Three novel Myxidium species (Myxozoa: Myxosporea) from fishes in river and small channels across Terengganu, Malaysia

Abstract

Previously, only a single Myxidium species, Myxidium cf. notopterum from Notopterus notopterus, and two unidentified species from Tor tambroides and Barbonymus gonionotus had been reported in Malaysia. In the present study, three additional species, Myxidium acutum n. sp., Myxidium truncatum n. sp., and Myxidium orbiculare n. sp. were described from the gallbladders of freshwater fishes, Labiobarbus leptocheilus, Trichopodus pectoralis and Channa gachua, respectively, in Malaysia. Myxidium acutum n. sp. possessed elongated, fusiform spores with tapered ends and 6–7 valvular striations, measuring 12.5 ± 0.6 μm in length, 5.1 ± 0.4 μm in width, and 4.3 ± 0.4 μm in thickness. The polar capsules were equal and slightly pyriform, measuring 3.3 ± 0.3 μm × 2.7 ± 0.2 μm, each containing a tubule with 4–5 coils. Myxidium truncatum n. sp. exhibited elongated, fusiform spores with truncated ends and five valvular striations, measuring 11.7 ± 0.6 μm × 4.4 ± 0.3 μm × 3.8 ± 0.3 μm. Its pyriform polar capsules measured 3.8 ± 0.3 μm × 2.7 ± 0.2 μm with four coils. Myxidium orbiculare n. sp. had ellipsoidal, slightly concave spores with truncated ends and seven valvular striations, measuring 13.4 ± 0.4 μm × 6.5 ± 0.4 μm × 5.5 ± 0.3 μm, with rounded polar capsules bearing papilla-like tips (4.1 ± 0.3 μm × 3.3 ± 0.2 μm), each containing a tubule with four coils. Morphological, molecular, and phylogenetic analyses supported their recognition as new species and extended the known diversity and geographic distribution of Myxidium in Malaysia.

Graphical abstract

Highlights

• •Three novel Myxidium species (Myxidium acutum n. sp., Myxidium truncatum n. sp., and Myxidium orbiculare n. sp.) are described from the gallbladders of freshwater fishes in Malaysia.
• •M. orbiculare n. sp. develops within plasmodia, whereas the other two species occur as free-floating spores.
• •First record of a Myxidium species infecting a fish of the order Anabantiformes.
• •First record of Myxidium species and myxozoan parasites infecting Labiobarbus leptocheilus and Trichopodus pectoralis, and the second report of a myxozoan species from Channa gachua.
• •Provides new insights into the diversity and distribution of Myxidium in Malaysia.

1. Introduction

Myxidium Bütschli, 1882 is the second largest myxozoan genus with nearly 300 described species (Eiras et al., 2011; Ponzetto et al., 2026). Most of them are coelozoic, primarily infecting fish gallbladders, urinary bladders or renal tubules, with few records from amphibians, reptiles, and birds (Bartholomew et al., 2008; Eiras et al., 2011; Hartigan et al., 2012; Espinoza et al., 2017). Unlike Zschokkella, which has nearly spherical polar capsules clustered on one side of the spore body, Myxidium spores are distinguished by spindle-shaped, straight, crescent, or sigmoid bodies with pointed ends, two pyriform polar capsules at opposite ends, smooth or striated shell valves, and a bisecting suture line (Lom and Dyková, 2006; Heiniger and Adlard, 2014).

In Malaysia, records remain scarce, with only Myxidium cf. notopterum from Notopterus notopterus (Borkhanuddin et al., 2020) and two comprehensively not described species from Tor tambroides (Borkhanuddin, 2013) and Barbonymus gonionotus (Suhaimi et al., 2025a). Previously, most Myxidium species have been detected among cyprinids, while none were known in Anabantiformes. Here, we describe three new freshwater Myxidium species that parasitize the gallbladders of fish from the order Cypriniformes (a single species) and Anabantiformes (2 species) based on morphology, morphometrics and 18S rDNA sequence analysis.

2. Materials and methods

2.1. Sample collection and microscopic study

A total of thirty-nine fish specimens representing three species; Labiobarbus leptocheilus (N = 15), Trichopodus pectoralis (N = 12) and Channa gachua (N = 12) were obtained from a local fish market in Kuala Terengganu, Terengganu, Malaysia. These fish originated from the river of Sungai Nerus in Kuala Nerus and from small channels across Kuala Terengganu. The procurement was conducted at two-week intervals over two periods: July to August 2023 and September to November 2024.

Live specimens were transported in oxygenated plastic bags to the Marine Science Biodiversity Laboratory of the Faculty of Science and Marine Environment at Universiti Malaysia Terengganu. Upon arrival, the fish were maintained in aerated tanks until autopsy and fed with commercial fish diet once daily. Taxonomic identification of the fish specimens was based on their morphological characteristics. In the laboratory, the fish were euthanized by neural pithing, dissected, and major organs, such as the fins, gills, skin, intestine, stomach, kidney, gallbladder, and muscles, were thoroughly examined to detect plasmodia of myxosporean parasites. Initial inspections were conducted with naked eye, followed by detailed observations using an Olympus SZX7 dissecting microscope (Olympus Corporation, Japan) and an Olympus CX33 biological microscope (Olympus Corporation, Japan) to confirm the presence of the plasmodia.

