Skip to main content
NCBI home page
Physiological Reports logoLink to Physiological Reports
. 2026 Sep 25;14(18):e71117. doi: 10.14814/phy2.71117

Acute high‐protein feeding induces hepatic amino acid accumulation in diabetic male mice prior to transcriptional adaptation

Hiroaki Sumioki 1, Eisuke Tomatsu 1, Yusuke Seino 1,2,✉, Shihomi Hidaka 1, Shinji Ueno 1, Sayumi Kanie 1, Koki Nishida 1, Takuya Haraguchi 1,2, Naoya Murao 1,2, Haruki Fujisawa 1, Takeshi Takayanagi 1, Yoshihisa Sugimura 1, Yoshitaka Hayashi 3,4, Atsushi Suzuki 1
PMCID: PMC13615171  PMID: 42791592

Abstract

Glucagon plays a pivotal role in hepatic amino acid metabolism; acute high‐protein diet feeding and diabetic condition both induce enhanced glucagon secretion. However, it remains unknown whether these two conditions alter hepatic amino acid metabolism through the same or different pathways. In this study, streptozotocin‐induced diabetic (STZ‐D) and nondiabetic (ND) mice received liquid normal control (LNC) or liquid high‐protein (LHP) diet. Plasma and hepatic parameters were analyzed 2 h post‐feeding. LHP increased plasma essential amino acids in both groups. Hepatic amino acid accumulation in LHP‐fed STZ‐D mice was increased compared to that in LNC‐fed STZ‐D mice but not in ND mice. In addition, LHP reduced hepatic glycogen while the expression of amino acid metabolism and urea cycle genes remained unchanged both in ND and STZ‐D mice. Compared with ND mice, STZ‐D mice showed upregulation of genes involved in gluconeogenesis and amino acid metabolism, together with an accumulation of early glycolytic intermediates and glycogen. These findings indicate that acute high‐protein intake induces non‐transcriptional regulation of amino acid metabolism within 2 h. The altered hepatic amino acid profile in STZ‐D mice is likely to be driven by increased hepatic amino acid uptake and accelerated gluconeogenesis.

Keywords: amino acid, glucagon, high‐protein diet, hyperglycemia, insulin, liver metabolism

1. INTRODUCTION

Oral glucose ingestion stimulates insulin secretion in both nondiabetic (ND) and type 2 diabetic (T2D) individuals; the early‐phase response is characteristically attenuated in T2D (Mitrakou et al., 1990; Yabe et al., 2015). Furthermore, while glucose suppresses plasma glucagon in individuals without T2D, it paradoxically leads to a slight elevation in those with T2D (Mitrakou et al., 1990; Yabe et al., 2015). In contrast, protein ingestion alone stimulates insulin secretion in both groups, albeit to a lesser extent than glucose (Alsalim et al., 2016; Ichikawa et al., 2023). Notably, protein serves as a potent secretagogue for glucagon regardless of glycemic status (Alsalim et al., 2016; Ichikawa et al., 2023). Consequently, mixed meals containing protein result in a concomitant rise in both hormones (Alsalim et al., 2016; El et al., 2021; Kondo‐Ando et al., 2019; Yabe et al., 2015).

During the postprandial state, insulin orchestrates glucose disposal through hepatic glycogen synthesis and peripheral glucose uptake (Yanagisawa, 2023). While insulin promotes amino acids uptake into peripheral tissues for protein synthesis, glucagon contributes to amino acid metabolism by stimulating hepatic gluconeogenesis, thereby facilitating the conversion of amino acids into glucose (James et al., 2017), indicating that these two hormones participate in amino acid homeostasis.

In type 1 diabetic (T1D) and T2D individuals, impaired insulin secretion and action combined with paradoxical hyperglucagonemia shifts the insulin‐to‐glucagon ratio (IGR) toward glucagon dominance (Dao et al., 2025; Ichikawa et al., 2019; Jiang & Zhang, 2003; Mitrakou et al., 1990; Müller et al., 1970; Wewer Albrechtsen et al., 2016; Yabe et al., 2015). This altered hormonal balance likely affects postprandial amino acid profiles, supporting findings that lean T2D individuals exhibit elevated plasma amino acid levels compared with nondiabetic controls (Alqudah et al., 2021; Grøndahl et al., 2024). While the increase in plasma amino acid concentrations following oral amino acid mixture ingestion during a euglycemic clamp was similar between individuals with T1D and ND (Rossetti et al., 2008), some of the plasma amino acid levels were higher in T1D individuals (Kawamori et al., 2023).

As glucagon and insulin coordinately regulate hepatic amino acid and glucose metabolism (James et al., 2017; Janah et al., 2019; Petersen & Shulman, 2018), we hypothesized that acute high‐protein diet feeding would similarly alter IGR due to its robust induction of glucagon secretion. However, it remains unclear whether these two conditions alter hepatic amino acid metabolism through the same or different pathways. We therefore compared the metabolic responses to an acute high protein diet feeding in diabetic and nondiabetic states in streptozotocin (STZ)‐induced diabetic (STZ‐D) and ND mice fed with a liquid high‐protein (LHP) diet or a liquid normal control (LNC) diet.

2. MATERIALS AND METHODS

2.1. Experimental animals and diets

Eight‐week‐old male C57BL/6J wild‐type mice (CLEA Japan, Inc., Tokyo, Japan) were maintained under a 12:12‐h light:dark cycle with ad libitum access to a standard laboratory chow diet (CLEA Rodent Diet CE‐2; CLEA Japan, Inc., Tokyo, Japan) and water. Mice were assigned to two groups: ND and STZ‐D mice. To induce diabetes, mice received intraperitoneal injections of STZ (50 mg/kg; Sigma‐Aldrich, Merck KGaA, Darmstadt, Germany; Cat. No. S0130) for five consecutive days as previously described in detail (Iida et al., 2016). Control mice were injected with saline for five consecutive days. After an 11‐day interval from the final injection, the mice were fasted for 16 h and then administered a liquid diet at 13 μL/g body weight (BW). The LNC group received a diet adjusted to 67.0% carbohydrate, 14.6% protein, and 18.4% fat (2.19 kcal/mL) (based on Meiji Maybalance Reha Support Mini; Meiji Co., Ltd., Tokyo, Japan). The LHP group received a diet supplemented with SAVAS protein (Meiji Co., Ltd.), resulting in a final composition of 23.4% carbohydrate, 58.2% protein, and 18.4% fat (2.18 kcal/mL). All the mouse experiments were performed in accordance with Fujita Health University protocols. The animal study protocol was approved by the Ethics Committee of Fujita Health University (AP18002: approval date 14 May 2018).

2.2. Plasma biochemical analyses

Blood was collected from the tip of the tails, and blood glucose levels were measured with an Antsense Duo Small Electrode Glucose Analyzer (Horiba, Kyoto, Japan). Blood samples were centrifuged (2000 g, 10 min, 4°C) twice, and the collected plasma samples were stored at −80°C until the biochemical analyses. Plasma hormone levels were measured using the following assays: insulin, Mouse/Rat Insulin ELISA Kit (Morinaga Institute of Biological Science, Kanagawa, Japan; Cat. No. M1108); Fibroblast Growth Factor 21 (FGF21), Mouse and Rat FGF21 ELISA Kit (BioVendor Inc., Brno, Czech Republic; Cat. No. RD291108200R); Glucagon ELISA Kit (Mercodia, Uppsala, Sweden; Cat. No. 10‐1281‐01); Glucose‐dependent insulinotropic polypeptide (GIP), GIP (total) ELISA kit (Millipore, Billerica, MA, USA; Cat. No. EZRMGIP‐55K); and corticosterone, Corticosterone Enzyme Immunoassay Kit (Arbor Assays, Ann Arbor, MI, USA; Cat. No. K014‐H1). Hormone concentrations were measured once for each sample using the indicated assay kits, in accordance with the manufacturers' protocols. Plasma amino acid concentrations were measured by standard assays at SRL, Inc. (Tokyo, Japan), as previously described (Ueno et al., 2022; Watanabe et al., 2012). The insulin‐to‐glucagon ratio (IGR) was calculated by [plasma insulin (pmol/L)/plasma glucagon (pmol/L)] and homeostasis model assessment of insulin resistance (HOMA‐IR) was calculated by [fasting glucose (mg/dL) × fasting insulin (μU/mL)]/405 (Maekawa et al., 2018; Matthews et al., 1985).

2.3. Isolation of RNA and quantitative PCR

Mice were euthanized by inhalation of 5% isoflurane (MSD Animal Health Tokyo Japan) and sacrificed 2 h after feeding and liver samples were collected. Total Ribonucleic acid (RNA) was extracted, Complementary Deoxyribonucleic acid (cDNA) was synthesized, and quantitative polymerase chain reactions (qPCR) were performed using QuantStudio 7 Flex Real‐Time PCR System (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA; Cat. No. 4485688) as previously described (Nishida et al., 2024; Ueno et al., 2022). Target gene messenger RNA (mRNA) levels were normalized to β‐actin as an internal control and expressed as fold change relative to LNC‐fed ND mice. The sequence of primers and abbreviation of the gene names are summarized in Table 1.

TABLE 1.

Primers used for quantitative real‐time PCR (qPCR).

Gene Forward primers (5′–3′) Reverse primers (3′–5′)
Phosphoenolpyruvate carboxykinase (Pepck) GTGTTTGTAGGAGCAGCCATGAG TAGCCGAAGAAGGGTCGCAT
Glucose‐6‐phosphatase, catalytic subunit (G6pc) CGGATCTACCTTGCTGCTCA AACAAGAAGATGGTGATGAGACAAT
Glucokinase (Gck) AGACGAAACACCAGATGTATTCC GAAGCCCTTGGTCCAGTTGAG
Glycogen synthase 2 (Gys2) GGAAGAAACTCTATGACGGGTTATT TCATCGATCATATTGTGAGTGGTC
Glycogen phosphorylase, liver form (Pygl) GCACTACTACGACAAGTGTCCC TAAATGGCCTCATCGCAG
Glutamic‐oxaloacetic transaminase (Got) TTGGTCTCACATCACTGAGCA GATGGAGGTAGCGACGTAATCTAG
Serine dehydratase (Sds) CAGCTTCCATGCTGCCATCAAG CCTCCTGGTCTGAGATGACCTC
Glutamic‐pyruvic transaminase (Gpt) TCCAGGCTTCAAGGAATGGAC CAAGGCACGTTGCACGATG
Glutamic‐pyruvic transaminase 2 (Gpt2) AACCATTCACTGAGGTAATCCGA GGGCTGTTTAGTAGGTTTGGGTA
Glutaminase 2 (Gls2) CGTCCGGTACTACCTCGGT TGTCCCTCTGCAATAGTGTAGAA
Alanine‐glyoxylate aminotransferase (Agxt) ACCTGCAGGAGATGGGCTTA GCACATAGCTGACGATGTCC
Argininosuccinate synthase 1 (Ass1) GCGACTATGAGCCCATCGAC GGCCCGCTCCTCTTTGTCAG
Arginase 1 (Arg1) TTCTGGGAGGCCTATCTTACAGA CCACTGCCGTGTTCACAGTA
Ornithine aminotransferase (Oat) TCAGTGAGAGGGAAAGGGTT CCGGATCTCATCCTCCTTGA
Carbamoyl‐phosphate synthase 1 (Cps1) GGAGTGGATACAAGAATGCTGAC GCAGGCGGATGACATTGTTTTT
Peroxisome proliferator‐activated receptor alpha (Pparα) CCTGAACATCGAGTGTCGAATAT GTTCTTCTTCTGAATCTTGCAGCT
Beta‐Actin (β‐actin) CATCCGTAAAGACCTCTATGCCAAC ATGGAGCCACCGATCCACA
Open in a new tab

2.4. Hepatic immunoblotting analysis

Liver proteins were extracted in radioimmunoprecipitation assay (RIPA) buffer containing PhosSTOP phosphatase inhibitor cocktail (Roche Diagnostics, Mannheim, Germany; Cat. No. 04906837001) and cOmplete Mini protease inhibitors (Roche Diagnostics; Cat. No. 11836170001) Total protein (30 μg) was separated on a 10% sodium dodecyl sulfate–polyacrylamide gel and transferred onto polyvinylidene difluoride membranes (Merck Millipore, Billerica, MA, USA; Cat. No. IPVH00010). After blocking with 3% bovine serum albumin in Tris‐buffered saline containing 0.1% Tween 20 (BSA/TBS‐T), the membranes were incubated with primary antibodies against phospho‐protein kinase B (p‐Akt; Ser473; Cat. No. 4060; 1:2000), Akt (Cat. No. 9272, 1:1000), phospho‐glycogen synthase kinase 3β (p‐GSK3β; Ser9; Cat. No. 9336; 1:1000), GSK3β (Cat. No. 12456, 1:1000), phospho‐cAMP response element‐binding protein (p‐CREB; Ser133; Cat. No. 9198; 1:1000), CREB (Cat. No. 9197, 1:1000), and glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) (Cat. No. 2118; 1:2000). All primary antibodies were obtained from Cell Signaling Technology (Danvers, MA, USA). Blots were imaged and quantified using ImageJ software (ver. 1.53e, National Institutes of Health, Bethesda, MD, USA) as previously reported (Nishida et al., 2024). The phosphorylation levels of AKT, CREB, and GSK3β were expressed relative to their corresponding total protein levels and normalized to the mean value of the ND‐LNC group.

2.5. Measurement of liver glycogen content

Liver samples (10 mg) were homogenized in 200 μL ddH2O, boiled for 10 min, and centrifuged (17,700 g, 10 min). The supernatant was analyzed using a Glycogen Colorimetric Assay Kit II (Abcam, Cambridge, UK; Cat. No. ab169558). Hepatic glycogen contents were measured once for each sample using the indicated assay kits, in accordance with the manufacturers' protocols.

2.6. Hepatic metabolome analysis

Metabolomic analysis was performed with modifications as previously described (Murao et al., 2025). Briefly, the liver tissue sample (30 mg) was homogenized with ice‐cold extraction buffer (41.9% methanol, 41.9% chloroform, and 16.2% ultrapure water containing the internal standard solution), deproteinized by ultrafiltration (Human Metabolome Technologies, Yamagata, Japan; Cat. No. UFC3LCCNB‐HMT), and lyophilized. Subsequently, metabolite concentrations were measured in both positive and negative ion modes using a G7100A capillary electrophoresis system coupled to a G6224A time‐of‐flight LC/MS (Agilent Technologies, Santa Clara, CA, USA). Chromatograms and mass spectra were analyzed using MassHunter Qualitative Analysis version 10.0 s (Agilent Technologies; RRID:SCR_015040, CA, USA). Annotation and quantification of chromatogram peaks were performed using a standard mixture (Human Metabolome Technologies, Yamagata, Japan; Cat. No. H3304‐1031, H3304‐1032, H3304‐1034, H3304‐1036).

2.7. Statistical analysis

Sample sizes were estimated from the expected effect size based on preliminary experimental trials. No randomization or blinding was used. Data are expressed as mean ± standard error of the mean (SEM). Statistical analyses were performed using two‐way ANOVA followed by Tukey's multiple comparisons test. A p value of <0.05 was considered statistically significant. All analyses were conducted using GraphPad Prism 10 for Windows (GraphPad Software, San Diego, CA, USA).

3. RESULTS

3.1. Metabolic and hormonal responses to LNC and LHP in ND and STZ‐D mice

We previously reported that mice treated with STZ (50 mg/kg) for 5 days showed hyperglycemia due to decreased insulin secretion from 1 week after post‐treatment compared with control mice (Iida et al., 2016). In the present study, we confirmed that STZ‐D mice exhibited significantly higher blood glucose levels and lower body weight than ND mice under fed ad libitum condition (Figure S1A,B).

Postprandial blood glucose levels were higher in STZ‐D mice compared to those in ND mice under both diets; LHP administration effectively suppressed this elevation regardless of the diabetic condition (Figure 1a). The plasma concentrations of insulin and glucagon were increased under both LNC and LHP, with insulin concentration being higher at 60 min than at 120 min, whereas glucagon concentration was higher at 120 min than at 60 min. The insulin secretion in response to LNC was significantly attenuated in STZ‐D mice, whereas the response to LHP was comparable between ND and STZ‐D mice. Glucagon secretion was greater under LHP than under LNC in both ND and STZ‐D mice (Figure 1b,c). Regardless of the diabetic state, plasma GIP levels at 60 min were significantly lower in the LHP group than in the LNC group (Figure 1d). In ND mice, the insulin‐to‐glucagon ratio (IGR) at 60 min was significantly lower in the LHP group compared to that in the LNC group. In the LNC‐fed groups, the IGR at 60 min was significantly lower in STZ‐D mice than that in ND mice. Notably, in STZ‐D mice, no significant difference in IGR was observed between the LNC and LHP groups (Figure 1e). STZ‐D mice tended to have higher glucose and insulin levels before liquid food loading, although the difference was not statistically significant. However, STZ‐D mice showed significantly higher HOMA‐IR values than ND mice (Figure 1f). Thus, STZ‐D mice exhibited hepatic insulin resistance combined with attenuated insulin secretion in response to food loading. No significant differences in plasma corticosterone levels at 120 min were observed between the LNC and LHP diets in either ND or STZ‐D mice (Figure 1g). In ND mice, plasma FGF21 levels at 120 min were significantly lower in the LHP group than in the LNC group. Furthermore, LNC‐fed STZ‐D mice tended to exhibit significantly lower 120‐min FGF21 levels compared to LNC‐fed ND mice, but any difference did not reach the statistical significance. While FGF21 levels in STZ‐D mice exhibited a downward trend in the LHP group relative to the LNC group, there was not a statistically significant difference (Figure 1h).

FIGURE 1.

FIGURE 1

Open in a new tab

Effects of acute LHP administration on postprandial metabolic parameters in ND and STZ‐D mice. (a) Blood glucose levels; (b) plasma insulin concentrations; (c) plasma glucagon concentrations; (d) plasma GIP concentrations; (e) IGR; (f) HOMA‐IR; (g) plasma corticosterone levels and (h) plasma FGF21 concentrations at 120 min; black bars, ND mice fed LNC; red bars, ND mice fed LHP; blue bars, STZ‐D mice fed LNC; green bars, STZ‐D mice fed LHP; Data are presented as mean ± standard deviation (SD), n = 7–8 per group. Statistical analysis was performed using (a)–(h) two‐way ANOVA followed by Tukey's multiple comparison test. p Values are shown in the figure. FGF21, fibroblast growth factor 21; GIP, glucose‐dependent insulinotropic polypeptide; HOMA‐IR, homeostasis model assessment of insulin resistance; IGR, insulin‐to‐glucagon ratio; LNC, liquid normal diet; LHP, liquid high‐protein diet; ND, nondiabetic; STZ‐D, streptozotocin‐induced diabetic.

3.2. Plasma amino acid profiles in ND and STZ‐D mice fed LNC or LHP

LHP administration significantly elevated the plasma concentrations of all essential amino acids (EAAs), including branched‐chain amino acids (BCAAs), compared to LNC regardless of diabetic status, except for phenylalanine in ND mice. On LNC ingestion, STZ‐D mice generally exhibited lower levels of amino acids than ND mice, except for arginine, aspartic acid, tryptophan, and BCAAs. On LHP ingestion, the concentrations of arginine, tyrosine, phenylalanine, lysine, tryptophan, and BCAAs were higher in STZ‐D mice. Among these, arginine, tyrosine, phenylalanine, tryptophan, and isoleucine concentrations were significantly increased in STZ‐D mice compared to ND mice (Table 2).

TABLE 2.

Plasma amino acid concentrations in nondiabetic (ND) and streptozotocin‐induced diabetic (STZ‐D) mice fed a liquid normal control diet (LNC) or a liquid high‐protein diet (LHP) at 120 min post administration.

Plasma amino acids Mean ± SD p Value
ND‐LNC ND‐LHP STZ‐D‐LNC STZ‐D‐LHP ND‐LNC vs. ND‐LHP STZ‐D‐LNC vs. STZ‐D‐LHP ND‐LNC vs. STZ‐D‐LNC ND‐LHP vs. STZ‐D‐LHP
(nmol/mL)
NEAAs Alanine 416.8 ± 74.0 470.5 ± 77.1 309.0 ± 61.6 442.9 ± 52.3 0.3908 0.0031 0.0188 0.8390
Arginine 59.5 ± 10.3 67.8 ± 9.6 67.1 ± 9.0 82.0 ± 13.7 0.3593 0.0304 0.4429 0.0424
Asparagine 48.3 ± 4.1 76.9 ± 14.3 37.0 ± 6.1 59.3 ± 7.9 <0.0001 0.0001 0.0576 0.0019
Aspartic acid 12.0 ± 3.8 13.3 ± 4.4 15.0 ± 14.7 12.9 ± 4.3 0.9897 0.9554 0.8872 0.9997
Cystine 5.4 ± 1.4 6.6 ± 1.7 5.2 ± 0.9 5.0 ± 0.5 0.6768 0.9983 0.9117 0.2115
Glutamine 663.3 ± 48.5 749.5 ± 108.2 568.8 ± 100.1 675.6 ± 86.8 0.1999 0.0810 0.1417 0.3189
Glutamic acid 44.4 ± 10.6 45.1 ± 8.9 42.9 ± 26.2 39.4 ± 8.8 0.9997 0.9722 0.9978 0.8929
Glycine 204.0 ± 35.0 182.4 ± 15.8 155.9 ± 25.9 144.1 ± 12.9 0.3494 0.7931 0.0056 0.0317
Proline 82.3 ± 9.2 135.8 ± 23.7 60.9 ± 10.1 118.9 ± 16.0 <0.0001 <0.0001 0.0174 0.0757
Serine 125.6 ± 16.5 155.6 ± 22.5 93.3 ± 21.8 124.8 ± 14.6 0.0177 0.0123 0.0099 0.0144
Tyrosine 50.2 ± 9.7 57.7 ± 10.5 48.0 ± 6.3 82.2 ± 32.7 0.8249 0.0036 0.9934 0.0441
EAAs Phenylalanine 83.9 ± 8.1 86.2 ± 11.5 83.0 ± 10.2 107.6 ± 14.1 0.9722 0.0008 0.9984 0.0032
Lysine 248.4 ± 28.6 377.0 ± 57.4 197.3 ± 34.8 400.9 ± 102.8 0.0012 <0.0001 0.3138 0.8407
Methionine 68.6 ± 7.7 93.7 ± 14.0 52.0 ± 8.9 81.6 ± 12.3 0.0004 <0.0001 0.0192 0.1167
Threonine 245.9 ± 29.5 487.1 ± 75.4 180.0 ± 48.2 359.0 ± 37.3 <0.0001 <0.0001 0.0534 0.0001
Tryptophan 53.2 ± 7.4 85.3 ± 8.7 54.2 ± 10.4 96.5 ± 9.9 <0.0001 <0.0001 0.9936 0.0443
Histidine 67.0 ± 5.3 79.9 ± 9.7 56.3 ± 6.0 74.7 ± 12.2 0.0170 0.0006 0.0556 0.5610
BCAAs Isoleucine 91.8 ± 11.5 222.8 ± 61.0 105.8 ± 20.4 296.6 ± 85.4 0.0003 <0.0001 0.9498 0.0480
Leucine 190.3 ± 34.2 457.9 ± 99.8 195.0 ± 34.9 568.3 ± 137.7 <0.0001 <0.0001 0.9995 0.0753
Valine 192.0 ± 43.3 546.0 ± 99.9 202.4 ± 42.4 645.0 ± 178.9 <0.0001 <0.0001 0.9960 0.1809
Open in a new tab

Note: Data are presented as mean ± standard deviation (SD), n = 8 per group. Statistical analysis was performed using two‐way ANOVA followed by Tukey's multiple comparison test.

Abbreviations: BCAAs, branched‐chain amino acids; EAAs, essential amino acids; LHP, liquid high‐protein diet; LNC, liquid normal control diet; ND, nondiabetic; NEAAs, nonessential amino acids.

3.3. Hepatic amino acid profiles in ND and STZ‐D mice fed LNC or LHP

Next, we examined metabolite profiles in the liver. In ND mice, amino acid content did not differ significantly between the LNC and LHP groups, except for significantly higher glutamine content in the LHP group. In contrast, in STZ‐D mice, the LHP group showed significant increases in alanine, aspartic acid, proline, threonine, and BCAAs, along with a trend toward increased lysine levels; notably, glutamine was the sole exception, being significantly lower than in the LNC group. Furthermore, STZ‐D mice displayed significantly higher levels of asparagine, glycine, tyrosine, and phenylalanine, and a higher trend of methionine, compared to ND mice. These differences were further accentuated by LHP loading, which resulted in an increase in STZ‐D mice in all EAAs except for histidine (Table 3). The lower plasma amino acid levels and higher hepatic amino acid profiles suggested that amino acid uptake by the liver is accelerated in STZ‐D mice administered LHP.

TABLE 3.

Hepatic amino acid in nondiabetic (ND) and diabetic (STZ‐D) mice fed a liquid normal control diet (LNC) or a liquid high‐protein diet (LHP) at 120 min post administration.

Metabolite Mean ± SD p Value
ND‐LNC ND‐LHP STZ‐D‐LNC STZ‐D‐LHP ND‐LNC vs. ND‐LHP STZ‐D‐LNC vs. STZ‐D‐LHP ND‐LNC vs. STZ‐D‐LNC ND‐LHP vs. STZ‐D‐LHP
(pmol/mg tissue)
NEAAs Alanine 2372.6 ± 514.4 2199.6 ± 459.3 2553.3 ± 416.2 3670.2 ± 996.1 0.9469 0.0102 0.9403 0.0008
Arginine 5.1 ± 1.6 4.0 ± 1.1 4.6 ± 1.0 5.8 ± 1.3 0.1792 0.1541 0.7924 0.0132
Asparagine 89.8 ± 14.5 98.5 ± 19.4 160.9 ± 40.5 157.0 ± 28.0 0.9314 0.9929 0.0004 0.0031
Aspartic acid 396.5 ± 101.8 381.6 ± 84.3 361.6 ± 45.7 598.1 ± 228.0 0.9962 0.0115 0.9553 0.0220
Cystine 14.2 ± 7.4 13.8 ± 6.4 7.3 ± 2.1 9.5 ± 4.6 0.9976 0.7303 0.0199 0.2214
Glutamine 3322.8 ± 635.2 4001.4 ± 517.6 3661.3 ± 441.2 2563.2 ± 380.5 0.0476 0.0009 0.5119 <0.0001
Glutamic acid 1692.4 ± 532.8 1393.4 ± 521.7 1186.6 ± 163.8 1743.8 ± 627.4 0.6028 0.1228 0.1807 0.4746
Glycine 1892.2 ± 254.5 2147.0 ± 216.9 2335.6 ± 259.4 2066.6 ± 158.9 0.1287 0.1012 0.0033 0.8849
Proline 212.7 ± 55.5 160.4 ± 43.7 232.9 ± 59.1 393.9 ± 146.3 0.5914 0.0041 0.9605 <0.0001
Serine 362.0 ± 64.6 396.3 ± 116.9 525.6 ± 130.2 649.6 ± 219.2 0.9630 0.3328 0.1340 0.0097
Tyrosine 110.9 ± 23.6 132.4 ± 34.3 204.6 ± 50.0 246.2 ± 72.0 0.8189 0.3543 0.0054 0.0008
EAAs Phenylalanine 102.4 ± 19.6 120.9 ± 27.2 178.0 ± 38.2 182.7 ± 43.4 0.7194 0.9932 0.0016 0.0101
Lysine 587.8 ± 239.6 501.1 ± 114.7 702.5 ± 149.1 1457.6 ± 1091.7 0.9889 0.0555 0.9752 0.0114
Methionine 48.3 ± 7.2 55.0 ± 15.1 78.4 ± 26.2 94.3 ± 30.6 0.9364 0.5308 0.0725 0.0135
Threonine 528.6 ± 104.4 381.6 ± 96.2 522.8 ± 71.2 759.6 ± 188.8 0.1109 0.0048 0.9997 <0.0001
Tryptophan 28.6 ± 6.2 24.7 ± 4.7 34.1 ± 7.4 36.5 ± 5.4 0.5410 0.8456 0.2465 0.0027
Histidine 439.7 ± 87.4 451.4 ± 80.5 442.7 ± 46.5 513.5 ± 101.2 0.9900 0.2860 0.9998 0.3960
BCAAs Isoleucine 208.6 ± 60.9 155.5 ± 33.4 224.0 ± 63.6 369.2 ± 117.4 0.4586 0.0028 0.9719 <0.0001
Leucine 437.7 ± 125.8 340.0 ± 71.3 446.9 ± 113.3 754.7 ± 258.2 0.5677 0.0025 0.9993 <0.0001
Valine 447.8 ± 102.4 288.9 ± 53.9 418.1 ± 103.2 771.4 ± 284.3 0.1776 0.0006 0.9781 <0.0001
Open in a new tab

Note: Data are presented as mean ± standard deviation (SD), n = 8 per group. Statistical analysis was performed using two‐way ANOVA followed by Tukey's multiple comparison test.

Abbreviations: BCAAs, branched‐chain amino acids; EAAs, essential amino acids; LHP, liquid high‐protein diet; LNC, liquid normal control diet; ND, nondiabetic; NEAAs, nonessential amino acids.

3.4. Hepatic glycogen content in ND and STZ‐D mice fed LNC or LHP

Hepatic glycogen content was higher in STZ‐D mice than in ND mice, regardless of the dietary composition. Furthermore, in STZ‐D mice, the LHP group showed significantly lower glycogen content compared to the LNC group, while a similar downward trend was observed in ND mice (Figure 2).

FIGURE 2.

FIGURE 2

Open in a new tab

Hepatic glycogen content in ND and STZ‐D mice following acute LHP administration. Hepatic glycogen content was measured 120 min after loading with LNC or LHP in ND and STZ‐D mice; black bars, ND mice fed LNC; red bars, ND mice fed LHP; blue bars, STZ‐D mice fed LNC; green bars, STZ‐D mice fed LHP; Data are presented as mean ± standard deviation (SD), n = 8 per group. Statistical analysis was performed using two‐way ANOVA followed by Tukey's multiple comparison test. p Values are shown in the figure. LHP, liquid high‐protein diet; LNC, liquid normal diet; ND, nondiabetic; STZ‐D, streptozotocin‐induced diabetic.

3.5. Hepatic glycolytic intermediates in ND and STZ‐D mice fed LNC or LHP

In contrast, glycolytic metabolite levels showed no significant differences between the LNC and LHP groups in either ND or STZ‐D mice. However, STZ‐D mice exhibited significantly higher concentrations of the initial glycolytic metabolites: glucose 1‐phosphate, glucose 6‐phosphate, and fructose 6‐phosphate, compared to ND mice (Table 4).

TABLE 4.

Hepatic glycolytic intermediate levels in nondiabetic (ND) and diabetic (STZ‐D) mice fed a liquid normal control diet (LNC) or a liquid high‐protein diet (LHP) at 120 min post administration.

Metabolite Mean ± SD p Value
ND‐LNC ND‐LHP STZ‐D‐LNC STZ‐D‐LHP ND‐LNC vs. ND‐LHP STZ‐D‐LNC vs. STZ‐D‐LHP ND‐LNC vs. STZ‐D‐LNC ND‐LHP vs. STZ‐D‐LHP
(pmol/mg tissue)
Glucose 1‐phosphate 64.9 ± 15.9 84.9 ± 20.9 112.6 ± 36.9 128.2 ± 35.8 0.4920 0.6815 0.0127 0.0256
Glucose 6‐phosphate 156.8 ± 48.9 190.3 ± 53.8 286.0 ± 53.6 306.5 ± 75.3 0.6522 0.8896 0.0010 0.0029
Fructose 6‐phosphate 36.8 ± 12.5 43.0 ± 9.0 72.4 ± 13.2 77.1 ± 19.4 0.8065 0.9052 0.0002 0.0004
Fructose 1,6‐diphosphate 14.8 ± 3.9 44.5 ± 39.4 51.1 ± 38.8 56.2 ± 26.1 0.2721 0.9885 0.1343 0.8822
Lactic acid 8911.2 ± 1621.6 10198.3 ± 3194.7 11243.6 ± 2171.2 12217.0 ± 3370.2 0.7599 0.8781 0.3088 0.4309
Acetyl CoA_divalent 11.1 ± 4.7 19.1 ± 7.5 5.8 ± 2.6 3.5 ± 1.6 0.0179 0.7825 0.1695 <0.0001
Citric acid 58.1 ± 20.3 77.3 ± 29.0 84.0 ± 25.6 83.0 ± 36.6 0.5085 0.9999 0.2585 0.9741
Succinic acid 482.2 ± 144.7 337.9 ± 156.4 129.6 ± 34.8 195.2 ± 55.7 0.0243 0.5003 <0.0001 0.0261
Fumaric acid 263.6 ± 64.1 261.1 ± 72.6 245.0 ± 38.3 388.3 ± 104.7 0.9999 0.0032 0.9530 0.0091
Malic acid 726.3 ± 214.7 716.8 ± 265.7 660.4 ± 91.0 927.9 ± 231.0 0.9997 0.0615 0.9102 0.1794
3‐Hydroxybutyric acid 1193.8 ± 333.5 1535.3 ± 441.2 1390.5 ± 496.6 1279.9 ± 704.7 0.6112 0.9777 0.8910 0.7920
2‐Hydroxybutyric acid 141.3 ± 42.8 76.7 ± 38.8 94.7 ± 31.0 216.0 ± 67.7 0.0799 0.0005 0.2822 0.0001
Glycerol 3‐phosphate 1531.5 ± 238.5 1693.1 ± 398.1 1541.6 ± 325.9 1336.5 ± 427.8 0.7351 0.1375 >0.9999 0.1375
Open in a new tab

Note: Data are presented as mean ± standard deviation (SD), n = 8 per group. Statistical analysis was performed using two‐way ANOVA followed by Tukey's multiple comparison test.

Abbreviations: LHP, liquid high‐protein diet; LNC, liquid normal control diet; ND, nondiabetic.

3.6. Gene expression in the liver of ND and STZ‐D mice fed LNC or LHP

We next examined the expression levels of genes involved in glucose and amino acid metabolism in the liver. No significant differences in gene expression between LNC‐fed and LHP‐fed were observed except for Cps1 in STZ‐D. In addition, a significant difference in expression levels was observed in a limited number of genes between ND and STZ‐D mice: G6pc and Gls2 in the LNC‐fed group and Arg1 and Cps1 in the LHP group. These data suggest changes in gene expression play only a minor role in differential amino acid accumulation in the liver among the four groups (Figure 3).

FIGURE 3.

FIGURE 3

Open in a new tab

Hepatic mRNA expression levels of genes involved in glucose and amino acid metabolism; black bars, ND mice fed LNC; red bars, ND mice fed LHP; blue bars, STZ‐D mice fed LNC; green bars, STZ‐D mice fed LHP; Data are presented as mean ± standard deviation (SD), n = 8 per group. Statistical analysis was performed using two‐way ANOVA followed by Tukey's multiple comparison test. p Values are shown in the figure. Agxt, Alanine‐glyoxylate aminotransferase; Arg1, Arginase 1; Ass1, Argininosuccinate synthase 1; Cps1, Carbamoyl‐phosphate synthase 1; G6pc, Glucose‐6‐phosphatase, catalytic subunit; Gck, Glucokinase; Gls2, Glutaminase 2; Got, Glutamic‐oxaloacetic transaminase; Gpt, Glutamic‐pyruvic transaminase; Gpt2, Glutamic‐pyruvic transaminase 2; Gys2, Glycogen synthase 2; LHP, liquid high‐protein diet; LNC, liquid normal diet; mRNA, messenger Ribonucleic Acid; ND, nondiabetic mice; Oat, Ornithine aminotransferase; Pepck, Phosphoenolpyruvate carboxykinase; Pparα, Peroxisome proliferator‐activated receptor alpha; Pygl, Glycogen phosphorylase, liver form; Sds, Serine dehydratase; STZ‐D, diabetic model mice treated with STZ.

3.7. Hepatic immunoblotting analysis in ND and STZ‐D mice fed LNC or LHP

Finally, to evaluate insulin and glucagon signaling, we analyzed the phosphorylation levels of Akt, GSK3β, and CREB in mouse liver tissues at 120 min by western blotting. In ND mice, Akt phosphorylation tended to be decreased in the LHP group compared with the LNC group, although any difference was not statistically significant (Figure 4a). On the other hand, in STZ‐D mice, Akt phosphorylation was significantly lower in the LHP group than in the LNC group (Figure 4a). No significant differences were observed in GSK3β or CREB phosphorylation among the four groups (Figure 4b,c).

FIGURE 4.

FIGURE 4

Open in a new tab

Hepatic immunoblotting analysis. Representative Western blot images and densitometric quantification of hepatic (a) phosphorylated AKT (p‐AKT)/total AKT, (b) phosphorylated GSK3β (p‐GSK3β)/total GSK3β, and (c) phosphorylated CREB (p‐CREB)/total CREB in ND and STZ‐D mice fed LNC or LHP. Phosphorylation levels were calculated as the ratio of phosphorylated to total protein and expressed relative to the mean value of the ND‐LNC group, which was set to 1.0. Representative GAPDH blots are shown as a loading control. Black bars, ND mice fed LNC; red bars, ND mice fed LHP; blue bars, STZ‐D mice fed LNC; green bars, STZ‐D mice fed LHP. Data are presented as mean ± standard deviation (SD), n = 6 per group. Statistical analysis was performed using two‐way ANOVA followed by Tukey's multiple‐comparison test. Exact p values are shown in the figure. AKT, protein kinase B; CREB, cAMP response element‐binding protein; GAPDH, glyceraldehyde‐3‐phosphate dehydrogenase; GSK3β, glycogen synthase kinase 3β; LHP, liquid high‐protein diet; LNC, liquid normal diet; ND, nondiabetic; STZ‐D, streptozotocin‐induced diabetic.

4. DISCUSSION

In the present study, we demonstrate that acute administration of a high‐protein diet induces rapid metabolic changes characterized by increased plasma glucagon and amino acids levels and differential hepatic amino acid metabolism between diabetic and nondiabetic states prior to detectable changes in gene expression in the liver. The STZ‐D mice exhibited attenuated insulin secretion in response to meal loading.

We first investigated the effects of an acute high‐protein diet on hormone secretion in both nondiabetic and diabetic mice. Glucose stimulates insulin and GIP secretion more effectively than protein (Ahrén, 2022; Elliott et al., 1993). In the present study, at 60 min after the meal load, plasma insulin levels were lower in the LHP‐fed ND mice than in the LNC‐fed ND mice, and plasma GIP levels were lower in the LHP group than in the LNC group. These findings are likely attributable to the lower carbohydrate content in the meal. Interestingly, despite a reduction in insulin secretion, the postprandial blood glucose levels after the meal load were lower in LHP‐fed STZ‐D mice than in LNC‐fed STZ‐D mice, whereas insulin secretion itself remained unchanged. This indicates that low carbohydrate content in meals plays a crucial role in improving postprandial blood glucose levels under conditions of impaired insulin secretion. Conversely, in LHP‐fed ND mice, plasma glucagon levels were significantly higher at 60 and 120 min than those in LNC‐fed ND mice, whereas in the STZ‐D mice, a significant increase was observed only at 120 min. This discrepancy may well be due to the enhanced glucagon secretion induced by hyperglycemia in STZ‐D mice, which may have partially masked the glucagon secretory response to LHP. On the other hand, plasma GIP levels were significantly lower at 60 min in the LHP group than in the LNC group, regardless of the presence of diabetes. This suggests that the phenomenon wherein protein stimulates less GIP secretion compared with glucose remains unaltered even in the diabetic state.

Despite evidence that chronic protein and sucrose intake modulate FGF21 in rodents (Laeger et al., 2014; Maekawa et al., 2017), the effects of acute administration remain largely unexplored. While acute intake of carbohydrate, such as glucose and fructose, elevates plasma FGF21 in human (Dushay et al., 2014; Samms et al., 2017), we found that plasma FGF21 levels were lower in ND‐LHP and STZ‐D‐LNC fed mice compared to those in ND‐LNC fed mice 2 h after administration of the diets. These results suggest that FGF21 secretion is acutely regulated by dietary protein levels and/or insulin action. Further studies are required to clarify how acute protein intake modulates FGF21 dynamics.

Glucagon and insulin coordinately regulate hepatic amino acid and glucose metabolism (James et al., 2017; Janah et al., 2019; Petersen & Shulman, 2018). While we previously reported that in mice fed a high‐protein diet for 7 days, plasma amino acids levels except for BCAAs do not differ from those in mice fed normal chow due to the glucagon‐mediated increase of hepatic expression of enzymes involved in amino acid metabolism (Ueno et al., 2022), the current study focused on the acute response to amino acids and/or glucagon on plasma amino acid concentrations in mice (Galsgaard et al., 2019; Galsgaard et al., 2020; Grøndahl et al., 2024; Kjeldsen et al., 2023; Sadri et al., 2017; Winther‐Sørensen et al., 2020). Since these responses occur instantaneously, a non‐transcriptional mechanism is assumed to be involved. Indeed, in the present study, no significant differences were observed in gene expression levels of enzymes in amino acid metabolism between LNC‐fed mice and LHP‐fed mice regardless of diabetes, 2 h after oral meal administration.

Hepatic glucose metabolism is coordinately regulated by insulin‐ and glucagon‐mediated signaling pathways. Insulin promotes glycogen synthesis through Akt‐dependent phosphorylation and inactivation of GSK3β, thereby relieving the inhibitory phosphorylation of glycogen synthase (Wang et al., 2022). In contrast, glucagon activates the cAMP–PKA–CREB signaling pathway, leading to the transcriptional induction of gluconeogenic genes and subsequently increasing hepatic glucose production (Janah et al., 2019). In the present study, Akt phosphorylation was significantly decreased in the LHP group compared to the LNC group, which is consistent with the lower liver glycogen content observed in the LHP group relative to the LNC group. However, phosphorylation of GSK3β, a key downstream effector of Akt in glycogen synthesis, showed no difference among the four groups. Furthermore, despite the elevated plasma glucagon levels in the LHP group and STZ‐D mice, CREB phosphorylation remained unchanged across the four groups. These discrepancies may be attributable to differences in temporal post‐feeding dynamics. Further investigation is required to analyze time‐course alterations in hormonal profiles, liver gene expression, and protein phosphorylation during feeding experiments.

Furthermore, although the IGR at 60 min was significantly decreased both in LHP‐fed ND mice and LNC‐fed STZ‐D mice compared with that in ND‐LNC, hepatic amino acid contents remained unchanged in LHP‐fed ND mice and were altered in only a subset of amino acids in LNC‐fed STZ‐D mice. These results indicate that amino acid metabolism is determined by multiple factors, which include nutrient availability, tissue‐specific demand, and the metabolic state, and not solely by the IGR.

Nevertheless, plasma amino acid profiles showed distinct changes: STZ‐D‐LNC mice exhibited lower levels of eight amino acids, including alanine, likely due to accelerated gluconeogenesis from amino acids (Korenfeld et al., 2021; Winther‐Sørensen et al., 2020), whereas all essential amino acids (EAAs) levels, except for phenylalanine in ND‐LHP mice, were higher in LHP‐fed mice than in LNC‐fed mice regardless of diabetic status. These results suggest that the acute postprandial amino acid excursion is primarily regulated by non‐transcriptional pathways—including the diversion of amino acids toward hepatic gluconeogenesis—and/or altered peripheral uptake, rather than immediate changes in hepatic enzymatic induction. The precise mechanisms remain to be fully elucidated.

Conventionally, insulin and glucagon are thought to act as opposing regulators of glycogen metabolism (Jiang & Zhang, 2003; Shah et al., 2000; Uehara et al., 2024; Wewer Albrechtsen et al., 2016), and diabetic models often exhibit reduced glycogen due to impaired insulin action (Del Prato et al., 1993; Gannon & Nuttall, 1997; Krssak et al., 2004). However, hepatic glycogen content was paradoxically higher in STZ‐D mice than in ND mice despite impaired insulin secretion and a lower insulin‐to‐glucagon ratio. Recently, it was reported that glucagon may also contribute to postprandial hepatic glycogen repletion after mix‐nutrient meal administration (Kejriwal et al., 2026). In addition, hyperglycemia and excess substrate availability promote hepatic glycogen accumulation even in diabetic states (Edgerton et al., 2004). The mechanism underlying hepatic glycogen accumulation in STZ‐D mice under refeeding conditions warrants further investigation.

While previous studies in obese diabetic models have attributed the increase in glycolytic intermediates to inefficient metabolic flux (van de Werve & Jeanrenaud, 1987), our findings in STZ‐D mice may suggest a distinct metabolic mechanism driven by overwhelming substrate availability. Following acute protein loading, we observed a marked accumulation of amino acids in the STZ‐D liver, together with elevated early gluconeogenic/glycolytic intermediates (glucose 6‐phosphate and fructose 6‐phosphate). These results may indicate that hepatic amino acid uptake exceeds the metabolic capacity of the liver following acute protein loading, leading to intrahepatic amino acid accumulation. The accumulated amino acids may serve as substrates for gluconeogenesis, together with increased expression of amino acid catabolic genes such as Got1, Sds, and Gls2, as well as gluconeogenic enzymes such as Pepck and G6pc. In addition, in LHP‐fed STZ‐D mice, hepatic contents of all six ketogenic amino acids were significantly higher than those in their ND counterparts. Conversely, among glucogenic amino acids, no significant differences were observed in cysteine, glutamic acid, glycine, nor histidine contents, whereas glutamine content was significantly decreased. These findings suggest that accelerated hepatic amino acid uptake is accompanied by stimulated gluconeogenesis in LHP‐fed STZ‐D mice. This metabolic shift likely prevents the accumulation of specific glucogenic amino acids in the liver, thereby shifting the metabolic flux toward gluconeogenesis.

Despite the higher hepatic glycogen content observed in STZ‐D mice, acute LHP intake resulted in significantly lower hepatic glycogen levels compared with LNC intake, particularly in STZ‐D mice. Because the LHP diet contained substantially less carbohydrate than the LNC diet, this reduction is likely attributable, at least in part, to decreased exogenous glucose availability.

This study has several limitations. First, we did not evaluate hepatic metabolism and gene expression under fasting condition or directly assess glycogen turnover. Second, we did not assess the absorption of nutrients from the intestinal tract. These issues should be addressed in future studies.

5. CONCLUSION

Acute intake of a high‐protein liquid diet induces rapid, non‐transcriptional metabolic changes, resulting in distinct hepatic amino acid accumulation patterns in diabetic mice. These findings highlight the importance of hormonal balance in modulating nutrient partitioning and suggest that metabolic sensitivity to protein loads is fundamentally altered in the diabetic state. In individuals with T1D, insulin secretion is severely impaired; protein‐rich meals may promote hyperglycemia by stimulating glucagon secretion (Dao et al., 2025). In contrast, our findings suggest that when residual insulin secretion is preserved, high‐protein, low‐carbohydrate feeding enhances hepatic amino acid uptake and glucogenesis without increasing postprandial blood glucose. The limited carbohydrate content may offset the glucose‐raising effect of glucagon‐stimulated glucogenesis and thereby attenuate postprandial glycemic excursions.

AUTHOR CONTRIBUTIONS

Hiroaki Sumioki: Conceptualization; data curation; formal analysis; investigation; methodology; validation; visualization. Eisuke Tomatsu: Conceptualization; data curation; formal analysis; investigation; methodology; visualization. Yusuke Seino: Conceptualization; data curation; formal analysis; funding acquisition; investigation; methodology; project administration; validation; visualization. Shihomi Hidaka: Conceptualization; data curation; formal analysis; investigation; methodology; visualization. Shinji Ueno: Conceptualization; data curation; formal analysis; funding acquisition; investigation; methodology; validation. Sayumi Kanie: Investigation. Koki Nishida: Investigation. Takuya Haraguchi: Conceptualization; methodology. Naoya Murao: Conceptualization; methodology. Haruki Fujisawa: formal analysis; Writing – review and editing. Takeshi Takayanagi: Data curation; formal analysis. Yoshihisa Sugimura: formal analysis; Writing – review and editing. Yoshitaka Hayashi: Conceptualization; methodology; project administration. Atsushi Suzuki: Supervision.

FUNDING INFORMATION

This study was supported by Grants‐in‐Aid for Scientific Research from the Japan Society for the Promotion of Science to Yu.S. (21K11608 and 24K14638), grants from the Japan Association for Diabetes Education and Care, 23‐2558 and 23‐2667 (to Yu.S. and S.U.), and a research grant from Fujita Health University.

CONFLICT OF INTEREST STATEMENT

The authors declare that they have no conflict of interest.

ETHICS STATEMENT

All animal experiments and research protocols were approved by the Ethics Committee of Fujita Health University (AP18002; approval date: 14 May 2018).

DECLARATION OF GENERATIVE AI AND AI‐ASSISTED TECHNOLOGIES IN THE WRITING PROCESS

The authors used Gemini (Gemini‐3.5 Thinking, Open AI; used between March 2026 and August 2026) and ChatGPT (GPT‐5.5 Thinking, OpenAI; used between March 2026 and August 2026) to enhance the English phrasing of this manuscript.

Supporting information

Figures S1–S2.

PHY2-14-e71117-s001.zip (729.8KB, zip)

Sumioki, H. , Tomatsu, E. , Seino, Y. , Hidaka, S. , Ueno, S. , Kanie, S. , Nishida, K. , Haraguchi, T. , Murao, N. , Fujisawa, H. , Takayanagi, T. , Sugimura, Y. , Hayashi, Y. , & Suzuki, A. (2026). Acute high‐protein feeding induces hepatic amino acid accumulation in diabetic male mice prior to transcriptional adaptation. Physiological Reports, 14, e71117. 10.14814/phy2.71117

Hiroaki Sumioki and Eisuke Tomatsu contributed equally to this work.

DATA AVAILABILITY STATEMENT

The data used to support the findings of this study are available from Yu.S. (Yusuke Seino) upon request. All metabolomics data for the liver are available in Metabobank under accession number MTBKS285 (https://ddbj.nig.ac.jp/public/metabobank/study/).

REFERENCES

  1. Ahrén, B. (2022). Glucose‐dependent insulinotropic polypeptide secretion after oral macronutrient ingestion: The human literature revisited and a systematic study in model experiments in mice. Journal of Diabetes Investigation, 13(10), 1655–1665. 10.1111/jdi.13836 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Alqudah, A. , Wedyan, M. , Qnais, E. , Jawarneh, H. , & McClements, L. (2021). Plasma amino acids metabolomics' important in glucose management in type 2 diabetes. Frontiers in Pharmacology, 12, 695418. 10.3389/fphar.2021.695418 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Alsalim, W. , Tura, A. , Pacini, G. , Omar, B. , Bizzotto, R. , Mari, A. , & Ahrén, B. (2016). Mixed meal ingestion diminishes glucose excursion in comparison with glucose ingestion via several adaptive mechanisms in people with and without type 2 diabetes. Diabetes, Obesity & Metabolism, 18(1), 24–33. 10.1111/dom.12570 [DOI] [PubMed] [Google Scholar]
  4. Dao, G. M. , Kowalski, G. M. , Bruce, C. R. , O'Neal, D. N. , Smart, C. E. , Zaharieva, D. P. , Hennessy, D. T. , Zhao, S. , & Morrison, D. J. (2025). The glycemic impact of protein ingestion in people with type 1 diabetes. Diabetes Care, 48(4), 509–518. 10.2337/dci24-0096 [DOI] [PubMed] [Google Scholar]
  5. Del Prato, S. , Bonadonna, R. C. , Bonora, E. , Gulli, G. , Solini, A. , Shank, M. , & DeFronzo, R. A. (1993). Characterization of cellular defects of insulin action in type 2 (non‐insulin‐dependent) diabetes mellitus. The Journal of Clinical Investigation, 91(2), 484–494. 10.1172/JCI116226 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Dushay, J. R. , Toschi, E. , Mitten, E. K. , Fisher, F. M. , Herman, M. A. , & Maratos‐Flier, E. (2014). Fructose ingestion acutely stimulates circulating FGF21 levels in humans. Molecular Metabolism, 4(1), 51–57. 10.1016/j.molmet.2014.09.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Edgerton, D. S. , Cardin, S. , Neal, D. , Farmer, B. , Lautz, M. , Pan, C. , & Cherrington, A. D. (2004). Effects of hyperglycemia on hepatic gluconeogenic flux during glycogen phosphorylase inhibition in the conscious dog. American Journal of Physiology. Endocrinology and Metabolism, 286(4), E510–E522. 10.1152/ajpendo.00211.2003 [DOI] [PubMed] [Google Scholar]
  8. El, K. , Gray, S. M. , Capozzi, M. E. , Knuth, E. R. , Jin, E. , Svendsen, B. , Clifford, A. , Brown, J. L. , Encisco, S. E. , Chazotte, B. M. , Sloop, K. W. , Nunez, D. J. , Merrins, M. J. , D'Alessio, D. A. , & Campbell, J. E. (2021). GIP mediates the incretin effect and glucose tolerance by dual actions on α cells and β cells. Science Advances, 7(11), eabf1948. 10.1126/sciadv.abf1948 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Elliott, R. M. , Morgan, L. M. , Tredger, J. A. , Deacon, S. , Wright, J. , & Marks, V. (1993). Glucagon‐like peptide‐1 (7‐36)amide and glucose‐dependent insulinotropic polypeptide secretion in response to nutrient ingestion in man: Acute post‐prandial and 24‐h secretion patterns. The Journal of Endocrinology, 138(1), 159–166. 10.1677/joe.0.1380159 [DOI] [PubMed] [Google Scholar]
  10. Galsgaard, K. D. , Pedersen, J. , Kjeldsen, S. A. S. , Winther‐Sørensen, M. , Stojanovska, E. , Vilstrup, H. , Ørskov, C. , Wewer Albrechtsen, N. J. , & Holst, J. J. (2020). Glucagon receptor signaling is not required for N‐carbamoyl glutamate‐ and l‐citrulline‐induced ureagenesis in mice. American Journal of Physiology. Gastrointestinal and Liver Physiology, 318(5), G912–G927. 10.1152/ajpgi.00294.2019 [DOI] [PubMed] [Google Scholar]
  11. Galsgaard, K. D. , Winther‐Sørensen, M. , Pedersen, J. , Kjeldsen, S. A. S. , Rosenkilde, M. M. , Wewer Albrechtsen, N. J. , & Holst, J. J. (2019). Glucose and amino acid metabolism in mice depend mutually on glucagon and insulin receptor signaling. American Journal of Physiology. Endocrinology and Metabolism, 316(4), E660–E673. 10.1152/ajpendo.00410.2018 [DOI] [PubMed] [Google Scholar]
  12. Gannon, M. C. , & Nuttall, F. Q. (1997). Effect of feeding, fasting, and diabetes on liver glycogen synthase activity, protein, and mRNA in rats. Diabetologia, 40(7), 758–763. 10.1007/s001250050746 [DOI] [PubMed] [Google Scholar]
  13. Grøndahl, M. F. G. , Bagger, J. I. , Suppli, M. P. , Van Hall, G. , Albrechtsen, N. J. W. , Holst, J. J. , Vilsbøll, T. , Christensen, M. B. , Lund, A. B. , & Knop, F. K. (2024). The effect of exogenous glucagon on circulating amino acids in individuals with and without type 2 diabetes and obesity. Endocrine Connections, 13(3), e230516. 10.1530/EC-23-0516 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Ichikawa, R. , Takano, K. , Fujimoto, K. , Kobayashi, M. , Kitamura, T. , Shichiri, M. , & Miyatsuka, T. (2023). Robust increase in glucagon secretion after oral protein intake, but not after glucose or lipid intake in Japanese people without diabetes. Journal of Diabetes Investigation, 14(10), 1172–1174. 10.1111/jdi.14053 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Ichikawa, R. , Takano, K. , Fujimoto, K. , Motomiya, T. , Kobayashi, M. , Kitamura, T. , & Shichiri, M. (2019). Basal glucagon hypersecretion and response to oral glucose load in prediabetes and mild type 2 diabetes. Endocrine Journal, 66(8), 663–675. 10.1507/endocrj.EJ18-0372 [DOI] [PubMed] [Google Scholar]
  16. Iida, A. , Seino, Y. , Fukami, A. , Maekawa, R. , Yabe, D. , Shimizu, S. , Kinoshita, K. , Takagi, Y. , Izumoto, T. , Ogata, H. , Ishikawa, K. , Ozaki, N. , Tsunekawa, S. , Hamada, Y. , Oiso, Y. , Arima, H. , & Hayashi, Y. (2016). Endogenous GIP ameliorates impairment of insulin secretion in proglucagon‐deficient mice under moderate beta cell damage induced by streptozotocin. Diabetologia, 59(7), 1533–1541. 10.1007/s00125-016-3935-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. James, H. A. , O'Neill, B. T. , & Nair, K. S. (2017). Insulin regulation of Proteostasis and clinical implications. Cell Metabolism, 26(2), 310–323. 10.1016/j.cmet.2017.06.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Janah, L. , Kjeldsen, S. , Galsgaard, K. D. , Winther‐Sørensen, M. , Stojanovska, E. , Pedersen, J. , Knop, F. K. , Holst, J. J. , & Wewer Albrechtsen, N. J. (2019). Glucagon receptor signaling and glucagon resistance. International Journal of Molecular Sciences, 20(13), 3314. 10.3390/ijms20133314 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Jiang, G. , & Zhang, B. B. (2003). Glucagon and regulation of glucose metabolism. American Journal of Physiology. Endocrinology and Metabolism, 284(4), E671–E678. 10.1152/ajpendo.00492.2002 [DOI] [PubMed] [Google Scholar]
  20. Kawamori, D. , Kageyama, Y. , Tanaka, T. , Ishizaka, Y. , Hosoe, S. , Katakami, N. , & Shimomura, I. (2023). Characteristic changes in plasma glutamate levels and free amino acid profiles in Japanese patients with type 1 diabetes mellitus. Journal of Diabetes Investigation, 14(1), 111–121. 10.1111/jdi.13911 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kejriwal, N. , Bouslov, D. , Castle, C. R. , Karve, R. S. , Arkharova, G. A. , Sargsyan, A. , Drucker, D. J. , Zhang, G. F. , D'Alessio, D. A. , Campbell, J. E. , & Capozzi, M. E. (2026). Glucagon promotes net hepatic glycogen repletion following meal ingestion. JCI Insight, 11(8), e201076. 10.1172/jci.insight.201076 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kjeldsen, S. A. S. , Richter, M. M. , Jensen, N. J. , Nilsson, M. S. D. , Heinz, N. , Nybing, J. D. , Linden, F. H. , Høgh‐Schmidt, E. , Boesen, M. P. , Madsbad, S. , Vilstrup, H. , Schiødt, F. V. , Møller, A. , Nørgaard, K. , Schmidt, S. , Rashu, E. B. , Gluud, L. L. , Haugaard, S. B. , Holst, J. J. , … Wewer Albrechtsen, N. J. (2023). Development of a glucagon sensitivity test in humans: Pilot data and the GLUSENTIC study protocol. Peptides, 161, 170938. 10.1016/j.peptides.2022.170938 [DOI] [PubMed] [Google Scholar]
  23. Kondo‐Ando, M. , Seino, Y. , Morikawa, R. , Negi, K. , Todoroki, H. , Kawakami, T. , Asada, Y. , Yoshimoto, R. , Tanaka, C. , Okamoto, K. , Masuda, A. , Tomatsu, E. , Hiratsuka, I. , Yoshino, Y. , Maki, W. , Kakita, A. , Shibata, M. , Takayanagi, T. , Makino, M. , … Suzuki, A. (2019). Low‐carbohydrate diet by staple change attenuates postprandial GIP and CPR levels in type 2 diabetes patients. Journal of Diabetes and its Complications, 33(11), 107415. 10.1016/j.jdiacomp.2019.107415 [DOI] [PubMed] [Google Scholar]
  24. Korenfeld, N. , Finkel, M. , Buchshtab, N. , Bar‐Shimon, M. , Charni‐Natan, M. , & Goldstein, I. (2021). Fasting hormones synergistically induce amino acid catabolism genes to promote gluconeogenesis. Cellular and Molecular Gastroenterology and Hepatology, 12(3), 1021–1036. 10.1016/j.jcmgh.2021.04.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Krssak, M. , Brehm, A. , Bernroider, E. , Anderwald, C. , Nowotny, P. , Dalla Man, C. , Cobelli, C. , Cline, G. W. , Shulman, G. I. , Waldhäusl, W. , & Roden, M. (2004). Alterations in postprandial hepatic glycogen metabolism in type 2 diabetes. Diabetes, 53(12), 3048–3056. 10.2337/diabetes.53.12.3048 [DOI] [PubMed] [Google Scholar]
  26. Laeger, T. , Henagan, T. M. , Albarado, D. C. , Redman, L. M. , Bray, G. A. , Noland, R. C. , Münzberg, H. , Hutson, S. M. , Gettys, T. W. , Schwartz, M. W. , & Morrison, C. D. (2014). FGF21 is an endocrine signal of protein restriction. The Journal of Clinical Investigation, 124(9), 3913–3922. 10.1172/JCI74915 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Maekawa, R. , Ogata, H. , Murase, M. , Harada, N. , Suzuki, K. , Joo, E. , Sankoda, A. , Iida, A. , Izumoto, T. , Tsunekawa, S. , Hamada, Y. , Oiso, Y. , Inagaki, N. , Arima, H. , Hayashi, Y. , & Seino, Y. (2018). Glucose‐dependent insulinotropic polypeptide is required for moderate high‐fat diet‐ but not high‐carbohydrate diet‐induced weight gain. American Journal of Physiology. Endocrinology and Metabolism, 314(6), E572–E583. 10.1152/ajpendo.00352.2017 [DOI] [PubMed] [Google Scholar]
  28. Maekawa, R. , Seino, Y. , Ogata, H. , Murase, M. , Iida, A. , Hosokawa, K. , Joo, E. , Harada, N. , Tsunekawa, S. , Hamada, Y. , Oiso, Y. , Inagaki, N. , Hayashi, Y. , & Arima, H. (2017). Chronic high‐sucrose diet increases fibroblast growth factor 21 production and energy expenditure in mice. The Journal of Nutritional Biochemistry, 49, 71–79. 10.1016/j.jnutbio.2017.07.010 [DOI] [PubMed] [Google Scholar]
  29. Matthews, D. R. , Hosker, J. P. , Rudenski, A. S. , Naylor, B. A. , Treacher, D. F. , & Turner, R. C. (1985). Homeostasis model assessment: Insulin resistance and beta‐cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia, 28(7), 412–419. 10.1007/BF00280883 [DOI] [PubMed] [Google Scholar]
  30. Mitrakou, A. , Kelley, D. , Veneman, T. , Jenssen, T. , Pangburn, T. , Reilly, J. , & Gerich, J. (1990). Contribution of abnormal muscle and liver glucose metabolism to postprandial hyperglycemia in NIDDM. Diabetes, 39(11), 1381–1390. 10.2337/diab.39.11.1381 [DOI] [PubMed] [Google Scholar]
  31. Müller, W. A. , Faloona, G. R. , Aguilar‐Parada, E. , & Unger, R. H. (1970). Abnormal alpha‐cell function in diabetes. Response to carbohydrate and protein ingestion. The New England Journal of Medicine, 283(3), 109–115. 10.1056/NEJM197007162830301 [DOI] [PubMed] [Google Scholar]
  32. Murao, N. , Seino, Y. , Morikawa, R. , Hidaka, S. , Haraguchi, T. , Tomatsu, E. , Habara, M. , Ohno, T. , Yokoi, N. , Harada, N. , Hayashi, Y. , Yamada, Y. , & Suzuki, A. (2025). Intestinal fructose metabolism triggers a glucagon‐like peptide‐1‐β‐cell axis to prevent post‐fructose hyperglycaemia. The Journal of Physiology, 603(22), 6833–6858. 10.1113/JP289067 [DOI] [PubMed] [Google Scholar]
  33. Nishida, K. , Ueno, S. , Seino, Y. , Hidaka, S. , Murao, N. , Asano, Y. , Fujisawa, H. , Shibata, M. , Takayanagi, T. , Ohbayashi, K. , Iwasaki, Y. , Iizuka, K. , Okuda, S. , Tanaka, M. , Fujii, T. , Tochio, T. , Yabe, D. , Yamada, Y. , Sugimura, Y. , … Suzuki, A. (2024). Impaired fat absorption from intestinal tract in high‐fat diet fed male mice deficient in proglucagon‐derived peptides. Nutrients, 16(14), 2270. 10.3390/nu16142270 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Petersen, M. C. , & Shulman, G. I. (2018). Mechanisms of insulin action and insulin resistance. Physiological Reviews, 98(4), 2133–2223. 10.1152/physrev.00063.2017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Rossetti, P. , Porcellati, F. , Busciantella Ricci, N. , Candeloro, P. , Cioli, P. , Nair, K. S. , Santeusanio, F. , Bolli, G. B. , & Fanelli, C. G. (2008). Effect of oral amino acids on counterregulatory responses and cognitive function during insulin‐induced hypoglycemia in nondiabetic and type 1 diabetic people. Diabetes, 57(7), 1905–1917. 10.2337/db08-0276 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Sadri, H. , von Soosten, D. , Meyer, U. , Kluess, J. , Dänicke, S. , Saremi, B. , & Sauerwein, H. (2017). Plasma amino acids and metabolic profiling of dairy cows in response to a bolus duodenal infusion of leucine. PLoS One, 12(4), e0176647. 10.1371/journal.pone.0176647 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Samms, R. J. , Lewis, J. E. , Norton, L. , Stephens, F. B. , Gaffney, C. J. , Butterfield, T. , Smith, D. P. , Cheng, C. C. , Perfield, J. W., 2nd , Adams, A. C. , Ebling, F. J. P. , & Tsintzas, K. (2017). FGF21 is an insulin‐dependent postprandial hormone in adult humans. The Journal of Clinical Endocrinology and Metabolism, 102(10), 3806–3813. 10.1210/jc.2017-01257 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Shah, P. , Vella, A. , Basu, A. , Basu, R. , Schwenk, W. F. , & Rizza, R. A. (2000). Lack of suppression of glucagon contributes to postprandial hyperglycemia in subjects with type 2 diabetes mellitus. The Journal of Clinical Endocrinology and Metabolism, 85(11), 4053–4059. 10.1210/jcem.85.11.6993 [DOI] [PubMed] [Google Scholar]
  39. Uehara, K. , Lee, W. D. , Stefkovich, M. , Biswas, D. , Santoleri, D. , Garcia Whitlock, A. , Quinn, W., 3rd , Coopersmith, T. , Creasy, K. T. , Rader, D. J. , Sakamoto, K. , Rabinowitz, J. D. , & Titchenell, P. M. (2024). mTORC1 controls murine postprandial hepatic glycogen synthesis via Ppp1r3b. The Journal of Clinical Investigation, 134(7), e173782. 10.1172/JCI173782 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Ueno, S. , Seino, Y. , Hidaka, S. , Maekawa, R. , Takano, Y. , Yamamoto, M. , Hori, M. , Yokota, K. , Masuda, A. , Himeno, T. , Tsunekawa, S. , Kamiya, H. , Nakamura, J. , Kuwata, H. , Fujisawa, H. , Shibata, M. , Takayanagi, T. , Sugimura, Y. , Yabe, D. , … Suzuki, A. (2022). High protein diet feeding aggravates Hyperaminoacidemia in mice deficient in Proglucagon‐derived peptides. Nutrients, 14(5), 975. 10.3390/nu14050975 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. van de Werve, G. , & Jeanrenaud, B. (1987). The onset of liver glycogen synthesis in fasted‐refed lean and genetically obese (fa/fa) rats. Diabetologia, 30(3), 169–174. 10.1007/BF00274223 [DOI] [PubMed] [Google Scholar]
  42. Wang, L. , Li, J. , & Di, L. J. (2022). Glycogen synthesis and beyond, a comprehensive review of GSK3 as a key regulator of metabolic pathways and a therapeutic target for treating metabolic diseases. Medicinal Research Reviews, 42(2), 946–982. 10.1002/med.21867 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Watanabe, C. , Seino, Y. , Miyahira, H. , Yamamoto, M. , Fukami, A. , Ozaki, N. , Takagishi, Y. , Sato, J. , Fukuwatari, T. , Shibata, K. , Oiso, Y. , Murata, Y. , & Hayashi, Y. (2012). Remodeling of hepatic metabolism and hyperaminoacidemia in mice deficient in proglucagon‐derived peptides. Diabetes, 61(1), 74–84. 10.2337/db11-0739 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Wewer Albrechtsen, N. J. , Kuhre, R. E. , Pedersen, J. , Knop, F. K. , & Holst, J. J. (2016). The biology of glucagon and the consequences of hyperglucagonemia. Biomarkers in Medicine, 10(11), 1141–1151. 10.2217/bmm-2016-0090 [DOI] [PubMed] [Google Scholar]
  45. Winther‐Sørensen, M. , Galsgaard, K. D. , Santos, A. , Trammell, S. A. J. , Sulek, K. , Kuhre, R. E. , Pedersen, J. , Andersen, D. B. , Hassing, A. S. , Dall, M. , Treebak, J. T. , Gillum, M. P. , Torekov, S. S. , Windeløv, J. A. , Hunt, J. E. , Kjeldsen, S. A. S. , Jepsen, S. L. , Vasilopoulou, C. G. , Knop, F. K. , … Wewer Albrechtsen, N. J. (2020). Glucagon acutely regulates hepatic amino acid catabolism and the effect may be disturbed by steatosis. Molecular Metabolism, 42, 101080. 10.1016/j.molmet.2020.101080 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Yabe, D. , Kuroe, A. , Watanabe, K. , Iwasaki, M. , Hamasaki, A. , Hamamoto, Y. , Harada, N. , Yamane, S. , Lee, S. , Murotani, K. , Deacon, C. F. , Holst, J. J. , Hirano, T. , Inagaki, N. , Kurose, T. , & Seino, Y. (2015). Early phase glucagon and insulin secretory abnormalities, but not incretin secretion, are similarly responsible for hyperglycemia after ingestion of nutrients. Journal of Diabetes and its Complications, 29(3), 413–421. 10.1016/j.jdiacomp.2014.12.010 [DOI] [PubMed] [Google Scholar]
  47. Yanagisawa, Y. (2023). How dietary amino acids and high protein diets influence insulin secretion. Physiological Reports, 11(2), e15577. 10.14814/phy2.15577 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figures S1–S2.

PHY2-14-e71117-s001.zip (729.8KB, zip)

Data Availability Statement

The data used to support the findings of this study are available from Yu.S. (Yusuke Seino) upon request. All metabolomics data for the liver are available in Metabobank under accession number MTBKS285 (https://ddbj.nig.ac.jp/public/metabobank/study/).

Articles from Physiological Reports are provided here courtesy of Wiley

RESOURCES