Skip to main content
NCBI home page
BMC Oral Health logoLink to BMC Oral Health
. 2026 Jul 1;26:1761. doi: 10.1186/s12903-026-09084-x

Altered peripheral blood mRNA and salivary biomarkers in dental anxiety: a cross-sectional study

Liu Wenlong 1,#, Tao Huai 2,#, Wang Shichen 3, Liu Chao 1, Hou Xianggang 4, Zhu Hongshuang 4, Duan Yige 1, Bai Minghai 1,4,✉, Liu Yong 3
PMCID: PMC13587487  PMID: 42381001

Abstract

Introduction

Previous studies indicate that dental anxiety (DA) is associated with increased salivary cortisol and alpha-amylase, biomarkers of hypothalamic–pituitary–adrenal (HPA) axis and sympathetic–adrenal–medullary (SAM) activation. However, underlying molecular mechanisms remain unclear. This study aimed to explore whether peripheral blood mRNA expression levels of glucocorticoid receptor (GR), GR transcripts containing exons 1B (GR-1B), glutamate ionotropic receptor AMPA type subunit 1 (GRIA1), oxytocin (OT), oxytocin receptor (OTR), and Poly ADP-Ribose Polymerase 1 (PARP1), together with salivary cortisol and alpha-amylase levels, are associated with dental anxiety.

Methods

In this cross-sectional study, a total of 30 DA patients and 28 non-DA patients were included. The mRNA expression levels of GR, GR-1B, GRIA1, OT, OTR, and PARP1 in peripheral blood were determined by real-time quantitative polymerase chain reaction. Salivary cortisol and alpha-amylase concentrations were determined by enzyme-linked immunosorbent assay.

Results

The expression levels of GR-1B mRNA were significantly higher in the DA group than in the non-DA group, whereas GRIA1 and OT mRNA expression levels were lower in the DA group. Concurrently, salivary cortisol and alpha-amylase levels were significantly higher in the DA group.

Conclusion

Dental anxiety may be associated with altered stress-related molecular expression and salivary biomarkers. These findings provide preliminary evidence of peripheral molecular and salivary changes associated with dental anxiety and may contribute to understanding its biological correlates.

Keywords: Dental anxiety, The Modified Dental Anxiety Scale (MDAS), GR-1B, GRIA1, OT, Cortisol, Alpha-amylase

Introduction

Dental anxiety (DA) refers to varying degrees of fear and nervousness related to dental diagnosis and treatment or specific aspects of these procedures [1]. Physiologically, patients may exhibit increased respiratory rate, heart rate, and sweating while waiting for dental treatment. Behaviorally, dental anxiety may manifest as avoidance-related behaviors, such as crying, refusal to open the mouth, interference with the dentist’s operation, delayed attendance, or interruption of treatment. Dental anxiety and dental phobia (DP) are closely related concepts and are often used interchangeably in the literature [2, 3], although important differences exist. Dental anxiety is a specific stress response to oral treatment in which the object of anxiety is unclear, ambiguous, or absent [4], whereas dental phobia is characterized by an extreme and persistent fear of a definite object or treatment process in the dental environment, leading individuals to avoid going to the dentist unless oral health concerns become urgent [5–7]. Patients who avoid treatment may miss the optimal treatment window and may ultimately require more complex, time-consuming, and costly interventions [8]. Therefore, early identification of dental anxiety before treatment is of clear clinical importance.

The body’s physiological response to stress involves two major systems: the hypothalamic-pituitary-adrenal axis (HPA) and the sympathetic-adrenal medulla (SAM) system [9–11]. Activation of the HPA axis in a state of stress can lead to an increase in glucocorticoids, which have anti-inflammatory, vasodilating effects and help the organism resist life-threatening challenges. The glucocorticoid receptor GR is one of the possible mediators of the maladaptive stress response, which binds cortisol, the principal glucocorticoid of the HPA axis [12]. GR gene polymorphisms have been shown to affect HPA-axis stress reactivity [13, 14]. GR-1B is a subtype of GR mRNA containing exon 1B. GRIA1 encodes the GluA1 subunit of α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors, which play an important role in glutamatergic neurotransmission. Based on its role in neural signaling, GRIA1 was included in this study as an exploratory candidate gene [15, 16].

Oxytocin is a neuropeptide synthesized by neurons in the posterior hypothalamus that binds to oxytocin receptors (OTR) to exert biological effects and plays an important role in social behavior, parent-child relationships, emotional connections, and sexual behavior. In the psychological realm, oxytocin has anti-stress effects and is involved in the regulation of stress, anxiety, fear, and pain tolerance. Its anti-stress effect is mainly mediated through regulation of the HPA axis. Oxytocin enhances the negative feedback loop of the HPA axis by enhancing corticotropin releasing factor (CRF) induced adrenocorticotropic hormone (ACTH) secretion, reducing the response of the HPA axis to stress. Studies have suggested a role for oxytocin in anxiety regulation [17].

Poly ADP-ribose polymerase 1 (PARP1) is a versatile human ADP-ribosyl transferase that plays a role in DNA repair and cell death, and PARP1 also plays a key role in inflammation, metabolism, tumor development and progression, chromatin modification and transcription, mRNA stability, and alternative splicing. Altered PARP1 expression has been reported in psychiatric and stress-related conditions, suggesting that it may be relevant to peripheral stress-related molecular responses [18]. Beyond genetic markers, stress-responsive biomarkers provide direct physiological insights into anxiety states. Salivary cortisol, the primary HPA axis effector [19, 20], and alpha-amylase, a sensitive indicator of SAM activation [21], are established non-invasive biomarkers for stress quantification. In dental contexts, these biomarkers objectively reflect autonomic responses during anxiety-provoking procedures [22].

Therefore, this study aimed to explore whether peripheral blood mRNA expression levels of GR, GR-1B, GRIA1, OT, OTR, and PARP1, together with salivary cortisol and alpha-amylase levels, are associated with dental anxiety.

Materials and methods

Subjects

This was a cross-sectional study. Orthodontic patients seeking treatment in the Orthodontic Department of the Stomatology Hospital Affiliated to Hunan University of Chinese Medicine from July 2021 to March 2023 were invited to complete a general information questionnaire and the Modified Dental Anxiety Scale (MDAS) before treatment [23]. Unified instructions were provided, and explanations were given when necessary. All questionnaires were completed by the patients themselves. Questionnaires with missing information were excluded, as were patients with recent use of anti-anxiety drugs or sedatives. All patients provided written informed consent prior to participation. Patients were excluded if they met one or more of the following criteria: co-existing psychiatric disorders, blood disorders, or use of anti-anxiety medications, sedatives, or analgesics within 1 week before the study. Participants were divided into DA and non-DA groups based on MDAS scores.

Anxiety assessment

Dental anxiety was assessed using the Modified Dental Anxiety Scale, a previously published and validated instrument [4]. The validated Chinese version was administered [24]. The MDAS consists of five items, each with five response options: “Relaxed” (scored 1), “a little uneasy” (scored 2), “nervous” (scored 3), “afraid or anxious” (scored 4), and “so afraid that I feel physically ill” (scored 5). The total score ranges from 5 to 25. Based on established criteria, participants were categorized as follows: an MDAS score of 5–9 indicated no dental anxiety, an MDAS score ≥ 10 was considered indicative of dental anxiety, and an MDAS score ≥ 19 was considered indicative of high dental anxiety (dental phobia).

RT-qPCR

Peripheral blood samples were collected from participants between 7:00 and 8:00 a.m. before food consumption. Peripheral blood mononuclear cells (PBMCs) were isolated and stored at − 80 °C until RNA extraction. Total RNA was extracted using the MagNA Pure LC Total Nucleic Acid Isolation Kit–High Performance on a MagNA Pure LC2.0 automatic extractor (Roche Diagnostics, Indianapolis, IN, USA), and complementary DNA (cDNA) was synthesized using the Transcriptor First Strand cDNA Synthesis Kit (Roche Applied Science, Penzberg, Germany). The mRNA expression levels of GR, GR-1B, GRIA1, OT, OTR, and PARP1 were quantified by RT-qPCR. Primer sequences are listed in Table 1. RT-qPCR was performed on a Roche LightCycler 480 using LightCycler 480 SYBR Green I Master (Roche). The thermal cycling conditions were 95 °C for 10 min, followed by 40 cycles of 95 °C for 10 s, 60 °C for 10 s, and 72 °C for 20 s. Each sample was analyzed in triplicate, and relative mRNA expression levels were calculated using the 2^-ΔΔCt method with β-actin and GAPDH as internal reference genes.

Table 1.

Primer sequences of the target genes and reference gene

Gene Primer sequences (5’→3’) Amplicon length (bp)
GR F-CAGCTCCTCAACAGCAACAACA 139
R-GTGCTGTCCTTCCACTGCTC
GR-1B F-CCGGGCCCAAATTGATATTCACT 205
R-GTCTTCGCTGCTTGGAGTCTG
GRIA1 F-TGCTTTGTCGCAACTCACAGA 121
R- GGCATAGACTCCTTTGGAGAAC
OT F-GCTGAAACTTGATGGCTCCG 67
R-TTCTGGGGTGGCTATGGG
OTR F-CTGAACATCCCGAGGAACTG 84
R- CTCTGAGCCACTGCAAATGA
PARP1 F-TGGAGAAGATAGAAAAGGGCCAG 247
R-TCGCCTTTTCTCTTTCCTTCAC
Open in a new tab

Salivary biomarker analysis

Saliva samples were collected from participants between 7:00 and 8:00 a.m. after overnight fasting. Before collection, participants were asked to refrain from eating, drinking, tooth brushing, smoking, and chewing gum, and to remain at rest. Unstimulated whole saliva was collected by spitting into sterile tubes before treatment. The samples were then centrifuged at 1000 × g for 15 min at 4 °C, aliquoted, and stored at ≤ − 20 °C until analysis.

Salivary cortisol concentrations were measured using a competitive ELISA kit (R&D Systems, KGE008B), and salivary alpha-amylase concentrations were measured using a sandwich ELISA kit (Novus Biologicals, NBP2-68204), according to the manufacturers’ instructions. Absorbance was measured at 450 nm, and concentrations were calculated using standard curves. All assays were performed in duplicate, and the intra-assay coefficient of variation was < 10%.

Statistical analysis

Statistical analyses were performed using SPSS 26.0 and GraphPad Prism version 8.0. Continuous variables were assessed for normality with the Shapiro-Wilk test; normally distributed data are presented as mean ± standard deviation (SD), whereas non-normally distributed data are presented as median with dispersion measures, including median (Q1, Q3) in tables and median with interquartile range (IQR) in the text. Between-group comparisons used independent samples t-test for normally distributed continuous variables and Mann-Whitney U test for non-normally distributed variables. Categorical variables are reported as frequencies and analyzed using χ² test. Statistical significance was defined as two-sided P < 0.05. In graphical representations, statistical significance is indicated as follows: *p < 0.05; **p < 0.01; ***p < 0.001. To account for multiple comparisons among biomarker outcomes, raw p values were additionally adjusted using the Benjamini–Hochberg false discovery rate (FDR) procedure. FDR-adjusted p values (q values) were reported, with q < 0.05 considered statistically significant.

Sample size estimation

This study was conducted as an exploratory cross-sectional study. Sample size estimation was based on the classical two-sample comparison framework with a two-sided α = 0.05 and target power of 1 − β = 0.80. For two-group comparisons of continuous outcomes, the required sample size per group is given by:

graphic file with name d33e544.gif

where Inline graphic is the standard normal deviate corresponding to the two-sided significance level, Inline graphic is the standard normal deviate corresponding to the target power, and d is the anticipated standardized mean difference (Cohen’s d). Because prior studies in related dental and orthodontic biomarker settings varied substantially in sample size and were heterogeneous in design, population, biomarkers, and outcomes, an exact effect-size estimate for the present study was not available. Therefore, a medium-to-large effect size (d ≈ 0.75) was used as an exploratory assumption for sample size estimation, rather than as an empirically validated effect-size estimate. Under equal allocation, this assumption yielded an estimated sample size of approximately 28–29 participants per group. In practice, 30 DA patients and 28 non-DA patients were enrolled and included in the exploratory analysis.

Results

Demographic characteristics

The demographic and clinical profiles of the two participant groups—non-DA (n = 28) and DA (n = 30)—are summarized in Table 2. There were no statistically significant differences between the two groups in age (t = 0.261, p = 0.795) or gender distribution (χ² = 1.050, p = 0.306). As expected, MDAS scores were significantly higher in the DA group than in the non-DA group (U = 0.000, p < 0.001).

Table 2.

Demographic characteristics of the study participants

Diagnostic
groups		 non-DA
(n = 28)		 DA
(n = 30)		 t/χ2/U a p
Age (years) 23.43 ± 4.96 23.10 ± 4.62 0.261 0.795
Gender (F/M) 14/14 19/11 1.050 0.306
MDAS 7.5 (5,9) 12.0 (11,14) 0.000 < 0.001***
Open in a new tab

a: Age was examined using the independent-samples t-test; gender was analyzed using the Pearson chi-square test (χ²); and MDAS scores were compared using the Mann–Whitney U test

Distribution of MDAS scores

Figure 1 presents the frequency distribution of MDAS scores using the established clinical cut-off of ≥ 10 for dental anxiety. Among 58 participants, 28 (48.3%) comprised the non-DA group (MDAS < 10), with scores predominantly clustered at 5 and 9 points (n = 8 each). The DA group (MDAS ≥ 10, n = 30, 51.7%) showed highest frequencies at 10 and 12 points (n = 7 each), with scores ranging from 10 to 17 points. Critically, no participants scored ≥ 19, indicating that none of the participants in the DA group met the threshold for phobic severity in this sample.

Fig. 1.

Fig. 1

Open in a new tab

Distribution of MDAS Scores

Peripheral blood mRNA expression levels

Human GR mRNA expression levels

The semiquantitative evaluation of GR mRNA expression was performed using real-time PCR with β-actin as the internal control in peripheral blood samples. Independent samples t-test revealed no significant difference in GR mRNA levels between the non-DA group (1.02 ± 0.19) and DA group (1.06 ± 0.32) (t = 0.5523, df = 56, p = 0.5830) in Fig. 2.

Fig. 2.

Fig. 2

Open in a new tab

Relative mRNA expression of GR. Error bars denote mean and SEM. DA, dental anxiety; non-DA, no dental anxiety; GR, glucocorticoid receptor

Human GR-1B mRNA expression levels

For GR-1B mRNA, Fig. 3 demonstrates significantly elevated expression in the DA group (1.16 ± 0.19) versus non-DA (1.02 ± 0.19) (t = 2.930, df = 56, p = 0.0049).

Fig. 3.

Fig. 3

Open in a new tab

Relative mRNA expression of GR-1B. ** means P < 0.01. Error bars denote mean and SEM. DA, dental anxiety; non-DA, no dental anxiety; GR-1B, GR transcripts containing exons 1B

Human GRIA1 mRNA expression levels

For GRIA1 mRNA, Mann-Whitney U-test revealed significantly lower expression in the DA group (median = 0.56, IQR 0.35–0.97) versus non-DA (median = 1.08, IQR 0.58–1.70) (U = 235, p = 0.0036) in Fig. 4.

Fig. 4.

Fig. 4

Open in a new tab

Relative mRNA expression of GRIA1. Error bars denote mean and SEM. DA, dental anxiety; non-DA, no dental anxiety; GRIA1, glutamate receptor 1

Human OT mRNA expression levels

For OT mRNA, Mann-Whitney U-test revealed significantly lower expression in the DA group (median = 0.59, IQR 0.37–0.92) versus non-DA (median = 0.88, IQR 0.59–1.49) (U = 251, p = 0.0080) in Fig. 5.

Fig. 5.

Fig. 5

Open in a new tab

Relative mRNA expression of OT. Error bars denote mean and SEM. DA, dental anxiety; non-DA, no dental anxiety; OT, oxytocin

Human OTR mRNA expression levels

Mann-Whitney U-test revealed no significant difference in OTR mRNA levels between the DA group (median = 0.44, IQR 0.26–1.95) versus non-DA (median = 0.99, IQR 0.57–1.55) (U = 366.5, p = 0.4102) in Fig. 6.

Fig. 6.

Fig. 6

Open in a new tab

Relative mRNA expression of OTR. Error bars denote mean and SEM. DA, dental anxiety; non-DA, no dental anxiety; OTR, oxytocin receptor

Human PARP1 mRNA expression levels

Mann-Whitney U-test revealed no significant difference in PARP1 mRNA levels between the DA group (median = 1.08, IQR 0.86–1.26) versus non-DA (median = 1.02, IQR 0.86–1.20) (U = 396, p = 0.7167) in Fig. 7.

Fig. 7.

Fig. 7

Open in a new tab

Relative mRNA expression of PARP1. Error bars denote mean and SEM. DA, dental anxiety; non-DA, no dental anxiety; PARP1, Poly ADP-Ribose Polymerase 1

Salivary cortisol levels

Salivary cortisol levels were measured by ELISA. The Mann-Whitney U test indicated significantly higher levels in the DA group (median = 4.64, IQR 3.90–5.56) compared to the non-DA group (median = 2.76, IQR = 2.01–4.00) (U = 164, p < 0.001; Fig. 8).

Fig. 8.

Fig. 8

Open in a new tab

Salivary cortisol levels quantified by ELISA. Error bars denote mean and SEM. DA, dental anxiety; non-DA, no dental anxiety

Salivary alpha-amylase levels

Salivary alpha-amylase levels were also measured by ELISA. The independent samples t-test indicated significantly higher levels in DA (28.11 ± 11.66) compared to the non-DA group (20.75 ± 11.67) (t = 2.401, df = 56, p = 0.0197; Fig. 9).

Fig. 9.

Fig. 9

Open in a new tab

Salivary alpha-amylase levels quantified by ELISA. Error bars denote mean and SEM. DA, dental anxiety; non-DA, no dental anxiety

Adjustment for multiple comparisons

To assess the robustness of the biomarker comparisons, Benjamini–Hochberg FDR correction was applied across the eight biomarker outcomes. After FDR correction, the group differences in GR-1B, GRIA1, OT, salivary cortisol, and salivary alpha-amylase remained statistically significant, whereas GR, OTR, and PARP1 remained non-significant (Table 3).

Table 3.

Raw and FDR adjusted p values for biomarker comparisons

Biomarker Raw p FDR q Result
GR 0.5830 0.6663 Not significant
GR-1B 0.0049 0.0131 Significant
GRIA1 0.0036 0.0131 Significant
OT 0.0080 0.0160 Significant
OTR 0.4102 0.5469 Not significant
PARP1 0.7167 0.7167 Not significant
Salivary cortisol < 0.001 < 0.008 Significant
Salivary alpha-amylase 0.0197 0.0315 Significant
Open in a new tab

FDR q indicates the Benjamini–Hochberg FDR adjusted p value. For salivary cortisol, q is reported as < 0.008 because the raw p value was reported as p < 0.001. FDR, false discovery rate

Discussion

Patients with dental anxiety are more likely to postpone or avoid dental treatment, which may worsen oral health and further reinforce anxiety, thereby contributing to a vicious cycle [25]. Consistent with this, we observed significantly elevated salivary cortisol levels, which may be consistent with increased HPA-axis activity during dental anticipation. Similarly, higher salivary alpha-amylase in DA patients may indicate enhanced SAM activation. These findings suggest that DA is accompanied by heightened physiological stress responses during dental treatment.

The expression level of GR mRNA in peripheral blood was slightly higher in the DA group than in the non-DA group, but the difference was not statistically significant. The expression level of GR-1B mRNA was higher in the DA group than in the non-DA group, which may be associated with peripheral stress-related changes in DA [26, 27]. However, the underlying mechanism remains to be further clarified.

GRIA1 encodes the GluA1 subunit of AMPA receptors, which are involved in glutamatergic neurotransmission and have been implicated in fear- and anxiety-related neural processes. Previous studies have suggested that GluA1-containing AMPA receptors participate in fear learning, extinction, and anxiety-related behaviors, indicating that GRIA1 may be relevant to emotional regulation [28, 29]. In the present study, peripheral blood GRIA1 mRNA expression was lower in the DA group than in the non-DA group, suggesting that altered GRIA1 expression may be associated with DA. Although the biological significance of peripheral GRIA1 expression remains unclear, this finding may reflect a peripheral molecular change related to stress or anxiety states and warrants further investigation.

In the present study, peripheral blood OT mRNA expression was significantly lower in patients with dental anxiety than in those without dental anxiety. Oxytocin, as a neurotransmitter with anti-anxiety effects, has an anti-stress effect and can regulate stress, anxiety, fear, and pain tolerance [30]. Its anti-stress effect is mainly achieved by regulating the HPA axis. Oxytocin enhances CRF induced ACTH secretion, thereby strengthening the negative feedback loop of the HPA axis and reducing its response to stress [17]. Lower OT mRNA expression in the peripheral blood of patients with dental anxiety may suggest a peripheral OT-related change associated with DA. Nash reported that intranasal oxytocin may help reduce adult anxiety and improve children’s cooperation during dental treatment [31], which also suggests a potential role of oxytocin in dental anxiety. Since the present study assessed peripheral blood OT mRNA expression, the relationship between this finding and central oxytocin signaling still requires further investigation.

Studies have shown that PARP1 may participate in glucocorticoid-related transcriptional responses [32, 33]. The expression level of PARP1 mRNA in peripheral blood of patients in the DA group was higher than that in the non-DA group, but there was no statistically significant difference between the two groups. The present results do not support a clear association between PARP1 mRNA expression and dental anxiety.

Overall, patients with dental anxiety showed higher GR-1B mRNA expression, lower GRIA1 and OT mRNA expression in peripheral blood, and elevated salivary cortisol and alpha-amylase levels compared with non-DA participants. These group differences remained statistically significant after FDR correction for multiple biomarker comparisons. These findings suggest that dental anxiety is associated with preliminary changes in PBMC mRNA expression and salivary stress-related biomarkers. However, the biological significance of these peripheral changes requires further validation in larger studies.

Limitations

This study has several limitations. First, this was a single-center study recruiting only orthodontic outpatients from the Stomatology Hospital of Hunan University of Chinese Medicine. Therefore, the findings may not be generalizable to broader dental anxiety populations, particularly patients undergoing other types of dental treatment. In addition, because the participants were predominantly young adults, the findings may not be fully generalizable to dental anxiety populations with different age distributions. Second, the cross-sectional design with a limited sample size reduces statistical power, and the sample size estimation was based on an assumed effect size rather than directly applicable empirical data. Moreover, PBMC mRNA expression was measured in peripheral blood, and its relationship with central nervous system activity remains uncertain. Third, oral health conditions, salivary flow rate, and possible oral inflammation were not specifically controlled, which may have affected salivary biomarker levels. Fourth, undocumented use of medicine in some participants could confound stress biomarker measurements. Fifth, venipuncture itself may act as an acute stressor and could have influenced peripheral biomarker levels, thereby confounding the interpretation of changes specifically attributable to dental anxiety. Accordingly, the statistical findings of this study should be interpreted as exploratory and hypothesis-generating rather than confirmatory.

Conclusion

Dental anxiety may be associated with altered PBMC mRNA expression and salivary stress-related biomarkers, including higher GR-1B mRNA expression, lower GRIA1 and OT mRNA expression, and elevated salivary cortisol and alpha-amylase levels. These findings provide preliminary evidence of peripheral molecular and salivary changes associated with dental anxiety and may contribute to understanding its biological correlates.

Acknowledgements

We thank all patients who participated in this study for their time and cooperation.

Abbreviations

HPA

Hypothalamic-Pituitary-Adrenal

SAM

Sympathetic-Adrenal-Medullary

DA

Dental Anxiety

GR

Glucocorticoid Receptor

GR-1B

Glucocorticoid Receptor Transcripts Containing Exons 1B

AMPA

α-Amino-3-Hydroxy-5-Methyl-4-Isoxazole Propionate

GRIA1

Glutamate Ionotropic Receptor AMPA Type Subunit 1

OT

Oxytocin

OTR

Oxytocin Receptor

PARP1

Poly ADP-Ribose Polymerase 1

DP

Dental Phobia

CRF

Corticotropin Releasing Factor

ACTH

Adrenocorticotropic Hormone

MDAS

Modified Dental Anxiety Scale

PBMCs

Peripheral Blood Mononuclear Cells

cDNA

Complementary DNA

RT-qPCR

Reverse Transcription Quantitative Polymerase Chain Reaction

SD

Standard Deviation

IQR

Interquartile Range

Authors’ contributions

W.L. (Wenlong Liu) contributed to conceptualization, methodology, investigation, data curation, formal analysis, and writing—original draft. T.H. (Tao Huai) contributed to conceptualization, methodology, data curation, validation, visualization, and writing—original draft. S.W. (Shichen Wang) contributed to writing—original draft and data curation. C.L. (Chao Liu) contributed to investigation, data acquisition, and visualization. X.H. (Xianggang Hou) contributed to investigation, data acquisition, and validation. H.Z. (Hongshuang Zhu) contributed to laboratory support, validation, and visualization. Y.D. (Yige Duan) contributed to data acquisition, formal analysis, and figure preparation. M.B. (Minghai Bai) and Y.L. (Yong Liu) provided supervision, resources, and writing—review & editing. All authors read and approved the final manuscript.

Funding

This research was funded by the Hunan University of Chinese Medicine (No. 2022XYLH131).

Data availability

The de-identified patient-level questionnaire datasets (MDAS scores and general information) generated and/or analysed during the current study are not publicly available due to institutional ethics restrictions and participant privacy, but are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

The study protocol involving orthodontic patients seeking treatment at the Orthodontic Department of the Stomatology Hospital Affiliated to Hunan University of Chinese Medicine (July 2021 to March 2023) was reviewed and approved by the Institutional Ethics Committee (approval number: 2022-11). Each participant provided written informed consent after receiving detailed verbal and written information about the study design. No identifiable individual data are presented in this manuscript. All methods were performed in accordance with relevant guidelines. All methods used in this study comply with the ethical standards of the institutional and/or national research committees and the Declaration of Helsinki and its subsequent amendments or comparable ethical standards.

Consent for publication

Not applicable. This manuscript does not contain any individual person’s data in any form (including images, videos, or identifiable details).

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Liu Wenlong and Tao Huai contributed equally to this work.

References

  • 1.Samorodnitzky GR, Levin L. Self-assessed dental status, oral behavior, DMF, and dental anxiety. J Dent Educ. 2005;69(12):1385–9. [PubMed] [Google Scholar]
  • 2.Wide U, Hakeberg M. Treatment of Dental Anxiety and Phobia-Diagnostic Criteria and Conceptual Model of Behavioural Treatment. Dent J (Basel). 2021;9(12):153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bürklein S, Brodowski C, Fliegel E, Jöhren HP, Enkling N. Recognizing and differentiating dental anxiety from dental phobia in adults: a systematic review based on the German guideline Dental anxiety in adults. Quintessence Int. 2021;52(4):360–73. [DOI] [PubMed] [Google Scholar]
  • 4.Humphris GM, Dyer TA, Robinson PG. The modified dental anxiety scale: UK general public population norms in 2008 with further psychometrics and effects of age. BMC Oral Health. 2009;9:20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Thomson WM, Stewart JF, Carter KD, Spencer AJ. Dental anxiety among Australians. Int Dent J. 1996;46(4):320–4. [PubMed] [Google Scholar]
  • 6.Armfield JM, Stewart JF, Spencer AJ. The vicious cycle of dental fear: exploring the interplay between oral health, service utilization and dental fear. BMC Oral Health. 2007;7:1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Asl AN, Shokravi M, Jamali Z, Shirazi S. Barriers and Drawbacks of the Assessment of Dental Fear, Dental Anxiety and Dental Phobia in Children: A Critical Literature Review. J Clin Pediatr Dent. 2017;41(6):399–423. [DOI] [PubMed] [Google Scholar]
  • 8.Liinavuori A, Tolvanen M, Pohjola V, Lahti S. Longitudinal interrelationships between dental fear and dental attendance among adult Finns in 2000–2011. Community Dent Oral Epidemiol. 2019;47(4):309–15. [DOI] [PubMed] [Google Scholar]
  • 9.Tananska VT. Salivary α-Amylase And Chromogranin A In Anxiety-Related Research. Folia Med (Plovdiv). 2014;56(4):233–6. [DOI] [PubMed] [Google Scholar]
  • 10.Hellhammer DH, Wüst S, Kudielka BM. Salivary cortisol as a biomarker in stress research. Psychoneuroendocrinology. 2009;34(2):163–71. [DOI] [PubMed] [Google Scholar]
  • 11.Wadsworth ME, Broderick AV, Loughlin-Presnal JE, et al. Co-activation of SAM and HPA responses to acute stress: A review of the literature and test of differential associations with preadolescents’ internalizing and externalizing. Dev Psychobiol. 2019;61(7):1079–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Oakley RH, Cidlowski JA. The biology of the glucocorticoid receptor: new signaling mechanisms in health and disease. J Allergy Clin Immunol. 2013;132(5):1033–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Wüst S, Van Rossum EF, Federenko IS, Koper JW, Kumsta R, Hellhammer DH. Common polymorphisms in the glucocorticoid receptor gene are associated with adrenocortical responses to psychosocial stress. J Clin Endocrinol Metab. 2004;89(2):565–73. [DOI] [PubMed] [Google Scholar]
  • 14.Kumsta R, Entringer S, Koper JW, van Rossum EF, Hellhammer DH, Wüst S. Sex specific associations between common glucocorticoid receptor gene variants and hypothalamus-pituitary-adrenal axis responses to psychosocial stress. Biol Psychiatry. 2007;62(8):863–9. [DOI] [PubMed] [Google Scholar]
  • 15.Miyazaki T, Abe H, Uchida H, Takahashi T. Translational medicine of the glutamate AMPA receptor. Proc Jpn Acad Ser B Phys Biol Sci. 2021;97(1):1–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Bhandage AK, Jin Z, Hellgren C, et al. AMPA, NMDA and kainate glutamate receptor subunits are expressed in human peripheral blood mononuclear cells (PBMCs) where the expression of GluK4 is altered by pregnancy and GluN2D by depression in pregnant women. J Neuroimmunol. 2017;305:51–8. [DOI] [PubMed] [Google Scholar]
  • 17.Yoon S, Kim YK. The Role of the Oxytocin System in Anxiety Disorders. Adv Exp Med Biol. 2020;1191:103–20. [DOI] [PubMed] [Google Scholar]
  • 18.Ryan KM, McLoughlin DM. PARP1 and OGG1 in Medicated Patients With Depression and the Response to ECT. Int J Neuropsychopharmacol. 2023;26(2):107–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Clow A, Smyth N. Salivary cortisol as a non-invasive window on the brain. Int Rev Neurobiol. 2020;150:1–16. [DOI] [PubMed] [Google Scholar]
  • 20.Törnhage CJ. Salivary cortisol for assessment of hypothalamic-pituitary-adrenal axis function. Neuroimmunomodulation. 2009;16(5):284–9. [DOI] [PubMed] [Google Scholar]
  • 21.Bosch JA, Veerman EC, de Geus EJ, Proctor GB. α-Amylase as a reliable and convenient measure of sympathetic activity: don’t start salivating just yet. Psychoneuroendocrinology. 2011;36(4):449–53. [DOI] [PubMed] [Google Scholar]
  • 22.AlMaummar M, AlThabit HO, Pani S. The impact of dental treatment and age on salivary cortisol and alpha-amylase levels of patients with varying degrees of dental anxiety. BMC Oral Health. 2019;19(1):211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Humphris GM, Morrison T, Lindsay SJ. The Modified Dental Anxiety Scale: validation and United Kingdom norms. Community Dent Health. 1995;12(3):143–50. [PubMed] [Google Scholar]
  • 24.Yuan S, Freeman R, Lahti S, Lloyd-Williams F, Humphris G. Some psychometric properties of the Chinese version of the Modified Dental Anxiety Scale with cross validation. Health Qual Life Outcomes. 2008;6:22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Crego A, Carrillo-Díaz M, Armfield JM, Romero M. From public mental health to community oral health: the impact of dental anxiety and fear on dental status. Front Public Health. 2014;2:16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Sinclair D, Fullerton JM, Webster MJ, Shannon Weickert C. Glucocorticoid receptor 1B and 1 C mRNA transcript alterations in schizophrenia and bipolar disorder, and their possible regulation by GR gene variants. PLoS ONE. 2012;7(3):e31720. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Liu Y, Tang Y, Li C, et al. Altered Expression of Glucocorticoid Receptor and Neuron-Specific Enolase mRNA in Peripheral Blood in First-Episode Schizophrenia and Chronic Schizophrenia. Front Psychiatry. 2020;11:760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Weber T, Vogt MA, Gartside SE, et al. Adult AMPA GLUA1 receptor subunit loss in 5-HT neurons results in a specific anxiety-phenotype with evidence for dysregulation of 5-HT neuronal activity. Neuropsychopharmacology. 2015;40(6):1471–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Walker DL, Davis M. The role of amygdala glutamate receptors in fear learning, fear-potentiated startle, and extinction. Pharmacol Biochem Behav. 2002;71(3):379–92. [DOI] [PubMed] [Google Scholar]
  • 30.Carter CS, Kenkel WM, MacLean EL, et al. Is Oxytocin Nature’s Medicine. Pharmacol Rev. 2020;72(4):829–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Nash DA. Translating neuroscience research to oral medicine: oxytocin and human behavior. Oral Dis. 2015;21(7):913–7. [DOI] [PubMed] [Google Scholar]
  • 32.Tan A, Younis AZ, Evans A, et al. PARP1 mediated PARylation contributes to myogenic progression and glucocorticoid transcriptional response. Cell Death Discov. 2023;9(1):133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Thomas M, Palombo P, Schuhmacher T, et al. Impaired PARP activity in response to the β-adrenergic receptor agonist isoproterenol. Toxicol In Vitro. 2018;50:29–39. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The de-identified patient-level questionnaire datasets (MDAS scores and general information) generated and/or analysed during the current study are not publicly available due to institutional ethics restrictions and participant privacy, but are available from the corresponding author on reasonable request.

Articles from BMC Oral Health are provided here courtesy of BMC

RESOURCES