Free-floating spores and plasmodium were isolated from the gallbladders and examined on glass slides using the biological microscope. After microscopic assessment, the remaining plasmodium and spores were divided into two and preserved in 90% ethanol for molecular analyses and in 10% neutral buffered formalin for morphological analysis. All fixed specimens were subsequently transported to the Fish Pathology and Parasitology Laboratory at the HUN-REN Veterinary Medical Research Institute (Budapest, Hungary) for further investigation, including high-magnification examinations (100× objective) and photographic documentation with an Olympus BX53 light microscope equipped with an Olympus DP74 digital camera (Olympus Corporation, Japan). Morphometric analysis of formalin-fixed spores was conducted in accordance with the guidelines of Lom and Arthur (1989) using ImageJ software. All measurements are reported as the mean ± standard deviation (SD), with the range provided in parentheses and expressed in micrometers (μm). Line drawings of Myxidium spores were prepared from original digital images using Inkscape (Free Software Foundation, Inc., MA, USA).

2.2. Molecular analysis

Genomic DNA was extracted from plasmodium and spores preserved in 90% ethanol. Prior to extraction, the samples were centrifuged at 13,000 rpm for 15 min, after which the ethanol was carefully removed by pipetting. The pellets including spores were rinsed twice with 10 mM Tris-HCl (pH 8.5) to eliminate any residual ethanol. DNA isolation was carried out using the Geneaid Tissue Genomic DNA Mini Kit (Geneaid Biotech Ltd., Taiwan), following the manufacturer's protocol for animal tissue samples.

The 18S rDNA gene was amplified by direct PCR using multiple primer sets listed in Table 1 using a Doppio Gradient Thermal Cycler (VWR). Each polymerase chain reaction (PCR) was performed in a final volume of 25 μL, containing 2 μL of template DNA, 1 × DreamTaq buffer (10×; Thermo Scientific), 0.2 mM dNTP mix (10 mM; Thermo Scientific), 1.25 U DreamTaq polymerase (5 U; Thermo Scientific), 12.5 pmol of each primer, and molecular grade water. Thermal cycling conditions for amplifications with different primer pairs listed in Table 2. PCR products were visualized by agarose gel electrophoresis. Bands of the expected size were excised from the gel and purified using the DNA Fragment Purification Kit (InViTek GmbH, Berlin, Germany). Purified amplicons were sequenced with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) bidirectionally and sequencing reactions were read on an ABI PRISM 3100 Genetic Analyzer using the primers listed in Table 1 at Delta Bio 2000 Ltd., Szeged, Hungary.

Table 1.

Primers used for PCR amplifications and sequencing of 18S rDNA gene region from Myxidium species. F forward primer, R reverse primer.

Species	Primer	Application	Sequence (5’ – 3′)	Reference
Myxidium acutum n. sp.	F: Myx1F	PCR and sequencing	GTGAGACTGCGGACGGCTCAG	Hallett and Diamant (2001)
	F: MyxospecF	PCR and sequencing	TTCTGCCCTATCAACTWGTTG	Fiala (2006)
	R: Myxgen4R	Sequencing	CTYTGATTTATTCAAGGCAC	Køie et al. (2008)
	R: SphR	PCR	GTTACCATTGTAGCGCGCGT	Eszterbauer and Székely (2004)
	R: 18R	PCR and sequencing	CTACGGAAACCTTGTTACG	Whipps et al. (2003)
Myxidium truncatum n. sp.	F: ERIB1	PCR and sequencing	ACCTGGTTGATCCTGCCAG	Barta et al. (1997)
	R: ACT1R	PCR and sequencing	AATTTCACCTCTCGCTGCCA	Hallett and Diamant (2001)
	F: MyxospecF	PCR and sequencing	TTCTGCCCTATCAACTWGTTG	Fiala (2006)
	F: Myxgen4F	Sequencing	GTGCCTTGAATAAATCAGAG	Diamant et al. (2004)
	R: 18R	PCR and sequencing	CTACGGAAACCTTGTTACG	Whipps et al. (2003)
Myxidium orbiculare n. sp.	F: ERIB1	PCR and sequencing	ACCTGGTTGATCCTGCCAG	Barta et al. (1997)
	F: ACT1fr	Sequencing	TTGGGTAATTTGCGCGCCTGCTGCC	Hallett and Diamant (2001)
	R: ACT1R	PCR and sequencing	AATTTCACCTCTCGCTGCCA	Hallett and Diamant (2001)
	R: ERIB10	PCR and sequencing	CTTCCGCAGGTTCACCTACGG	Barta et al. (1997)
	F: Myxgen4F	PCR and sequencing	GTGCCTTGAATAAATCAGAG	Diamant et al. (2004)
	R: Myxgen4R	Sequencing	CTYTGATTTATTCAAGGCAC	Køie et al. (2008)

Table 2.

PCR conditions for 18S rDNA gene region amplification using different primer pairs.

Primer pair	Initial denaturation	Cycles (denaturation, annealing, elongation)	Final elongation	Reference
MyxospecF-18R	94°C, 3 min	35 cycles: 95°C 30 s, 55°C 45 s, 72°C 90 sa	72°C, 7 min	Liu et al. (2016)
Myxgen4F-ERIB10	94°C, 3 min	35 cycles: 94°C 45 s, 55°C 50 s, 72°C 1 min	72°C, 10 min	Colunga-Ramírez et al., 2024
Myx1F-SphR
ERIB1-ACT1R	95°C, 3 min	35 cycles: 95°C 1 min, 55°C 45 s, 72°C 2 min	72°C, 7 min	Úngari et al. (2021)

^aThe original protocol was modified with 90 s of elongation period.

2.3. Phylogenetic analyses

The obtained 18S rDNA sequences were visualized, corrected if necessary based on the chromatogram, and assembled using Geneious Prime v11.1 (Bio-matters; Auckland, New Zealand; https://www.geneious.com/) (Kearse et al., 2012). Phylogenetic analysis was conducted using the three sequences (from each fish host individuals) generated in this study, together with 41 related sequences retrieved from the GenBank database, using a threshold of ≥80% identity and ≥80% query coverage. Ceratomyxa shasta (AF001579) was designated as the outgroup. Sequences with lower identity (<80%) or poor support were excluded. Multiple sequence alignment was performed using the ClustalW algorithm (Thompson et al., 1994) implemented in MEGA X (Molecular Evolutionary Genetics Analysis, 64-bit version; https://www.megasoftware.net/) (Kumar et al., 2018). Phylogenetic tree was reconstructed using the Maximum Likelihood (ML) method with 1000 bootstrap replicates in MEGA X, and Bayesian Inference (BI) conducted in MrBayes v3.2.443 (Ronquist et al., 2012). Gaps were treated using partial deletion with 75% site coverage cut-off for ML. The best-fit mucleotide substitution model (GTR + G + I) was selected based on the Akaike information criterion (AIC) and Bayesian Information Criterion (BIC) executed in jModelTest 2.1.10 v2016030344 (Darriba et al., 2012). For Bayesian analysis, Markov Chain Monte Carlo (MCMC) simulations were run for 1,000,000 generations, with the initial 25% discarded as burn-in. A consensus tree was generated from the remaining sampled topologies. Clades were considered well supported when bootstrap values (BS) were ≥ 70% for ML and posterior probabilities (PP) were ≥ 0.90 for BI analysis. The resulting tree topologies were visualized in MEGA X and FigTree v. 1.4.445 (Rambaut, 2018), and further refined graphically using Inkscape software. Pairwise genetic distances were calculated in MEGA X using p-distance model, accounting for both transitions and transversions.

3. Results

3.1. Description of novel Myxidium species

3.1.1. Myxidium acutum n. sp. (Fig. 1A–D)

Fig. 1.

Myxidium acutum n. sp. from the gallbladder of Labiobarbus leptocheilus. A) Mature dispersed spore with pointed ends. B) Spore showing the six valvular striations (white arrowhead). C) Spore in sutural view showing the sutural line (black arrowhead). D) Schematic drawings of Myxidium acutum n. sp. in frontal and sutural views. Scale bars = 10 μm.

Spore: Fixed dispersal spores, coelozoic, elongate and fusiform in both frontal and sutural views, with tapered ends, 12.7 ± 0.5 (12.0–13.9) μm long, 5.1 ± 0.4 (4.5–5.9) μm wide, 4.4 ± 0.3 (3.5–4.9) μm thick (n = 16). Polar capsule: Two, equal, slightly pyriform polar capsules, positioned at opposite ends of the spore and oriented outward in opposite directions, 3.3 ± 0.3 (2.6–3.7) μm long, 2.7 ± 0.2 (2.3–3.1) μm wide. Distance between two polar capsules, 5.0 ± 0.5 (4.1–6.3) μm. Polar tubule: Coiled four to five times, positioned perpendicularly to capsule axis. Sutural line: Straight. Valvular striation: Six to seven longitudinal striations (Fig. 1B). Sporoplasm: Binucleate, filling the spore body cavity between the two polar capsules. Measurements from 30 formalin-fixed spores.

3.1.2. Taxonomic summary

Class: Myxosporea Bütschli, 1881

Order: Bivalvulida Sgulman, 1959.

Family: Myxidiidae Thélohan, 1892

Genus: Myxidium Bütschli, 1882

Host: Thin-lips barb Labiobarbus leptocheilus Valenciennes, 1842 (Order: Cypriniformes). Average length between 7.0 and 13.0 cm.

Locality: Sungai Nerus, Kuala Nerus, Terengganu, Malaysia.

Infection site: Gallbladder.

Prevalence: 6.67% (1/15).

Type material: Phototypes were deposited in the parasitological collection of the Zoological Department, Hungarian Natural History Museum, Budapest, Coll. No. HNMPCC-HNHM-PAR-72089.

Etymology: The name Myxidium acutum n. sp. is derived from the pointed ends of the spore.

Molecular data: Partial 18S rDNA sequence of M. acutum n. sp., consisting of 1,862 base pairs was deposited in GenBank under the accession number PZ519830. Pairwise distance estimation of M. acutum n. sp. indicated the highest similarity of 99.4% to Zschokkella sp. (KM401441), which infects the gallbladder of Labeo rohita in Myanmar (Table 3). Phylogenetic analyses revealed two main distinct lineages: A–B (Fig. 2). Clade A comprised majority of myxosporean species, including most Myxidium spp., together with several freshwater and marine Zschokkella spp. In contrast, Clade B contained a small number of Myxidium and Zschokkella species, predominantly originating from freshwater habitats, with only two species reported from marine environments. In the phylogenetic tree, M. acutum n. sp. clustered with Zschokkella sp. (KM401441) in the same branch and formed a sister group with Myxidium sp. (PP693377), Myxidium spinibarba (MN922568) and Myxidium hoabinhense (MK913426) within Clade A (Fig. 2).

Table 3.

Genetic p-distance and sequence similarities (%) based on comparisons of 18S rDNA sequences of Myxidium acutum n. sp., Myxidium truncatum n. sp., Myxidium orbiculare n. sp. and its most closely related species exhibiting ≥80% 18S rDNA sequence identity and ≥80% query coverage. Only identical or the closest-related sequences are presented.

Sequence	Genetic distance	Sequence similarities (%)
Myxidium acutum n. sp. PZ519830
Zschokkella sp. KM401441	0.006	99.4
Myxidium sp. PP693377	0.022	97.8
Myxidium spinibarba MN922568	0.026	97.4
Myxidium hoabinhense MK913426	0.026	97.4
Myxidium truncatum n. sp. PZ519832
Zschokkella sp. MT840090	0.054	94.6
Myxosporea KP030767	0.055	94.5
Myxidium orbiculare n. sp. PZ519831
Myxidium chuatsi PQ869811	0.090	91.0
Myxidium sp. KP030766	0.103	89.7

Fig. 2.

Maximum likelihood (ML) phylogenetic tree of 18S rDNA sequences of Myxidium acutum n. sp., Myxidium truncatum n. sp., Myxidium orbiculare n. sp. and related species. Ceratomyxa shasta was used as the outgroup. Nodal supports are indicated for ML at 1000 replicates and Bayesian Inference (BI). Only values with ≥ 70% bootstrap (BS) and ≥ 0.90 posterior probabilities (PP) support are presented. The names of the parasite species are presented before GenBank accession numbers, following the host species, infection site and habitat. Sequences obtained in the present study are shown in bold within colored boxes. The scale bar indicates the expected number of substitutions per site.

Remarks: Based on spore morphology, this species is classified as a new member of the genus Myxidium. The morphology and morphometrics of M. acutum n. sp. do not match any previously described Myxidium spp. (Table 4). However, we found a sequence of Zschokkella sp. (KM401441; 2057 base pairs) deposited in GenBank sharing 99.4% similarity to M. acutum n. sp. Unfortunately, the morphology and morphometric measurements of these spores have not been published for comparison. Remarkably, the host species also differ, infecting L. leptocheilus and Labeo rohita from Myanmar. The closest morphological and morphometrics resemblance is observed with Myxidium spinibarba Chen et al., 2020, which infects the gallbladder of Myxocyprinus asiaticus and differs only in the number of valvular striations (6–7 vs. 8–10). This distinction is further supported by molecular data, with the two species sharing 97.4% sequence similarity, suggesting that they are separate species. Morphometrically, M. acutum n. sp. is also similar to Myxidium horatioense McAllister, Cloutman, Leis et Robinson, 2025 from the gallbladder of Ameiurus natalis, but differs mainly in spore length and width as well as in the number of polar filament coils.

Table 4.

Comparative data for spore measurements (mean value ± standard deviation [SD] followed by the range in parentheses) of Myxidium acutum n. sp., and species with similar morphologies. All measurements are in μm. Abbreviations: SL spore length, SW spore width, ST spore thickness, PCL polar capsule length, PCW polar capsule width, PFC polar filament coils, VS valvular striations, – no data.

Species	Host	Site infection	SL	SW	ST	PCL	PCW	PFC	VS	Reference
Myxidium acutum n. sp.	Labiobarbus leptocheilus	Gallbladder	12.7 ± 0.5 (12.0–13.9)	5.1 ± 0.4 (4.5–5.9)	4.4 ± 0.3 (3.5–4.9)	3.3 ± 0.3 (2.6–3.7)	2.7 ± 0.2 (2.3–3.1)	4–5	6–7	Present study
M. spinibarba	Myxocyprinus asiaticus	Gallbladder	12.6 ± 0.5 (11.6–13.4)	5.9 ± 0.5 (5.1–6.9)	–	3.5 ± 0.3 (2.6–4.2)	2.8 ± 0.2 (2.3–3.2)	4–5	8–10	Xiang et al. (2021)
M. horatioense	Ameiurus natalis	Gallbladder	12.2 ± 0.8 (10.8–12.6)	4.7 ± 0.4 (4.2–5.4)	–	3.0 ± 0.3 (2.4–3.6)	2.9 ± 0.3 (2.6–3.8)	3–4	6–7	McAllister et al. (2025)
M. hemiculteri	Hemiculter leucisculus	Gallbladder	12.1 (11.5–13.0)	6.9 (5.6–7.2)	–	3.1 (3.0–3.2)	3.4 (3.2–4.0)	–	4–5	Chen and Ma, 1998
M. chuatsi	Siniperca chuatsi	Gallbladder	10.7 ± 0.4 (10.0–11.4)	5.7 ± 0.3 (5.4–6.1)	5.8 ± 0.3 (5.4–6.1)	3.2 ± 0.2 (2.9–3.7)	2.8 ± 0.1 (2.6–3.2)	4–5	6–8	Yin et al. (2025)
M. whippsi	Esox niger	Gallbladder	8.7 (7.7–9.8)	5.1 (4.3–6.0)	–	2.5 (2.2–3.2)	2.4 (2.0–2.7)	3–5	5	McAllister et al. (2022)

3.2. Myxidium truncatum n. sp. (Fig. 3A–E)

Fig. 3.

Myxidium truncatum n. sp. from the gallbladder of Trichopodus pectoralis. A) Mature dispersed spore with truncated ends. B) Spore in sutural view showing the sutural line (black arrowhead). C) Spore with polar capsules containing four polar filament coils (pf). D) Spore showing six valvular striations (white arrowhead). E) Schematic drawings of Myxidium truncatum n. sp. in frontal and sutural views. Scale bars = 10 μm.

Spore: Fixed dispersal spores, coelozoic, elongate and fusiform in both frontal and sutural views, with truncated ends, 11.9 ± 0.6 (11.0–12.9) μm long, 4.5 ± 0.3 (4.1–4.9) μm wide, 3.8 ± 0.3 (3.1–4.3) μm thick. Polar capsule: Two, equal, pyriform polar capsules, positioned at opposite ends of the spore and oriented outward in opposite directions, 3.9 ± 0.3 (3.5–4.5) μm long, 2.7 ± 0.2 (2.4–3.0) μm wide. Distance between two polar capsules, 2.5 ± 0.3 (2.1–3.1) μm. Polar tubule: Coiled four times, positioned perpendicularly to capsule axis (Fig. 3C). Sutural line: Straight. Valvular striation: Five longitudinal striations (Fig. 3D). Sporoplasm: Binucleate, filling the spore body cavity between the two polar capsules. Measurements from 30 formalin-fixed spores derived from a single individual.

3.2.1. Taxonomic summary

Class: Myxosporea Bütschli, 1881

Order: Bivalvulida Sgulman, 1959.

