Abstract
Background
Asthma is a chronic inflammatory airway disease influenced by genetic and environmental factors. Low vitamin-D status has been implicated in asthma severity, while polymorphisms in the SNAIL1 gene, a transcription factor involved in epithelial-mesenchymal transition, may affect airway remodeling.
Aim
This exploratory study aimed to investigate the relationship between SNAIL1 genetic variants, SNAIL1 and vitamin-D receptor (VDR) gene expression, and vitamin-D status among Jordanian patients with asthma.
Methods
A case-control study was conducted involving 100 participants classified into four groups according to asthma status and vitamin-D status. Serum vitamin-D levels were measured, and SNAIL1 and VDR gene expression levels were analyzed using quantitative real-time PCR. Relative gene expression was calculated using the 2^-ΔΔCt method. SNAIL1 genetic variants were identified using PCR amplification followed by Sanger sequencing of the SNAIL1 coding exons.
Results
Serum vitamin-D concentrations differed significantly among the study groups (p < 0.0001). SNAIL1 expression showed higher fold changes in asthmatic participants than in non-asthmatic participants, irrespective of vitamin D status; however, these differences did not reach statistical significance (p = 0.08–0.09). VDR expression demonstrated a decreasing trend in participants with low vitamin-D status, although most comparisons were not statistically significant. A novel missense variant in SNAIL1 (c.196C>T; p.Ala66Val) was identified in a single asthmatic participant with low vitamin-D status. This participant also exhibited higher SNAIL1 expression; however, the biological significance of this observation remains exploratory. In silico prediction tools classified this variant as benign, and its potential biological significance remains exploratory.
Conclusion
This study provides exploratory evidence suggesting potential relationships among SNAIL1 expression, VDR expression, vitamin D status, and asthma in a Jordanian population. The identified SNAIL1 variant represents a preliminary finding requiring further investigation. Larger studies with functional validation are needed to confirm these observations and provide a basis for future multidisciplinary research.
Keywords: vitamin-D, asthma, SNAIL1, vitamin D receptor, polymorphism
Graphical Abstract
Introduction
Vitamin-D is a fat soluble vitamin that is primarily synthesized cutaneously in the skin and converted into its biologically active form in the liver and kidney via two steps of hydroxylation.1 It is used by the body for normal development and maintenance of bones by increasing the absorption of calcium ions and phosphate.2 Further, vitamin-D modifies immune function, cell proliferation, differentiation, and apoptosis.3 The deficiency of vitamin-D is increasing at an alarming rate, as more people are experiencing vitamin-D deficiency or insufficient levels. Various family studies have demonstrated moderate to high heritability for circulating vitamin-D levels.4
Snail family transcriptional repressor 1 (SNAIL) is one of the genes that are responsible for vitamin-D resistance, as their activity either lowers the circulating levels of vitamin-D or reduces the availability of it in its target tissues.5 Recent advances in genetic studies methods have identified associations between the Vitamin D receptor (VDR) and the transcription factor SNAILs with serum vitamin-D levels.6 This has been attributed to vitamin D-resistant genes that reduce circulating vitamin-D levels through a set of signaling pathways. SNAIL1 and SNAIL2 that belong to the Snail family of zinc-finger transcription factors and modulate processes that are essential for implying cell movement during embryonic development stages and tumor progression. Cellular over-expression of SNAIL1 induces the epithelial-to-mesenchymal transition (EMT), which entails the conversion from an epithelial phenotype to the acquisition of a mesenchymal, fibroblastic characteristics.7
Deficiency in vitamin-D is widespread and has been linked to asthma exacerbation, increased airway hyperreactivity, and reduced corticosteroid responsiveness.8 SNAIL1 is a zinc-finger transcription factor that induces EMT, a process essential for tissue remodeling but detrimental when dysregulated. Elevated SNAIL1 activity contributes to fibrosis and airway remodeling in asthma. Studies have shown that VDR signaling negatively regulates SNAIL1, suggesting an inverse relationship between vitamin-D status and EMT activation.9 In Jordan, both asthma and vitamin-D deficiency are highly prevalent, yet their genetic interactions remain underexplored.10 Recent advances have highlighted that asthma is a genetically complex disease resulting from interactions between multiple susceptibility genes and environmental factors. Large-scale genomic studies have identified numerous loci associated with asthma susceptibility, immune regulation, airway inflammation, and lung function, supporting the concept that genetic determinants contribute substantially to disease heterogeneity and clinical phenotypes.11 Despite these advances, the contribution of genes involved in airway remodeling and epithelial–mesenchymal transition (EMT) remains incompletely understood.
Recent reviews have emphasized the central role of airway epithelial dysfunction and EMT in asthma pathogenesis and identified these pathways as promising sources of novel biomarkers and therapeutic targets.12
Vitamin-D has emerged as an important immunomodulatory factor capable of influencing airway inflammation and remodeling. Recent systematic reviews suggest that adequate vitamin D status may attenuate airway remodeling by reducing inflammatory responses, regulating extracellular matrix deposition, and modulating epithelial cell function.13 Although previous studies have independently investigated the roles of vitamin D deficiency, VDR signaling, and SNAIL1 in asthma or other chronic inflammatory diseases, limited information is available regarding their combined relationship in asthma. Furthermore, data evaluating both SNAIL1 gene variants and gene expression in relation to vitamin D status remain scarce, particularly in Middle Eastern populations. To our knowledge, no previous study has comprehensively investigated SNAIL1 genetic variation, SNAIL1 and VDR gene expression, and vitamin-D status simultaneously in Jordanian patients with asthma. We hypothesized that vitamin-D deficiency is associated with altered SNAIL1 and VDR gene expression in patients with asthma and that genetic variation within the SNAIL1 gene may contribute to these molecular alterations. Therefore, this study aimed to investigate the association between SNAIL1 gene variants, SNAIL1 and VDR gene expression, and vitamin-D status in Jordanian patients with asthma.
Methods
Subjects
This exploratory case-control study involved 100 participants consisting of 50 asthmatic patients and 50 non-asthmatic controls (age range 18–80 years old). The study samples were collected over a period from February 2024 to June 2025. All eligible participants were consecutively recruited during the study period in accordance with the inclusion and exclusion criteria specified below. All of the asthmatic subjects involved in the present study visited the chest clinic at the Jordan University Hospital, Amman, Jordan. Control subjects were recruited from individuals attending Jordan University Hospital for routine health assessments and had no history of asthma or chronic respiratory disease. Asthmatic patients were diagnosed according to the history, physical examination, pulmonary imaging and tests. The diagnosis of asthma and the assessment of its clinical severity were based on clinical symptoms and lung function according to the Global Initiative for Asthma (GINA) guidelines.14 Initially, patients were evaluated based on characteristic clinical manifestations, including cough, wheezing, exercise intolerance, and dyspnea. The diagnosis was subsequently confirmed by spirometric assessment. Asthma was confirmed by spirometric evidence of reversible airflow obstruction. In adults, bronchodilator reversibility was defined as an increase in FEV1 exceeding 200 mL and 12% of the baseline value, measured 15 minutes after bronchodilator administration. Patients with prebronchodilator FEV1/forced vital capacity FVC less than 70%; FEV1/FVC <70%; or lower limit of normal; peak flow variability of 15% for 5 days; FEV1increase of 400 mL in 2 weeks after inhaled corticosteroid; and bronchodilator reversibility is a 12% change in FEV1 and at least 200 mL on spirometry after inhaling the bronchodilator.
EXCLUSION CRITERIA: Patients suffering from chronic diseases (eg, cardiorespiratory, endocrine, or metabolic diseases) other than asthma; other respiratory diseases like chronic obstructive pulmonary disease, lung embolism, lung fibrosis, and bronchiectasis; children, pregnant women; and patients with missing results.
Ethical Considerations
Prior to enrollment, written informed consent was obtained from all participants. Ethical approval for the study was granted by the Institutional Review Board of Jordan University Hospital (Approval No. 10/2024/2652). The study was conducted in compliance with the ethical principles governing human research, adhering to institutional and national regulations as well as the Declaration of Helsinki.15
Measurement of Vitamin-D Levels
A 5-mL peripheral blood sample was collected from each participant using plain collection tubes. Samples were centrifuged at 1,500 × g for 10 minutes, after which the serum was separated, aliquoted into storage tubes, and maintained at −20°C until laboratory analysis. Serum 25-Hydroxyvitamin D3 levels were determined using an automated chemiluminescence immunoassay analyzer (MAGLUMI 800, Snibe Diagnostic, China) with the corresponding reagent kit (Catalog No. 130211004M). The assay has a detection range of approximately 3–150 ng/mL with an analytical sensitivity of about 1 ng/mL. All experimental procedures were performed in strict accordance with the manufacturer’s recommended protocol. According to the manufacturer’s specifications, the intra-assay and inter-assay coefficients of variation (CVs) were below 5% and 8%, respectively.
Measuring vitamin-D levels and sorting them into three levels: sufficient, insufficient, and deficient. Vitamin-D status was assessed in accordance with the recommendations of the Endocrine Society Clinical Practice Guideline.16 Vitamin-D deficiency is when the level of serum 25-Hydroxyvitamin D3 is less than or equal to 20 ng mL−1; Vitamin-D insufficiency is when the level of serum 25-Hydroxyvitamin D3 is between 21 and 29ng mL−1, and above 30 ng mL−1 is considered sufficient.17 Sorting the samples, depending on the levels of vitamin-D, into four groups, each one composed of at least 25 samples: asthmatic with sufficient vitamin-D level, asthmatic with deficient vitamin-D level, non-asthmatic and normal vitamin-D level, and non-asthmatic and deficient vitamin-D level.
Blood Withdrawal and DNA Extraction
A round 5mL sample of peripheral blood from each participant was collected in ethylenediaminetetraacetic acid (EDTA)tubes. Genomic DNA was extracted following the manufacturer’s instructions for the Wizard Genomic DNA Purification Kit (Purchased from Promega/USA). DNA concentration and purity were assessed by measuring absorbance at 260 nm and 280 nm using a UV spectrophotometer (SmartSpec Plus/USA, Bio-Rad). Samples with an A260/A280 ratio of 1.8 ± 0.1 were considered acceptable for PCR analysis. The purified DNA was subsequently stored at −20°C until further use.
RNA Extraction and Gene Expression Analysis
Approximately 5 mL of peripheral blood was collected from each participant into EDTA-containing tubes. Total RNA was isolated from the peripheral blood buffy coat fraction, which contains peripheral blood mononuclear cells (PBMCs), using the RNeasy Mini Kit (Qiagen, Germany) according to the manufacturer’s protocol. The extracted RNA was then reverse-transcribed into complementary DNA (cDNA) using the HyperScript 2X RT Master Mix (Cat. No. 601–710) following the manufacturer’s instructions. Gene expression levels of the vitamin-D receptor and SNAIL1 were subsequently quantified using real-time quantitative PCR (qPCR) technology. The18S rRNA gene was selected as the internal reference control for normalization. The stability of the endogenous reference gene was evaluated by comparing its Ct values across the study groups. As no significant differences were observed, 18S rRNA was considered sufficiently stable for normalization. Relative gene expression levels were then calculated using the comparative 2^-ΔΔCt method. Quantitative PCR reactions were performed using SYBR Green Master Mix (Thermo Fisher Scientific/Applied Biosystems, USA) combined with 10 ng of cDNA along with optimized concentrations of forward and reverse primers. Primer sequences for each target gene were designed using the NCBI database (https://www.ncbi.nlm.nih.gov/) and are presented in Table 1. All qPCR reactions were performed in technical duplicates. Primer specificity and amplification efficiency were evaluated before relative quantification. Relative gene expression levels were normalized to the housekeeping gene 18SrRNAand calculated using the 2^-ΔΔCt method.18 The resulting normalized relative expression values were used for statistical analysis and fold-change determination. Data analysis was performed using GraphPad Prism version 7.0 software.
Table 1.
Primer Sequences and Melting Temperatures Used in qPCR for Vitamin-D Receptor, the SNAL1 and 18SrRNA Genes
| Primer sequence (5ʹ–3ʹ) | Tm (°C) |
|---|---|
| Vitamin D Receptor F: GAG GAG CAG GAG GAG ATG GA R:CTGCTGCTGTTGCTGTAGGT |
67.5 |
| SNAIL1 F: GCT GCT CCA CAA GCA CCA AG R: AGG AGA AGG TCC GAG GCT GA |
68.2 |
| 18S rRNAF: CGG CTA CCA CAT CCA AGG AA R: GCT GGA ATT ACC GCG GCT |
67.5 |
Abbreviations: F, forward primer; R, reverse primer; Tm, melting temperature.
PCR and Genotyping
Briefly, 100 ng of genomic DNA was subjected to PCR amplification using gene-specific primers designed with Primer3 software19 and listed in Table 2. Amplification was performed using a C1000 Touch Thermal Cycler (Bio-Rad Laboratories, Inc). The PCR reaction mixture contained Taq DNA polymerase, dNTPs, and the appropriate reaction buffer, prepared according to the manufacturer’s instructions (Genei Laboratories Private, Bengaluru, India). Thermal cycling conditions included an initial denaturation step at 95°C for 5 minutes, followed by 30 cycles consisting of denaturation at 95°C for 30 seconds, annealing for 30 seconds at 60°C for exon 1 and exon 3, and 56°C for exon 2, and extension at 72°C for 30 seconds. A final extension step was carried out at 72°C for 5 minutes. PCR products corresponding to the three exons were resolved on a 2.5% agarose gel and visualized under UV illumination, as shown in Figure 1. The exonic regions of the SNAIL1 gene were sequenced using the Sanger sequencing technique, which was carried out by Macrogen (Seoul, South Korea). Sequences were aligned against the human SNAIL1 reference sequence (RefSeq: NC_000020.11GRCh38.p14) obtained from the NCBI database. Sequencing chromatograms were analyzed using DNA-Based v3.5.4 software (HeracleBioSoft, Romania). Multiple sequence alignment was performed using the MultAlin tool (http://multalin.toulouse.inra.fr/multalin/).20 The identified novel genetic variant was further validated by resequencing the PCR product using the reverse primer. Three genomic regions corresponding to the three exons of the SNAIL1 gene were successfully amplified by PCR. As shown in Figure 1, agarose gel electrophoresis (2.5%) confirmed the presence of the three expected amplicons. The fragment sizes for exons 1, 2, and 3 were 300 bp, 800 bp, and 450 bp, respectively.
Table 2.
Primer Sequences and Annealing Temperatures Used in PCR Amplification of the SNAIL1 Gene
| Primer Sequence (5ʹ–3ʹ) | AT (°C) | Region | Size (bp) |
|---|---|---|---|
|
F: AGT GGT TCT TCT GCG CTA CT R: ACA AAA CAT CCT GTG ACT CGA TC |
60 °C | Exon 1 | 300 |
|
F: GTT GAT TGA GTG AAT GAT TTA ATT AAC GC R: CTT GAG CTA GAA GTT AGA AGA CTC G |
56 °C | Exon 2 | 800 |
|
F: GAT TCC CAT CAC TGC CAG CC R: GAA TTC CAT GGC AGT GAG AAG GAT |
60 °C | Exon 3 | 450 |
Abbreviations: F, forward primer; R, reverse primer; AT, annealing temperature.
Figure 1.
Agarose gel electrophoresis (2.5%) of PCR-amplified SNAIL1 exons. Lane M DNA ladder; lanes 1–2: exon 1 (300 bp); lanes 3–4: exon 2 (800 bp); lane 5: exon 3 (450 bp). Bands correspond to the expected amplicon sizes.
In silico Prediction of SNAIL1 Variants
In silico functional prediction of SNAIL1 variants was performed using multiple computational tools. The potential impact of single nucleotide polymorphisms (SNPs) on protein function was assessed using SIFT,21 PolyPhen‑2,22 and MutPred.23 Variants were classified according to each tool’s scoring system, and consensus predictions were considered for interpretation.
Statistical Analysis
Data were expressed as mean ± standard error of the mean (SEM), and the normality of data distribution was assessed. Statistical analyses were performed using SPSS software version 29. Normality of the data distribution was assessed using the Kolmogorov–Smirnov test, and homogeneity of variances was evaluated using Levene’s test. The assumptions of normality and equal variances were satisfied (p>0.05) before performing ANOVA. Vitamin-D levels in all study groups were normally distributed (p> 0.05). Comparisons among groups were performed using one-way ANOVA followed by Tukey’s post hoc test where appropriate. Two-way ANOVA was applied to evaluate the effects of asthma status, vitamin-D status, and their interaction on gene expression levels, followed by Bonferroni adjusted post hoc analysis to compare differences between groups. Gene expression analyses were performed using normalized ΔCt values to the housekeeping gene 18S rRNA. The stability of 18S rRNA expression was evaluated across the study groups and confirmed its suitability as a reference gene for normalization. Relative gene expression (fold change) was subsequently calculated using the comparative 2^-ΔΔCt method. The relationship between SNAIL1 and VDR gene expression levels was assessed using Pearson’s correlation analysis based on ΔCt values. For qPCR expression analysis, fold changes were reported with their corresponding 95% confidence intervals (CIs), calculated from ΔΔCt values and back-transformed to the original fold-change scale. Effect sizes were reported where appropriate, including Pearson correlation coefficients (r) for correlation analyses. Because this was an exploratory study, no a priori sample size calculation was performed, and the findings should be interpreted accordingly.
Results
Vitamin-D Levels
Vitamin-D levels differed significantly among the four study groups (F value =72.12482, p < 0.0001), as shown in Table 3. Post-hoc Tukey analysis showed that Group 1 (Asthmatic and Sufficient vitamin-D levels) and Group 2 (Non-asthmatic and sufficient vitamin-D levels) had significantly (p<0.05) higher vitamin-D levels compared with Group 3 (Asthmatic and deficient vitamin-D levels) and Group 4 (non-asthmatic and deficient vitamin-D levels) (p < 0.001), while no significant differences (p>0.05) were observed between Groups 1 and 2 or between Groups 3 and 4 (Table 3). For analytical purposes, vitamin-D Deficient and insufficient individuals were combined into a single low vitamin-D status group, as both categories reflect suboptimal vitamin-D status.
Table 3.
Baseline Demographic, Anthropometric, Clinical, and Biochemical Characteristics of the Four Study Groups
| Variable | Non-Asthmatic Vit D Sufficient (n=23) |
Non-Asthmatic with Low Vit D Status (n=25) |
Asthmatic Vit D Sufficient (n=25) |
Asthmatic with Low Vit D Status (n=23) |
P value |
|---|---|---|---|---|---|
| Age (years), mean ± SD | 40.8 ± 16.9 | 41.9 ± 17.7 | 44.3 ± 18.2 | 41.7 ± 16.8 | 0.910 |
|
Sex, n% Male |
(34.8%) | (36.0%) | (43.5%) | (65.0%) | 0.133 |
|
Sex, n% Female |
(65.2%) | (64.0%) | (56.5%) | (35.0%) | 0.133 |
| BMI (kg/m2), mean ± SD | 29.9 ± 5.3 | 31.1 ± 5.9 | 28.8 ± 5.4 | 30.6 ± 6.2 | 0.638 |
| FEV1 (% predicted), mean ± SD | NA | NA | 86.3 ± 17.5 | 84.3 ± 15.1 | 0.673 |
| Serum Vitamin D (ng/mL), mean ± SD | 37.4 ±8.7 | 15.8 ± 6.6 | 34.2 ± 5.9 | 14.9 ± 6.7 | p<0.0001 |
Abbreviation: NA, not applicable.
Demographic and Anthropometric Data
Participants’ demographic characteristics, including age and sex, were assessed across all study groups. There were no statistically significant differences observed in sex or age distribution between the study groups (p>0.05). Details are available in Table 3.
Expression Patterns of SNAIL1 and VDR
The expression of the SNAIL1 gene varied across the studied groups. Relative gene expression is presented as fold change together with the corresponding 95% confidence intervals (CIs). When asthmatic participants with sufficient vitamin-D levels were compared to non-asthmatic participants with sufficient vitamin-D levels, SNAIL1 expression showed a trend toward higher levels of expression, with a fold change of 5.73; however, this difference was not statistically significant (p= 0.09). Similarly, asthmatic participants with low vitamin-D levels showed a similar trend toward increased SNAIL1 expression compared to their non-asthmatic counterparts with low vitamin-D, with a fold change of 5.97 (p= 0.08).
In contrast, comparison between asthmatic participants with low and sufficient vitamin-D levels revealed a modest, non-significant increase in SNAIL1 expression (fold change = 1.19), showing a consistent directional change without statistical significance (p = 0.45). Notably, non-asthmatic participants with low vitamin-D levels exhibited a down regulation of SNAIL1 expression compared to non-asthmatic participants with sufficient vitamin-D levels, with a fold change of 0.31; this difference was also not statistically significant (p = 0.20).
The expression of the VDR gene also showed variability among the study groups. A trend toward reduced VDR expression was observed in asthmatic participants with low vitamin-D levels compared to asthmatic participants with sufficient vitamin-D levels (fold change = 0.16, p = 0.07). Furthermore, VDR expression tended to be lower in asthmatic participants with sufficient vitamin-D when compared to non-asthmatic participants with sufficient vitamin-D levels, with a fold change of 0.44 (p = 0.12), as shown in Table 4.
Table 4.
Comparative Analysis of SNAIL1 and VDR Gene Expression Across Study Groups Stratified by Asthma Status and Vitamin D Levels
| Comparison Between Groups | Gene | Fold Change | P value | 95% CI | Bonferroni Adjusted p |
|---|---|---|---|---|---|
| Asthmatic Sufficient vs Non-asthmatic Sufficient | SNAIL1 | 5.73 | 0.09 | 0.13–248.9 | 0.73 |
| Asthmatic low Vitamin D vs Non-asthmatic low Vitamin D | SNAIL1 | 5.97 | 0.08 | 0.09–360.6 | 0.64 |
| Asthmatic low Vitamin D vs Asthmatic Sufficient | SNAIL1 | 1.19 | 0.45 | 0.06–23.5 | 1.0 |
| Non-asthmatic low Vitamin D vs Non-asthmatic Sufficient | SNAIL1 | 0.31 | 0.2 | 0.01–7.1 | 1.0 |
| Asthmatic low Vitamin D vs Asthmatic Sufficient | VDR | 0.16 | 0.07 | 0.01–2.54 | 0.56 |
| Asthmatic Sufficient vs Non-asthmatic Sufficient | VDR | 0.44 | 0.12 | 0.01–1.43 | 0.96 |
| Asthmatic low Vitamin D vs Non-asthmatic low Vitamin D | VDR | 0.71 | 0.35 | 0.03–16.4 | 1.0 |
| Non-asthmatic low Vitamin D vs Non-asthmatic Sufficient | VDR | 0.11 | 0.05 | 0.01–1.26 | 0.40 |
Comparisons between asthmatic and non-asthmatic participants with low vitamin-D levels demonstrated a further reduction in VDR expression (fold change = 0.71, p = 0.35). Additionally, non-asthmatic participants with low vitamin-D levels exhibited a pronounced down regulation of VDR expression compared to non-asthmatic participants with sufficient vitamin-D levels (fold change = 0.11, p = 0.05), as shown in Table 4.
Pearson correlation analysis showed an inverse direction of association between VDR and SNAIL1 expression across the study groups; however, the correlations were not statistically significant. Although correlation does not imply causation, this finding is consistent with previous experimental evidence suggesting that VDR may negatively regulate SNAIL1 expression. Log10 transformation was applied to account for wide variability in gene expression, allowing for clear visualization and quantification of these relationships in scatter plots.
Association of SNAIL1 Polymorphism
After DNA sequencing of our target gene for 100 patients, a novel missense variant in the SNAIL1 gene, p.Ala66Val (c.196C>T), was identified in one individual from the asthmatic patient group with low vitamin-D status, as shown in the chromatogram of Figure 2. This genetic variant was associated with altered SNAIL1 expression in this patient and was confirmed by resequencing using the reverse primer. This variant results in the substitution of Alanine at position 66 with Valine and is located within exon 2, a coding region critical for SNAIL1 function. The presence of this variant coincided with the observed elevated SNAIL1 expression in this patient, suggesting a potential effect on gene regulation or protein activity.
Figure 2.
Chromatograms for the novel DNA variant among asthmatic patients with low vitamin-D located in exon 2 of SNAIL1 gene. (A) shows the wild-type sequence, whereas (B) shows the novel c.196C>T (p.Ala66Val) variant.
In silico Prediction
Table 5 presents the predicted effect of the Ala66Val (A66V) variant. The different prediction tools consistently suggest that this variant is unlikely to have a harmful effect on protein function. The SIFT score of 0.15 classifies the variant as tolerated, while PolyPhen-2 (0.22) and MutPred (0.34) both predict a benign effect.
Table 5.
In Silico Prediction for Ala66Val (196 C>T) in SNAIL1
| SNP | Codon/Nucleotide Change | Amino Acid Change | SIFT Score Prediction | PolyPhen-2 Score Prediction | MutPred Score Prediction | Consensus Prediction |
|---|---|---|---|---|---|---|
| Ala66Val | 196 C>T | A66V | 0.15 (Tolerated) | 0.22 (Benign) | 0.34 (Benign) | Benign |
Discussion
The present study explored the expression of SNAIL1 in relation to vitamin-D status and VDR expression in the context of asthma, aiming to better understand the molecular mechanisms contributing to airway inflammation and disease heterogeneity. Although no statistically significant differences were observed between the studied groups, a trend toward higher SNAIL1 expression was observed among asthmatic individuals. This finding highlights the complex regulatory landscape underlying asthma pathogenesis and suggests that transcriptional alterations may warrant further investigation as potential contributors to asthma-related pathways. The wide confidence intervals observed in several comparisons reflect the variability of gene expression measurements and support cautious interpretation of these exploratory findings. Although correction for multiple comparisons was considered, the adjusted analyses resulted in no statistically significant differences. The conservative nature of the Bonferroni approach, together with the relatively limited sample size, may have contributed to the absence of statistical significance. Therefore, the observed expression patterns should be interpreted as preliminary findings requiring validation in larger cohorts.
Asthma is a heterogeneous inflammatory disease characterized by remodeling of the airway, epithelial dysfunction, and immune dysregulation. Transcription factors such as SNAIL1 are known regulators of epithelial plasticity and have been implicated in processes including EMT, tissue remodeling, and chronic inflammation. Dysregulation of SNAIL1 expression may therefore influence airway structural changes and persistent inflammation observed in asthma, particularly in more severe or poorly controlled phenotypes.7
Vitamin-D has emerged as an important immunomodulatory factor in asthma, exerting anti-inflammatory effects and contributing to epithelial barrier integrity through its interaction with the VDR.24 Reduced vitamin-D levels and altered expression of VDR have been associated with increased asthma severity, reduced lung function, and diminished responsiveness to corticosteroid therapy. Importantly, experimental evidence suggests that vitamin D signaling can negatively regulate EMT-related pathways, partly through modulation of transcription factors such as SNAIL1.9 Therefore, impaired vitamin D–VDR signaling may influence SNAIL1-related pathways and may be relevant to airway remodeling in asthma. This finding is biologically relevant, as reduced VDR expression may limit the anti-inflammatory and immunomodulatory effects of vitamin-D, thereby exacerbating airway inflammation and dysregulated immune responses.25
In the current study, the observed increase in SNAIL1 expression, alongside alterations in vitamin-D and VDR-related parameters, may be consistent with the hypothesis of a regulatory imbalance between pro-remodeling transcriptional programs and protective vitamin-D signaling in asthma. Although the differences did not reach significance, the directionality of change aligns with previous mechanistic studies linking vitamin-D deficiency to enhanced EMT activity and airway structural alterations.26 These findings may provide pulmonologists and respiratory healthcare providers with additional insights into the molecular features associated with asthma and may support a more comprehensive evaluation of factors that could influence disease-related pathways. Primary care and family medicine providers may also benefit from increased awareness of vitamin-D status as a potentially relevant factor in the overall assessment and management of patients with asthma. In addition, clinical nutrition specialists may contribute to the evaluation and management of nutritional factors, including vitamin-D status, as part of a multidisciplinary approach to patient care. Clinical laboratory specialists and molecular diagnosticians may play an important role in the investigation and future validation of molecular biomarkers related to asthma. Overall, this study highlights the potential value of collaboration among respiratory medicine, primary care, clinical nutrition, and laboratory medicine to advance the understanding of asthma pathophysiology and support future translational research.
In agreement with our findings, several experimental and clinical studies have indicated that elevated SNAIL1 expression is associated with subepithelial fibrosis, extracellular matrix deposition, and persistent airway inflammation in asthma.27,28 Notably, while some reports suggested that vitamin-D may suppress EMT-related pathways, including SNAIL1expression,29 our data revealed a trend toward higher SNAIL1 expression among asthmatic individuals regardless of vitamin-D status. This observation represents a preliminary molecular finding that warrants further investigation in asthma; however, further validation studies are required before considering its potential utility as a biomarker or therapeutic target.
The absence of statistical significance may be attributed to several factors, including biological heterogeneity among patients, variability in disease severity, and limited sample size. Asthma encompasses multiple endotypes with distinct molecular signatures, and transcriptional changes such as SNAIL1 upregulation may be prominent only in specific subgroups. As such, averaging expression levels across heterogeneous populations may obscure biologically meaningful signals present in subsets of patients. Although the linear trend lines showed a negative slope, indicating an inverse direction between VDR and SNAIL1 expression, the observed correlations were not statistically significant and should therefore be interpreted cautiously.
Interestingly, the comparison between the asthmatic low vitamin-D and asthmatic vitamin-D sufficient groups revealed a trend toward reduced VDR expression in one comparison, although the difference was not statistically significant. This observation raises the possibility that asthma-related inflammatory processes or other disease-related factors may influence VDR expression in addition to vitamin-D status. This interpretation is consistent with previous reports indicating that chronic inflammation can downregulate VDR expression, reducing cellular responsiveness to vitamin-D.30
Importantly, gene expression changes do not need to be large or uniform to exert functional effects. Modest alterations in transcription factor activity can amplify downstream signaling cascades and influence cellular behavior over time. Thus, the observed trend toward increased SNAIL1 expression may reflect early or context-dependent regulatory changes that contribute cumulatively to airway inflammation and remodeling. Taken together, the inverse expression patterns of SNAIL1 and VDR in Figure 3 may suggest a potential relationship between vitamin-D signaling and EMT-related pathways. Previous studies have suggested that reduced VDR signaling may influence SNAIL1 and other EMT-related pathways, potentially contributing to airway remodeling in asthma. These observations provide a potential mechanistic framework for further investigating how vitamin-D signaling may interact with SNAIL1-related pathways in asthma beyond serum vitamin-D levels alone.
Figure 3.
Scatter plot showing the relationship between log10-transformed VDR and SNAIL1 gene expression levels based on ΔCt values in the four study groups. Pearson’s correlation coefficient (r), R2, p-value, and sample size (n) are indicated for each panel. Each point represents one sample. A linear trend line is included for visual guidance, showing a moderate inverse correlation. Log10 transformation was applied due to wide variability in gene expression values. Panels represent: (A) asthmatic participants with low vitamin-D status (AL), (B) asthmatic presents with sufficient vitamin-D status (AS), (C) non-asthmatic participants with sufficient vitamin-D status (NS), and D. non-asthmatic participants with low vitamin-D status (NL).
The SNAIL1 missense variant identified in one participant may be of interest in the context of inter-individual variability in gene expression; however, its contribution cannot be established from the present study. Although the identified variant was a non-synonymous missense variant, in silico analyses using three independent prediction tools indicated that this variant was benign, suggesting that it was unlikely to have a significant functional effect on protein structure or activity. The identification of this rare variant highlights the possibility that genetic variation may contribute to inter-individual variability; however, its functional significance requires further investigation. Although the variant co-occurred with higher SNAIL1 expression in this participant, this observation is insufficient to establish a relationship between the variant and gene expression or asthma phenotype. Collectively, these observations raise the possibility that genetic variation in SNAIL1 and environmental or nutritional factors (vitamin-D levels) may contribute to inter-individual variation in SNAIL1- and VDR-related molecular features; however, this hypothesis requires validation in larger studies.
No additional coding variants were detected in exon 2 among the remaining participants. This observation highlights the possibility that rare, population-specific variants in SNAIL1 may contribute to inter-individual molecular variability; however, their potential relevance to asthma phenotypes requires further investigation. The novel variant was identified by Sanger sequencing, as demonstrated by the representative chromatograms shown in Figure 2. Further studies involving larger cohorts are needed to determine its prevalence and functional significance.
Despite the informative nature of these results, this study has certain limitations. Its cross-sectional design precludes causal inference. Gene expression analysis was based on relative quantification, and larger sample sizes would strengthen the statistical power of the findings. Potential residual confounding factors, including seasonal variation in vitamin-D levels, asthma severity, corticosteroid use, smoking status, and sun exposure, were not fully evaluated. Importantly, SNAIL1 and VDR expressions were assessed using RNA isolated from peripheral blood buffy coat-derived cells, which may not fully reflect gene expression patterns in airway epithelial or structural cells. Therefore, these findings should be interpreted as peripheral molecular observations rather than direct evidence of airway-specific molecular alterations. Future studies using airway-derived samples are warranted. Additionally, as the study population consisted of Jordanian patients recruited from a single clinical setting, the generalizability of these findings to other ethnic and geographic populations may be limited. Finally, functional studies are needed to further elucidate the direct regulatory relationship between VDR and SNAIL1. Our findings are broadly consistent with previous studies reporting inverse associations between vitamin-D status and asthma severity.31 This study provides preliminary observations regarding the relationship between vitamin-D status, SNAIL1 and VDR expression, and SNAIL1 genetic variation among Jordanian patients with asthma. These findings should be considered hypothesis-generating and require validation in larger, adequately powered and independent cohorts.
Conclusion
While the present study did not demonstrate statistically significant differences in SNAIL1 expression between groups, the observed trend toward higher SNAIL1 expression among asthmatic individuals, together with the established roles of vitamin-D, VDR, and SNAIL1 in immune regulation and airway remodeling, provides a biologically plausible basis for further investigation of their potential interplay in asthma. VDR expression showed a trend toward lower levels in asthmatic individuals, particularly among those with low vitamin-D status; however, these differences were not statistically significant. These findings suggest that alterations in vitamin D–VDR signaling may be relevant to asthma-related molecular pathways, although the observed expression patterns should be interpreted cautiously.
Furthermore, the identified SNAIL1 c.196C>T (p.Ala66Val) variant represents a novel finding in this study. Although its potential relevance to inter-individual molecular variability is of interest, its occurrence in a single participant precludes conclusions regarding its clinical or functional significance. Overall, this exploratory study provides preliminary, hypothesis-generating observations regarding the relationship between vitamin-D status, SNAIL1 and VDR expression, and SNAIL1 genetic variation among Jordanian patients with asthma. Larger, adequately powered and independent multicenter studies incorporating functional assays and stratification by asthma phenotypes are required to validate these observations and clarify the potential interplay between vitamin-D signaling, SNAIL1, and VDR in asthma.
Acknowledgments
The authors thank the staff of Jordan University Hospital at the University of Jordan for their technical support.
Funding Statement
This research was supported by the University of Jordan Research Fund 2024-171/2023. The authors received no external funding for this study. The research was conducted using the facilities and resources available at the University.
Disclosure
The authors report no conflicts of interest in this work.
References
- 1.Jarrar Y, Alhammadin G, Lee SJ. Genetic polymorphisms in cytochrome p450 enzymes involved in vitamin d metabolism and the vitamin d receptor: their clinical relevance. J Pers Med. 2025;15(4):128.PMID: 40278307; PMCID: PMC12028346. doi: 10.3390/jpm15040128 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Taylor SN. Calcium, magnesium, phosphorus, and vitamin D. World Rev Nutr Diet. 2021;122:122–13. [DOI] [PubMed] [Google Scholar]
- 3.Amrein K, Scherkl M, Hoffmann M, et al. Vitamin D deficiency 2.0: an update on the current status worldwide. Eur. J. Clin. Nutr. 2020;74(11):1498–1513. doi: 10.1038/s41430-020-0558-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Shraim R, MacDonnchadha C, Vrbanic L, McManus R, Zgaga L. Gene-environment interactions in vitamin D status and sun exposure: a systematic review with recommendations for future research. Nutrients. 2022;14(13):2735. doi: 10.3390/nu14132735 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Milan KL, Jayasuriya R, Harithpriya K, et al. Vitamin D resistant genes–promising therapeutic targets of chronic diseases. Food Funct. 2022;13(15):7984–7998. doi: 10.1039/D2FO00822J [DOI] [PubMed] [Google Scholar]
- 6.Carlberg C, Muñoz A. Vitamin D signaling and cancer. Semin Cancer Biol. 2022;79:217–230. doi: 10.1016/j.semcancer.2020.05.018 [DOI] [PubMed] [Google Scholar]
- 7.Brasier AR. Innate immunity, epithelial plasticity, and remodeling in asthma. In Precision Approaches to Heterogeneity in Asthma (pp. 265-285). Springer International Publishing: Cham; 2023 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Salmanpour F, Kian N, Samieefar N, KhazeeiTabari MA, Rezaei N. Asthma and vitamin D deficiency: occurrence, immune mechanisms, and new perspectives. J Immunol Res. 2022;2022(1):6735900. doi: 10.1155/2022/6735900 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Larriba MJ, García de Herreros A, Muñoz A. Vitamin D and the epithelial to mesenchymal transition. Stem Cells Inte. 2016;2016(1):6213872. doi: 10.1155/2016/6213872 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Alkhatatbeh MJ, Almomani HS, Abdul-Razzak KK, Samrah S. Association of asthma with low serum vitamin D and its related musculoskeletal and psychological symptoms in adults: a case-control study. Npj Primary Care Respir Med. 2021;31(1):27. doi: 10.1038/s41533-021-00239-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Sayers I, John C, Chen J, et al. Genetics of chronic respiratory disease. Nat Rev Genet. 2024;25(8):534–547. doi: 10.1038/s41576-024-00695-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.ElAbd A, Dasari H, Dodin P, et al. Associations between vitamin D status and biomarkers linked with inflammation in patients with asthma: a systematic review and meta-analysis of interventional and observational studies. Respir Res. 2024;25:344. doi: 10.1186/s12931-024-02967-z [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Salameh L, Alashqar A, Al-Daghri NM, et al. The role of vitamin d supplementation on airway remodeling in asthma: a systematic review. Nutrients. 2023;15(11):2477. doi: 10.3390/nu15112477 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Levy ML, Bacharier LB, Bateman E, et al. Key recommendations from GINA 2023 update. NPJ Prim Care Respir Med. 2023;33(1):7. doi: 10.1038/s41533-023-00330-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.World Medical Association. World Medical Association Declaration of Helsinki: ethical principles for medical research involving human subjects. Jama. 2013;310(20):2191–2194. doi: 10.1001/jama.2013.281053 [DOI] [PubMed] [Google Scholar]
- 16.Holick MF, Binkley NC, Bischoff-Ferrari HA, et al. Evaluation, treatment, and prevention of vitamin D deficiency: an Endocrine Society clinical practice guideline. J Clin Endocrinol Metab. 2011;96(7):1911–1930. doi: 10.1210/jc.2011-0385 [DOI] [PubMed] [Google Scholar]
- 17.Bilezikian JP, Formenti AM, Adler RA, et al. Vitamin D: dosing, levels, form, and route of administration: does one approach fit all?. Rev. Endocr. Metab. Disord. 2021;22(4):1201–1218. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta DeltaC(T)) Method. Methods. 2001;25(4):402–408 [DOI] [PubMed] [Google Scholar]
- 19.Untergasser A, Cutcutache I, Koressaar T, et al. Primer3--new capabilities and interfaces. Nucleic Acids Res. 2012;40(15):e115.PMID: 22730293; PMCID: PMC3424584. doi: 10.1093/nar/gks596 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Corpet F. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res.;16(22):10881–10890. PMID: 2849754; PMCID: PMC338945. doi: 10.1093/nar/16.22.10881 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Ng PC, Henikoff S. SIFT: predicting amino acid changes that affect protein function. Nucleic Acids Res. 2003;31(13):3812–3814. doi: 10.1093/nar/gkg509 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Adzhubei IA, Schmidt S, Peshkin L, et al. A method and server for predicting damaging missense mutations. Nature Methods. 2010;7(4):248–249. doi: 10.1038/nmeth0410-248 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Pejaver V, Urresti J, Lugo‑Martinez J, et al. MutPred2: inferring the molecular and phenotypic impact of amino acid variants. bioRxiv. 2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Hamza FN, Daher S, Fakhoury HM, Grant WB, Kvietys PR, Al-Kattan K. Immunomodulatory properties of vitamin D in the intestinal and respiratory systems. Nutrients. 2023;15(7):1696. doi: 10.3390/nu15071696 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Bikle DD. Vitamin D regulation of immune function. Curr Osteoporosis Rep. 2022;20(3):186–193. doi: 10.1007/s11914-022-00732-z [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ricca C, Aillon A, Viano M, Bergandi L, Aldieri E, Silvagno F. Vitamin D inhibits the epithelial-mesenchymal transition by a negative feedback regulation of TGF-β activity. J Steroid Biochem Mol Biol. 2019;187:97–105. doi: 10.1016/j.jsbmb.2018.11.006 [DOI] [PubMed] [Google Scholar]
- 27.Kalluri R, Weinberg RA. The basics of epithelial–mesenchymal transition. J Clin Investig. 2009;119(6):1420–1428. doi: 10.1172/JCI39104 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Zhang Y, Wang X, Yang H, Liu H, Lu Y, Han L. Association of epithelial–mesenchymal transition–related gene expression with airway remodeling and asthma severity. Clin Exp Immunol. 2019;49(4):547–556. doi: 10.1111/cea.13342 [DOI] [Google Scholar]
- 29.Fischer KD, Agrawal DK, Chen J. Vitamin D regulates TGF-β–induced epithelial–mesenchymal transition in lung epithelial cells. Respir Res. 2016;17:146. doi: 10.1186/s12931-016-0465-x [DOI] [Google Scholar]
- 30.Pfeffer PE, Hawrylowicz CM. Vitamin D in asthma: mechanisms of action and considerations for clinical trials. Chest. 2018;153(5):1229–1239. doi: 10.1016/j.chest.2017.09.005 [DOI] [PubMed] [Google Scholar]
- 31.Jolliffe DA, Stefanidis C, Wang Z, et al. Vitamin D metabolism is dysregulated in asthma. Am J Respir Crit Care Med. 2020;202(3):371–382. doi: 10.1164/rccm.201909-1867OC [DOI] [PMC free article] [PubMed] [Google Scholar]