ArlR regulates environmental stress tolerance and biofilm formation in foodborne Staphylococcusaureus

Abstract

Staphylococcus aureus (S. aureus) is a major Gram-positive pathogen capable of sensing and responding to diverse host- and environment-derived stresses, contributing to both clinical infections and foodborne illnesses. This exceptional stress tolerance is primarily mediated by intricate regulatory networks. Although the ArlRS two-component system is known to regulate autolysis, capsule synthesis, and virulence, the specific role of ArlR in environmental stress adaptation remains poorly understood. In this study, we demonstrate that deletion of arlR significantly reduces the tolerance of the foodborne strain RMSA49 to acetic acid, desiccation, whereas its responses to temperature and osmotic stress not affected. Notably, the arlR mutant also exhibits significantly enhanced biofilm formation. Transcriptomic analysis, validated by RT–qPCR, further reveals that ArlR regulates a broad set of stress- and biofilms-associated genes, highlighting its central role in coordinating environmental adaptation. These findings establish ArlR as a key regulator of environmental stress adaptation in foodborne S. aureus RMSA49 and suggest its potential as a target for controlling S. aureus.

Graphical abstract

Highlights

• •ArlR enhances the tolerance of foodborne S. aureus to environmental stresses.
• •ArlR mutant enhances the biofilm formation capacity of foodborne S. aureus.
• •ArlR regulates the stress tolerance of S. aureus through pathways independent of biofilms.
• •The expression levels of multiple genes stress-related are regulated by ArlR.

1. Introduction

Staphylococcus aureus (S. aureus) is a major human pathogen that colonizes diverse host niches and causes diseases ranging from skin and soft-tissue infections to life-threatening conditions such as endocarditis and bacteremia (Xue et al., 2011; Murdoch et al., 2009). In addition to its role in clinical infections, S. aureus is also a significant foodborne pathogen. Its enterotoxins are responsible for staphylococcal food poisoning (SFP), one of the most prevalent foodborne illnesses globally (Hennekinne et al., 2012; Wendlandt et al., 2013). Food poisoning outbreaks caused by S. aureus occur frequently worldwide, resulting in substantial economic losses and posing serious public health threats. The pronounced pathogenicity of S. aureus is largely attributed to its diverse virulence factors, which can cause systemic infections and foodborne intoxication (Tam and Torres, 2019; Thammavongsa et al., 2015). Bacterial biofilms are structured microbial communities that adhere to surfaces and are embedded within an extracellular polymeric substances (EPS) matrix (Karygianni et al., 2020). The EPS matrix comprises exopolysaccharides, extracellular nucleic acids (eDNA and eRNA), proteins, lipids, and lipoproteins. Within biofilms, bacterial cells engage in cooperative behaviors to optimize nutrient acquisition, withstand environmental stresses, and enhance their tolerance to antimicrobial agents and host immune defenses (Flemming et al., 2016; Koo et al., 2017; Dragos and Kovács, 2017).

Milk is a globally consumed foodstuff that plays a critical role in human nutrition and can be processed into a wide array of dairy products, including milk powder and cheese (Visioli and Strata, 2014). During industrial processing, raw milk undergoes heating, vacuum-drying, and other preservation techniques to extend its shelf life (Liu et al., 2020). Nevertheless, residual S. aureus can survive these procedures and contaminate the final products (Hennekinne et al., 2012). Extensive research has demonstrated that S. aureus exhibits remarkable survival under diverse environmental stresses (Cebrián et al., 2010; Wang et al., 2023). Various molecular regulatory networks work together to regulate the environmental adaptation of foodborne S. aureus. For instance, SigB regulates the synthesis of Staphylococcus aureus pigment to resist radiation stress, and ClpC is essential for survival under various adverse conditions (Pannu et al., 2019; Chatterjee et al., 2005).

Two-component signaling systems represent key regulatory pathways in S. aureus that control virulence-factor expression and mediate stress resistance. A typical two-component system consists of a membrane-bound sensor histidine kinase (HK) and a cognate response regulator (RR). Upon detection of specific environmental stimuli, the histidine kinase transfers a phosphoryl group to the response regulator, triggering downstream transcriptional and physiological responses (Groisman, 2016). The ArlRS two-component system regulates extracellular proteolytic activity, autolysis, and capsule biosynthesis (Fournier and Hooper, 2000; Liang et al., 2005). Moreover, ArlRS plays critical roles in modulating adhesion, endothelial cell damage, and immune evasion (Seidl et al., 2018). Recent studies have shown that ArlRS regulates S. aureus cell aggregation and is essential for biofilm formation in vivo (Burgui et al., 2018). Nevertheless, it remains unclear whether ArlRS contributes to the stress response during food processing.

