Targeted degradation of Influenza a virus nucleoprotein via aptamer-based PROTACs for antiviral therapy

ABSTRACT

Influenza A virus (IAV) poses a serious threat to public health due to its high mutability and rapid transmissibility. The viral nucleoprotein (NP), a highly conserved and essential component, has emerged as an ideal target for antiviral therapies. However, its biological function has proven challenging to modulate with conventional drugs, and no NP-targeting therapeutics have reached the market so far. Here, we report the development and application of an aptamer-based proteolysis-targeting chimera (PROTAC) for the targeted degradation of IAV NP. Utilizing the Direct-to-Biology (D2B) platform, we efficiently screened and identified NP-PROTAC#4 as a functional candidate. Subsequently, we developed a lipid nanoparticle (LNP) formulation of NP‑PROTAC#4 (LNP@NP‑PROTAC#4) for effective intracellular delivery. Importantly, LNP@NP-PROTAC#4 demonstrated potent antiviral activity both in vitro and in vivo. Mechanistically, NP-PROTAC#4 exerts its antiviral effects by targeting and degrading NP via the ubiquitin-proteasome system. In conclusion, our findings provide the first evidence that NP-targeted PROTAC degrader exhibits therapeutic effects, proposing a novel therapeutic strategy for IAV.

Introduction

Influenza A virus (IAV) is the primary pathogen responsible for seasonal and pandemic influenza, causing 3 to 5 million severe cases and approximately 290,000 to 650,000 deaths annually worldwide [1]. Consequently, IAV remains a serious and persistent threat to human health. The IAV genome encodes several major functional proteins, which include hemagglutinin (HA) and neuraminidase (NA) glycoproteins, matrix proteins (M1 and M2), as well as nucleoprotein (NP) and polymerase complexes (PA, PB1, and PB2) [2]. Currently, multiple antiviral drugs, including M2 antagonists (amantadine [3]), NA inhibitors (oseltamivir [4]), and polymerase inhibitors (baloxavir [5] and onradivir [6]), remain the mainstay of clinical treatment for influenza. However, drug resistance has become a severe challenge due to the high mutation rate of the influenza virus [7]. Therefore, the development of novel antiviral agents and alternative strategies is desperately needed to overcome the challenge of drug resistance.

The influenza virus nucleoprotein (NP) is the most abundant structural protein within the viral particle and plays multifaceted and indispensable roles in the viral life cycle [8], including encapsidation of the viral RNA genome [9], assembly of the ribonucleoprotein complex (vRNP) [10], and participation in viral RNA transcription and replication [11]. Thus, NP represents a highly conserved and multifunctional viral protein serving as a potential therapeutic target [12]. Notably, traditional small-molecule inhibitors primarily rely on an occupancy-driven mechanism, aiming to obstruct NP functional sites to block oligomerization or nucleocytoplasmic transport [13]. Nevertheless, these occupancy-driven inhibitors face substantial challenges in efficacy, selectivity, and the development of resistance, highlighting the urgent need to explore alternative targeting strategies.

The Proteolysis-Targeting Chimera (PROTAC) technology represents a revolutionary therapeutic paradigm that operates via a unique “event-driven” mechanism [14]. A typical PROTAC is a heterobifunctional molecule composed of three core elements: a ligand that binds the protein of interest (POI), a ligand that recruits the E3 ubiquitin ligase, and a linker that bridges the two moieties [15]. Its mechanism involves the PROTAC molecule recruiting the POI and an E3 ligase to form the POI-PROTAC-E3 ternary complex [16]. This complex hijacks the host ubiquitin-proteasome system, leading to polyubiquitination of the POI and its subsequent recognition and degradation by the 26S proteasome [17]. PROTACs have already proven to be a promising therapeutic modality, with their application rapidly expanding from oncology into the field of infectious diseases. Particularly in antiviral research, PROTACs targeting pathogens such as the hepatitis B virus (HBV) have demonstrated encouraging inhibitory effects [18,19]. Consequently, targeted inhibition or degradation of the NP protein holds promise as a novel strategy for controlling influenza A virus infection.

In PROTAC design, cereblon (CRBN) and von Hippel-Lindau (VHL) represent the two most widely targeted substrate-recognition subunits of E3 ligase complexes [20]. In addition, various molecules such as small molecules, peptides, antibodies, and aptamers serve as ligands for target proteins [21]. Aptamer-based PROTAC represents a particularly promising strategy for challenging targets [22]. Aptamers are short single-stranded oligonucleotides selected in vitro to bind specific targets with high affinity and specificity [23]. As targeting warheads for PROTACs, aptamers are independent of predefined deep binding pockets, enabling the targeting of “undruggable” protein surfaces typical of many viral proteins [24]. Furthermore, the aptamers exhibit exceptional specificity to minimize off-target effects against host proteins [25], and they can be chemically synthesized and readily modified, allowing for precise site-specific conjugation to E3 ligase ligands [26]. However, it remains unclear whether aptamer-based PROTACs targeting NP degradation can be effectively applied in anti-influenza virus therapy.

In this study, we engineered a conjugate molecule by tethering a high-affinity DNA aptamer against influenza NP to a ligand for the E3 ubiquitin ligase. This degrader induces the ubiquitination and degradation of the NP protein, disrupting the viral replication cycle and achieving potent inhibition of influenza A virus both in vitro and in vivo. In conclusion, our findings offer an innovative drug candidate for influenza therapy and expand the application prospects of PROTAC technology in antiviral fields.

Materials and methods

Ethics statement

All animal experiments were approved by the Ethics Committee of The First Affiliated Hospital of Guangzhou Medical University under project license IACUC-20251103. Experimental procedures were carried out in accordance with the Regulation on the Use and Care of Laboratory Animals for Research of The First Affiliated Hospital of Guangzhou Medical University. The animal experiments in this study complied with the ARRIVE guidelines.

Cells and virus strains

A549 (ATCC, Catalog #: CCL-185), MDCK (ATCC, Catalog #: CCL-34), and 293T (ATCC, Catalog #: CRL-3216) cells were acquired from the American Type Culture Collection. All the cell lines were maintained in medium containing 10% fetal bovine serum (Sigma, Catalog #: F0193) and 1% penicillin/streptomycin (Thermo Scientific, Catalog #: 15,140,122) at 37°C in a humidified incubator with 5% CO₂. The cells were transfected using Lipofectamine 8000 (Beyotime, Catalog #: C0533) according to the manufacturer’s protocols. The influenza A virus (IAV) strain A/Puerto Rico/8/1934 (H1N1; PR8) and its recombinant virus PR8-GFP were generously gifted by Dr. Shaobo Wang (Guangzhou National Laboratory) and Prof. Ruikun Du (Shandong University of Traditional Chinese Medicine), respectively. Both viruses were generated using the construction strategy described previously [27].

Mice

Female BALB/c mice (5–6 weeks) were obtained from Shanghai Research Center for Model Organisms (Shanghai, China). Mice were kept in pathogen-free setting with a temperature of 25°C and a humidity level of 40–50%. Food and water were available ad libitum. Healthy BALB/c mice at 6–7 weeks were selected as study subjects. After euthanizing the mice with carbon dioxide, the lung tissues were extracted for examination.

Materials and reagents

The following reagents were used in this study: iodo(triethyl phosphite)copper(I) (Catalog #: I918669), 4-methylmorpholine (Catalog #: 016240692) and dimethyl sulfoxide (Catalog #: T0341) were purchased from Macklin, Adamas and TargetMol (Shanghai, China), respectively. The pcDNA3-HA-NP and pcDNA3-GFP-NP plasmids were constructed and stored in our lab. Rabbit anti-influenza A virus nucleoprotein antibody (Catalog #: HL1098) was provided by GeneTex (Shanghai, China). Rabbit anti-PB2 antibody (Catalog #: PA5-32221), rabbit anti-PB1 antibody (Catalog #: PA5-34914) and rabbit anti-PA antibody (Catalog #: PA5-32223) were purchased from Thermo Scientific (USA). Mouse anti-GAPDH antibody (Catalog #: 60,004–1-Ig), mouse anti-GFP antibody (Catalog #: 66,002–1-Ig), rabbit anti-ubiquitin antibody (Catalog #: 10,201–2-AP), HRP-conjugated goat anti-mouse (Catalog #: SA00001-1), and goat anti-rabbit secondary antibodies (Catalog #: SA00001-2) were acquired from Proteintech (Wuhan, China). MG132 (Catalog #: S2619), Cell Counting Kit-8 (Catalog #: C6005M) and serum-free medium for influenza A virus isolation (Catalog #: NC0204) were provided by Selleck (Shanghai, China), UElandy (Suzhou, China) and Yocon (Beijing, China), respectively.

Synthesis of NP-PROTACs

To construct the aptamer-based PROTACs, we selected and synthesized two previously established NP-targeting aptamers with validated high affinity to serve as the targeting ligands [28,29]. The secondary structures and detailed sequences of the aptamers are provided in Supplementary Figure S1 and Supplementary Table S1. The alkyne-, azide-, biotin- and Cy3-modified aptamers were synthesized by Sangon Biotech (Shanghai, China). The CRBN and VHL ligands with various linkers (Bide Pharmatech, Catalog #: 2,098,487-52–4; 2,098,799-77–8; 2,357,108-05–3; 2,758,431-96–6; 2,271,036-46–3; 2,010,159-45–0; 2,271,036-44–1; 2,821,804-11–7; 2,375,555-72–7; 1,797,406-81–5; 2,271,036-47–4) were obtained from Bidepharm (Supplementary Figure S2). For CRBN recruitment, thalidomide and pomalidomide derivatives were functionalized via either ether (-O-) or amine (-NH-) linkages to an array of linkers. These included flexible, hydrophilic PEG chains (PEG1 to PEG4) and hydrophobic alkyl chains (ranging from 3 to 6 carbons in length). For VHL recruitment, specific ligands were derivatized via amide bonds to either a 5-carbon alkyl chain or PEG chains of various lengths (PEG1 and PEG3). The VHL/CRBN ligands and iodo(triethyl phosphite)copper(I) (Macklin, Catalog #: I918669) were prepared in DMSO (Adamas, Catalog #: T0341) at 50 mM and 100 mM, respectively. 4-Methylmorpholine (Adamas, Catalog #: 016240692) was dissolved in MeOH at 30 mM. The alkyne-, azide-, biotin-, and Cy3-functionalized aptamers were dissolved in ddH₂O to a concentration of 500 μM. For the synthesis of NP‑PROTACs, 20 μL of aptamer solution was combined with 10 μL of E3 ligand solution, 10 μL of iodo(triethyl phosphite)copper(I) solution, and 10 μL of 4‑methylmorpholine solution. The copper‑catalyzed azide‑alkyne cycloaddition (CuAAC) reaction was allowed to proceed overnight at room temperature. Subsequently, the resulting PROTACs were purified using a 3 K ultrafiltration membrane (Millipore, Burlington, MA) [30]. The chemical structures of NP-PROTACs are provided in Supplementary Figure S3. The NP-PROTACs were confirmed by native polyacrylamide gel electrophoresis (native‑PAGE) and UV‑vis spectroscopy.

Cell viability assay

The cytotoxicity of NP-PROTAC#4 was evaluated using the CCK-8 assay [31]. Briefly, A549 and 293T cells were seeded into 96-well plates. After 24 h of incubation, the cells were treated with NP-PROTACs with a concentration gradient ranging from 0.5 μM to 5 μM for 48 h. Subsequently, 10 μL of CCK-8 solution was added to each well, followed by incubation for 1 h. The absorbance at 450 nm was then measured using an automated microplate reader (Bioteck, USA).

Serum stability assay

The stability of NP-PROTAC#4 was evaluated under physiological conditions by incubation in complete medium supplemented with 10% fetal bovine serum at 37°C. The samples were collected at predetermined time points (0, 6, 12, 24, 36, and 48 h) and analyzed using 15% native polyacrylamide gel electrophoresis. Following electrophoresis, the gels were stained with Goldview for 30 min and imaged using an iBright Imaging System (Thermo Scientific, USA).

Reverse transcription-quantitative PCR (RT-qPCR)

A549 cells were infected with the PR8 influenza virus and subsequently treated with NP-PROTAC#4. Total RNA was extracted using TRIzol reagent (Vazyme Biotech, Catalog #: R401) and equally divided into four aliquots for reverse transcription (RT). Complementary DNA (cDNA) was synthesized using a reverse transcription kit (EnzyArtisan, Catalog #: R201-01) with the following sequence‑specific primers (NP-mRNAtag-RT: CCAGATCGTTCGAGTCGTTTTTTTTTTTTTTTTTCTTTAATTGTC; NP-cRNAtag-RT: GCTAGCTTCAGCTAGGCATCAGTAGAAACAAGGGTATTTTTCTTT; NP-vRNAtag-RT: GGCCGTCATGGTGGCGAATGAATGGACGAAAAACAAGAATTGC). The qPCR assays were performed in triplicate using SYBR Green qPCR Master Mix (EnzyArtisan, Catalog #: Q204-01) and specific primers (Supplementary Table S2) on a CFX96 Touch Real-Time PCR System (Bio-Rad). The expression of the target gene in each sample was normalized to the endogenous control gene, and relative gene expression levels were calculated using the comparative threshold cycle (2^−ΔΔCt) method.

Streptavidin pulldown assay

293T cells were plated in 6-well plates. After 24 h of incubation, the cells were transfected with pcDNA3-HA-NP plasmid for 24 h, followed by treatment with biotinylated NP-PROTAC#4. The cells were collected and lysed using RIPA lysis buffer (Beyotime, Catalog #: P0013K). Then, the cellular proteins were incubated with streptavidin-agarose (SA) beads (Yeasen, Catalog #: 35101ES03) at 4°C for 6 h. Finally, the samples were analyzed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE).

Flow cytometry

293T and A549 cells were seeded in 12-well plates. After 24 h of incubation, the cells were either infected with the PR8-GFP virus or transfected with the specified plasmids and aptamers, each for the designated duration. Following treatment, cells were harvested and resuspended in phosphate-buffered saline (PBS). Then, the samples were analyzed using a CytoFLEX S flow cytometer (Beckman Coulter, USA) and the resulting data were processed using FlowJo software.

Immunoblotting

For immunoblotting analysis, protein samples were resolved by 10% SDS-PAGE. Subsequently, the separated proteins were transferred onto polyvinylidene difluoride membranes. The membranes were blocked with 5% bovine serum albumin (Beyotime, Catalog #: ST023) for 1 h at room temperature and then incubated with specific primary antibodies overnight at 4°C. Following three washes, the membranes were incubated with HRP-conjugated secondary antibodies for 1 h at room temperature. Protein bands were detected using an enhanced chemiluminescence (ECL) substrate kit (Millipore Sigma, Catalog #: WBULP-100 ML) and imaged with an iBright Imaging System (Thermo Scientific, USA).

Preparation and characterization of LNP@NP-PROTAC#4

The lipid nanoparticles (LNPs) were kindly provided by Professor Qiong Zhang. LNPs and LNP@NP-PROTAC#4 formulations were prepared using a microfluidic chip via the Blue Magpie automated encapsulation system. Following encapsulation, the formulations were dialyzed for 4 h and subsequently concentrated by ultrafiltration. The hydrodynamic diameter of the particles was determined by dynamic light scattering using a Nanoparticle Size Analyzer (Brookhaven), and the encapsulation efficiency was quantified using the Quant-iT™ RiboGreen RNA Assay Kit (Thermo Scientific, Catalog #: R11490).

Safety evaluation and antiviral efficacy of NP-PROTAC#4

For the safety evaluation, 10 female BALB/c mice (6–7 weeks) were randomly divided into two groups (n = 5 per group): a control group receiving no treatment, and a treatment group administered LNP@NP‑PROTAC#4 (10 mg/kg) daily intratracheally. General health status was monitored daily, and body weight was recorded. Major organs were collected at the endpoint for histopathological examination to assess potential toxicity. For the antiviral efficacy study, 15 female BALB/c mice (6–7 weeks) were randomly divided into three groups. One group remained uninfected as a control, while the other two groups were intranasally inoculated with 200 plaque‑forming units (PFU) of the PR8 influenza virus. Among the PR8-infected groups, one was treated with PBS, while the other group was treated with LNP@NP-PROTAC#4 (10 mg/kg). The antiviral efficacy of NP-PROTAC#4 was evaluated based on survival rate, body weight changes, viral load, and histopathological assessment.

Statistical analysis

All experiments were performed with at least three independent biological replicates, and all values are shown as mean ± SD. Statistical analysis was performed using GraphPad Prism 8.0. Data were analyzed using Student’s t-test for pairwise comparisons and analysis of variance (ANOVA) for multiple group comparisons, with significance thresholds set at a p-value < 0.05.

Results

Synthesis and screening of PROTACs targeting IAV NP

To synthesize and screen PROTACs targeting IAV NP, we conjugated CRBN or VHL ligands with diverse linkers to aptamers targeting IAV nucleoprotein (NP) via click chemistry to make 44 compounds. These compounds (1 µM) were then added to A549 cells infected with the green fluorescent protein-expressing PR8 (PR8-GFP) influenza virus (MOI = 0.01) to screen for PROTACs with pronounced antiviral activity Figure 1(A). Using this D2B screening platform, we identified NP-PROTAC#4, which exhibited a viral suppression rate of up to 87% Figure 1(B,C). Then, the anti-influenza virus activity and cytotoxicity of these synthesized compounds were evaluated in MDCK cells, in which oseltamivir carboxylate (OSC) was used as the positive control (Supplementary Table S3). Among all candidate compounds, NP-PROTAC#4 exhibited the most potent antiviral efficacy, achieving EC₅₀ values of 0.37 μM against H1N1 and 1.02 μM against H3N2 influenza virus.

Figure 1.

Synthesis and screening of PROTACs targeting IAV NP. (A) Flowchart of PROTAC library synthesis and screening. (B) The antiviral efficacy was evaluated based on a phenotype-based screen from the PROTAC library. The 44 compounds (1 µM) were transfected into A549 cells infected with PR8-GFP influenza virus (MOI = 0.01). After 24 h, total fluorescence intensity of PR8-GFP virus was analyzed using an enzyme-linked immunosorbent assay reader. (C) Chemical structure of NP-PROTAC#4 consisting of a CRBN ligand (CRBNL), a flexible linker, and an NP-specific aptamer (NP-Apt). (D) Native-PAGE analysis of the NP aptamer and NP-PROTAC#4. (E) UV absorbance spectra of the NP aptamer and NP-PROTAC#4. (F) Serum stability analysis of NP-PROTAC#4 via native-PAGE. (G) Cell viability assay of A549 and 293T cells treated with different concentrations of NP-PROTAC#4. (H) Cellular uptake of Cy3-labeled NP-PROTAC#4 in A549 cells. Data are expressed as mean ± SD of three independent experiments. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001.

The successful synthesis of NP-PROTAC#4 was confirmed by 15% native polyacrylamide gel electrophoresis (native-PAGE) and UV spectroscopy. The electrophoretic mobility shift confirmed an increase in molecular weight upon conjugation of the aptamer to the CRBN ligand, a result further corroborated by UV spectral analysis Figure 1(C,D). Subsequently, the stability of NP-PROTAC#4 was assessed following incubation in 10% fetal bovine serum (FBS) at 37°C for various time periods. Native-PAGE analysis revealed that NP-PROTAC#4 retained over 47% of its integrity after 24 h in 10% FBS Figure 1(F). Cytotoxicity evaluation demonstrated that NP-PROTAC#4 exhibited minimal cytotoxicity across a concentration range of 0–5 µM in A549 and 293T cells, indicating favorable biocompatibility Figure 1(G). To evaluate the cellular uptake of NP-PROTAC#4, Cy3-labeled NP-PROTAC#4 was administered to A549 cells in the presence or absence of liposomal transfection reagent. The results indicated that liposome-mediated transfection significantly enhances cellular uptake of NP-PROTAC#4 Figure 1(H). Collectively, these results validate the application of the D2B platform for antiviral drug screening and provide initial evidence for the antiviral efficacy of NP-PROTAC#4 against influenza A virus.

NP-PROTAC#4 mediates the degradation of IAV NP

PROTAC-mediated targeted protein degradation enables the specific clearance of pathogenic proteins to exert antiviral functions [32]. To evaluate the degradation activity of NP-PROTAC#4 against the NP of influenza A virus, Western blot analysis was applied and it demonstrated a significant reduction in IAV NP protein levels following treatment with NP-PROTAC#4 Figure 2(A). Next, we examined the degradation efficiency by treating NP-GFP-expressing cells with a concentration gradient of NP-PROTAC#4. Both fluorescence microscopy and flow cytometric analysis revealed that the amount of green fluorescence decreased with increasing dose of NP-PROTAC#4 Figure 2(B,C).

Figure 2.

NP-PROTAC#4 mediates the degradation of IAV NP. (A) Western blot analysis of NP degradation with E3-ligand, aptamer, and NP-PROTAC#4. The concentration of the E3-ligand, aptamer, and NP-PROTAC#4 is all 1 μM. (B, C) Fluorescence images and flow cytometric analysis of NP-GFP in cells treated with different concentrations of NP-PROTAC#4. (D) Time-dependent degradation of NP by NP-PROTAC#4 within 48 h. (E) Quantification of NP degradation over time with a half-life (T_1/2) of 24.31 h. (F) Western blot analysis of NP levels in cells treated with different concentrations of NP-PROTAC#4. (G) Quantification of dose-dependent NP degradation with the half-maximal degradation concentration (DC₅₀) of 0.55 μM. (H) Western blot analysis of H1 and H3 NP protein degradation treated with NP-PROTAC#4. (I) Western blot analysis of NP degradation in H1N1 influenza-infected cells treated with NP-PROTAC#4. Data are expressed as mean ± SD of three independent experiments.

Furthermore, we treated cells with 1 μM NP-PROTAC#4 for various time intervals. Western blot analysis demonstrated a pronounced time-dependent decrease in NP protein, with approximately 50% degradation occurring within 24.31 h Figure 2(D,C). The results indicated a potent dose-dependent reduction in NP protein levels, with a half-maximal degradation concentration (DC₅₀) of 0.55 μM Figure 2(F,G). Furthermore, we assessed NP-PROTAC#4 across an extended concentration range in the protein degradation assay to fully characterize its degradation profile. The results revealed a typical PROTAC hook effect: NP degradation increased in a concentration-dependent manner, peaking at 2.5 μM, and then rebounded markedly at higher concentrations (5 and 10 μM) (Supplementary Figure S4). Seasonal influenza is primarily dominated by the H1 and H3 subtypes of influenza viruses [33]. Interestingly, NP-PROTAC#4 can degrade NP proteins of both H1 and H3 subtypes, which suggests its potential to combat multi-subtype influenza viruses Figure 2(H). Moreover, this degradation activity was consistently observed at both 24 and 48 h post-infection Figure 2(I). These results demonstrated that NP-PROTAC#4 effectively degrades the NP protein of influenza A virus in a dose- and time-dependent manner.

NP-PROTAC#4 inhibits IAV replication by targeting NP for proteasome degradation

The PB2, PB1, and PA proteins of influenza virus form the viral polymerase. Viral RNA (vRNA) binds to these polymerase proteins and the nucleoprotein (NP) to assemble the viral ribonucleoprotein (vRNP) complex [34]. Upon viral entry into cells, the vRNP complex is released and transported into the nucleus to initiate the transcription and replication of the viral genome [35]. To evaluate the antiviral efficacy of NP-PROTAC#4 against IAV infection, A549 cells were infected with PR8 (H1N1), H3N2, or H3N8-GFP virus at 37°C for 24 h. The results showed that A549 cells infected with IAV express green fluorescent protein. However, GFP expression in IAV-infected cells was markedly suppressed by NP-PROTAC#4 treatment in a concentration-dependent manner Figures 3(A,B). Then, the antiviral activity of NP-PROTAC#4 was further confirmed using plaque assays, which demonstrated a significant reduction in viral titers for PR8 virus following treatment Figure 3(C). Consistent with this, Western blot analysis indicated that levels of viral polymerase proteins (PB2, PB1, PA) as well as nucleoprotein (NP) were substantially decreased when treated with NP-PROTAC#4 Figure 3(D). Additionally, RT-qPCR analysis revealed that NP-PROTAC#4 treatment effectively inhibited the expression of NP mRNA, vRNA, and cRNA compared to the control group Figure 3(E). These results indicated that NP-PROTAC#4 exhibits potent antiviral efficacy against IAV infection in vitro.

Figure 3.

NP-PROTAC#4 inhibits IAV replication by targeting NP for proteasomal degradation. (A) Fluorescence images of A549 cells infected with PR8-GFP, H3N8-GFP, or H3N2-GFP viruses treated with different concentrations of NP-PROTAC#4. (B) Quantitative analysis of relative viral number shown in (A). (C) the viral titer of the PR8 virus in A549 cells after treatment with different concentrations of NP-PROTAC#4. (D) Western blot analysis of viral proteins (NP, PB2, PB1, PA) in virus-infected cells treated with NP-PROTAC#4. (E) Quantitative analysis of relative viral RNA levels (vRNA, mRNA, cRNA) in virus-infected cells treated with NP-PROTAC#4. (F) Streptavidin pull-down assay confirmed the interaction of H1/H3 NP and NP-PROTAC#4. (G) Confocal microscopy images showing the colocalization of Cy3-NP-PROTAC#4 and NP-GFP. (H) Following transfection with the pCDNA3-HA-NP, cells were treated with NP-PROTAC#4 (0.5 or 1 μM) in the presence of the proteasome inhibitor MG132 (10 μM). After 24 h, cellular proteins were extracted and the ubiquitination level of NP protein was detected using anti-ub antibodies. (I) Following transfection with the pCDNA3-HA-NP, cells were treated with NP-PROTAC#4 (0.5 or 1 μM) and DMSO/MG132 (10 μM). After 24 h, the protein level of NP protein was detected. Data are expressed as mean ± SD of three independent experiments. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001.

Effective target engagement by PROTACs is essential for inducing protein degradation [36]. To explore the interaction between NP-PROTAC#4 and the NP protein, we co-transfected with H1/H3 NP and NP-PROTAC#4. The results indicated that NP-PROTAC#4 specifically binds to NP of H1 and H3 IAV Figure 3(F). Furthermore, confocal microscopy demonstrated clear cellular colocalization of NP-PROTAC#4 and NP Figure 3(G). To further elucidate the underlying mechanism, we assessed the ubiquitination of NP treatment with NP-PROTAC#4. The results showed that NP-PROTAC#4 significantly enhanced the ubiquitination of NP compared to the control Figure 3(H). Furthermore, Western blot analysis showed that treatment with NP-PROTAC#4 resulted in a dose-dependent decrease in NP protein levels. This degradation was effectively blocked by the proteasome inhibitor MG132, confirming that the degradation of NP depends on the ubiquitin-proteasome system Figure 3(I). Therefore, these results demonstrated that NP-PROTAC#4 targets NP for proteasomal degradation via enhancing its ubiquitination to exhibit antiviral function in vitro.

Safety assessment of LNP@NP-PROTAC#4 in vivo

As oligonucleotide molecules, aptamers are susceptible to degradation by nucleases and are rapidly cleared in vivo [37]. Moreover, their intrinsic hydrophilicity and negative charge result in poor cell membrane permeability. These characteristics collectively constitute the primary bottlenecks for their in vivo applications [38]. To address the delivery challenges of NP-PROTAC#4, we constructed a lipid nanoparticle (LNP) carrier using lipid components (SM-102, DSPC, cholesterol, and PEG lipid) [39,40]. The self-assembled LNPs were then used to encapsulate NP-PROTAC#4, forming the LNP@NP-PROTAC#4 Figure 4(A). The loading efficiency of NP-PROTAC#4 into LNPs was quantified with different ratios of LNP and NP-PROTAC#4 (1:1 to 4:1). Loading efficiency increased with the LNP proportion, reaching 95% at a 3:1 ratio – this optimized ratio ensured maximal payload of NP-PROTAC#4 without compromising formulation integrity Figure 4(B). Dynamic light scattering (DLS) characterization showed that both empty LNPs and LNP@NP-PROTAC#4 exhibited a narrow size distribution centered around 100 nm Figure 4(C). Monitoring colloidal stability via correlation coefficient revealed that both formulations maintained low aggregation coefficients, preventing particle agglomeration during storage or in vivo circulation Figure 4(D). We further evaluated the cellular uptake of Cy3-NP-PROTAC#4 and Cy3-LNP@NP-PROTAC#4, and found that Cy3-LNP@NP-PROTAC#4 significantly enhanced cellular internalization in A549 cells (Supplementary Figure S6). Thus, we developed a lipid nanoparticle (LNP) formulation of NP‑PROTAC#4 (LNP@NP‑PROTAC#4) for effective intracellular delivery.

Figure 4.

Preparation and in vivo safety evaluation of LNP@NP-PROTAC#4. (A) Schematic of LNP@NP-PROTAC#4 synthesis. Lipid nanoparticles (LNPs) were self-assembled, and then NP-PROTAC#4 was encapsulated into LNPs to generate LNP@NP-PROTAC#4. (B) The loading efficiency of LNP@NP-PROTAC#4 with different ratios of LNP and NP-PROTAC#4. (C) Dynamic light scattering (DLS) size analysis of empty LNPs and LNP@NP-PROTAC#4. (D) Colloidal stability analysis of empty LNPs and LNP@NP-PROTAC#4. (E) Schematic of safety evaluation of LNP@NP-PROTAC#4 in the mice. (F) Body weight changes in control and LNP@NP-PROTAC#4-treated mice for 7 consecutive days. (G) Representative images of mouse lungs in each group. (H) H&E staining images of lung, liver, heart, and spleen tissues. Data are expressed as mean ± SD of three independent experiments.

To evaluate the systemic safety of LNP@NP-PROTAC#4 in vivo, we administered five consecutive doses to six-week-old female BALB/c mice and harvested organs (heart, liver, spleen, and lungs) on day 7 for comprehensive analysis Figure 4(E). The LNP@NP-PROTAC#4 group showed no significant difference in body weight change compared to the control group, indicating no apparent systemic toxicity Figure 4(F). Macroscopic examination of lungs revealed no abnormalities in the LNP@NP-PROTAC#4 group compared to the control group. Histopathological analysis further demonstrated that lung, heart, liver, and spleen tissues in the LNP@NP-PROTAC#4 group were morphologically identical to the control group in cellular structure and inflammatory status, with no evidence of tissue damage, inflammatory cell infiltration, or necrosis detected Figure 4(G,H). Furthermore, in vivo fluorescence imaging was conducted to evaluate the in vivo metabolic stability of LNP formulation. The results showed that the free NP-PROTAC#4 underwent rapid degradation and was quickly cleared from the lungs, with minimal residual fluorescence detected at 24 h. In contrast, the LNP@NP-PROTAC#4 group maintained strong, sustained fluorescence signals throughout the 24-hour observation period (Supplementary Figure S5). Therefore, LNP@NP-PROTAC#4 demonstrates favorable loading efficiency, stability, and in vivo biocompatibility, representing a promising delivery system for in vivo applications of NP-PROTAC#4.

Therapeutic efficacy of LNP@NP-PROTAC#4 in vivo

To validate the therapeutic efficacy of LNP@NP-PROTAC#4, we employed a mouse model infected with influenza A virus. Six-week-old female BALB/c mice were intranasally infected with H1N1 influenza virus, followed by intratracheal administration of LNP@NP-PROTAC#4. On day 1 post-infection (d.p.i.), LNP@NP-PROTAC#4 (10 mg/kg) was administered via intratracheal instillation. Subsequently, continuous administration was performed via drip infusion. Lung tissue was collected on day 5, and survival rates and body weights were recorded daily for 7 consecutive days Figure 5(A). Survival results showed a 0% survival rate in the virus-infected group within 6 d.p.i, while the LNP@NP-PROTAC#4 group maintained approximately 40% survival Figure 5(B). This not only validates the lethality of the infection model but also confirms the protective activity of LNP@NP-PROTAC#4 against the lethal viral challenge. Notably, all infected mice exhibited a sharp decline in body weight at 5 d.p.i, with the rate of decline gradually slowing after treatment with LNP@NP-PROTAC#4 Figure 5(C).

Figure 5.

Therapeutic efficacy of LNP@NP-PROTAC#4 in vivo. (A) Schematic for evaluating therapeutic efficacy in the lethal mouse model of influenza. (B) The survival curves of mice in three groups (control, H1N1 and H1N1+LNP@NP-PROTAC#4) post-infection (n = 5/group). (C) Body weight changes of mice in the three groups over 7 days post-infection (n = 5/group). (D) Representative images of mouse lungs in each group. (E) H&E staining images of lung tissues. (F) The viral titer and relative NP mRNA expression of lung tissues. (G) Western blot analysis of NP protein levels in lung tissues. Data are expressed as mean ± SD of three independent experiments. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001.

Histopathological examination revealed dark, consolidated lung tissue in mice infected with the virus alone, whereas lung tissue from mice treated with LNP@NP-PROTAC#4 resembled that of healthy controls. Histopathological analysis further confirmed extensive inflammatory cell infiltration, alveolar collapse, and parenchymal damage in the virus-infected group. Conversely, pathological changes were minimal in the LNP@NP-PROTAC#4 group Figure 5(D,E). Collectively, these data indicate that LNP@NP-PROTAC#4 alleviates virus-induced lung injury.

Viral replication levels were assessed through viral titers, mRNA expression and NP protein abundance in lung tissues. Results demonstrated that viral titers and NP mRNA expression were significantly reduced in the LNP@NP-PROTAC#4 group compared to the virus-infected group Figure 5(F). Western blot analysis further confirmed that LNP@NP-PROTAC#4 treatment significantly decreased NP protein levels Figure 5(G). Taken together, these findings suggest that LNP@NP-PROTAC#4 can protect mice from H1N1 influenza virus infection in vivo, demonstrating potential for developing novel anti-influenza therapies.

Discussion

Protein degradation-targeting chimeras (PROTACs) are an emerging pharmaceutical strategy. Expanding evidence suggests that PROTACs demonstrate promising antiviral efficacy against viruses, such as severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) [41], human immunodeficiency virus 1 (HIV-1) [42], and hepatitis B/C virus [30,43]. In this study, we designed PROTACs targeting NP protein of influenza A virus, a highly conserved viral protein for which no targeted therapeutics drugs are available. In the design of PROTAC molecules, the in vitro screening of aptamers with high affinity and specificity for binding target proteins offers a highly promising approach for acting on traditionally “undruggable” viral targets [44]. Thus, we have synthesized two aptamers targeting NP that have been reported previously [28,29]. The CRBN and VHL ligands are the two most commonly used classes of E3 ligase ligands. Moreover, an increasing number of E3 ligases are being reported for the precise degradation of specific target proteins [45]. Previous studies have found that the linker between the target protein ligand and the E3 ligase ligand may influence the degradation efficiency of PROTAC molecules by affecting their conformation [46]. We coupled alkyne-modified E3 ligase ligands with azide-modified aptamers using linkers of various lengths via click chemistry reactions. The core reaction of click chemistry is the copper-catalyzed azide-alkyne cycloaddition (CuAAC), which has been extensively demonstrated in numerous studies [47,48]. Based on this, we synthesized 44 PROTAC molecules, which were confirmed by native-PAGE and UV spectroscopy. Further preliminary antiviral drug screening was conducted using the PR8-GFP influenza virus, leading to the identification of the highly effective PROTAC molecule NP-PROTAC#4. Among the synthesized library, NP-PROTAC#4 emerged as the most potent degrader. This highlights the critical role of linker design in PROTAC efficacy. NP-PROTAC#4 incorporates a 4-carbon (C4) alkyl linker connecting the aptamer to a pomalidomide-based CRBN ligand. We hypothesize that this specific C4 linker provides the optimal spatial distance and structural rigidity required to bridge the viral NP protein and the CRBN E3 ligase. Linkers that are too short may cause steric clashes between the two proteins, while overly long or highly flexible PEG linkers can incur a high entropic penalty, hindering ternary complex formation [49]. The optimal geometry of NP-PROTAC#4 likely promotes favorable protein-protein interactions within the ternary complex, leading to highly efficient polyubiquitination and subsequent degradation of the target protein. Therefore, aptamer-based PROTACs targeting NP have been successfully synthesized, and candidate compound NP-PROTAC#4 was efficiently identified through the Direct-to-Biology (D2B) platform.

The mechanism of PROTACs is to use the ubiquitin-proteasome system to ubiquitinate and degrade the target protein [50]. Previous studies have demonstrated that multiple E3 ligases, including CNOT4, TRIM14 and TRIM41, catalyze the ubiquitination of the NP protein [51–53]. This suggests that PROTACs can be engineered using specific E3 ligase ligands to efficiently degrade target proteins. Traditional small-molecule antivirals, such as the neuraminidase inhibitor oseltamivir or the endonuclease inhibitor baloxavir marboxil, primarily rely on an occupancy-driven pharmacological mechanism [54]. This continuous active-site inhibition renders them inherently susceptible to the rapid emergence of drug-resistant viral mutations. In contrast, the PROTAC system operates through an event-driven, catalytic degradation mechanism, mediating the complete destruction of intracellular viral nucleoprotein rather than transiently blocking its activity [55]. Furthermore, while neutralizing monoclonal antibodies are largely confined to extracellular viral surface antigens, aptamer-based PROTACs can efficiently penetrate host cell membranes to eliminate critical intracellular viral components [56]. Finally, compared to conventional peptide- or small-molecule-based PROTACs, nucleic acid aptamers as targeting ligands offer superior structural programmability, cost-effective chemical synthesis, lower immunogenicity, and exceptional specificity [57]. Collectively, these features position the aptamer-based targeted degradation platform as a potent and modular alternative to existing antiviral therapeutics. In this study, the aptamer module in NP-PROTAC#4 specifically recognizes and binds to the NP protein of IAV. Simultaneously, the E3 ubiquitin ligase ligand attached to its other end recruits the host ubiquitin-proteasome system, thereby specifically ubiquitinating the NP protein and facilitating its degradation. Because NP serves as the structural core of the viral ribonucleoprotein complex (vRNP) and an essential replication protein, its clearance directly disassembles the vRNP, irreversibly blocking transcription and replication [58,59]. Together, our results demonstrate that NP-PROTAC#4, an efficient degrader of NP, exerts its antiviral effects by targeting and degrading NP protein via the ubiquitin-proteasome system.

Lipid nanoparticles (LNPs) represent the most mature and efficient nucleic acid drug delivery platform currently available [60,61]. Their core advantage lies in effectively overcoming key in vivo bottlenecks faced by nucleic acid molecules, including membrane permeability barriers, serum nuclease degradation, and nonspecific distribution [62]. In this study, we successfully encapsulated NP-PROTAC efficiently within the LNP core using microfluidic mixing technology, yielding a nanoparticle formulation with uniform particle size, high encapsulation efficiency, and excellent stability. Moreover, several studies demonstrated that intratracheal instillation ensures precise drug delivery to the lungs [25,34]. Thus, we employed intratracheal instillation for administration, enabling NP-PROTAC to achieve more efficient degradation and sustained inhibition of viral target. Together, these data confirm that NP-PROTAC#4 exhibits potent antiviral activity in vitro and in vivo. These results not only validate a novel antiviral strategy but also establish a versatile nanotherapeutic platform that synergistically combines efficient delivery, precise targeting, and potent protein degradation capabilities.

In summary, we developed an aptamer-based degradation strategy for anti-influenza therapy. Our findings demonstrated that NP-PROTAC#4 precisely targets and degrades the nucleoprotein of influenza A virus via ubiquitin-proteasome pathway. It exhibits potent antiviral activity in both cellular and animal models, coupled with favorable safety profiles. Collectively, these findings provide a versatile and expandable paradigm for the treatment of viral infectious diseases.

Funding Statement

This study was supported by the Prevention and Control of Emerging and Major Infectious Diseases-National Science and Technology Major Project [2026ZD01999610], Major Project of Guangzhou National Laboratory [GZNL2024A01016 and GZNL2025C01015] and Guangdong Special Support Plan on Young Topnotch Talents [2024TQ08A676].

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

The data that support the findings of this study are openly available in Science Data Bank at: Weiqiang Li, Yong Ju, Yaoyao Gao, et al. (2026). Experimental dataset of targeted degradation of Influenza A virus nucleoprotein via aptamer-based PROTACs for antiviral therapy. V6. Science Data Bank. https://doi.org/10.57760/sciencedb.30781 [63].

Open scholarship

This article has earned the Center for Open Science badge for Open Data. The data are openly accessible at https://hdl.handle.net/2268/315487

Supplemental data

Supplemental data for this article can be accessed online at https://doi.org/10.1080/21505594.2026.2721813