Family: Myxidiidae Thélohan, 1892

Genus: Myxidium Bütschli, 1882

Species: Myxidium truncatum n. sp.

Host: Snakeskin gourami Trichopodus pectoralis Regan, 1910 (Order: Anabantiformes). Average length between 10.0 and 23.5 cm.

Locality: Small channels across Kuala Terengganu, Terengganu, Malaysia.

Infection site: Gallbladder.

Prevalence: 66.7% (8/15).

Type material: Phototypes were deposited in the parasitological collection of the Zoological Department, Hungarian Natural History Museum, Budapest, Coll. No. HNMPCC-HNHM-PAR-72090.

Etymology: The name Myxidium truncatum n. sp. is derived from the truncated ends of the spore.

Molecular data: Partial 18S rDNA sequence of M. truncatum n. sp., consisting of 1,930 base pairs was deposited in GenBank under the accession number PZ519832. Pairwise distance estimation of M. truncatum n. sp. indicated the highest similarities of 94.6% to Zschokkella sp. (MT840090) and 94.5% to Myxosporea (KP030767) (Table 3). Phylogenetic analyses revealed two main distinct lineages: A–B (Fig. 2). Clade A comprised majority of myxosporean species, including most Myxidium spp., together with several freshwater and marine Zschokkella spp. In contrast, Clade B contained a small number of Myxidium and Zschokkella species, predominantly originating from freshwater habitats, with only two species reported from marine environments. In the phylogenetic tree, M. truncatum n. sp. is closely related to Zschokkella sp. (MT840090), which infects the gallbladder of Etroplus suratensis from India, and formed a sister relationship with Myxosporea (KP030767) from the gallbladder of Synodontis sp. in Kenya within Clade B (Fig. 2).

Remarks: Based on spore morphology, this species is classified as a new member of the genus Myxidium. The morphology and morphometrics of M. truncatum n. sp. do not match any previously described Myxidium spp. (Table 5). It most closely resembles Myxidium djolonensis Benoît et al., 2020, which infects the gallbladder and urinary bladder of Paramormyrops kingsleyae. Notable, both species possesses truncated ends, a feature rarely observed among other Myxidium spp.; however, they differ in their morphometric characteristics. Morphometrically, M. truncatum n. sp. shows the greatest similarity to Myxidium macrocheili Mitchell (1967) and Myxidium phyllium Davis (1917) in terms of spore and polar capsule lengths and polar capsule width, while other features differ significantly.

Table 5.

Comparative data for spore measurements (mean value ± standard deviation [SD] followed by the range in parentheses) of Myxidium truncatum n. sp. from Trichopterus pectoralis and species with similar morphologies. All measurements are in μm. Abbreviations: SL spore length, SW spore width, ST spore thickness, PCL polar capsule length, PCW polar capsule width, PFC polar filament coils, VS valvular striations, – no data.

Species	Host	Site infection	SL	SW	ST	PCL	PCW	PFC	VS	Reference
Myxidium truncatum n. sp.	Trichopterus pectoralis	Gallbladder	11.9 ± 0.6 (11.0–12.9)	4.5 ± 0.3 (4.1–4.9)	3.8 ± 0.3 (3.1–4.3)	3.9 ± 0.3 (3.5–4.5)	2.7 ± 0.2 (2.4–3.0)	5–6	6	Present study
M. macrocheili	Catostomus macrocheilus	Gallbladder	11.7 (10.0–14.4)	6.6 (5.5–8.0)	6.3 (5.5–8.0)	4.0 (3.0–5.5)	3.5 (2.0–4.5)	4–5	9–10	Mitchell (1967)
M. phyllium	Gambusia affinis	Gallbladder	11.0	8.0	–	3.0	3.0	–	–	Davis (1917)
M. sharmai	Luciobarbus longiceps	Gallbladder	10.5 ± 0.3 (10.0–11.4)	5.4 ± 0.3 (4.3–6.1)	–	3.3 ± 0.2 (2.5–3.9)	2.5 ± 0.3 (2.0–3.1)	4	7–10	Gupta et al. (2025)
M. cuneiforme	Cyprinus carpio	Gallbladder	12.5 ± 0.3 (12.0–13.1)	5.4 ± 0.3 (4.8–6.1)	–	4.3 ± 0.2 (4.0–4.6)	3.1 ± 0.2 (2.6–3.4)	5–6	6–8	Li et al. (2016)
M. pseudocuneiforme	C. carpio	Gallbladder	12.5 ± 0.3 (12.0–13.1)	5.4 ± 0.3 (4.8–6.1)	5.2 ± 0.4 (4.9–6.2)	3.9 ± 0.2 (3.5–4.2)	2.5 ± 0.1 (2.5–2.8)	5–6	6–8	Chen et al. (2021)
M. rhodei	Barbatula barbatula	Kidney	13.7 ± 0.6 (12.5–14.8)	5.4 ± 0.4 (4.6–5.9)	–	4.0 ± 0.4 (3.2–4.9)	3.1 ± 0.3 (2.6–3.6)	5	9–13	Baiko et al. (2024)
M. cf. notopterum	Notopterus notopterus	Gallbladder	14.7 ± 0.6 (13.8–16.0)	6.3 ± 0.6 (5.5–7.7)	–	5.7 ± 0.4 (4.6–6.4)	4.7 ± 0.4 (3.6–5.3)	3–4	8–10	Borkhanuddin et al. (2020)
Myxidium sp.	Noturus nocturus	Gallbladder	14.8 ± 1.1 (13.8–16.2)	8.7 ± 1.1 (6.5–9.7)	–	4.9 ± 0.5 (4.3–5.7)	4.9 ± 0.5 (4.3–5.7)	4–6	7–8	McAllister et al. (2024)
M. djolonensis	Paramormyrops kingsleyae	Gallbladder, urinary bladder	16.3 (15.5–18.0)	6.1 (5.0–7.1)	–	4.9 (4.0–5.6)	3.5 (3.0–4.2)	5–7	7–9	Benoît et al. (2020)

3.3. Myxidium orbiculare n. sp. (Fig. 4C–E)

Fig. 4.

Myxidium orbiculare n. sp. from the gallbladder of Channa gachua. A) Large plasmodium (black arrow) in the gallbladder. B) Orbicular plasmodium. C) Mature spore in frontal view. D) Spore showing seven valvular striations (white arrowhead). E) Schematic drawings of Myxidium orbiculare n. sp. in frontal and sutural views. Scale bars = 10 μm.

Plasmodia: Found in the gallbladder, orbicular in shape (Fig. 4A and B). Spore: Fixed dispersal spores, ellipsoidal, slightly concave with mildly truncated ends in both frontal and sutural views, 13.5 ± 0.4 (12.5–14.4) μm long, 6.5 ± 0.5 (5.7–7.6) μm wide, 5.6 ± 0.3 (5.1–6.4) μm thick. Polar capsule: Two, equal, rounded with papilla-like tips, positioned at opposite ends of the spore and oriented outward in opposite directions, 4.0 ± 0.3 (3.5–4.8) μm long, 3.3 ± 0.2 (2.9–4.0) μm wide. Distance between two polar capsules, 3.9 ± 0.6 (2.8–4.6) μm. Polar tubule: Coiled four times, positioned perpendicularly to capsule axis. Sutural line: Straight. Valvular striation: Seven longitudinal striations (Fig. 4D). Sporoplasm: Binucleate, filling the spore body cavity between the two polar capsules. Measurements from 30 formalin-fixed spores derived from a single individual.

3.3.1. Taxonomic summary

Class: Myxosporea Bütschli, 1881

Order: Bivalvulida Sgulman, 1959.

Family: Myxidiidae Thélohan, 1892

Genus: Myxidium Bütschli, 1882

Species: Myxidium orbiculare n. sp.

Host: Dwarf snakehead Channa gachua Hamilton, 1822 (Order: Anabantiformes). Average length between 7.5 and 5.5 cm.

Locality: Small channels across Kuala Terengganu, Terengganu, Malaysia.

Infection site: Gallbladder.

Prevalence: 16.7% (2/12).

Type material: Phototypes were deposited in the parasitological collection of the Zoological Department, Hungarian Natural History Museum, Budapest, Coll. No. HNMPCC-HNHM-PAR-72091.

Etymology: The name Myxidium orbiculare n. sp. is derived from the orbicular shape of the plasmodium.

Molecular data: Partial 18S rDNA sequence of M. orbiculare n. sp., consisting of 2,017 base pairs was deposited in GenBank under the accession number PZ519831. Pairwise distance estimation of M. orbiculare n. sp. indicated the highest similarity of 91.0% to Myxidium chuatsi (PQ869811) (Table 3). Phylogenetic analyses revealed two main distinct lineages: A–B (Fig. 2). Clade A comprised majority of myxosporean species, including most Myxidium spp., together with several freshwater and marine Zschokkella spp. In contrast, Clade B contained a small number of Myxidium and Zschokkella species, predominantly originating from freshwater habitats, with only two species reported from marine environments (Fig. 2).

Remarks: Based on spore morphology, this species belongs to the genus Myxidium. The morphology and morphometrics of M. orbiculare n. sp. do not match any previously described Myxidium spp. (Table 6). Remarkably, no previously recorded species exhibits a morphology as similar to M. orbiculare n. sp., which is characterized by a slightly concave body with mildly truncated ends, a feature rarely observed, though a few Myxidium spp. possess fusiform spores with truncated ends. Morphometrically, M. orbiculare n. sp. shows the greatest similarity to Myxidium schilba Ali, Sakran et al, 1999 that infects the gallbladder of Schilbe mystus and Myxidium onyhosionmatis Chen and Ma, 1998, which infects the gallbladder of Varicorhinus simus, sharing comparable measurements. In particular, M. orbiculare n. sp. shared most morphometric measurements with M. onyhosionmatis, differing only in the polar capsule width. However, no sequence data are available for M. onyhosionmatis for molecular comparison. Because V. simus, currently treated as Onychostoma simum, is not known from Malaysia and is restricted to China and Vietnam (Froese and Pauly, 2026), the present species is here regarded as a new species.

Table 6.

Comparative data for spore measurements (mean value ± standard deviation [SD] followed by the range in parentheses) of Myxidium orbiculare n. sp. from Channa gachua and species with similar morphologies. All measurements are in μm. Abbreviations: SL spore length, SW spore width, ST spore thickness, PCL polar capsule length, PCW polar capsule width, PFC polar filament coils, VS valvular striations, – no data.

Species	Host	Site infection	SL	SW	ST	PCL	PCW	PFC	VS	Reference
Myxidium orbiculare n. sp.	Channa gachua	Gallbladder	13.5 ± 0.4 (12.5–14.4)	6.5 ± 0.5 (5.7–7.6)	5.6 ± 0.3 (5.1–6.4)	4.0 ± 0.3 (3.5–4.8)	3.3 ± 0.2 (2.9–4.0)	4	7	Present study
M. schilba	Schilbe mystus	Gallbladder	13.7 (12.7–14.9)	5.6 (4.9–6.1)	–	4.3 (3.0–4.9)	2.9 (2.0–3.4)	4	–	Eiras et al. (2011)
M. onyhosionmatis	Varicorhinus simus	Gallbladder	13.9 (13.6–14.4)	6.5 (6.0–7.2)	5.7 (5.0–6.0)	4.0 (3.9–4.0)	2.4 (2.3–2.4)	–	6–7	Chen and Ma, 1998
M. grauri	Carasobarbus canis	Gallbladder	14.2 ± 0.6 (12.5–15.7)	5.7 ± 0.4 (4.4–7.1)	–	5.1 ± 0.2 (4.1–5.8)	3.0 ± 0.5 (2.1–3.8)	5	6–8	Gupta et al. (2025)
M. asiaticum	M. asiaticus	Gallbladder	14.4 ± 0.5 (13.4–15.5)	7.6 ± 0.5 (6.5–8.4)	6.7 ± 0.2 (6.3–7.0)	3.8 ± 0.2 (3.4–4.2)	3.0 ± 0.2 (2.7–3.4)	4–5	–	Lom and Dyková (2006)
M. spinibarba	Spinibarbus sinensis	Gallbladder	11.8 ± 0.5 (10.6–12.4)	6.1 ± 0.5 (5.5–7.2)	–	3.6 ± 0.4 (3.0–4.4)	3.0 ± 0.2 (2.8–4.2)	4–5	8–10	Chen et al. (2020)
M. kudoi	Ictalurus furcatus	Gallbladder	11.6 ± 0.5 (10.8–12.6)	5.7 ± 0.5 (4.7–6.6)	3.6 (2.5–5.0)	3.4 ± 0.3 (2.7–3.9)	3.1 ± 0.3 (2.4–3.5)	3–4	7–9	Woodyard et al. (2020)
M. ceccarellii	Leporinus elongatus	Gallbladder	17.7 ± 0.5 (17.1–18.1)	10.4 ± 0.4 (9.8–11.3)	10.1 ± 0.2 (9.6–10.4)	6.3 ± 0.5 (5.7–7.0)	6.4 ± 0.4 (5.7–6.9)	4–5	–	Adriano et al. (2014)

4. Discussion

Several scientific reports have been published on the myxozoans of Malaysia in previous years; however, only a single Myxidium species, Myxidium cf. notopterum has been described from this country (Borkhanuddin et al., 2020). This study aimed to broaden the survey by examining additional host species such as L. leptocheilus, T. pectoralis, and C. gachua, to identify potential new species. In this study, three novel Myxidium species were described namely Myxidium acutum n. sp. from L. leptocheilus, Myxidium truncatum n. sp. from T. pectoralis, and Myxidium orbiculare n. sp. from C. gachua in Malaysia. These species were characterized based on morphological features and analyses of the 18S rDNA gene sequences. All three species exhibited similar tissue tropism, as they were detected in the gallbladder of their respective hosts.

Based on BLASTn analysis, the Myxidium sample collected from gallbladder of L. leptocheilus in this study showed 99.4% sequence similarity to Zschokkella sp. (KM401441; 2,057 base pairs) previously reported from the gallbladder of L. rohita. However, no morphological and morphometric were available for that species, as it lacked a valid description at the time of publication. This situation is consistent with findings from recent study on Zschokkella chezhachei, in which sequence data were available in GenBank but no accompanying morphological information existed to support the species identification evidence (Suhaimi et al., 2025b). Consequently, Z. chezhachei was described as a new taxon based on combined molecular and morphological. The spores of M. acutum n. sp. exhibited typical Myxidium morphology such as fusiform or sigmoid shape with pointed ends and pyriform polar capsules located at each pole (Lom and Dyková, 2006), in which differed clearly from the characteristics of Zschokkella, whose spores are typically subspherical to spherical with nearly spherical polar capsules positioned on one side of the spore. These morphological distinctions ruled out the possibility of synonymy, supporting its classification as a new species. The previous misidentification of Myxidium as Zschokkella may have resulted from low-resolution microscopic images or insufficient taxonomic expertise. Phylogenetic analysis further showed that M. acutum n. sp. clustered with Zschokkella sp. (KM401441) within a well-supported monophyletic clade of Myxidium species, suggesting that Zschokkella sp. (KM401441) likely represents a member of the Myxidium genus. Since the similarity was 99.4% and the sequence of Zschokkella sp. (KM401441) is long enough (2,057 bp) to include conservative and variable regions for comparison both samples may represent the same species. This could be explained by M. acutum n. sp. being developing in both L. leptocheilus or L. rohita. Given that both hosts are members of the family Cyprinidae and relatively closely related, such host sharing would be possible. Therefore, additional sampling of L. rohita in Myanmar to obtain specimens for morphological and morphometric comparison, is necessary to confirm this assumption.

Morphologically, M. acutum n. sp. was compared with several previously described Myxidium species, including Myxidium rhodei Léger, 1905; Myxidium eminentis Ishizaki, 1957; Myxidium melanostigmum Noble, 1966; Myxidium bouixi Siau, 1971; Myxidium iwamotoi Moser, Noble et Lee, 1976; Myxidium profundum Zubtschenko, 1981; Myxidium baueri Kovaljova et Gaevskaya, 1982; and Myxidium pantanalense Ponzetto, Adriano et Maia, 2026. Although these species share generally similar spore morphology, elongated, fusiform spores with pointed ends, they differ in morphometric characteristics. Furthermore, molecular data are currently unavailable for several of these taxa, which limits comprehensive genetic comparisons.

This study represent the first investigation of myxozoan parasites in T. pectoralis, leading to the identification M. truncatum n. sp. detected in the gallbladder. Morphological and morphometric comparisons with previously described Myxidium spp. revealed significant differences. Its morphology was most similar to M. djolonensis from Cameroon, sharing the rare feature of a fusiform body with truncated ends, in contrast to the pointed ends typical of most Myxidium spp. Despite their resemblance, they differed in spore dimensions, geographical distributions and host species. The phylogenetic and pairwise distance analyses showed that M. truncatum n. sp. was closely related to Zschokkella sp. (MT840090) from E. suratensis and Myxosporea (KP030767) from Synodontis sp. However, due to the lack of available morphological and morphometric data for these latter two species, direct comparison was not possible. Further sampling of E. suratensis and Synodontis sp. is recommended to enable full species descriptions of Zschokkella sp., and Myxosporea and to clarify their taxonomic relationships.

Since M. truncatum n. sp. exhibited the typical morphological characteristics and clustered within the lineage in Clade B (Fig. 2), it was confirmed to belong to genus Myxidium. However, the phylogenetic analysis of the closely related species revealed certain anomalies, such as the inclusion of a small group consisting of eight marine Zschokkella spp. and two Myxidium spp. within a predominantly freshwater Myxidium lineages, A and B, respectively. Similar clustering of marine Zschokkella species within the freshwater clades have been reported and discussed previously (Fiala and Bartošová, 2010; Yemmen et al., 2013; Rocha et al., 2013; Heiniger and Adlard, 2014; Azizi et al., 2016; Chen et al., 2020). According to Fiala and Bartošová (2010), this is because a secondary lineage of marine-origin myxosporeans re-entered marine environments after adapting to freshwater habitats. The taxonomic boundaries between Myxidium and Zschokkella remain poorly defined, largely due to similarities in their morphology, as defined by Lom and Dyková (2006), which has often resulted in inconsistent species assignments. Molecular approaches have therefore been increasingly applied to clarify the ambiguous distinction between these two genera (Fiala, 2006; Fiala and Bartošová, 2010). The disposition of the marine M. grauri n. sp. and M. sharmai n. sp. (Gupta et al., 2025) within the freshwater clade (B) also supports a subsequent marine-to-freshwater transition. Additionally, this clade includes Myxidium species that infect variety of fish hosts across Malaysia, Kenya, India and China, highlighting their wide geographic and host diversity.

Only a few studies have investigated myxozoan parasites infecting the genus Channa. Most records originate from India and China (Chen and Ma, 1998; Gupta et al., 2021; Eiras et al., 2023; Zhang et al., 2023); and only a single Myxidium species, Myxidium islampurium Sarkar, Mazumber et Pramanik, 1985 has been described from Channa marulius. In this study, an additional Myxidium species was identified from C. gachua. Both plasmodia and dispersed spores of M. orbiculare n. sp. were detected in the gallbladder of the host. This species exhibited a unique morphological feature, such as concave spore shape/form with slightly truncated ends, which has not been previously reported in other Myxidium species, supporting its recognition as a novel species. In comparison, M. islampurium from C. marulis displays a fusiform spore shape/form with tapered ends (Eiras et al., 2011). Unfortunately, the absence of M. islampurium sequences in GenBank prevented molecular comparison. Molecular analyses revealed that M. orbiculare n. sp. shared its highest similarity (91.0%) to M. chuatsi, a parasite of Siniperca chuatsi, which also exhibits a concave spore shape/form but with tapered ends. Furthermore, it confirmed the species’ separation, which occupies a basal position within a subclade that includes Myxidium spp. capable of infecting a variety of hosts (Rhinogobius similis, S. chuatsi, Labeo horie, Cranoglanis bouderius, L. leptocheilus, L. rohita, Culter alburnus, Myxocyprinus asiaticus from Order Gobiiformes, Centrarchiformes, Cypriniformes and Siluriformes) from China, Kenya, Malaysia and Myanmar. The obvious separation of M. orbiculare n. sp. probably reflects the absence of available Myxidium sequences from Channa species in current databases. Including M. islampurium sequence data could presumably place both species close together in the phylogenetic tree, given their shared host genus. Notably, this represents the first record of a Myxidium species infecting C. gachua. The distinctive morphological characters observed, particularly the appearance of spore ends, may reflect host specificity, suggesting that the truncated form may be an exclusive feature for Myxidium of Channa from Malaysia. Further surveys of Channa species across Southeast Asia could help clarify host-parasite coevolution, reveal the diversity of myxozoans in this genus, and better characterize the morphological features of Malaysian Myxidium.

In conclusion, this study provides strong morphological and molecular evidence supporting the description of Myxidium acutum n. sp., Myxidium truncatum n. sp., and Myxidium orbiculare n. sp. as new species. These findings expand current knowledge of Myxidium diversity in Malaysia, and highlight the need for a broader investigations of myxozoan parasites infecting native and introduced fish fauna in the region, as they may represent unexplored reservoirs of myxozoan biodiversity. Furthermore, this study represents the first record of Myxidium species and myxozoan parasites infecting L. leptocheilus and T. pectoralis, and the second report of a myxozoan species from C. gachua.

Ethical approval

All applicable institutional, national, and international guidelines for the care and use of animals were followed.

Funding

This work was supported by the Stipendium Hungaricum Program.

CRediT authorship contribution statement

Nadhirah Syafiqah Suhaimi: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Software, Validation, Visualization, Writing – original draft, Writing – review & editing. Csaba Székely: Conceptualization, Funding acquisition, Project administration, Resources, Supervision, Validation, Writing – review & editing. Gábor Cech: Data curation, Methodology, Software, Validation, Writing – review & editing. Boglárka Sellyei: Data curation, Supervision, Validation, Writing – review & editing. Muhammad Hafiz Borkhanuddin: Conceptualization, Funding acquisition, Resources, Writing – review & editing.

Conflict of interest and authorship conformation form

• ○All authors have participated in (a) conception and design, or analysis and interpretation of the data; (b) drafting the article or revising it critically for important intellectual content; and (c) approval of the final version.
• ○This manuscript has not been submitted to, nor is under review at, another journal or other publishing venue
• ○The authors have no affiliation with any organization with a direct or indirect financial interest in the subject matter discussed in the manuscript
• ○The following authors have affiliations with organizations with direct or indirect financial interest in the subject matter discussed in the manuscript: