modification; however, each has its own advantages and limitations13,38. Among these, CRISPR/Cas9 is more widely adopted due to its simplicity, as it requires only the design of a ~ 20 bp guide RNA, in contrast to other systems that involve complex engineering of DNA-binding proteins to target specific sequences39–41.

sgRNAs were designed using an online tool and sgRNAs with the highest efficiency and the fewest off-target sites were selected for our study. The use of two sgRNAs with high specificity and minimal predicted off-target effects ensured accurate targeting, which is a critical prerequisite for efficient genome editing42,43. The absence of predicted mismatches and bulges in off-target analysis further strengthens the reliability of the designed sgRNA and is consistent with earlier studies emphasizing the importance of careful sgRNA selection for minimizing unintended genomic alterations44,45. sgRNAs were successfully cloned into the pSpCas9(BB)-2A-GFP (PX458) vector, and their insertion was confirmed by Sanger sequencing. This step is essential, as improper insertion or orientation of sgRNA sequences can significantly compromise the accuracy and effectiveness of the CRISPR/Cas9 technology. A similar, procedure was used by Fereydani et al.46 to confirm the insertion of gRNAs into the PX458 vector for targeting the HBB FSC 36-37 (-T) mutation locus in hematopoietic stem cells. The successful cloning and Sanger sequencing confirmation indicate that the cloning strategy and sgRNA design employed in this study were effective, enabling accurate and efficient gene targeting. The high cloning success rate observed in this study aligns with previous reports utilizing BbsI-mediated cloning systems for CRISPR vector construction, indicating the robustness of this approach. The utility of the PX458 vector has been demonstrated in diverse genome-editing applications, including the development of HLD17 and phenylketonuria cell models and CRISPR/Cas9-mediated genome editing in olive flounder cells47–49.

CRISPR/Cas9 technology has emerged as a powerful genome-editing tool and has been extensively applied in various fish species, including freshwater fish used in aquaculture50. CRISPR/Cas9 mediated genome editing is being explored as a promising approach to address several challenges faced by the aquaculture industry, including the improvement of growth-related traits through manipulation of specific genes. Among these traits, the mstn gene has gained considerable attention due of its well-established role as a negative regulator of muscle growth51. Previous studies in various fish species, including Grass carp52, Nile tilapia53, Common carp54, Yellow catfish8,9, and Medaka55, have demonstrated that disruption or suppression of mstn leads to increased muscle mass and improved growth traits.

Evaluating CRISPR/Cas9 mediated genome editing in cell lines is important because it provides a controlled and efficient preliminary step before conducting in vivo experiments. In our study, the transfection of CRISPR/Cas9 constructs was performed in the LRDM cell line at three different passages (10th, 20th, and 30th). GFP expression was observed across all passages, indicating efficient plasmid delivery and expression of CRISPR components. This finding suggests that passage number did not significantly affect transfection efficiency, highlighting the stability and suitability of the LRDM cell line for gene-editing applications. In general, fish cell lines are known to exhibit lower transfection efficiencies compared to mammalian systems, primarily due to differences in membrane composition and fluidity24,33. However, the successful transfection achieved in this study indicates that optimized chemical transfection methods can substantially improve gene delivery efficiency in fish cell lines. The use of GFP as a reporter gene enabled rapid and reliable assessment of transfection efficiency, which serves as an indirect indicator of CRISPR/Cas9 activity56,57. The presence of distinct GFP-positive cells across all passages confirms that the developed constructs were successfully expressed within the LRDM cells. Similar approaches have been widely used in genome editing studies to assess the transfection success prior to downstream validation of gene knockout58,59.

This study establishes an effective platform for CRISPR/Cas9-mediated genome editing in L. rohita muscle cells. The present findings show that the LRDM cell line is amenable to lipid-mediated transfection and can efficiently express CRISPR/Cas9 constructs for genome editing studies at different passages. The transfection efficiencies observed across different passages indicate that the LRDM cells remained stable during prolonged subculturing, supporting its suitability for genome editing studies. Slight variations in transfection efficiency among passages may be attributed to differences in the physiological condition and passage number of the transfected cells60. Previous studies have also reported that cells at different passage numbers may not respond equally to transfection conditions due to changes in cellular characteristics and metabolic activity61,62. Fluorescence intensity analysis further confirmed efficient and consistent transfection of both sgRNA-1 and sgRNA-2 constructs in the established cell line across different passages. In both transfected groups, the 20th and 30th passages showed significantly higher fluorescence intensity compared to the 10th passage, indicating higher transgene expression levels in the 20th and 30th passages than in the 10th passage. However, no significant difference was observed between the 20th and 30th passages, suggesting stabilization of transfection efficiency after the mid-passage stage. Overall, the findings confirm the suitability of this cell line for CRISPR/Cas9-mediated gene delivery studies across multiple passages. Therefore, the LRDM cell line represents a promising cellular model for studying muscle-specific gene regulation, functional genomics and genome editing studies. The CRISPR/Cas9 constructs developed in the present study may have potential applications in in vivo genome editing through microinjection into L. rohita embryos. These CRISPR/Cas9 constructs for the mstnb gene provide a foundation for future in vitro and in vivo genome-editing studies in L. rohita.

Conclusion

The present study successfully constructed CRISPR/Cas9 constructs for exon 1 of the mstnb gene and evaluated their transfection in the LRDM cell line. sgRNAs exhibited high specificity with minimal predicted off-target effects, and their successful insertion into the pSpCas9(BB)-2A-GFP vector was confirmed. Efficient transfection of the developed constructs into LRDM cell line was achieved across three different passages. The transfection efficiency across multiple passages shows the stability of plasmid delivery and sustained expression of CRISPR/Cas9 constructs highlighting, the reliability of the LRDM cell line for genome editing applications. However, further studies are required to study the effects of mstn knockout in the transfected cell line. The developed platform may facilitate future mstn knockout and in vitro genome editing studies with potential applications in aquaculture. It also demonstrates the reliability of the fish muscle cell line as a model for in vitro genome editing before subsequent in in vivo applications.

Supplementary Information

Supplementary Information 1. (921.3KB, pdf)
Supplementary Information 2. (7.6MB, zip)

Acknowledgements

The authors sincerely express their gratitude to the Director, ICAR-Central Institute of Fisheries Education (CIFE), Mumbai, Maharashtra, India, for providing the facilities and support necessary for the successful completion of this research. The first author also acknowledges the fellowship support received from ICAR-CIFE during the study period and expresses sincere gratitude for the opportunity to conduct this research as part of his PhD work.

Author contributions

GI: Bench work, validation, original draft writing and manuscript correction. NP: Manuscript correction and validation. DP: Assistance in cell culture. AS: Assistance in CRISPR/Cas9, and Transfection. KDR: Manuscript correction and methodology. LSS: Assistance in plasmid isolation. NCC: Assistance in cloning. MG: Overall supervision, manuscript correction and methodology. All authors read and approved the final manuscript.

Data availability

Data is available as Supplementary Material Supplementary Material 1: SM1; Supplementary Material 2: SM2.

Declarations

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Ansori, A. N. et al. Application of CRISPR-Cas9 genome editing technology in various fields: A review. Narra J.3(2), e184 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.McPherron, A. C. & Lee, S. J. Double muscling in cattle due to mutations in the myostatin gene. Proc. Natl. Acad. Sci. U. S. A.94(23), 12457–12461 (1997). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Priyanka, et al. Exploring myostatin’s role and potential applications in fisheries and aquaculture: A review. Aquac. Int.33(1), 75 (2025). [Google Scholar]
  • 4.Xu, C., Wu, G., Zohar, Y. & Du, S. J. Analysis of myostatin gene structure, expression and function in zebrafish. J. Exp. Biol.206(22), 4067–4079 (2003). [DOI] [PubMed] [Google Scholar]
  • 5.Wang, Q. et al. Transcriptional knock-down of mstn encoding myostatin improves muscle quality of Nile tilapia (Oreochromis niloticus). Mar. Biotechnol.25(6), 951–965 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Sawatari, E. et al. Overexpression of the dominant-negative form of myostatin results in doubling of muscle-fiber number in transgenic medaka (Oryzias latipes). Comp. Biochem. Physiol. A Mol. Integr. Physiol.155(2), 183–189 (2010). [DOI] [PubMed] [Google Scholar]
  • 7.Kerr, T. B. Discovery and characterization of a novel myostatin in zebrafish (Doctoral Dissertation, Washington State University, 2005).
  • 8.Zhang, S. et al. Functional identification and characterization of IpMSTNa, a novel orthologous myostatin (MSTN) gene in channel catfish Ictalurus punctatus. Int. J. Biol. Macromol.152, 1–10 (2020). [DOI] [PubMed] [Google Scholar]
  • 9.Zhang, X. et al. A new strain of yellow catfish carrying genome edited myostatin alleles exhibits double muscling phenotype with hyperplasia. Aquaculture523, 735187 (2020). [Google Scholar]
  • 10.Xu, Y. et al. Fish growth in response to different feeding regimes and the related molecular mechanism on the changes in skeletal muscle growth in grass carp (Ctenopharyngodon idellus). Aquaculture10.1016/j.aquaculture.2019.734295 (2019). [Google Scholar]
  • 11.Sun, Y., Zheng, G. D., Nissa, M., Chen, J. & Zou, S. M. Disruption of mstna and mstnb gene through CRISPR/Cas9 leads to elevated muscle mass in blunt snout bream (Megalobrama amblycephala). Aquaculture528, 735597 (2020). [Google Scholar]
  • 12.Bindal, G. & Rath, D. Programmable multiplex genome editing: Innovations in CRISPR effectors, crRNA engineering, and delivery strategies. Synth. Biol. Eng.3(3), 10014 (2025). [Google Scholar]
  • 13.Gaj, T., Gersbach, C. A. & Barbas, C. F. 3rd. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol.31, 397–405 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Elkhadragy, L. et al. Generation of genetically tailored porcine liver cancer cells by CRISPR/Cas9 editing. Biotechniques70(1), 37–48 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Rozen-Gagnon, K., Yi, S., Jacobson, E., Novack, S. & Rice, C. M. A selectable, plasmid-based system to generate CRISPR/Cas9 gene edited and knock-in mosquito cell lines. Sci. Rep.11(1), 736 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Li-Fang, J. I. N. & Jin-Song, L. I. Generation of genetically modified mice using CRISPR/Cas9 and haploid embryonic stem cell systems. Zool. Res.37(4), 205 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lin, Y. et al. Application of CRISPR/Cas9 system in establishing large animal models. Front. Cell Dev. Biol.10, 919155 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Bauer, D. E., Canver, M. C. & Orkin, S. H. Generation of genomic deletions in mammalian cell lines via CRISPR/Cas9. JoVE95, e52118 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ye, X. et al. An efficient vector-based CRISPR/Cas9 system in zebrafish cell line. Mar. Biotechnol.26(3), 588–598 (2024). [DOI] [PubMed] [Google Scholar]
  • 20.Goswami, M. et al. Development and characterization of a new muscle cell line developed from pearl spot, Etroplus suratensis (Bloch 1790). Res. Vet. Sci.10.1016/j.rvsc.2025.105880 (2025). [DOI] [PubMed] [Google Scholar]
  • 21.Kumar, M. S. et al. Fish cell line: Depositories, web resources and future applications. Cytotechnology76(1), 1–25 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Goswami, M., Pinto, N., Yashwanth, B. S., Sathiyanarayanan, A. & Ovissipour, R. Development of a cell line from skeletal trunk muscle of the fish Labeo rohita. Cytotechnology75(4), 349–361 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Goswami, M., Yashwanth, B. S., Trudeau, V. & Lakra, W. S. Role and relevance of fish cell lines in advanced in vitro research. Mol. Biol. Rep.49(3), 2393–2411 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Kumar, A. et al. Establishment and characterization of a new muscle cell line of zebrafish (Danio rerio) as an in vitro model for gene expression studies. Anim. Biotechnol.27(3), 166–173 (2016). [DOI] [PubMed] [Google Scholar]
  • 25.Ruiz-Palacios, M. et al. Establishment of a brain cell line (FuB-1) from mummichog (Fundulus heteroclitus) and its application to fish virology, immunity and nanoplastics toxicology. Sci. Total Environ.708, 134821 (2020). [DOI] [PubMed] [Google Scholar]
  • 26.Goswami, M., Sharma, B. S., Yadav, K., Bahuguna, S. N. & Lakra, W. S. Establishment and characterization of a piscean PCF cell line for toxicity and gene expression studies as in vitro model. Tissue Cell46(3), 206–212 (2014). [DOI] [PubMed] [Google Scholar]
  • 27.Luo, X. et al. Development of a new marine fish continuous cell line derived from brain of red sea bream (Pagrosomus major) and its application to fish virology and heavy metal toxicology. Animals13(22), 3524 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Lakra, W. S., Swaminathan, T. R. & Joy, K. P. Development, characterization, conservation and storage of fish cell lines: A review. Fish Physiol. Biochem.37(1), 1–20 (2011). [DOI] [PubMed] [Google Scholar]
  • 29.Ghermezian, B. et al. Growth and replication of infectious bursal disease virus in the fish cell line as an experimental vaccine. Res. Vet. Sci.174, 105293 (2024). [DOI] [PubMed] [Google Scholar]
  • 30.Liu, Q., Yuan, Y., Zhu, F., Hong, Y. & Ge, R. Efficient genome editing using CRISPR/Cas9 ribonucleoprotein approach in cultured Medaka fish cells. Biol. Open7(8), bio035170 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Escobar-Aguirre, S. et al. Development of a bicistronic vector for the expression of a CRISPR/Cas9-mCherry system in fish cell lines. Cells8(1), 75 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Xue, T. et al. Establishment of a cell line from the kidney of black carp and its susceptibility to spring viremia of carp virus. J. Fish Dis.41(2), 365–374 (2018). [DOI] [PubMed] [Google Scholar]
  • 33.Romøren, K., Thu, B. J., Bols, N. C. & Evensen, Ø. Transfection efficiency and cytotoxicity of cationic liposomes in salmonid cell lines of hepatocyte and macrophage origin. Biochim. Biophys. Acta Biomembr.1663(1–2), 127–134 (2004). [DOI] [PubMed] [Google Scholar]
  • 34.Ran, F. A. et al. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc.8(11), 2281–2308 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Iqbal, G. et al. Myogenic potential in Labeo rohita dorsal muscle cell line and development of CRISPR-Cas9 construct for myostatin gene. ACS Omega10.1021/acsomega.5c02861 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Khalil, K. et al. Generation of myostatin gene-edited channel catfish (Ictalurus punctatus) via zygote injection of CRISPR/Cas9 system. Sci. Rep.7(1), 7301 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Zhong, Z. et al. Targeted disruption of sp7 and myostatin with CRISPR-Cas9 results in severe bone defects and more muscular cells in common carp. Sci. Rep.6(1), 22953 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Shamshirgaran, Y., Liu, J., Sumer, H., Verma, P. J. & Taheri-Ghahfarokhi, A. Tools for efficient genome editing; ZFN, TALEN, and CRISPR. In Applications of Genome Modulation and Editing 29–46 (2022). [DOI] [PubMed] [Google Scholar]
  • 39.Jinek, M. et al. A programmable dual-RNA–guided DNA endonuclease in adaptive bacterial immunity. Science337(6096), 816–821 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Wiles, M. V., Qin, W., Cheng, A. W. & Wang, H. CRISPR–Cas9-mediated genome editing and guide RNA design. Mamm. Genome26(9), 501–510 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Nguyen, A. D. H. & Quang, M. T. CRISPR/Cas9 genome editing in oncology: Mechanisms, therapeutic platforms and translational challenges. Mol. Biotechnol.68, 1–29 (2025). [DOI] [PubMed] [Google Scholar]
  • 42.Manghwar, H. et al. CRISPR/Cas systems in genome editing: Methodologies and tools for sgRNA design, off‐target evaluation, and strategies to mitigate off‐target effects. Adv. Sci.7(6), 1902312 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Rodríguez, T. C. et al. Genome-wide detection and analysis of CRISPR-Cas off-targets. Prog. Mol. Biol. Transl. Sci.181, 31–43 (2021). [DOI] [PubMed] [Google Scholar]
  • 44.Han, H. A., Pang, J. K. S. & Soh, B. S. Mitigating off-target effects in CRISPR/Cas9-mediated in vivo gene editing. J. Mol. Med.98(5), 615–632 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Newman, A., Starrs, L. & Burgio, G. Cas9 cuts and consequences; detecting, predicting, and mitigating CRISPR/Cas9 on‐and off‐target damage: Techniques for detecting, predicting, and mitigating the on‐and off‐target effects of Cas9 editing. BioEssays42(9), 2000047 (2020). [DOI] [PubMed] [Google Scholar]
  • 46.Fereydani, N. M. et al. Investigating the efficacy of the CRISPR/Cas9 gene-editing system for targeting the HBB FSC 36–37 (-T) mutation locus in hematopoietic stem cells. Mol. Biotechnol.68, 1–16 (2025). [DOI] [PubMed] [Google Scholar]
  • 47.Farrokhi, S., Eslahi, A., Alizadeh, F., Kerachian, M. A. & Mojarrad, M. Assessment the efficacy of the CRISPR system for inducing mutations in the AIMP2 gene to create a cell line model of HLD17 disease. Mol. Biotechnol.67(10), 3922–3929 (2025). [DOI] [PubMed] [Google Scholar]
  • 48.Tabei, S. M. B. Creating cell model of phenylketonuria disease by CRISPR-Cas9 mediated genome editing method (2019).
  • 49.Kim, J. et al. Molecular characterization of Paralichthys olivaceus MAF1 and its potential role as an anti-viral hemorrhagic septicaemia virus factor in hirame natural embryo cells. Int. J. Mol. Sci.22(3), 1353 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Zhu, M. et al. CRISPR/Cas9 technology for enhancing desirable traits of fish species in aquaculture. Int. J. Mol. Sci.25(17), 9299 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Liang, M. et al. Enhanced muscle growth via DNA methylation editing of mstnb exon in zebrafish. Aquac. Fish.10.1016/j.aaf.2026.02.004 (2026). [Google Scholar]
  • 52.Zhao, P. et al. Generation of fast-growth grass carp by mutation of mstnb via CRISPR/Cas9 system. Reprod. Breed.5(4), 163–170 (2025). [Google Scholar]
  • 53.Wu, Y. et al. Generation of fast growth Nile tilapia (Oreochromis niloticus) by myostatin gene mutation. Aquaculture562, 738762 (2023). [Google Scholar]
  • 54.Shahi, N., Mallik, S. K. & Sarma, D. Muscle growth in targeted knockout common carp (Cyprinus carpio) mstn gene with low off-target effects. Aquaculture547, 737423 (2022). [Google Scholar]
  • 55.Yeh, Y. C. et al. Using CRISPR/Cas9-mediated gene editing to further explore growth and trade-off effects in myostatin-mutated F4 medaka (Oryzias latipes). Sci. Rep.7(1), 11435 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Mousavi Kahaki, S. A., Ebrahimzadeh, N., Fahimi, H. & Moshiri, A. Development of an optimized protocol for generating knockout cancer cell lines using the CRISPR/Cas9 system, with emphasis on transient transfection. PLoS ONE19(11), e0310368 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Shalaby, K. E., Aouida, M., Gupta, V., Ghanem, S. S. & El-Agnaf, O. M. Rapid assessment of CRISPR transfection efficiency and enrichment of CRISPR induced mutations using a dual-fluorescent stable reporter system. Front. Genome Ed.4, 854866 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Kimura, Y., Hisano, Y., Kawahara, A. & Higashijima, S. I. Efficient generation of knock-in transgenic zebrafish carrying reporter/driver genes by CRISPR/Cas9-mediated genome engineering. Sci. Rep.4(1), 6545 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Jin, J. et al. An improved strategy for CRISPR/Cas9 gene knockout and subsequent wildtype and mutant gene rescue. PLoS ONE15(2), e0228910 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Chong, Z. X., Yeap, S. K. & Ho, W. Y. Transfection types, methods and strategies: A technical review. PeerJ9, e11165 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Bhuiyan, M. M. U. et al. Effect of transfection and passage number of ear fibroblasts on in vitro development of bovine transgenic nuclear transfer embryos. J. Vet. Med. Sci.66(3), 257–261 (2004). [DOI] [PubMed] [Google Scholar]
  • 62.Fus-Kujawa, A. et al. An overview of methods and tools for transfection of eukaryotic cells in vitro. Front. Bioeng. Biotechnol.9, 701031 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Information 1. (921.3KB, pdf)
Supplementary Information 2. (7.6MB, zip)

Data Availability Statement

Data is available as Supplementary Material Supplementary Material 1: SM1; Supplementary Material 2: SM2.

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES