Generation of two homozygous iPSC lines carrying variants of uncertain significance in LMNA associated with cardiomyopathy

Abstract

Variants of uncertain significance (VUS) in the LMNA gene represent a major challenge in clinical genetics, as insufficient functional evidence limits their interpretation and clinical decision-making in laminopathies, including dilated cardiomyopathy (DCM). Here, we generated two isogenic induced pluripotent stem cell (iPSC) lines carrying homozygous LMNA variants, c.293A > G (p.Glu98Gly) and c.439G > A (p.Ala147Thr) by prime editing of a healthy donor iPSC line. Both variants are located within Coil 1B domain of lamin A. The edited iPSC lines retain normal morphology, pluripotency, genomic integrity, and trilineage differentiation capacity, providing a valuable platform for functional characterization and potential clinical reclassification of LMNA VUS.

1. Resource table

Unique stem cell lines identifier	1. BFVSBi013-A2. BFVSBi013-B3. BFVSBi013-C
Institution	Baszucki Family Vascular Surgery Biobank
Contact information of the reported cell line distributor	Dr. Nazish Sayedsayedns@stanford.edu
Type of cell lines	iPSC
Origin	Human
Additional origin info (Applicable for human ESC or iPSC)	BFVSBi013-A; Age: 60–70; Sex: Male; Ethnicity: White
Cell Source	iPSCs (BFVSBi013-A), established from donor PBMCs via integration-free Sendai virus reprogramming and subsequently edited by prime editing to generate BFVSBi013-B and BFVSBi013-C.
Method of reprogramming	Integration-free Sendai virus expressing human OCT4, SOX2, KLF4, and c-MYC
Clonality	Clonal
Evidence of the reprogramming transgene loss	RT/q-PCR
Method of Genetic Modification	Induced mutation by Prime Editing
Associated disease	Dilated Cardiomyopathy (DCM)
Gene/locus	Gene: LMNA NM_170707.4:c.293A > G (p. Glu98Gly) NM_170707.4:c.439G > A (p. Ala147Thr)
Date archived/stock date	BFVSBi013-A: 05/18/2024; BFVSBi013-B: 02/25/2025; BFVSBi013-C: 03/01/2025
Cell line repository/bank	https://hpscreg.eu/cell-line/BFVSBi013-A; https://hpscreg.eu/cell-line/BFVSBi013-Bhttps://hpscreg.eu/cell-line/BFVSBi013-C
Analysis of the nuclease-targeted allele status	Sequencing of the targeted allele
Homozygous allele status validation	Sanger sequencing confirmed
Descriptive name of the transgene	N/A
Eukaryotic selective agent resistance cassettes	N/A
Inducible/constitutive expression system details	N/A
Genome-editing reagent delivery method	Electroporation using the Neon Transfection System
Ethical approvals	The Administrative Panel approved the generation of the lines on Human Subjects Research (IRB) under IRB #62122, “Human Induced Pluripotent Stem Cells for Studying Cardiac and Vascular Diseases.”

2. Resource utility

These isogenic iPSC lines carrying the homozygous LMNA variants c.293A > G (p.Glu98Gly) and c.439G > A (p.Ala147Thr) provide a controlled platform for functional characterization of LMNA variants of uncertain significance. They enable mechanistic studies of laminopathy-associated cardiomyopathy and facilitate variant interpretation and potential clinical reclassification (Table 1).

Table 1.

Characterization and validation.

Classification	Test	Result	Data
Schematic of a transgene/genetic modification	N/A	N/A	Fig. 1A
Morphology	Photography Bright field	Normal	Fig. 1B
Phenotype	Quantitative analysis (RT-qPCR)	mRNA expression of SOX2 and NANOG	Fig. 1D
	Qualitative analysis (Immunocytochemistry)	Positive expression of pluripotency markers: SSEA3, SSEA4, TRA-1–60	Fig. 1E
Genotype	Karyotype: G-banding (Cell Guidance Systems)	Normal karyotype: 46, XY for BFVSBi013-A	Fig. 1H
	Karyotype: Whole genome array (KaryoStat™ Assay) Resolution 1–2 Mb	Normal karyotype: 46, XY for BFVSBi013-B and BFVSBi013-C	Fig. 1I
Identity	Microsatellite PCR (mPCR) or	N/A	N/A
	STR analysis	16 loci tested, 100% matching identity	Submitted in archive with journal
Mutation analysis	Sequencing	Sanger sequencing	Fig. 1C
	Southern Blot OR WGS	N/A	N/A
Microbiology and virology	Mycoplasma	Luminescence: Negative	Fig. 1F
Differentiation potential	Directed differentiation, Immunofluorescence staining for 2 markers per germ layer	Positive Immunofluorescence staining of three germ layer markers Ectoderm: PAX6, OTX2 Endoderm: SOX17, FOXA2, Mesoderm: BRACHYURY, TBX6	Fig. 1G
Donor screening	HIV 1 + 2 Hepatitis B, Hepatitis C	N/A	N/A
Genotype additional info	Blood group genotyping	N/A	N/A
	HLA tissue typing	N/A	N/A

3. Resource details

Lamin A/C, encoded by the LMNA gene, is a type V intermediate filament protein that constitutes a major structural component of the nuclear lamina (Dittmer and Misteli, 2011). It plays essential roles in maintaining nuclear architecture, chromatin organization, DNA replication, and mechanotransduction (Turgay et al., 2017, Ahn et al., 2019, Sayed et al., 2020). Pathogenic variants in LMNA cause a diverse group of disorders collectively termed laminopathies, including DCM, which is frequently associated with conduction system disease, myocardial fibrosis, heart failure, and increased risk of sudden cardiac death (Fatkin et al., 1999; McNally et al., 2013; Wu et al., 2026). Despite advances in clinical genetic testing, a substantial proportion of LMNA variants identified in patients are classified as variants of uncertain significance (VUS) because of insufficient functional evidence to determine pathogenicity. This represents a major limitation in clinical decision-making and underscores the need for physiologically relevant models to functionally interrogate these variants (Anderson et al., 2021).

Induced pluripotent stem cell (iPSC)-based platforms provide a powerful system to model human genetic disease in a patient-relevant context. In particular, isogenic iPSC lines, where specific variants are introduced into a shared genetic background enable direct attribution of cellular phenotypes to individual variants while minimizing confounding effects of genetic heterogeneity (Ma et al., 2018). Such systems are especially valuable for studying VUS, where subtle or context-dependent phenotypes may be difficult to resolve. These iPSC lines can be differentiated into cardiovascular cell types, facilitating mechanistic studies and high-throughput therapeutic screening (Thomas et al., 2024; Manhas et al., 2025).

Here, we generated two isogenic iPSC lines carrying homozygous LMNA VUS, c.293A > G (p.Glu98Gly; rs1441670218) and c.439G > A (p.Ala147Thr; rs139875047), using prime editing in a healthy donor iPSC line (BFVSBi013-A). Both variants are located within exon 2 of LMNA, corresponding to the Coil 1B domain of lamin A (Fig. 1A), a region critical for filament assembly and nuclear mechanical stability (Vahabikashi et al., 2022). Prime editing was performed by electroporation of synthetic pegRNA and nicking guide RNA together with in vitro transcribed PE2 mRNA (Fig. 1A). Edited clones were isolated by single-cell cloning (Fig. 1B) and confirmed to be homozygous by Sanger sequencing (Fig. 1C). Predicted off-target sites identified computationally were evaluated by targeted Sanger sequencing, and no unintended editing was detected at the analyzed loci (Table S1; Fig. S1).

Fig. 1.

Generation and characterization of isogenic iPSC lines carrying homozygous LMNA variants. (A) Schematic of the LMNA gene and lamin A protein domain structure showing the locations of c.293A>G (p.Glu98Gly; rs1441670218) and c.439G>A (p.Ala147Thr; rs139875047), with the corresponding prime-editing guide designs. (B) Representative brightfield images of the parental iPSC line BFVSBi013-A and prime-edited lines BFVSBi013-B and BFVSBi013-C. (C) Sanger sequencing chromatograms confirming homozygous introduction of c.293A>G in BFVSBi013-B and c.439G>A in BFVSBi013-C compared with the parental line BFVSBi013-A. (D) RT-qPCR analysis of pluripotency markers NANOG and SOX2. (E) Immunofluorescence staining for pluripotency markers SSEA3, SSEA4, and TRA-1–60. (F) Mycoplasma testing using the MycoAlert^™ PLUS assay. (G) Trilineage differentiation showing expression of ectodermal markers OTX2 and PAX6, mesodermal markers BRACHYURY and TBX6, and endodermal markers SOX17 and FOXA2. (H) G-banded karyotype of the parental BFVSBi013-A line showing a normal karyotype. (I) KaryoStat^™ whole-genome array analysis of BFVSBi013-B and BFVSBi013-C demonstrating normal chromosomal integrity.

Both edited iPSC lines exhibited typical human pluripotent stem cell morphology and maintained robust expression of pluripotency markers, including NANOG and SOX2, as assessed by RT-qPCR (Fig. 1D), and SSEA3, SSEA4, and TRA-1–60 by immunofluorescence staining (Fig. 1E). Additionally, both lines tested negative for mycoplasma contamination (Fig. 1F). The differentiation potential of the edited iPSC lines was confirmed using directed trilineage differentiation assays. Cells successfully differentiated into ectoderm, mesoderm, and endoderm, as demonstrated by expression of lineage-specific markers including OTX2 and PAX6 (ectoderm), BRACHYURY and TBX6 (mesoderm), and SOX17 and FOXA2 (endoderm) (Fig. 1G). Chromosomal integrity was assessed by genome-wide array analysis, demonstrating normal karyotypes for the parental line (Fig. 1H) and both prime-edited lines (Fig. 1I).

These isogenic iPSC lines provide a controlled platform for functional characterization of LMNA VUS. They enable investigation of nuclear architecture and disease-associated phenotypes and serve as a valuable resource for studying laminopathy mechanisms and facilitating variant interpretation and potential clinical reclassification.

4. Materials and methods

4.1. Reprogramming of PBMC to iPSCs

Peripheral blood mononuclear cells (PBMCs) were isolated from whole blood and reprogrammed using the CytoTune^™-iPSC 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific, #A16517) as described previously (Liu et al., 2026). Emerging iPSC colonies (days 10–15) were manually picked and expanded for characterization.

4.2. Cell culture

iPSCs were maintained in StemMACS^™ iPS-Brew XF medium (Miltenyi Biotec) on Matrigel-coated plates. Cells were passaged every 4–5 days at ~ 80% confluence using TrypLE^™ Express (Gibco) and seeded at 1.2 × 10⁵ cells/well in 6-well plates with 10 μM Y-27632 ROCK inhibitor (Selleck Chemicals) for 24 h.

4.3. Prime editing of iPSCs

Prime editing guide RNAs (pegRNAs) and nicking guide RNAs (ngRNAs) targeting the LMNA c.293A > G (p.Glu98Gly) and c.439G > A (p.Ala147Thr) variants were designed using pegIT (https://pegit.giehmlab.dk/). PE2 mRNA was generated by in vitro transcription from the CMV-PE2-GFP plasmid (Addgene #132776) using the HiScribe T7 ARCA mRNA Kit with tailing (NEB). Following transcription, the reaction mixture was treated with DNase I to completely remove the plasmid DNA template, and the synthesized PE2 mRNA was purified using the RNA Clean & Concentrator Kit (Zymo Research). Prime editing was performed on the parental iPSC line BFVSBi013-A at passage 24. Before electroporation, iPSCs were pre-treated with 5 μM Y-27632 for 30 min. A total of 5 × 10⁵ cells were electroporated with 100 pmol pegRNA, 50 pmol ngRNA, and 4 μg PE2 mRNA using the Neon Transfection System (1200 V, 30 ms, 2 pulses). Single-cell clones were isolated using the IsoCell system (iotaSciences), and successful editing was confirmed by Sanger sequencing. Potential off-target sites for both the pegRNA spacer and nicking sgRNA were predicted using CRISPOR (https://crispor.gi.ucsc.edu/crispor.py). Candidate loci were selected for experimental validation based on CRISPOR prediction scores, genomic context, and primer availability. Selected loci were amplified by PCR and analyzed by Sanger sequencing.

4.4. Trilineage differentiation

Differentiation potential was assessed using the STEMdiff^™ Trilineage Differentiation Kit (STEMCELL Technologies). Lineage specification was confirmed by immunofluorescence staining for OTX2 and PAX6 (ectoderm), BRACHYURY and TBX6 (mesoderm), and SOX17 and FOXA2 (endoderm). Trilineage differentiation was performed at passages 29.

4.5. Immunofluorescence

Cells were fixed in 4% paraformaldehyde for 15 min, permeabilized with 0.5% Triton X-100, and blocked with 3% BSA in PBS with 0.1% Tween-20. Primary antibodies (Table 2) were incubated overnight at 4°C, followed by Alexa Fluor-conjugated secondary antibodies (Table 2) for 1 h at room temperature. Nuclei were stained with DAPI. Images were acquired using a KEYENCE fluorescence microscope.

Table 2.

Reagents details.

Antibodies used for Immunocytochemistry
	Antibody	Dilution	Company Cat #	RRID
	Rat Anti-SSEA3	1:100	Abcam Cat# ab16286,	AB_882700
Pluripotency Markers	Rabbit Anti-SSEA4	1:100	Abcam Cat# ab620500,	AB_3674317
	Mouse Anti-TRA-1–60 (R)	1:100	Novus Biologicals Cat# NBP2–80985	AB_33410059
Ectoderm Markers	Goat Anti-OTX2	1:200	R&D Systems Cat# 963,273	AB_2157172
	Rabbit Anti-Pax6	1:100	Thermo Fisher Scientific Cat# 42–6600	AB_2533534
Endoderm Markers	Goat Anti-SOX17	1:200	R&D Systems Cat# 963,121	AB_355060
	Rabbit Anti-Foxa2	1:250	Thermo Fisher Scientific Cat# 701,698	AB_2576439
Mesoderm Markers	Goat Anti-Brachyury	1:200	R&D Systems Cat# 963,427	AB_2200235
	Rabbit Anti-Tbx6	1:200	Thermo Fisher Scientific cat # PA5–35102	AB_2552412
	Alexa Fluor 488 Goat Anti-Mouse IgG1	1:1000	Thermo Fisher Scientific #A-21121	AB_2535764
Secondary Antibodies	Alexa Fluor 488 Goat Anti-Rat IgG (H + L)	1:1000	Thermo Fisher Scientific #A-11006	AB_141373
	Alexa Fluor 555 Goat Anti-Rabbit IgG (H + L)	1:500	Thermo Fisher Scientific #A-21428	AB_141784
	Alexa Fluor 647 Goat Anti-Mouse IgG2b	1:250	Thermo Fisher Scientific #A-21242	AB_2535811
Primers
	Target	Forward/Reverse primer (5′−3′)
	c.293A > G(E98G)	FWD: TTTGATGCTCACAAGGGGCT
	rs1441670218	REV: GAGCATGAAAGTGGGAGGCT
	c.439G > A(A147T)	FWD: CAATACCAAGAAGGAGGGTGAC
	rs139875047	REV: TCTAGGACAGGTGAATGGCTCT
	exon:CPA5	FWD: CCTGGCAAACCTCCTGAGAG
	(OfftargetSeq)	REV: CTGGATTTGGGGAGGACCAC
	intergenic:C7orf49-WDR91 (OfftargetSeq)	FWD: AAACCGCGAATACCCTCAACC
		REV: CTATGCCGCCTCTTGTCTGA
	exon: EPHA7	FWD: TTCTGAACTTTAGCCTTGTTGGCA
	(OfftargetSeq)	REV:CTGGCCTCCTGGATGCTTTAG
	exon: SCARB2	FWD: ACTGTGACATATGATGGCTCCC
	(OfftargetSeq)	REV: AATGATCATGCTACGAAAAGATGCT
	intergenic:RP11–219 J21 (OfftargetSeq)	FWD: AATGACTGTCCGTAGGCCCC
		REV: ACGAAGATTGCCTGTTTTAGTCAG
	intron:TNR	FWD: AGGTCAATTCAGTCCTGGAGC
	(OfftargetSeq)	REV: TTAACACTGACTACATCACAGAGT
	intron:RP1	FWD: ACTGGCAAAGATGACTGGCT
	(OfftargetSeq)	REV: AGTGGGGCTTTTTCCCCTTT
Sendai Virus	N/A	N/A
Genotyping	N/A	N/A
House-Keeping Gene	GAPDH	HS02758991_g1
Pluripotency marker	SOX2	HS01053049_s1
Pluripotency marker	NANOG	HS02387400_g1
PegRNA sequence
	c.293A > G(E98G)	GACCCTTGACTCAGTAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGA
	rs1441670218	GTCGGTGCGCGGGCGCGCcCCTTGGCTACTGAGTCAAG
	c.439G > A (A147T)	ACTGAGAGCAGTGCTCAGTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGT
	rs139875047	CGGTGCTCCAAGGAGGCCcCACTGAGCACTGCTCT

4.6. RT-qPCR

Total RNA was extracted using TRIzol^® and purified with the Directzol RNA Microprep Kit (Zymo Research). cDNA was synthesized using the iScript^™ cDNA Synthesis Kit (Bio-Rad). Expression of pluripotency markers (NANOG, SOX2) was assessed using TaqMan^™ assays (Applied Biosystems) with gene-specific probes and primers as detailed in Table 2.

4.7. Karyotyping

For the parental line (BFVSBi013-A), G-banded karyotype analysis was performed by Cell Guidance Systems (Cambridge, UK) at passage 25. Chromosomal integrity of the edited lines (BFVSBi013-B and BFVSBi013-C) was assessed at passage 28 using the KaryoStat^™ assay (ThermoFisher Scientific). A total of 2 × 10⁶ iPSCs were harvested and the pellet was analyzed for chromosomal abnormality.

4.8. Short tandem repeat analysis

Genomic DNA was isolated from PBMCs and iPSCs at passage 21 using the QIAamp^® DNA Micro Kit (Qiagen). STR profiling was performed using the CLA IdentiFiler^™ Direct PCR Amplification Kit (Thermo Fisher Scientific), and fragment analysis was conducted by capillary electrophoresis on an ABI 3130xl Genetic Analyzer (Azenta Life Sciences). STR analysis was performed at passages 28.

4.9. Mycoplasma detection

Mycoplasma contamination in iPSCs was evaluated utilizing the MycoAlert^™ PLUS Mycoplasma Detection Kit (Lonza, #LT07–705) at passage 29, prior to cryopreservation.

Appendix A. Supplementary data

Supplementary data to this article can be found online at https://doi.org/10.1016/j.scr.2026.104086. Supplementary material includes predicted off-target analysis (Table S1) and targeted Sanger sequencing validation of selected off-target loci (Fig. S1).

Data availability

Data will be made available on request.