ArlRS is a critical system for responding to host immune responses and nutritional constraints. Recent studies have shown that the absence of ArlRS leads to increased bacterial susceptibility to calprotectin, which in turn affects their ability to survive and reproduce within the host (Radin et al., 2016). Multiple research groups have observed significant virulence defects in arlRS knockout mutants: In infection models involving vertebrates and invertebrates including skin and soft tissue infections, biofilms on implants, peritonitis, endocarditis, and sepsis ΔarlRS strains exhibited significantly lower colonization capacity, tissue damage potential, and in vivo survival levels compared to wild-type strains (Kwiecinski et al., 2021, 2022; Crosby et al., 2020; Fournier et al., 2001). This underscores the importance of this regulatory system in bacterial adaptation to the host environment and pathogenicity. These findings provide a new perspective on understanding how bacteria evade the host immune system by regulating their own signaling mechanisms.

In this study, we constructed arlR knockout and complementation strains to investigate the role of arlR in S. aureus survival under high-temperature, desiccation, osmotic, and acetic acid stresses. We further evaluated the biofilm-forming capacity of the mutant and employed transcriptomic analysis to explore potential regulatory mechanisms underlying these phenotypes. Our results uncover previously unrecognized functions of ArlR in environmental-stress tolerance and significantly advance the mechanistic understanding of how S. aureus achieves resilience in challenging environments.

2. Materials and method

2.1. Bacterial strain and culture conditions

The strains and plasmids used in this study are summarized in Table 1. Except as noted, S. aureus strains were regularly maintained on TSB 1.5% agar plates or grown aerobically in tryptic soy broth (TSB) at 37°C. Cell growth was monitored by measuring optical density at 600 nm (OD₆₀₀). Ampicillin (Amp) and chloramphenicol (Cm) were employed for plasmid selection and maintenance at final concentrations of 100 μg/mL and 15 μg/mL, respectively.

Table 1.

Strains and plasmids were used in this study.

Strains or plasmids	Description	Reference or source
Strains
E. coli
DH5α	Clone host strain	Invitrogen
S. aureus
RMSA49	S. aureus isolated in milk; MRSA	Wang et al. (2022a)
WT	RMSA49 Wild-type strain	This study
RN4220	8325-4, restriction-negative strain	NARSA
WTΔarlR	RMSA49 arlR-deletion mutant	This study
WT/pLI50	WT with the empty vector pLI50 Ampr, Cmr	This study
WTΔarlR/pLI50	WTΔarlR with the empty vector pLI50 Ampr, Cmr	This study
WTΔarlR/pCarlR	WTΔarlR with the complement plasmid pCarlR Ampr, Cmr	This study
Plasmids
pBTs	Shuttle vector, temp sensitive, Ampr Cmr	Hu et al. (2015)
pBT-arlR	pBTs derivative, for arlR mutagenesis; Ampr, Cmr	This study
pLI50	Shuttle vector, Ampr, Cmr	Novagen
pCarlR	pLI50 with arlR	This study

Amp^r, ampicillin-resistant; Cm^r, chloramphenicol-resistant.

2.2. Construction of the arlR mutant and complement strain

According to previously reported protocols, arlR was deleted using the shuttle plasmid pBTs via homologous recombination (Hu et al., 2015). Upstream and downstream fragments of arlR were amplified from the RMSA49 genome using primers arlR-up-kpnⅠ-F/arlR-up-R and arlR-down-F/arlR-down-SalⅠ-R. The upstream and downstream fragments were subsequently fused via overlapping PCR using primers arlR-up-F-kpnⅠ and arlR-down-R-SalⅠ. The resulting product was digested with KpnⅠ/SalI and ligated into the pBTs plasmid using T4 DNA ligase. For plasmid modification, the constructed pBT-arlR plasmid was initially introduced into strain RN4220, and subsequently transferred into RMSA49. Allelic replacement mutants were selected and further verified by PCR and DNA sequencing.

To generate the complementation strain, the arlR gene along with its native promoter was amplified from the RMSA49 genome using primers pCarlR-F and pCarlR-R, cloned into the pLI50 plasmid, propagated in RN4220, and subsequently transformed into the ΔarlR strain to yield ΔarlR/pCarlR. All primers constructed used in this study are listed in Table 2.

Table 2.

Primers for this study.

Primer name	Oligonucleotide (5′-3′)	Reference or source
arlR-up-kpnI-F	GGGGGTACCTAAAGTGTCGTAAGGGTT	This study
arlR-up-R	CAACGCCACGCTTGCTAAGTTTTGTTCAT
arlR-down-F	CTTAGCAAGCGTGGCGTTGGGTATGTGAT	This study
arlR-down-SalI-R	GGGGTCGACTTCTTCTAATACTGCTGGGT
Check-pBT-F	TCACCGACAAACAACAGA	Hu et al. (2015)
Check-pBT-R	CCAAGCCTATGCCTACA
Check-arlR-F	ACAGAATGCCATTAACTGAT	This study
Check-arlR-R	TAACAAGCTATACCCTTTGA
pCarlR-F	GAATTCGAGCTCGGTACCTATTGCGGTAAGGCCTTG	This study
pCarlR-R	TTGCATGCCTGCAGGTCGACTCATCGTATCACATACC
pLI50-F	CCTGACGTCTAAGAAACCAT	This study
pLI50-R	CGATAACCACATAACAGTCA
RT-hu-F	AAAGAAGCTGGTTCAGCAGTAG	Valihrach and Demnerova (2012)
RT-hu-R	TTTACGTGCAGCACGTTCAC
RT-icaA-F	CGGGTGTCTTCACTCTAT	This study
RT-icaA-R	GACCTCCCAATGTTTCTG
RT-icaB-F	GGGTTTATTATCACAGGTCA	This study
RT-icaB-R	GTTATGCAAATCGTGGGTAT	This study
RT-icaC-F	GCGTTAGCAAATGGAGAC	This study
RT-icaC-R	AAATGCGTGCAAATACCC
RT-icaD-F	ACAGAGGGAATACCCAACGC	This study
RT-icaD-R	CGAAAATGCCCATAGTTTCA
RT-narH-F	AACGATGCCGATGGTTTGGT	This study
RT-narH-R	ATGGCTGTTGAGTAACTTGAGA	This study
RT-pflA-F	TTAGGCTTTCCTGTCAATCT	This study
RT-pflA-R	GTGTAACAGTCAGTGGTGGC	This study
RT-gmpI-F	ATTGTCGGCTCAAGCATACC	This study
RT-gmpI-R	GTGGTGGACGTAACGAGGAA	This study
RT-lrgA-F	GAGCTTGTGCCTCCTCTATT	This study
RT-lrgA-R	TAACATTGGCTTACTCTTCG	This study
RT-gltB-F	CGATACCTGGCGTTGACCCT	This study
RT-gltB-R	TCGATTTCAGCGGAAGCACA	This study
RT-capA-F	AGTTAAAGTCGCACCAAA	This study
RT-capA-R	GAACCCAATACAGGCAAT	This study
RT-MgrA-F	AAGTACAATCTAACATACCCAC	This study
RT-MgrA-R	CTACTTGTTCCATTCGTTTT	This study
RT-norB-F	TTAGTCATTATGCTCCTCAG	This study
RT-norB-R	GATTGATAAACTTCCTGCTT	This study

The sequences underlined refer to the restriction endonuclease recognition sites.

2.3. Growth curves

Overnight S. aureus cultures were diluted into 100 mL of fresh TSB to an initial OD₆₀₀ = 0.03 and incubated at 37°C with shaking. Cell growth was monitored every 2 h by measuring OD₆₀₀ using a UV–visible spectrophotometer (Thermo Scientific, Pittsburgh, PA, USA). All experiments were performed in triplicate.

Overnight cultures were diluted to OD₆₀₀ = 0.03 in fresh TSB containing varying concentrations of NaCl. Bacterial growth was monitored every 2 h to assess viability under osmotic stress conditions.

2.4. Analysis of desiccation stress

S. aureus cultures were grown at 37°C with shaking at 200 rpm overnight, diluted to OD₆₀₀ = 0.03, and further incubated to OD₆₀₀ = 1.0. Fifty microliters of culture were added to 48-well plates and evenly spread, then subjected to desiccation at 37°C for 3, 5, or 7 days. Survival rates were determined by colony-forming unit (CFU) enumeration following 10-fold serial dilution before and after desiccation.

2.5. Acetic acid stress analysis

WT/pLI50, WTΔarlR/pLI50, WTΔarlR/pCarlR was cultured at 37°C, 200 rpm/min, and after overnight incubation. Transfer the overnight cultured bacterial broth to fresh TSB medium, continue shaking until OD₆₀₀ = 1.0, then add acetic acid solution to a final concentration of 0.2 M and treatment for 1 h. Subsequently, perform a 10-fold serial dilution and plating onto TSB plates, and count the CFU.

2.6. Temperature stress analysis

Dilute the overnight cultured test strains into fresh TSB medium to make OD₆₀₀ = 0.03. Continue shaking culture until OD₆₀₀ = 1.0. Then, 50 μL of the bacterial solution is transferred to a 48-well plate and placed in a 63°C incubator for high-temperature treatment. After treating for 15 min and 30 min respectively, it is immediately taken out and placed on ice, followed by dilution and plating onto TSB solid culture medium.

2.7. Biofilm formation analysis

Biofilm formation was quantified as described previously (Shen et al., 2021). Overnight cultures were diluted to OD₆₀₀ = 0.03 in fresh TSB and inoculated into sterile 96-well plates (200 μL/well), then incubated at 37°C for 24 h. After incubation, planktonic cells were removed, and biofilms were stained with 0.2% crystal violet for 30 min, washed with PBS, and dissolved in 33% acetic acid. Absorbance was measured at 492 nm using a microplate reader (Thermo Fisher Scientific, Waltham, MA, USA).

2.8. Evaluation of biofilm formation ability using confocal laser scanning microscopy (CLSM)

Overnight cultures were diluted to OD₆₀₀ = 0.03 and inoculated into 6-well plates containing a coverslip at the bottom (5 mL per well). Plates were incubated at 37°C for 24 h. Planktonic cells were removed, coverslips washed twice with PBS, and biofilms stained with the LIVE/DEAD BacLight Bacterial Viability Kit (Thermo Fisher Scientific). Biofilm formation was subsequently visualized using confocal laser scanning microscopy (ZEISS LSM800).

2.9. RNA extraction and sequencing

RNA extraction and sequencing analysis methods are detailed in our published research (Ma et al., 2025). Briefly, grow each strain in standard TSB medium until OD₆₀₀ reaches 1.5, then collect the cells, and extract total RNA using the Trizol method. Biozeron Biotechnology Co., Ltd. helps us with RNA sequencing and library construction, and provides high-quality reads for sequence analysis and bioinformatics data analysis.

RNA-Seq strand-specific libraries were prepared using the Illumina TruSeq RNA Sample Preparation Kit (San Diego, CA). Following rRNA removal, cDNA synthesis, and end repair, a cDNA library of 200–300 bp was selected and sequenced using the Illumina NovaSeq 6000 (150 bp × 2, Shanghai Biozeron Co., Ltd.).

2.10. RNA isolation, cDNA synthesis and quantitative real-time PCR analysis

Overnight cultures were diluted to OD₆₀₀ = 0.03 in fresh TSB and incubated at 37°C with shaking until mid-exponential phase (OD₆₀₀ = 1.5). Cells were harvested by centrifugation at 12,000 × g for 1 min and resuspended in RNase-free water. Total RNA was extracted using Trizol reagent (Transgen, Beijing, China). cDNA synthesis was performed using the EasyScript One-Step gDNA Removal and cDNA Synthesis SuperMix kit (Transgen, Beijing, China). Quantitative real-time PCR (RT-qPCR) was conducted on a CFX96 Real-Time System (BioRad, California, USA) using TransStart Tip Green qPCR SuperMix (Transgen, Beijing, China), with hu serving as the internal reference gene for normalization. All experiments were performed in triplicate.

2.11. Statistical analysis

All experiments were performed in biological triplicates. Graphing and analysis were performed using GraphPad Prism 8.0 (GraphPad Software Inc., GraphPad Prism 8.0.2, San Diego, CA, USA, 2018). Statistically significant differences calculated by the unpaired two-tailed Student's t-test are indicated: NS, not significant (P > 0.05); *, P < 0.05; **, P < 0.01; ***, P < 0.001.

3. Results

3.1. Deletion of the arlR gene has no effect on the growth of the S. aureus RMSA49

The arlR gene was deleted by homologous recombination to generate an arlR knockout mutant. The strategy for arlR deletion in S. aureus is shown in Fig. 1A. A complementation strain, ΔarlR/pCarlR, was constructed using the pLI50 plasmid. To control for plasmid-associated effects, pLI50 was introduced into both the wild-type (WT) and arlR mutant strains. Successful construction of the mutant and complemented strains was confirmed by PCR (Fig. 1B). Lanes 1–3 correspond to genomic arlR (wild-type, 1279 bp; mutant, 742 bp), whereas lanes 4–6 correspond to plasmid-encoded arlR (empty vector, 280 bp; pCarlR, 1201 bp). These results confirm the successful construction of WT/pLI50, ΔarlR/pLI50, and ΔarlR/pCarlR strains. To evaluate the impact of arlR deletion on S. aureus growth, growth curves were generated for all three strains in TSB supplemented with 15 μg/mL chloramphenicol. As shown in Fig. 1C, all strains exhibited nearly identical growth rates under these conditions. However, previous studies have shown that arlR mutations cause growth defects in a clinical human isolate strain WCUH29 (Liang et al., 2005), which may be due to strain specific factors.

Fig. 1.

Knockout and complementation verification of the arlR gene and its growth curve measurement. (A) arlR Gene knockout schematic. (B) Lane 1 is the wild-type arlR gene verification, lanes 2 and 3 are the genomic arlR gene verifications of mutant and complemented strains. Lanes 4 and 5 are the pLI50 plasmid verifications of wild-type and mutant strains, and lane 6 is the verification of the pCarlR plasmid. (C) WT/pLI50, ΔarlR/pLI50, ΔarlR/pCarlR growth curve measurement.

3.2. The arlR mutation reduces the survival of S. aureus under acetic acid stress

Given the widespread use of organic acids in food processing, we evaluated the response of S. aureus to acetic acid–induced stress. Before acetic acid exposure, WT/pLI50, ΔarlR/pLI50, and ΔarlR/pCarlR exhibited comparable growth profiles and CFU counts (Fig. 2A–B). After exposure to 0.2 M acetic acid for 1 h, the ΔarlR/pLI50 mutant showed a significant reduction in CFU compared with WT/pLI50, whereas genetic complementation with pCarlR restored survival to wild-type levels (Fig. 2C).

Fig. 2.

Analysis of acetic acid stress. (A) Dilution plating map when the WT/pLI50, ΔarlR/pLI50, ΔarlR/pCarlR strain OD₆₀₀ = 1.0. (B) Number of live bacteria at OD₆₀₀ = 1.0. (C) Number of live bacteria after 1h of acetic acid stress. *, P < 0.05, **, P < 0.01, ***, P < 0.001.

3.3. The arlR mutation don't affect the survival of S. aureus under temperature stress

During food processing and storage, S. aureus encounters high- and low-temperature conditions. To evaluate the role of arlR in temperature stress response, WT/pLI50, ΔarlR/pLI50, and ΔarlR/pCarlR strains were exposed to 63°C for 15 or 30 min. No significantly difference in survival was observed among the strains (Fig. 3A), suggesting that arlR is not essential for heat tolerance. In contrast, after 24h of incubation at −20°C or −80°C, the viable counts of the ΔarlR/pLI50 strain were significantly lower than those of WT/pLI50 (Fig. 3B). However, the complemented strain failed to restore wild-type survival, what makes it unclear if the observed effect is real, or if it is just an experimental artifact. Therefore, this study indicates that ArlR potentially affects the cold tolerance of S. aureus, and this finding requires further verification.

Fig. 3.

Analysis of temperature stress. (A) The Number of live bacteria after treatment at 63°C for 15 and 30 min, respectively. (B) Number of live bacteria after treatment at −20°C and −80°C for 24h, respectively. *, P < 0.05, **, P < 0.01, ***, P < 0.001.

3.4. The arlR mutation reduces desiccation tolerance of S. aureus

Desiccation is widely used method for long-term food preservation, highlighting the importance of elucidating the role of arlR in S. aureus desiccation tolerance. Prior to desiccation, all strains exhibited comparable survival rates (Fig. 4A). However, following 3, 5, and 7 days of desiccation, ΔarlR/pLI50 exhibited a significant decrease in viability compared with WT/pLI50 (Fig. 4B–D), indicating that arlR is essential for desiccation resistance in S. aureus.

Fig. 4.

Analysis of desiccation stress. (A) The number of live bacteria before of desiccation stress. (B) The number of live bacteria after 3 days of desiccation stress. (C) The number of live bacteria after 5 days of desiccation stress. (D) The number of live bacteria after 7 days of desiccation stress. *, P < 0.05, **, P < 0.01, ***, P < 0.001.

3.5. The arlR mutation does not affect osmotic stress tolerance in S. aureus

To investigate the role of arlR in osmotic stress tolerance, the growth of WT/pLI50, ΔarlR/pLI50, and ΔarlR/pCarlR strains were assessed under varying NaCl concentrations. WT growth was comparable in 5% NaCl and TSB, severely impaired in 15% NaCl, and completely inhibited in 20% NaCl (Fig. 5A). Based on these results, 10% NaCl was selected as the optimal concentration to evaluate the contribution of arlR to osmotic stress tolerance. Under this condition, all three strains showed similar growth profiles (Fig. 5B), indicating that arlR is not essential for osmotic stress tolerance in S. aureus.

Fig. 5.

Analysis of osmotic stress. (A) Growth of WT under different concentrations of NaCl. (B) Growth of WT/pLI50, ΔarlR/pLI50, ΔarlR/pCarlR in a 10% NaCl.

3.6. The arlR mutation enhances the biofilm formation in S. aureus

To explore the role of ArlR in biofilm formation of the milk-derived strain RMSA49, we performed crystal violet staining (CVS) to evaluate biofilm production in the WT/pLI50, ΔarlR/pLI50 and ΔarlR/pCarlR strains. Biofilm biomass in 96-well plates was quantified by measuring the absorbance at OD₄₉₂ following crystal violet staining (Fig. 6A and B). The ΔarlR/pLI50 mutant exhibited significantly enhanced biofilm formation compared to both WT/pLI50 and ΔarlR/pCarlR. Consistent with this, CLSM analysis further revealed that the arlR mutant formed a denser biofilm than the control strains (Fig. 6C). This indicates that ArlR negatively regulates biofilm formation in the S. aureus strain RMSA49, consistent with the findings that the arlR mutation in the NCTC8325 strain enhances the biofilm-forming ability of S. aureus (Jin et al., 2019).

Fig. 6.

Analysis of biofilm formation ability of WT/pLI50, ΔarlR/pLI50, ΔarlR/pCarlR strains. (A) CV staining of biofilms in a 96-well plate. (B) After staining with CV and dissolving in 33% glacial acetic acid, the biomass was measured at 492 nm. (C) Image of S. aureus biofilm by CLSM. *, P < 0.05, **, P < 0.01, ***, P < 0.001.

3.7. Transcriptome sequencing analysis

To elucidate the mechanisms by which ArlR mediates environmental stress responses and biofilm formation, transcriptomic profiles of RMSA49 and the arlR mutant were compared. RNA-seq quantified expression levels for 2316 genes, among which 213 (Table S1) were differentially expressed in the mutant 146 upregulated and 67 downregulated (Fig. 7A). Functional annotation via GO and KEGG analysis revealed enrichment of DEGs in cellular processes, metabolic processes, catalytic activity, and response to stimuli (Fig. 7B), In addition, DEGs were significantly enriched in pathways associated with quorum sensing, amino acid biosynthesis, microbial metabolism in diverse environments, and general metabolic pathways (Fig. 7C).

Fig. 7.

Transcriptome analysis and RT-qPCR validation. (A) Volcano Plots of DEGs. The red dots represent up-regulated DEGs, the blue dots represent down-regulated DEGs. (B) GO enrichment analysis of significant DEGs. (C) KEGG enrichment analysis of significant DEGs. (D) Analysis of transcription levels of genes related to environmental stress. (E) Analysis of transcription levels of genes related to biofilm. *, P < 0.05, **, P < 0.01, ***, P < 0.001.

Among the DEGs, several stress-related genes were further validated by RT-qPCR. Consistent with the sequencing data (Table 3), the expression of the genes gltB and lrgA (Wen et al., 2025; Xu et al., 2024) was significantly upregulated in the arlR mutant. In contrast, the expression of cap, mgrA, pflA, norB, narH and gmpI (Wang et al., 2022b, 2023; Chen et al., 2021; McCaughey et al., 2013), which are involved in stress responses including pH and temperature tolerance, was markedly downregulated (Fig. 7E). These findings suggest that ArlR modulates the environmental stress tolerance of S. aureus RMSA49 via regulating the transcription of the above-mentioned genes.

Table 3.

Key DEGs associated with biofilm formation and environmental stress tolerance in the arlR mutant of S. aureus RMSA49 relative to the WT strain.

Gene ID	Name	Product	Fold Change
NLG45_09965	icaA	poly-beta-1,6 N-acetyl-D-glucosamine synthase IcaA	17.1
NLG45_09955	icaB	intercellular adhesin biosynthesis polysaccharide N-deacetylase	7.5
NLG45_09950	icaC	polysaccharide intercellular adhesin biosynthesis/export protein IcaC	8.0
NLG45_09960	icaD	intracellular adhesion protein IcaD	6.1
NLG45_07195	gltB	glutamate synthase large subunit	7.5
NLG45_09195	capA	capsular polysaccharide type 5/8 biosynthesis protein	−51.9
NLG45_05940	mgrA	HTH-type transcriptional regulator MgrA	−2.6
NLG45_08600	lrgA	antiholin-like murein hydrolase modulator LrgA	3.0
NLG45_11405	narH	nitrate reductase subunit beta	−2.8
NLG45_05470	gpmI	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	−3.0
NLG45_08805	pflA	pyruvate formate-lyase-activating protein	−2.5
NLG45_02125	norB	multidrug efflux MFS transporter	−5.9

Furthermore, transcriptomic analysis revealed that the icaABCD operon, which encodes EPS and is essential for biofilm formation, was markedly upregulated in the arlR mutant. To validate this finding, we further quantified the transcriptional levels of the icaABCD operon using RT-qPCR. Consistent wWang et al., 2022b, 2023ith the transcriptomic data, expression of icaABCD was significantly elevated in the arlR mutant (Fig. 7D). Collectively, these results indicate that arlR likely modulates biofilm formation in S. aureus by regulating the ica operon. The raw RNA-seq data have been deposited in the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus database under the SRA accession number PRJNA1469966 (https://www.ncbi.nlm.nih.gov/sra/PRJNA1469966).

4. Discussion

The ArlRS two-component system is a conserved regulatory pathway in S. aureus that contributes to diverse physiological and pathogenic processes, including autolysis, biofilm development, virulence regulation, and adaptation to host-associated stresses (Fournier and Hooper, 2000; Toledo-Arana et al., 2005). Previous studies demonstrated that ArlRS is activated during manganese starvation induced by calprotectin or depletion of glycolytic substrates, enabling S. aureus to coordinate metabolic adaptation and resistance to nutritional immunity (Solórzano et al., 2019). In addition, pyruvate-mediated activation of ArlRS promotes the production of pore-forming leukocidins and enhances bacterial virulence (Harper et al., 2018). These findings establish ArlRS as an important regulator of bacterial adaptation; however, its contribution to survival under food processing associated environmental stresses remains incompletely understood.

In the present study, deletion of arlR significantly impaired survival under desiccation and acid stress, whereas no significant effects were observed under heat or osmotic stress conditions. These findings suggest that ArlR does not function as a universal stress regulator but instead contributes selectively to specific environmental adaptation pathways. Desiccation is one of the most important stresses encountered by S. aureus in food-processing environments (Burgess et al., 2016). Previous studies have shown that capsular polysaccharide synthesis contributes to bacterial persistence during drying conditions (Wang et al., 2022b). Consistent with this observation, transcriptomic analysis revealed reduced expression of the cap operon in the arlR mutant, providing a potential mechanistic explanation for its decreased desiccation tolerance. Similarly, the decrease in survival rate observed in the acid stress experiment may be related to downregulation of norB expression; norB encodes a multidrug efflux pump that plays a crucial role in adaptation to acidic environments (Beetham et al., 2024a; Truong-Bolduc et al., 2011). These results indicate that ArlR promotes environmental fitness by regulating genes involved in protection against specific food associated stresses.

Transcriptomic profiling identified 213 differentially expressed genes in the arlR mutant, highlighting the broad regulatory influence of ArlR. Previous transcriptomic studies on the ArlRS regulatory network have reported varying scales of transcriptional changes: the ArlRS mutation in the USA300 strain resulted in 250 differentially expressed genes (Crosby et al., 2020), while the arlR mutation in the WCUH29 strain led to significant changes in the expression levels of 114 genes (Liang et al., 2005). Notably, Párraga Solórzano et al. detected 614 differentially expressed genes in the Newman strain when the arlRS pathway was activated by glucose deprivation (Párraga Solórzano et al., 2023), suggesting that strain background and environmental conditions have a significant impact on the ArlRS regulatory network. Transcriptomic data from this study show that following arlR mutation, a large number of metabolism-related genes exhibited significant differential expression, with the most pronounced downregulation observed in genes associated with carbohydrate metabolism, amino acid metabolism, and metal homeostasis. In conjunction with the findings of Crosby et al. (2020), ArlRS can indirectly influence the pathogen's uptake of key metal ions such as manganese and iron by downregulating the expression of genes associated with metal transport systems. Meanwhile, Párraga-Solórzano et al. (Párraga Solórzano et al., 2023) found that ArlRS regulation of fdaB is glucose-dependent; arlR knockout leads to a significant downregulation of fdaB expression only in the presence of glucose. This finding is highly consistent with the culture conditions used in the transcriptomic analysis of this study, further validating the environmental dependence of ArlRS-mediated coupled regulation of carbohydrate metabolism and metal homeostasis. This study identified 213 ArlRS-regulated genes in the foodborne strain RMSA49. This number falls within the range reported in previous studies. Despite these differences, comparison with published datasets revealed a conserved core set of ArlRS-regulated genes, including components of the agr quorum-sensing system, autolysis-associated genes, capsular polysaccharide biosynthesis genes, urease genes, and the global regulator mgrA (Table S1).

Among the differentially expressed genes identified in this study, mgrA is of particular interest because it represents a well-established direct target of ArlR. Previous studies demonstrated that ArlR binds directly to the mgrA promoter (Crosby et al., 2020) and activates its transcription. MgrA functions as a global regulator controlling virulence, autolysis, surface protein expression, and biofilm development (Li et al., 2019; Lei and Lee, 2021). Consistent with these observations, mgrA expression was significantly reduced in the arlR mutant, suggesting that part of the stress-adaptation phenotype observed in this study may be mediated through the ArlR–MgrA regulatory axis. In addition, altered expression of cap associated genes(Wang et al., 2022b) and norB (Beetham et al., 2024b) further supports the hypothesis that ArlR promotes environmental adaptation through coordinated regulation of multiple downstream pathways rather than through a single stress-response mechanism.

Biofilms represent a critical defense strategy, providing structural protection via extracellular matrix secretion (Yin et al., 2019). Biofilm formation is a key determinant for the persistent infections, immune evasion, and enhanced antibiotic resistance of S. aureus. As a physical protective barrier, biofilm also impedes the penetration of antimicrobial agents, weakens drug effectiveness, and thereby complicates clinical anti-infection therapies (Brandquist and Kielian, 2025; Lister and Horswill, 2014). Previous studies have demonstrated that mutation of arlR markedly attenuates the virulence of S. aureus but dramatically strengthens its biofilm-forming capacity (Crosby et al., 2020; Ouyang et al., 2019), indicating that ArlR modulates staphylococcal virulence in a biofilm-independent manner. This observation is consistent with our findings in the foodborne strain RMSA49. Although biofilm formation is generally associated with enhanced environmental stress tolerance (Guldimann et al., 2016), the RMSA49 arlR mutant displays increased biofilm formation yet reduced stress tolerance. Therefore, for RMSA49, environmental adaptability depends more on physiological processes regulated by ArlR than on the formation of a biofilm alone.

This study still has limitations. Although transcriptomic analysis identified a large number of potential genes regulated by ArlRS, their direct regulatory relationships have not yet been validated through experiments such as EMSA. Some pathways regulated by ArlR have been reported, such as the control of S. aureus agglutination and pathogenesis through regulation of the gene encoding the surface protein ebh (Walker et al., 2013), the cascade regulation of virulence via MgrA (Crosby et al., 2020), and the modulation of the glycosylation pattern of cell wall-anchored glycopolymers wall teichoic acids (Kuijk et al., 2025), these studies have focused on infection-related regulatory pathways within the host, and much remains unknown about the mechanisms by which ArlR senses environmental signals and responds to them. In the future, it will be necessary to systematically elucidate the ArlRS regulatory network and its signal transduction mechanisms using a combination of molecular biology, biochemical analysis, and genetic methods.

In summary, this study has expanded our understanding of the functions of ArlRS, contributes to a deeper understanding of S. aureus's adaptation to stress, and provides a strategic basis for controlling the survival of the bacterium in food and clinical settings.

CRediT authorship contribution statement

Kai Ma: Data curation, Formal analysis, Writing – original draft, conceived and designed the study. Bingtao Zhang: Methodology, Software, Data curation. Xiayang Zhang: Writing – review & editing, Methodology. Ying Yang: Data curation, Investigation. Qing Xu: Software, Formal analysis. Ting Xue: Conceptualization, Writing-review & editing, Supervision, Funding acquisition.

Declaration of competing interests

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A. Supplementary data

The following is the Supplementary data to this article: