Proteomic insights into azoospermia: protein differences in testicular tissue between non-obstructive and obstructive azoospermia patients

Abstract

Non-obstructive azoospermia (NOA) and obstructive azoospermia (OA) are the main classifications of severe male infertility, but the molecular mechanism of NOA remains poorly understood. This study aimed to identify potential biomarkers and pathological mechanisms by comparing the proteomic differences in testicular tissues of NOA and OA patients. Through proteomic analysis based on liquid chromatography-tandem mass spectrometry (LC-MS/MS) of testicular samples from 5 NOA patients and 5 OA patients, we identified 5264 proteins, among which 717 differentially expressed proteins (DEPs) were found between the two groups (242 upregulated and 475 downregulated in NOA). Bioinformatics analysis indicated that these DEPs were significantly associated with reproductive development, gametogenesis, and cell structural stability. On the basis of this, six candidate proteins, including dysferlin (DYSF), myoferlin (MYOF), mitsugumin 53 (MG53), cluster of differentiation 63 (CD63), caveolin-3 (CAV3), and calpain-3 (CAPN3), were selected from the DEPs and verified in an expanded sample set (37 NOA cases and 28 OA cases) through quantitative real-time polymerase chain reaction (qRT-PCR) and Western blot, confirming their dysregulation in NOA. These findings provide new proteomic insights into NOA, highlighting the disruption of membrane repair and structural pathways, and offer potential biomarkers for understanding its pathogenesis.

INTRODUCTION

Azoospermia, the most severe form of male infertility, is classified into non-obstructive azoospermia (NOA) and obstructive azoospermia (OA).1 Worldwide statistics indicate that approximately 15% couples of reproductive age experience infertility, and male factors account for more than half of these cases, a proportion that is increasing.2 NOA typically results from defects in spermatogenic cell development or testicular dysfunction and accounts for 60%–80% of azoospermia cases. Conversely, OA stems from structural blockages in the reproductive tract, which resulted in the absence of spermatozoa and spermatogonia in the semen and post-ejaculation urine.3 While OA patients can often be treated with methods such as microdissection or testicular sperm extraction,4 the lack of clear pathological mechanisms for NOA complicates the development of effective treatments.5,6 Investigating the molecular mechanisms of NOA is crucial for identifying diagnostics targets, with proteomics serving as a potent tool for analyzing biomarkers and elucidating potential pathogenic mechanisms in these two main forms of azoospermia.

Proteomics, which uses high-throughput analysis techniques, comprehensively investigates the differential protein expression linked to azoospermia, thereby elucidating its role in spermatogenesis.7 The current research indicates that numerous proteins are crucial in spermatogenesis, maturation, and function.8 In azoospermic patients, the expression of these proteins may be significantly altered.9 Compared with seminal plasma proteomics, testicular tissue proteomics offers superior insights into early spermatogenic damage and holds more substantial potential for azoospermia research.8 Consequently, by analyzing the protein profile differences between NOA and OA patients, specific biomarkers for NOA can be identified.

This study explores the protein differences between NOA and OA through proteomic analysis. Initially, we collected testicular tissue samples from patients diagnosed with two types of azoospermia, conducted analyses of serum hormones and tissue pathology, and then employed proteomic analysis. This was followed by a bioinformatics analysis of differentially expressed proteins (DEPs). We screened out DEPs with P < 0.05, carried out relevant literature research, and finally selected six DEPs. These selected DEPs were confirmed through quantitative real-time polymerase chain reaction (qRT-PCR) and Western blot techniques. This research is expected to provide new insights into the molecular mechanisms underlying NOA.

PATIENTS AND METHODS

Patients and clinical samples

A total of 42 patients with NOA and 33 with OA were recruited from August 2024 to March 2025 from The First Affiliated Hospital of Xinjiang Medical University (Urumqi, China). Among patients diagnosed with NOA, spermatogenic arrest constituted 64.3% of cases, while Sertoli cell-only syndrome (SCOS) accounted for the remaining 35.7%. The participants underwent serum hormone measuring and open testicular biopsy. Patients with genetic abnormalities, inflammatory conditions of the reproductive system, varicocele, or testicular torsion were excluded. There were no statistically significant differences in age (P = 0.4416) or body mass index (BMI; P = 0.9161) between the groups. Prior to biopsy, a definitive diagnosis of azoospermia was confirmed through semen analysis performed at least three times, demonstrating the absence of spermatozoa in two consecutive ejaculates. The semen analysis adhered to the 5^th edition of the World Health Organization manual (normal semen concentration ≥15 × 10⁶ ml⁻¹).10 NOA patients underwent testicular biopsy after at least two semen analyses confirmed the absence of spermatozoa. This study received approval from the Clinical Research Ethics Committee of The First Affiliated Hospital of Xinjiang Medical University (Urumqi, China; Ethics Approval No. K202408-07). Written informed consent for the surgery, biopsy, and further investigation was obtained from all participants, which included permission to publish the anonymized data.

Testicular tissue procurement and processing were performed as follows. During the biopsy procedure, an incision was made in the tunica albuginea, and a small portion of protruding testicular parenchyma was excised with surgical microscissors. Half of the tissue was subsequently immediately frozen in liquid nitrogen and stored at −80°C, whereas the other half was fixed in 10% formaldehyde, embedded in paraffin, and stained with hematoxylin and eosin (H&E). All diagnoses were made according to the WHO Manual for the Standardized Investigation, Diagnosis, and Management of the Infertile Male.11 The basic parameters of the patients included in the study are presented in Table 1.

Table 1.

Basic parameters of the NOA and OA patients

Characteristic	NOA (n=42)	OA (n=33) a	P
Age (year)	33.2±5.0	34.1±5.0	0.4416
BMI (kg m−2)	26.0±4.4	25.9±3.6	0.9161
TV (left), ml	8.909±6.001	17.488±6.577	<0.05
TV (right), ml	10.141±6.748	18.391±7.835	<0.05

The values are presented as the mean±s.d. TV: testis volume; NOA: non-obstructive azoospermia; OA: obstructive azoospermia; BMI: body mass index; s.d.: standard deviation

Chemicals and reagents

Antibodies against dysferlin (DYSF; monoclonal, rabbit, A19572, 1:1000), myoferlin (MYOF; polyclonal, rabbit, A15427, 1:1000), cluster of differentiation 63 (CD63; polyclonal, rabbit, A5271, 1:300), caveolin-3 (CAV3; monoclonal, rabbit, A4891, 1:1000), and horseradish peroxidase (HRP)-conjugated goat anti-rabbit immunoglobulin G (IgG; rabbit, As014, 1:5000) were obtained from Wuhan Abotech Biotechnology Co., Ltd. (Wuhan, China). Antibodies against calpain 3 (CAPN3; polyclonal, rabbit, 10492-1-AP, 1:1000) and cluster of differentiation 63 (CD63; polyclonal, rabbit, 22151-1-AP, 1:6000) were obtained from Wuhan Sanying Biotechnology Co., Ltd. (Wuhan, China). The antibody against glyceraldehyde-3-phosphate dehydrogenase (GAPDH; polyclonal, rabbit, 10494-1-AP, 1:10 000) was purchased from Proteintech Group, Inc. (Manchester, UK). The bicinchoninic acid (BCA) protein detection kit was supplied by Thermo Fisher Scientific (Waltham, MA, USA). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), tris-buffered saline with Tween 20 (TBST), transfer buffer (pH 8.4), and electrophoresis buffer (pH 8.4) were purchased from Servicebio (Wuhan, China). The complementary DNA (cDNA) reverse transcription kit and TRIzol reagent were from Thermo Fisher Scientific (batch No. 91258333 and 98597501); the qRT-PCR kits were provided by Nanjing Novogene Bioinformatics Technology Co., Ltd. (Nanjing, China; batch No. 027E2260IA). Other reagents and supplies were acquired from Biosharp (Shanghai, China).

Serum hormone assay (reproductive hormone test)

Between 8:00 a.m. and 10:00 a.m., 4 ml of fasting venous blood was collected from the cubital vein, allowed to stand for 1 h, and then centrifuged at 1000g for 10 min using a Sorvall ST 16R centrifuge (Thermo Fisher Scientific). The supernatants were harvested, and the levels of serum luteinizing hormone (LH), follicle-stimulating hormone (FSH), testosterone (T), and estrogen (E2) were analyzed via a fully automated, high-efficiency microparticle chemiluminescent immunoassay analyzer with reagents provided by Abbott Laboratories (Abbott Park, IL, USA).

Histological analysis

For H&E staining, fixed testicular tissue was collected and rinsed, followed by immersion in alcohol and a clear xylene wash. The samples were immersed in wax within a culture dish and then cooled and solidified to form wax blocks. The paraffin blocks were sliced into approximately 4-μm thick sections and stored at 4°C. The paraffin sections were treated with xylene, anhydrous ethanols, graded ethanol, and distilled water for dewaxing and hydration. The mitochondria and nuclei were subsequently stained with hematoxylin staining solution and 1% hydrochloric acid – methanol, followed by thorough washing with running water. The sections were placed in eosin stain for cytoplasmic staining, washed and processed through graded ethanol and xylene, and finally sealed with neutral gum. Quantitative histological assessment was performed on H&E-stained sections. The number of spermatogonia, primary spermatocytes, and round/elongated spermatids per seminiferous tubule cross-section was manually counted. Only tubules with nearly circular cross-sections were assessed to minimize counting bias. A minimum of 100 such tubular cross-sections were evaluated for each sample by two independent observers blinded to the group assignment.

Proteomic analysis and bioinformatics of testis

For proteomic analysis, we selected five NOA and five OA samples from the total cohort of 42 NOA and 33 OA patients. Baseline characteristics of these NOA patients were as follows: age (range: 26–37 years; mean ± standard deviation [s.d.]: 31.4 ± 4.9 years); BMI (range: 20–27 kg m⁻²; mean ± s.d.: 21.4 ± 3.0 kg m⁻²); left testicular volume range: 5.15–11.96 ml; mean ± s.d.: 7.994 ± 2.588 ml); and right testicular volume (range: 4.12–9.29 ml; mean ± s.d.: 6.034 ± 2.026 ml). Regarding the etiological classification, five cases of idiopathic NOA were included. All patients were histologically confirmed by testicular biopsy to have either spermatogenic arrest or SCOS, and none had received prior hormone therapy or surgical intervention. Testicular tissue samples from each five NOA and OA patients were homogenized in liquid nitrogen, lysed, and sonicated. Two groups were selected based on matched baseline characteristics (such as age and BMI) to minimize confounding factors. Samples were sonicated on ice using a VCX750 ultrasonic cell disruptor with a microtip (Sonics & Materials, Inc., Newtown, CT, USA), operating at 200 W, with a protocol of 5 bursts of 10 s each and 30 s of cooling between bursts to prevent overheating. After centrifugation at 12 000g for 10 min at 4°C using a Thermo high-speed refrigerated centrifuge (Thermo Fisher Scientific), supernatants were collected, and protein concentrations were quantified via bicinchoninic acid (BCA). For liquid chromatography-tandem mass spectrometry (LC-MS/MS), proteins were reduced (10 mmol l⁻¹ dithiothreitol [DTT], 37°C), alkylated (20 mmol l⁻¹ iodoacetamide, dark), digested with trypsin (50 ng μl⁻¹, 1:50 ratio, 37°C, overnight), and desalted using C18 columns. Peptides were separated on a C18 analytical column (Thermo Fisher Scientific) with a 91-min gradient (5%–35% Buffer B: 0.1% formic acid and 84% acetonitrile) at 300 nl min⁻¹. Mass spectrometry (Q Exactive, Thermo Fisher Scientific) operated in positive ion mode with data-dependent top 20 HCD fragmentation (300–1800 m z⁻¹). Raw data were processed via MaxQuant software (version 1.6.14; Max Planck Institute of Biochemistry, Martinsried, Germany) to identify DEPs (P < 0.05, fold change [FC] ≥1.5). Bioinformatics analyses included domain annotation using InterProScan (EMBL-EBI, Hinxton, UK), Gene Ontology (GO), and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment (adjusted P < 0.05) based on the GO and KEGG databases. Protein–protein interaction (PPI) network analysis was performed using the STRING database (https://string-db.org/, last accessed on 2025 Feb 06) and Cytoscape software (The Cytoscape Consortium, San Diego, CA, USA). Key modules were extracted via Molecular Complex Detection (MCODE; score ≥20) for pathway mapping. Detailed methodology is described in Supplementary Materials and Methods.

RT-qPCR analysis

Total RNA was extracted from testicular tissue using TRIzol reagent (Thermo Fisher Scientific). The quality and concentration of total RNA were assessed in a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific), followed by reverse transcription into cDNA with the Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). The cDNA was then amplified by the Quant Studio 1 Plus quantitative PCR system (Thermo Fisher Scientific) in combination with the 2× Universal SYBR Green Fast qPCR Mix Kit (Abclonal, Wuhan, China). The qRT-PCR amplification protocol consisted of an initial denaturation step at 95°C for 3 min, followed by 45 cycles of 95°C for 5 s and 60°C for 34 s. The relative expression levels of target genes were calculated by the 2^−ΔΔCt method and normalized to the expression of GAPDH in each sample. No reverse transcription controls were performed for all samples to exclude genomic DNA contamination. All primer sequences and RefSeq numbers used in this study are listed in Supplementary Table 1 (Xinjiang Youkang Biological, Urumqi, China).

Supplementary Table 1.

Primers used for polymerase chain reaction amplification

Gene name	Forward Primer	Reverse Primer	RefSeqs
homo-DYSF	AAGAACAGCGTGAACCCTGTA	CCTCTCGGAGTGGGACCTT	NM_001130455.2
homo-MYOF	TAATTGGCACGGCGACTGTAG	GGAGATCAGCTTGTACGGCAG	NM_013451.4
homo-CAV3	GACCCCAAGAACATTAACGAGG	GGACAACAGACGGTAGCACC	NM_001234.5
homo-CAPN3	GTCCTTAACACAGTCGTGAACA	TGAGCGCAATCATGCTACGG	NM_000070.3
homo-MG53	GAGGTGGATGTTGGCGACAA	CCGAAGCTCAGGTAAAGGC	NM_001008274.4
homo-CD63	CAGTGGTCATCATCGCAGTG	ATCGAAGCAGTGTGGTTGTTT	NM_001257389.2
homo-GAPDH	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG	NM_001256799.3

Western blot analysis

Testicular tissue protein extracts were prepared using a tissue lysis buffer composed of 98% radioimmunoprecipitation assay (RIPA) buffer supplemented with 1% phenylmethylsulfonyl fluoride (PMSF) and 1% phosphatase inhibitor (both from Solarbio, Beijing, China). Tissue homogenization was performed using a tissue disruptor (Servicebio). The homogenates were incubated at 4°C for 30 min, followed by centrifugation at 20 390g for 15 min, and the supernatant was collected. Protein concentration was quantified by BCA Protein Assay Kit (Thermo Fisher Scientific). Equal amounts of protein from each sample were mixed with protein loading buffer and phosphate-buffered saline (PBS), thoroughly vortexed, and denatured at 100°C for 10 min. Proteins were separated by 10% SDS-PAGE and transferred onto polyvinylidene fluoride (PVDF) membranes under ice-bath conditions. The PVDF membranes were blocked with 5% skimmed milk in TBST for 2 h at room temperature, washed three times with TBST, and incubated overnight at 4°C with primary antibodies. Following incubation, the membranes were washed three times with TBST and incubated with HRP-conjugated goat antirabbit IgG secondary antibody for 2 h at room temperature. Finally, immunoreactive bands were visualized by Image Lab Chemiluminescence Imaging System (Bio-Rad, Hercules, CA, USA). Protein expression levels were quantified in Quantity One software and normalized to GAPDH as an internal loading control.

Statistical analyses

In addition to the proteomics data, other experimental results were expressed as the mean ± s.d. Statistical analysis and visualization were conducted using GraphPad Prism software (version 9.0, GraphPad Software, Boston, MA, USA). For normally distributed data, mean ± s.d. was used with Student’s t-test; for skewed data, median (interquartile range [IQR]) was used with Mann–Whitney U test. P < 0.05 was considered statistically significant.

RESULTS

Serum hormone measurement

Compared with the OA group, the NOA group exhibited elevated levels of LH and FSH (both P < 0.05), suggesting the dysregulation of hypothalamic–pituitary hormones; however, there was no significant difference in T and E2 levels between patients with NOA and OA (both P > 0.05; Figure 1a). Serum sex hormone assays confirmed the distinctions in serum sex hormones between patients with NOA and OA.

Figure 1.

Serum sex hormone levels and testicular pathology in NOA and OA patients. (a) Comparison of serum sex hormone levels between patients with NOA and OA. (b) Representative images of testicular tissue histopathology in NOA and OA groups using H&E staining; the red boxes indicate regions magnified 2 times. Statistical data are presented as mean ± s.d. ^**P < 0.05 indicates a significant difference between the NOA and OA groups (one-way ANOVA). NOA: non-obstructive azoospermia; OA: obstructive azoospermia; LH: luteinizing hormone; FSH: follicle-stimulating hormone; T: testosterone; E2: estradiol; H&E: hematoxylin and eosin; s.d.: standard deviation; ANOVA: analysis of variance.

Morphological results

The results of testicular H&E staining indicated that spermatogenesis was absent in the NOA group, which was characterized by Sertoli cell proliferation and notable thickening of the basement membrane surrounding the seminiferous tubules. In contrast, the OA group exhibited preserved spermatogenesis, with various stages of spermatogenic cells and mature spermatozoa present within the seminiferous tubules (Figure 1b).

Identification and quantification of protein differences

We conducted a proteomic analysis of ten testicular tissue samples (five NOA and five OA) using label-free LC-MS/MS. A total of 5264 proteins were identified via mass spectrometry, as shown in Figure 2a and Supplementary Table 2. Additionally, Figure 2b shows a Venn diagram depicting the distribution of proteins identified among the intergroup samples.

Figure 2.

Proteomic analysis of testicular tissues in NOA and OA. (a) Bar graph depicting protein identification and quantification. (b) Venn diagram illustrating the overlap of proteins identified in different groups. (c) Bar graph showing the number of upregulated and downregulated DEPs. (d) Volcano plot representing DEPs; the horizontal axis represents FC (log₂ transformed) and the vertical axis represents the statistical significance (-log₁₀[P-value]). (e) Hierarchical clustering analysis and heatmap of DEPs. Color scale indicates relative protein abundance (z-score). (f) Pie chart showing the predicted subcellular localization of DEPs. NOA: non-obstructive azoospermia; OA: obstructive azoospermia; DYSF: dysferlin; MYOF: myoferlin; FC: fold change; DEPs: differentially expressed proteins.

Supplementary Table 2.

Differentially Expressed Proteins

Protein	Protein Name	Gene Name	Coverage	NOA/OA	t test P	Up or down
O75923	Dysferlin	DYSF	9.3	22.15101249	0.010068804	Up
Q3SY77	UDP-glucuronosyltransferase 3A2	UGT3A2	24.7	12.51880217	6.6257E-06	Up
Q14643	Inositol 1,4,5-trisphosphate receptor type 1	ITPR1	8	8.481499028	0.00879053	Up
P09488	Glutathione S-transferase Mu 1	GSTM1	82.6	7.285687899	0.004220275	Up
P23946	Chymase	CMA1	51.4	6.791698951	0.003837369	Up
P15088	Mast cell carboxypeptidase A	CPA3	28.3	6.657346388	0.004276478	Up
P01911	HLA class II histocompatibility antigen, DRB1 beta chain	HLA-DRB1	35.7	5.983847852	0.03158362	Up
Q7Z3B1	Neuronal growth regulator 1	NEGR1	32.8	5.892678186	0.017218306	Up
Q9HB40	Retinoid-inducible serine carboxypeptidase	SCPEP1	21.7	5.729595314	0.003253053	Up
P46439	Glutathione S-transferase Mu 5	GSTM5	75.7	5.702837228	0.002589247	Up
Q12797	Aspartyl/asparaginyl beta-hydroxylase	ASPH	22.7	5.124353738	2.99221E-05	Up
Q9NZM1	Myoferlin	MYOF	14.1	4.571770403	0.002264913	Up
P22676	Calretinin	CALB2	80.8	4.481827283	1.73016E-06	Up
P08311	Cathepsin G	CTSG	47.8	4.379833436	0.003523685	Up
P14207	Folate receptor beta	FOLR2	29.8	4.37855995	0.002764425	Up
P20231	Tryptase beta-2	TPSB2	27.3	4.361374734	0.009784155	Up
P48681	Nestin	NES	11.4	4.287500318	0.000261988	Up
P10620	Microsomal glutathione S-transferase 1	MGST1	43.2	4.279617156	0.000667954	Up
Q9BXN1	Asporin	ASPN	34.7	4.196230005	0.004368449	Up
Q6UWT4	Uncharacterized protein C5orf46	C5orf46	21.8	4.18681138	0.001104344	Up
P51460	Insulin-like 3	INSL3	26	3.88785144	3.30159E-05	Up
P02511	Alpha-crystallin B chain	CRYAB	45.7	3.798525099	0.000276849	Up
Q9UHJ6	Sedoheptulokinase	SHPK	33.3	3.777412022	0.000131443	Up
Q9H9L3	Interferon-stimulated 20 kDa exonuclease-like 2	ISG20L2	3.4	3.7702778	0.002294245	Up
Q687X5	Metalloreductase STEAP4	STEAP4	42.5	3.759425715	0.000198349	Up
Q86VB7	Scavenger receptor cysteine-rich type 1 protein M130	CD163	20.3	3.733105285	0.006271017	Up
P04839	Cytochrome b-245 heavy chain	CYBB	13	3.710081239	0.014292928	Up
Q58EX7	Puratrophin-1	PLEKHG4	2.6	3.701616623	0.000127726	Up
P11908	Ribose-phosphate pyrophosphokinase 2	PRPS2	73.3	3.658944609	0.000172048	Up
Q63HR2	Tensin-2	TNS2	14	3.613771175	0.018854769	Up
P31146	Coronin-1A	CORO1A	20.6	3.559257766	0.001162247	Up
Q15493	Regucalcin	RGN	26.1	3.506473228	0.031343924	Up
Q9P0K7	Ankycorbin	RAI14	11.7	3.449502714	0.023774932	Up
Q14112	Nidogen-2	NID2	9.7	3.443019984	0.000911222	Up
O14684	Prostaglandin E synthase	PTGES	19.1	3.43690149	0.003024627	Up
Q06278	Aldehyde oxidase	AOX1	35.9	3.433445248	2.68816E-06	Up
P53634	Dipeptidyl peptidase 1	CTSC	32.2	3.409026631	0.000388894	Up
Q14956	Transmembrane glycoprotein NMB	GPNMB	4.7	3.400708007	0.000242471	Up
P50135	Histamine N-methyltransferase	HNMT	39.7	3.366728556	0.005507671	Up
P08519	Apolipoprotein (a)	LPA	14	3.358814336	0.035720091	Up
Q15800	Methylsterol monooxygenase 1	MSMO1	12.6	3.323215251	0.000230279	Up
O14495	Phospholipid phosphatase 3	PLPP3	26.4	3.219758284	0.005170332	Up
P45381	Aspartoacylase	ASPA	32.9	3.180089257	0.01136327	Up
Q5VZ89	DENN domain-containing protein 4C	DENND4C	8.7	3.157977716	0.003161024	Up
P98172	Ephrin-B1	EFNB1	14.7	3.154315166	2.14255E-05	Up
Q01484	Ankyrin-2	ANK2	4.1	3.133729912	0.000441969	Up
Q7Z7G0	Target of Nesh-SH3	ABI3BP	11.6	3.132331918	0.044980516	Up
Q15293	Reticulocalbin-1	RCN1	57.7	3.10470093	0.000149217	Up
Q14141	Septin-6	SEPTIN6	56.5	3.098671689	0.002496972	Up
Q8WTV0	Scavenger receptor class B member 1	SCARB1	5.8	3.095731789	0.005601485	Up
Q8IVN8	Somatomedin-B and thrombospondin type-1 domain-containing protein	SBSPON	30.7	3.089764808	0.00027588	Up
P42330	Aldo-keto reductase family 1 member C3	AKR1C3	64.1	3.062287766	0.01203855	Up
P31949	Protein S100-A11	S100A11	82.9	3.042828642	2.29093E-05	Up
Q96AQ6	Pre-B-cell leukemia transcription factor-interacting protein 1	PBXIP1	30.9	3.026401485	0.000225749	Up
Q5JTB6	Placenta-specific protein 9	PLAC9	33	3.017086015	0.002854403	Up
Q9HBK9	Arsenite methyltransferase	AS3MT	45.3	3.016134595	0.000569048	Up
A8MSI8	LYR motif-containing protein 9	LYRM9	24.4	2.995823532	0.02190614	Up
O60701	UDP-glucose 6-dehydrogenase	UGDH	32.6	2.977827015	2.45419E-05	Up
P36269	Glutathione hydrolase 5 proenzyme	GGT5	19.5	2.973561317	0.000129018	Up
P25391	Laminin subunit alpha-1	LAMA1	41.7	2.956419364	0.013935545	Up
P08962	CD63 antigen	CD63	7.6	2.949590676	0.00038823	Up
Q15125	3-beta-hydroxysteroid-Delta (8), Delta (7)-isomerase	EBP	16.5	2.933766589	6.17397E-05	Up
P20292	Arachidonate 5-lipoxygenase-activating protein	ALOX5AP	8.1	2.931124964	0.007373119	Up
P13611	Versican core protein	VCAN	6.2	2.901304003	9.95848E-07	Up
P29966	Myristoylated alanine-rich C-kinase substrate	MARCKS	19	2.878588584	0.009873774	Up
O76062	Delta (14)-sterol reductase TM7SF2	TM7SF2	13.4	2.866115828	0.000192659	Up
P55268	Laminin subunit beta-2	LAMB2	57.7	2.853536694	0.002182529	Up
O95340	Bifunctional 3-phosphoadenosine 5-phosphosulfate synthase 2	PAPSS2	46.9	2.847175191	0.00167524	Up
Q15738	Sterol-4-alpha-carboxylate 3-dehydrogenase, decarboxylating	NSDHL	42.9	2.817465608	6.49053E-05	Up
P22694	cAMP-dependent protein kinase catalytic subunit beta	PRKACB	50.7	2.814683725	0.001877677	Up
P05543	Thyroxine-binding globulin	SERPINA7	24.3	2.807433336	0.017395074	Up
Q15847	Adipogenesis regulatory factor	ADIRF	78.9	2.797299258	0.008531109	Up
P05093	Steroid 17-alpha-hydroxylase/17,20 lyase	CYP17A1	56.9	2.783178352	2.17584E-06	Up
O14756	17-beta-hydroxysteroid dehydrogenase type 6	HSD17B6	53.6	2.772198411	0.002784164	Up
Q03013	Glutathione S-transferase Mu 4	GSTM4	83.9	2.768296757	0.014783642	Up
P60903	Protein S100-A10	S100A10	35.1	2.763630542	0.001057702	Up
P51530	DNA replication ATP-dependent helicase/nuclease DNA2	DNA2	0.8	2.732870585	0.049842463	Up
O15217	Glutathione S-transferase A4	GSTA4	40.5	2.726197947	1.82021E-05	Up
Q15274	Nicotinate-nucleotide pyrophosphorylase [carboxylating]	QPRT	27.3	2.726097737	6.51704E-05	Up
P07686	Beta-hexosaminidase subunit beta	HEXB	24.5	2.719699126	1.62684E-06	Up
P28062	Proteasome subunit beta type-8	PSMB8	17.4	2.717171858	0.001894891	Up
P22897	Macrophage mannose receptor 1	MRC1	19.5	2.714457509	3.56698E-05	Up
Q14315	Filamin-C	FLNC	12.7	2.710552651	0.034323402	Up
Q96IY4	Carboxypeptidase B2	CPB2	11.3	2.709193021	0.000543424	Up
P30711	Glutathione S-transferase theta-1	GSTT1	42.5	2.685344934	0.01748719	Up
P11047	Laminin subunit gamma-1	LAMC1	51.5	2.678821554	0.00395102	Up
Q9Y2S2	Lambda-crystallin homolog	CRYL1	22.3	2.665185964	0.020938202	Up
O15230	Laminin subunit alpha-5	LAMA5	13.6	2.660073194	0.004276851	Up
Q8TDB4	Protein MGARP	MGARP	21.7	2.655544215	0.009994312	Up
Q9UN36	Protein NDRG2	NDRG2	45	2.650188801	0.000576631	Up
Q9C0J1	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase 4	B3GNT4	4.5	2.631432354	0.000164217	Up
P20962	Parathymosin	PTMS	22.5	2.630027689	0.000534848	Up
Q16850	Lanosterol 14-alpha demethylase	CYP51A1	55.2	2.622345587	0.002604726	Up
P98082	Disabled homolog 2	DAB2	10.5	2.600314716	0.005334114	Up
P51857	Aldo-keto reductase family 1 member D1	AKR1D1	5.2	2.598021189	0.000545034	Up
Q9Y3Q0	N-acetylated-alpha-linked acidic dipeptidase 2	NAALAD2	27.7	2.583736399	0.000317807	Up
P55899	IgG receptor FcRn large subunit p51	FCGRT	25.8	2.577977896	0.021136253	Up
P35555	Fibrillin-1	FBN1	43.7	2.571422897	2.37606E-06	Up
A0FGR8	Extended synaptotagmin-2	ESYT2	14.9	2.549231556	0.005023726	Up
Q7Z4H8	Protein O-glucosyltransferase 3	POGLUT3	19.5	2.540040205	0.013758225	Up
Q96DG6	Carboxymethylenebutenolidase homolog	CMBL	43.7	2.539935136	9.16998E-07	Up
Q96F85	CB1 cannabinoid receptor-interacting protein 1	CNRIP1	53.7	2.532583772	0.000524496	Up
Q15392	Delta (24)-sterol reductase	DHCR24	48.6	2.528973835	0.004085548	Up
Q9H8H3	Putative methyltransferase-like protein 7A	METTL7A	43	2.517484909	2.93458E-07	Up
O14558	Heat shock protein beta-6	HSPB6	91.9	2.502736614	0.003976763	Up
P21980	Protein-glutamine gamma-glutamyltransferase 2	TGM2	40.6	2.499870701	0.01160932	Up
P08138	Tumor necrosis factor receptor superfamily member 16	NGFR	20.4	2.498032659	0.0045797	Up
P47895	Aldehyde dehydrogenase family 1 member A3	ALDH1A3	48.8	2.486104299	0.001947793	Up
P01903	HLA class II histocompatibility antigen, DR alpha chain	HLA-DRA	12.2	2.478933491	0.010748205	Up
Q7Z3C6	Autophagy-related protein 9A	ATG9A	3.9	2.469010975	0.011772909	Up
P23141	Liver carboxylesterase 1	CES1	23.8	2.462986156	0.01283673	Up
P05090	Apolipoprotein D	APOD	34.9	2.462106864	0.001189149	Up
Q04828	Aldo-keto reductase family 1 member C1	AKR1C1	70.3	2.458094324	0.002133544	Up
Q9ULZ3	Apoptosis-associated speck-like protein containing a CARD	PYCARD	13.3	2.456258384	0.00905741	Up
Q7L775	EPM2A-interacting protein 1	EPM2AIP1	23.4	2.445934714	7.91371E-05	Up
Q9UIJ7	GTP:AMP phosphotransferase AK3, mitochondrial	AK3	69.6	2.444463741	3.80862E-05	Up
P05108	Cholesterol side-chain cleavage enzyme, mitochondrial	CYP11A1	61	2.442332136	4.50395E-05	Up
P08571	Monocyte differentiation antigen CD14	CD14	22.4	2.439328384	0.001971696	Up
P29622	Kallistatin	SERPINA4	28.3	2.413232086	0.000290721	Up
Q9H6R3	Acyl-CoA synthetase short-chain family member 3, mitochondrial	ACSS3	11.7	2.412515084	0.00042797	Up
P07099	Epoxide hydrolase 1	EPHX1	69.2	2.40596147	7.3206E-08	Up
Q5SRE7	Phytanoyl-CoA dioxygenase domain-containing protein 1	PHYHD1	24.4	2.405817675	0.002822638	Up
P49675	Steroidogenic acute regulatory protein, mitochondrial	STAR	39.3	2.403797509	0.006123882	Up
P61769	Beta-2-microglobulin	B2M	37.8	2.402662167	0.004343873	Up
Q6UXB8	Peptidase inhibitor 16	PI16	7.3	2.40163004	0.015068072	Up
Q96T51	RUN and FYVE domain-containing protein 1	RUFY1	16.7	2.401216194	0.009120119	Up
O95865	N(G), N(G)-dimethylarginine dimethylaminohydrolase 2	DDAH2	64.6	2.39845173	0.000845002	Up
Q9Y6K9	NF-kappa-B essential modulator	IKBKG	16.2	2.384972825	0.01434853	Up
Q8N688	Beta-defensin 123	DEFB123	23.9	2.377874746	0.019543026	Up
O14498	Immunoglobulin superfamily containing leucine-rich repeat protein	ISLR	14.5	2.37323361	0.001541033	Up
Q13449	Limbic system-associated membrane protein	LSAMP	28.1	2.36927757	0.013556231	Up
P52789	Hexokinase-2	HK2	37.5	2.36880359	2.68961E-07	Up
P29590	Protein PML	PML	20.4	2.3583807	0.000887604	Up
Q13228	Methanethiol oxidase	SELENBP1	83.9	2.352370375	0.000668265	Up
Q9UBM7	7-dehydrocholesterol reductase	DHCR7	16.2	2.349606108	2.93259E-05	Up
O00469	Procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2	PLOD2	2.7	2.346144342	0.032111625	Up
P16444	Dipeptidase 1	DPEP1	63	2.34406104	0.001494447	Up
Q96C23	Galactose mutarotase	GALM	59.9	2.337614703	0.006904346	Up
Q9UH62	Armadillo repeat-containing X-linked protein 3	ARMCX3	33.2	2.323494904	0.00221108	Up
P07355	Annexin A2	ANXA2	77	2.318347764	0.00033188	Up
Q08380	Galectin-3-binding protein	LGALS3BP	37.6	2.312787746	0.000192185	Up
Q86TX2	Acyl-coenzyme A thioesterase 1	ACOT1	65.8	2.312158301	0.00259344	Up
P06703	Protein S100-A6	S100A6	84.4	2.306723351	8.87406E-07	Up
P17900	Ganglioside GM2 activator	GM2A	19.7	2.306689715	3.18003E-05	Up
Q9NT22	EMILIN-3	EMILIN3	13.7	2.302887715	0.026314708	Up
O95834	Echinoderm microtubule-associated protein-like 2	EML2	27	2.296053199	0.006211069	Up
Q9UM47	Neurogenic locus notch homolog protein 3	NOTCH3	0.4	2.288626744	0.010614898	Up
P41218	Myeloid cell nuclear differentiation antigen	MNDA	25.1	2.286624733	0.003187007	Up
P01714	Immunoglobulin lambda variable 3-19	IGLV3-19	8	2.285565859	0.000253755	Up
P08263	Glutathione S-transferase A1	GSTA1	71.6	2.278360551	2.97776E-05	Up
Q9UBG0	C-type mannose receptor 2	MRC2	23	2.276153708	0.000645949	Up
P10321	HLA class I histocompatibility antigen, C alpha chain	HLA-C	29	2.26529352	0.025731202	Up
O76070	Gamma-synuclein	SNCG	29.9	2.256636274	0.041185901	Up
P06280	Alpha-galactosidase A	GLA	22.1	2.256447304	0.000329584	Up
Q8N6C5	Immunoglobulin superfamily member 1	IGSF1	7.3	2.253202585	0.039771571	Up
P62834	Ras-related protein Rap-1A	RAP1A	80.4	2.252573942	0.002405228	Up
P14384	Carboxypeptidase M	CPM	18.5	2.25233927	0.000135339	Up
O00264	Membrane-associated progesterone receptor component 1	PGRMC1	62.1	2.251980851	0.000239605	Up
Q06187	Tyrosine-protein kinase BTK	BTK	1.7	2.251755984	0.01087733	Up
Q96PE7	Methylmalonyl-CoA epimerase, mitochondrial	MCEE	5.1	2.248283291	0.001081136	Up
Q9Y6K5	2-5-oligoadenylate synthase 3	OAS3	7	2.243646973	0.009528171	Up
O60568	Multifunctional procollagen lysine hydroxylase and glycosyltransferase LH3	PLOD3	18.7	2.241426263	0.013245266	Up
Q30154	HLA class II histocompatibility antigen, DR beta 5 chain	HLA-DRB5	26.3	2.237669542	0.01187185	Up
Q01581	Hydroxymethylglutaryl-CoA synthase, cytoplasmic	HMGCS1	26	2.235067377	0.002869843	Up
Q9NZ08	Endoplasmic reticulum aminopeptidase 1	ERAP1	24.5	2.234502886	0.006814031	Up
Q8N690	Beta-defensin 119	DEFB119	56	2.233702266	0.005424923	Up
Q13907	Isopentenyl-diphosphate Delta-isomerase 1	IDI1	44.1	2.229169784	2.18349E-05	Up
P05111	Inhibin alpha chain	INHA	21.6	2.215042385	0.001623241	Up
Q9BVC6	Transmembrane protein 109	TMEM109	12.8	2.205507131	0.000500836	Up
Q13885	Tubulin beta-2A chain	TUBB2A	51	2.203382511	0.001025919	Up
Q8N5I4	Dehydrogenase/reductase SDR family member on chromosome X	DHRSX	5.2	2.191556171	0.009960087	Up
Q96LZ7	Regulator of microtubule dynamics protein 2	RMDN2	15.9	2.189188221	0.008074223	Up
Q8IV08	5-3 exonuclease PLD3	PLD3	13.1	2.187147877	2.54066E-06	Up
O14907	Tax1-binding protein 3	TAX1BP3	39.5	2.184448158	1.90391E-05	Up
P00167	Cytochrome b5	CYB5A	49.3	2.183298305	3.82094E-05	Up
Q567U6	Coiled-coil domain-containing protein 93	CCDC93	13.2	2.176193076	0.025152597	Up
Q96DC8	Enoyl-CoA hydratase domain-containing protein 3, mitochondrial	ECHDC3	35.6	2.174385368	0.000279549	Up
Q9P2B2	Prostaglandin F2 receptor negative regulator	PTGFRN	18.2	2.169898067	0.002860972	Up
O94919	Endonuclease domain-containing 1 protein	ENDOD1	20.6	2.164111327	0.00416032	Up
P04083	Annexin A1	ANXA1	72.5	2.153126125	0.002829872	Up
P84157	Matrix-remodeling-associated protein 7	MXRA7	34.8	2.1517992	8.27786E-05	Up
P09455	Retinol-binding protein 1	RBP1	84.4	2.149557547	6.85529E-05	Up
P10109	Adrenodoxin, mitochondrial	FDX1	37.5	2.147812127	0.000574948	Up
P13796	Plastin-2	LCP1	63	2.143845807	0.00082712	Up
Q8N2G8	GH3 domain-containing protein	GHDC	8.3	2.141999835	0.005844194	Up
P48059	LIM and senescent cell antigen-like-containing domain protein 1	LIMS1	54.2	2.141511597	0.000928089	Up
Q8NF91	Nesprin-1	SYNE1	4.9	2.139429462	0.001626654	Up
Q96S66	Chloride channel CLIC-like protein 1	CLCC1	15.1	2.137023557	2.72093E-05	Up
P17252	Protein kinase C alpha type	PRKCA	29.2	2.133937515	5.25394E-05	Up
Q10589	Bone marrow stromal antigen 2	BST2	13.9	2.13078082	0.003299634	Up
Q9BQE5	Apolipoprotein L2	APOL2	13.1	2.129349182	0.001816201	Up
Q96AC1	Fermitin family homolog 2	FERMT2	46.6	2.124507736	0.000501717	Up
O75828	Carbonyl reductase [NADPH] 3	CBR3	37.2	2.120066847	0.002648797	Up
Q6NUK4	Receptor expression-enhancing protein 3	REEP3	14.5	2.113801441	0.044218604	Up
Q9BYF1	Angiotensin-converting enzyme 2	ACE2	45.2	2.109494103	0.006631997	Up
A1X283	SH3 and PX domain-containing protein 2B	SH3PXD2B	9.1	2.109125706	2.10787E-05	Up
O95479	GDH/6PGL endoplasmic bifunctional protein	H6PD	42.5	2.10733377	0.000764414	Up
P52566	Rho GDP-dissociation inhibitor 2	ARHGDIB	53.2	2.107044674	0.004677214	Up
P02545	Prelamin-A/C	LMNA	78.5	2.102308322	0.000208715	Up
Q07507	Dermatopontin	DPT	50.7	2.101649817	0.030633703	Up
Q8TBC5	Zinc finger and SCAN domain-containing protein 18	ZSCAN18	5.3	2.099426617	0.015502218	Up
P15291	Beta-1,4-galactosyltransferase 1	B4GALT1	9.8	2.098127864	0.047764228	Up
Q9Y646	Carboxypeptidase Q	CPQ	38.3	2.096349382	9.89222E-05	Up
O15162	Phospholipid scramblase 1	PLSCR1	9.4	2.09170715	0.000201543	Up
O14773	Tripeptidyl-peptidase 1	TPP1	30.6	2.089914013	0.0003027	Up
P30536	Translocator protein	TSPO	9.5	2.089824597	0.002637516	Up
Q9UNH6	Sorting nexin-7	SNX7	16.3	2.083653165	0.000364453	Up
P17813	Endoglin	ENG	30.7	2.083417813	0.00477215	Up
Q969X1	Protein lifeguard 3	TMBIM1	4.5	2.070490129	0.000571581	Up
Q6UX71	Plexin domain-containing protein 2	PLXDC2	8.9	2.070171372	0.000599733	Up
Q96FQ6	Protein S100-A16	S100A16	76.7	2.066940832	2.52776E-06	Up
Q15165	Serum paraoxonase/arylesterase 2	PON2	56.8	2.065882972	0.005348223	Up
P23470	Receptor-type tyrosine-protein phosphatase gamma	PTPRG	5.6	2.060622413	0.013486364	Up
Q7Z2W4	Zinc finger CCCH-type antiviral protein 1	ZC3HAV1	11.1	2.059595016	0.003712838	Up
Q9HA72	Calcium homeostasis modulator protein 2	CALHM2	5.3	2.056105336	0.016581305	Up
P26447	Protein S100-A4	S100A4	36.6	2.054829393	0.012759466	Up
P49327	Fatty acid synthase	FASN	46.3	2.048173466	1.2937E-06	Up
P35754	Glutaredoxin-1	GLRX	37.7	2.047984367	3.80049E-05	Up
Q5T3F8	CSC1-like protein 2	TMEM63B	5.6	2.04572023	0.01746895	Up
Q04760	Lactoylglutathione lyase	GLO1	84.8	2.041396088	7.18081E-05	Up
P04792	Heat shock protein beta-1	HSPB1	84.9	2.037669582	0.001857901	Up
Q07954	Prolow-density lipoprotein receptor-related protein 1	LRP1	18.5	2.03749488	0.000742918	Up
Q8WUP2	Filamin-binding LIM protein 1	FBLIM1	7	2.03588918	0.006047999	Up
Q9H2D6	TRIO and F-actin-binding protein	TRIOBP	6.2	2.034573207	0.0103673	Up
P06865	Beta-hexosaminidase subunit alpha	HEXA	32.5	2.034348284	3.28935E-05	Up
O75369	Filamin-B	FLNB	63.7	2.033079665	0.00010003	Up
Q9Y5L3	Ectonucleoside triphosphate diphosphohydrolase 2	ENTPD2	30.9	2.030493326	0.027289881	Up
P07357	Complement component C8 alpha chain	C8A	37.7	2.027820676	0.029644735	Up
O95302	Peptidyl-prolyl cis-trans isomerase FKBP9	FKBP9	21.9	2.027477013	0.024156301	Up
Q9BZG1	Ras-related protein Rab-34	RAB34	36.3	2.025791639	0.005459912	Up
Q16270	Insulin-like growth factor-binding protein 7	IGFBP7	29.4	2.025428917	1.15609E-05	Up
P14543	Nidogen-1	NID1	42.7	2.020529614	0.001260172	Up
O43175	D-3-phosphoglycerate dehydrogenase	PHGDH	43.7	2.019293078	0.012347872	Up
A0A0C4DH31	Immunoglobulin heavy variable 1-18	IGHV1-18	23.9	2.017969035	0.007487443	Up
Q6PIU2	Neutral cholesterol ester hydrolase 1	NCEH1	10.5	2.009978535	0.005388546	Up
P61225	Ras-related protein Rap-2b	RAP2B	31.1	2.009018025	0.015626115	Up
P62328	Thymosin beta-4	TMSB4X	88.6	2.009003529	2.6132E-05	Up
Q96NT0	Coiled-coil domain-containing protein 115	CCDC115	27.8	2.008922579	0.021884128	Up
Q09666	Neuroblast differentiation-associated protein AHNAK	AHNAK	68.1	2.007028267	0.000596916	Up
Q96TA1	Protein Niban 2	NIBAN2	24.4	2.005036864	0.006355774	Up
Q9BSJ8	Extended synaptotagmin-1	ESYT1	31.5	2.004112351	0.000259808	Up
P09211	Glutathione S-transferase P	GSTP1	69.5	2.001444737	0.000553715	Up
P16949	Stathmin	STMN1	72.5	0.499491089	0.000158672	Down
Q13573	SNW domain-containing protein 1	SNW1	25.9	0.49948264	0.000848428	Down
P30566	Adenylosuccinate lyase	ADSL	53.5	0.49859897	0.005171556	Down
Q16629	Serine/arginine-rich splicing factor 7	SRSF7	28.6	0.498057419	0.00023949	Down
Q9C0J8	pre-mRNA 3 end processing protein WDR33	WDR33	5.3	0.497651341	0.007062596	Down
P41250	Glycine--tRNA ligase	GARS1	43.3	0.496580682	4.78285E-05	Down
Q15717	ELAV-like protein 1	ELAVL1	38.3	0.496316339	3.87182E-05	Down
Q9UEW8	STE20/SPS1-related proline-alanine-rich protein kinase	STK39	25.5	0.49616375	0.000583571	Down
P52594	Arf-GAP domain and FG repeat-containing protein 1	AGFG1	14.1	0.495963428	0.002489623	Down
O15355	Protein phosphatase 1G	PPM1G	28.8	0.494744762	0.000940386	Down
O43427	Acidic fibroblast growth factor intracellular-binding protein	FIBP	21.2	0.494609356	0.001041152	Down
Q15819	Ubiquitin-conjugating enzyme E2 variant 2	UBE2V2	71.7	0.494212388	1.90409E-05	Down
Q9Y4E8	Ubiquitin carboxyl-terminal hydrolase 15	USP15	23.9	0.493615097	1.90516E-05	Down
P16402	Histone H1.3	H1-3	35.3	0.493508357	0.006666079	Down
Q9BV86	N-terminal Xaa-Pro-Lys N-methyltransferase 1	NTMT1	52.5	0.493425646	1.69963E-05	Down
P40818	Ubiquitin carboxyl-terminal hydrolase 8	USP8	14.8	0.492002849	0.001369846	Down
P29084	Transcription initiation factor IIE subunit beta	GTF2E2	8.9	0.491675022	0.002190876	Down
P33121	Long-chain-fatty-acid--CoA ligase 1	ACSL1	37	0.4908907	7.13367E-05	Down
Q9NPJ3	Acyl-coenzyme A thioesterase 13	ACOT13	62.1	0.490383979	8.4726E-05	Down
Q9GZP4	PITH domain-containing protein 1	PITHD1	63.5	0.490322465	0.000780089	Down
Q9UNZ2	NSFL1 cofactor p47	NSFL1C	65.7	0.489947689	0.000152628	Down
Q8TF09	Dynein light chain roadblock-type 2	DYNLRB2	60.4	0.48879374	0.000193145	Down
P40937	Replication factor C subunit 5	RFC5	7.9	0.4887073	0.001152819	Down
Q9H3K6	BolA-like protein 2	BOLA2B	80.2	0.487452539	0.000280417	Down
Q9HD15	Steroid receptor RNA activator 1	SRA1	24.6	0.487450569	0.001130535	Down
P13861	cAMP-dependent protein kinase type II-alpha regulatory subunit	PRKAR2A	64.1	0.487291022	6.84148E-06	Down
Q9NSD9	Phenylalanine--tRNA ligase beta subunit	FARSB	46.3	0.48661651	5.14828E-06	Down
O95347	Structural maintenance of chromosomes protein 2	SMC2	10.6	0.486441754	0.008175888	Down
Q92615	La-related protein 4B	LARP4B	5.7	0.486257738	0.004739077	Down
O95777	U6 snRNA-associated Sm-like protein LSm8	LSM8	54.2	0.485765614	0.012552329	Down
O60884	DnaJ homolog subfamily A member 2	DNAJA2	48.1	0.4850164	0.000233156	Down
Q9BR61	Acyl-CoA-binding domain-containing protein 6	ACBD6	29.1	0.484637996	8.05263E-05	Down
Q15046	Lysine--tRNA ligase	KARS1	61.6	0.484491728	2.31573E-05	Down
P62312	U6 snRNA-associated Sm-like protein LSm6	LSM6	56.2	0.484381488	0.002759072	Down
P55809	Succinyl-CoA: 3-ketoacid coenzyme A transferase 1, mitochondrial	OXCT1	46.5	0.48205312	0.000141376	Down
Q01844	RNA-binding protein EWS	EWSR1	15.1	0.480872582	5.29787E-06	Down
Q8IYB8	ATP-dependent RNA helicase SUPV3L1, mitochondrial	SUPV3L1	16.2	0.480456381	0.000262402	Down
Q86TU7	Actin-histidine N-methyltransferase	SETD3	27.8	0.48032471	0.000196012	Down
Q9H3G5	Probable serine carboxypeptidase CPVL	CPVL	26.3	0.479864861	0.000324761	Down
Q8IZ07	Ankyrin repeat domain-containing protein 13A	ANKRD13A	7.5	0.478015305	0.002925762	Down
P41567	Eukaryotic translation initiation factor 1	EIF1	77	0.477417946	0.010358368	Down
P36915	Guanine nucleotide-binding protein-like 1	GNL1	31.5	0.47682055	7.82222E-06	Down
O75886	Signal transducing adapter molecule 2	STAM2	13.1	0.476545713	3.18687E-05	Down
Q86Y56	Dynein axonemal assembly factor 5	DNAAF5	10.4	0.476544876	0.000854356	Down
P18583	Protein SON	SON	9.1	0.476511669	0.000469974	Down
Q9NPQ8	Synembryn-A	RIC8A	30.9	0.476364502	0.000575886	Down
O00422	Histone deacetylase complex subunit SAP18	SAP18	52.9	0.476189296	3.95782E-05	Down
Q13243	Serine/arginine-rich splicing factor 5	SRSF5	25.4	0.475659938	5.7638E-06	Down
Q8IXT5	RNA-binding protein 12B	RBM12B	3.3	0.474993261	0.00551334	Down
Q99567	Nuclear pore complex protein Nup88	NUP88	30.5	0.474931061	9.05437E-05	Down
O43813	Glutathione S-transferase LANCL1	LANCL1	52.4	0.474836665	1.13113E-05	Down
P53367	Arfaptin-1	ARFIP1	29.2	0.474328989	0.002163962	Down
Q8WUK0	Phosphatidylglycerophosphatase and protein-tyrosine phosphatase 1	PTPMT1	22.9	0.474270993	0.002100266	Down
Q9UJC3	Protein Hook homolog 1	HOOK1	13.9	0.473764396	0.014062054	Down
P46459	Vesicle-fusing ATPase	NSF	58.7	0.473703735	1.45753E-05	Down
Q04323	UBX domain-containing protein 1	UBXN1	39.1	0.472394162	4.07635E-05	Down
Q9Y285	Phenylalanine--tRNA ligase alpha subunit	FARSA	39.2	0.470795738	6.10441E-06	Down
O60264	SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5	SMARCA5	31.7	0.469152233	0.000179646	Down
Q9Y6C9	Mitochondrial carrier homolog 2	MTCH2	49.2	0.469101876	4.05319E-05	Down
P16333	Cytoplasmic protein NCK1	NCK1	26.3	0.468136474	0.008596153	Down
Q9BRK5	45 kDa calcium-binding protein	SDF4	26	0.467951382	0.000507018	Down
A6NDG6	Glycerol-3-phosphate phosphatase	PGP	48.3	0.467574211	0.000463735	Down
Q9Y2L1	Exosome complex exonuclease RRP44	DIS3	14.4	0.467427289	5.9731E-05	Down
Q8WXF7	Atlastin-1	ATL1	9.7	0.46691227	0.002618682	Down
Q8N7H5	RNA polymerase II-associated factor 1 homolog	PAF1	7.2	0.466900839	0.000176737	Down
O60610	Protein diaphanous homolog 1	DIAPH 1	13	0.46668272	0.001150039	Down
P16219	Short-chain specific acyl-CoA dehydrogenase, mitochondrial	ACADS	50.5	0.466123011	0.001876422	Down
Q9UBE0	SUMO-activating enzyme subunit 1	SAE1	79.2	0.465048871	0.000446159	Down
P49427	Ubiquitin-conjugating enzyme E2 R1	CDC34	9.3	0.463979014	0.019674188	Down
Q9Y4Y9	U6 snRNA-associated Sm-like protein LSm5	LSM5	82.4	0.463603096	0.003100836	Down
P31689	DnaJ homolog subfamily A member 1	DNAJA1	59.2	0.463447936	3.03908E-05	Down
Q9P2X3	Protein IMPACT	IMPACT	23.8	0.462451854	7.93802E-05	Down
Q9Y259	Choline/ethanolamine kinase	CHKB	21.8	0.46151149	0.000120652	Down
Q8IUR0	Trafficking protein particle complex subunit 5	TRAPPC5	13.8	0.461051594	5.95011E-05	Down
Q9NV35	Nucleotide triphosphate diphosphatase NUDT15	NUDT15	22.6	0.460062891	0.000669945	Down
P11940	Polyadenylate-binding protein 1	PABPC1	67.6	0.459769186	1.52219E-05	Down
P40227	T-complex protein 1 subunit zeta	CCT6A	71.2	0.459604806	7.52056E-05	Down
Q8N1F7	Nuclear pore complex protein Nup93	NUP93	47	0.458994463	2.28378E-05	Down
Q9UQ35	Serine/arginine repetitive matrix protein 2	SRRM2	11.3	0.458956143	9.12701E-05	Down
Q96N06	Spermatogenesis-associated protein 33	SPATA33	37.4	0.458756383	0.000319251	Down
Q13185	Chromobox protein homolog 3	CBX3	42.6	0.456828726	2.53431E-05	Down
Q9NR28	Diablo IAP-binding mitochondrial protein	DIABLO	62.3	0.453568851	0.000118002	Down
P49750	YLP motif-containing protein 1	YLPM1	7.9	0.453470417	0.004369863	Down
Q5BJF6	Outer dense fiber protein 2	ODF2	21.6	0.451429632	0.005560371	Down
Q8IYB3	Serine/arginine repetitive matrix protein 1	SRRM1	4.8	0.450781365	0.002060011	Down
P35658	Nuclear pore complex protein Nup214	NUP214	20.8	0.449811792	0.000914096	Down
Q9Y587	AP-4 complex subunit sigma-1	AP4S1	22.9	0.449483177	0.000149127	Down
P57105	Synaptojanin-2-binding protein	SYNJ2BP	57.9	0.449100352	1.98128E-05	Down
Q96IW7	Vesicle-trafficking protein SEC22a	SEC22A	3.3	0.448517306	0.008330977	Down
Q9NP58	ATP-binding cassette sub-family B member 6	ABCB6	15.7	0.448113351	0.000231689	Down
O60684	Importin subunit alpha-7	KPNA6	29.5	0.447868802	0.000207246	Down
Q5RI15	Cytochrome c oxidase assembly protein COX20, mitochondrial	COX20	22	0.445814422	0.02846798	Down
Q8IYS2	Uncharacterized protein KIAA2013	KIAA2013	8.5	0.444776095	0.002871166	Down
P17096	High mobility group protein HMG-I/HMG-Y	HMGA1	37.4	0.443700418	0.014145836	Down
O60841	Eukaryotic translation initiation factor 5B	EIF5B	30.1	0.443392178	4.49976E-06	Down
Q96CW5	Gamma-tubulin complex component 3	TUBGCP3	29	0.443183658	0.009113094	Down
Q0VDG4	Secernin-3	SCRN3	2.6	0.442815721	0.036995413	Down
O95081	Arf-GAP domain and FG repeat-containing protein 2	AGFG2	2.5	0.441308773	0.003527605	Down
Q9H583	HEAT repeat-containing protein 1	HEATR1	5.1	0.440955746	0.004701934	Down
Q9Y3E0	Vesicle transport protein GOT1B	GOLT1B	26.1	0.439322153	0.005125653	Down
Q9Y3I1	F-box only protein 7	FBXO7	18.8	0.436487747	0.038994597	Down
Q9HAU5	Regulator of nonsense transcripts 2	UPF2	12.3	0.43621937	0.006882007	Down
Q9Y277	Voltage-dependent anion-selective channel protein 3	VDAC3	61.8	0.435970777	3.51393E-05	Down
Q8NHR9	Profilin-4	PFN4	20.2	0.435273028	0.025621013	Down
P61962	DDB1- and CUL4-associated factor 7	DCAF7	27.5	0.435191116	6.54035E-05	Down
Q8NEY8	Periphilin-1	PPHLN1	5.7	0.434895443	0.000217933	Down
Q96PK6	RNA-binding protein 14	RBM14	34.8	0.434505421	8.26789E-05	Down
Q9UK76	Jupiter microtubule associated homolog 1	JPT1	78.6	0.43284444	0.000277025	Down
Q9BTD8	RNA-binding protein 42	RBM42	5.8	0.432384149	5.08042E-05	Down
Q9BRP4	Proteasomal ATPase-associated factor 1	PAAF1	21.4	0.43172089	0.005986637	Down
Q8NG31	Kinetochore scaffold 1	KNL1	2	0.431182988	0.018290115	Down
Q71DI3	Histone H3.2	H3C13	58.8	0.430575872	0.000284478	Down
P78406	mRNA export factor RAE1	RAE1	65.2	0.428860882	0.000271559	Down
Q9Y570	Protein phosphatase methylesterase 1	PPME1	38.1	0.427756336	0.000194852	Down
P22492	Histone H1t	H1-6	49.8	0.427738411	0.000250865	Down
P52597	Heterogeneous nuclear ribonucleoprotein F	HNRNPF	64.3	0.427199773	6.90867E-05	Down
Q07617	Sperm-associated antigen 1	SPAG1	15	0.426155805	0.009312983	Down
O15027	Protein transport protein Sec16A	SEC16A	10.7	0.42597325	0.000504098	Down
P60510	Serine/threonine-protein phosphatase 4 catalytic subunit	PPP4C	27	0.424743135	0.003822054	Down
Q92598	Heat shock protein 105 kDa	HSPH 1	52.2	0.423822247	0.000388846	Down
Q9Y6G9	Cytoplasmic dynein 1 light intermediate chain 1	DYNC1LI1	44.7	0.42368996	0.000633882	Down
Q8N163	Cell cycle and apoptosis regulator protein 2	CCAR2	39	0.423279805	6.56569E-05	Down
Q96I25	Splicing factor 45	RBM17	16.5	0.423102853	0.000797334	Down
P47224	Guanine nucleotide exchange factor MSS4	RABIF	29.3	0.422149862	0.031021626	Down
P18754	Regulator of chromosome condensation	RCC1	43.9	0.420414342	4.34735E-05	Down
Q6IPR1	Electron transfer flavoprotein regulatory factor 1	ETFRF1	30	0.41984958	8.98162E-05	Down
P43246	DNA mismatch repair protein Msh2	MSH2	22.9	0.419518428	0.000632401	Down
P49840	Glycogen synthase kinase-3 alpha	GSK3A	20.7	0.418534487	0.012137556	Down
Q9UPU5	Ubiquitin carboxyl-terminal hydrolase 24	USP24	3.8	0.418425173	0.026220459	Down
Q9NTJ3	Structural maintenance of chromosomes protein 4	SMC4	11.9	0.41781414	0.00153283	Down
Q15424	Scaffold attachment factor B1	SAFB	26.3	0.417353754	0.000308457	Down
Q13595	Transformer-2 protein homolog alpha	TRA2A	22.7	0.415789511	0.000106986	Down
Q92797	Symplekin	SYMPK	13.6	0.415602439	0.000376227	Down
Q96F86	Enhancer of mRNA-decapping protein 3	EDC3	8.1	0.415149441	0.000150686	Down
Q9H267	Vacuolar protein sorting-associated protein 33B	VPS33B	16.5	0.41476727	0.014173918	Down
P52788	Spermine synthase	SMS	43.2	0.414030546	0.000445505	Down
Q8WXF1	Paraspeckle component 1	PSPC1	31.5	0.413912884	0.000147182	Down
Q9Y4P3	Transducin beta-like protein 2	TBL2	51.9	0.41381574	9.04529E-05	Down
Q9Y530	ADP-ribose glycohydrolase OARD1	OARD1	55.9	0.412075846	0.011064635	Down
Q5TD97	Four and a half LIM domains protein 5	FHL5	49.6	0.411546618	0.001846944	Down
Q6P1J9	Parafibromin	CDC73	18.3	0.411293389	0.00042838	Down
P29144	Tripeptidyl-peptidase 2	TPP2	40.7	0.411047424	7.5648E-05	Down
Q9Y371	Endophilin-B1	SH3GLB1	52.1	0.409061013	1.12285E-05	Down
Q9UBN7	Histone deacetylase 6	HDAC6	14	0.40881008	2.28629E-05	Down
P16401	Histone H1.5	H1-5	29.2	0.408617224	0.002495189	Down
Q9UII4	E3 ISG15--protein ligase HERC5	HERC5	27.1	0.408453299	0.000540607	Down
Q16563	Synaptophysin-like protein 1	SYPL1	27.8	0.408382433	0.000433978	Down
Q9UBU9	Nuclear RNA export factor 1	NXF1	21.3	0.408299887	0.003626649	Down
P53041	Serine/threonine-protein phosphatase 5	PPP5C	45.7	0.407249434	0.000126221	Down
P23381	Tryptophan--tRNA ligase, cytoplasmic	WARS1	45.6	0.406427178	1.39652E-05	Down
Q8WVY7	Ubiquitin-like domain-containing CTD phosphatase 1	UBLCP1	49.1	0.406145048	0.000115865	Down
Q9UPN7	Serine/threonine-protein phosphatase 6 regulatory subunit 1	PPP6R1	10.4	0.405418106	0.005750472	Down
O60271	C-Jun-amino-terminal kinase-interacting protein 4	SPAG9	28.2	0.404633436	3.33294E-08	Down
P49589	Cysteine--tRNA ligase, cytoplasmic	CARS1	33.8	0.403898061	0.000388498	Down
P49368	T-complex protein 1 subunit gamma	CCT3	67	0.403161303	1.50685E-05	Down
Q68CQ7	Glycosyltransferase 8 domain-containing protein 1	GLT8D1	16.2	0.402968832	0.003151998	Down
Q7L2E3	ATP-dependent RNA helicase DHX30	DHX30	16.9	0.400892196	0.001834938	Down
Q99615	DnaJ homolog subfamily C member 7	DNAJC7	31.6	0.400356917	0.002853159	Down
O60763	General vesicular transport factor p115	USO1	50.9	0.400350731	2.28067E-05	Down
Q9Y295	Developmentally-regulated GTP-binding protein 1	DRG1	32.2	0.39881203	1.28993E-05	Down
Q99598	Translin-associated protein X	TSNAX	66.6	0.397707465	0.00018759	Down
P16455	Methylated-DNA--protein-cysteine methyltransferase	MGMT	28.5	0.397586826	0.002915344	Down
Q9UQE7	Structural maintenance of chromosomes protein 3	SMC3	50.7	0.397213021	0.000117099	Down
Q9BRJ7	Tudor-interacting repair regulator protein	NUDT16L1	63.5	0.396859342	0.000669888	Down
Q9H0C8	Integrin-linked kinase-associated serine/threonine phosphatase 2C	ILKAP	18.4	0.396683688	0.001761075	Down
P17987	T-complex protein 1 subunit alpha	TCP1	74.6	0.396311084	5.50623E-06	Down
P31948	Stress-induced-phosphoprotein 1	STIP1	67.4	0.396034073	0.000329834	Down
P61221	ATP-binding cassette sub-family E member 1	ABCE1	45.1	0.395594615	6.5106E-07	Down
P82979	SAP domain-containing ribonucleoprotein	SARNP	42.4	0.394122422	9.51272E-05	Down
P50990	T-complex protein 1 subunit theta	CCT8	82.1	0.393624254	6.70842E-06	Down
Q15435	Protein phosphatase 1 regulatory subunit 7	PPP1R7	58.9	0.393485303	4.97471E-05	Down
Q12996	Cleavage stimulation factor subunit 3	CSTF3	29.1	0.393400219	4.17121E-05	Down
Q96IV0	Peptide-N (4)-(N-acetyl-beta-glucosaminyl) asparagine amidase	NGLY1	15.3	0.393172365	0.000170423	Down
Q9H910	Jupiter microtubule associated homolog 2	JPT2	29.5	0.390610532	0.006857749	Down
Q99832	T-complex protein 1 subunit eta	CCT7	82.5	0.390348994	1.40512E-05	Down
Q6BCY4	NADH-cytochrome b5 reductase 2	CYB5R2	69.9	0.390182511	0.000233873	Down
Q8TF05	Serine/threonine-protein phosphatase 4 regulatory subunit 1	PPP4R1	6.6	0.389813815	0.002487042	Down
O14737	Programmed cell death protein 5	PDCD5	61.6	0.388842858	0.000465812	Down
Q6IA69	Glutamine-dependent NAD(+) synthetase	NADSYN1	17	0.387210238	0.012983034	Down
P50991	T-complex protein 1 subunit delta	CCT4	72.5	0.387164078	2.66155E-05	Down
O60942	mRNA-capping enzyme	RNGTT	5.7	0.386496734	0.000613236	Down
Q3SXM0	DDB1- and CUL4-associated factor 4-like protein 1	DCAF4L1	30.1	0.386208268	0.049479982	Down
Q96FZ2	Abasic site processing protein HMCES	HMCES	20.9	0.384542706	0.001148648	Down
Q13618	Cullin-3	CUL3	49.1	0.38432817	1.86274E-05	Down
Q9P270	SLAIN motif-containing protein 2	SLAIN2	11.7	0.382837697	0.000816411	Down
Q9BSJ2	Gamma-tubulin complex component 2	TUBGCP2	32.3	0.382768939	4.13166E-05	Down
O75928	E3 SUMO-protein ligase PIAS2	PIAS2	5.5	0.38250814	0.000643013	Down
P21127	Cyclin-dependent kinase 11B	CDK11B	14.7	0.382426375	9.70334E-05	Down
Q6UN15	Pre-mRNA 3-end-processing factor FIP1	FIP1L1	16.5	0.382369367	2.98042E-05	Down
Q96D96	Voltage-gated hydrogen channel 1	HVCN1	24.9	0.381470289	0.044046122	Down
Q15185	Prostaglandin E synthase 3	PTGES3	54.4	0.380231977	0.000142668	Down
O94829	Importin-13	IPO13	5.1	0.379923566	0.021903049	Down
Q9Y5B8	Nucleoside diphosphate kinase 7	NME7	18.1	0.378758354	0.002283413	Down
O75475	PC4 and SFRS1-interacting protein	PSIP1	37	0.375345439	0.000109475	Down
Q14966	Zinc finger protein 638	ZNF638	8.9	0.375332524	7.38359E-05	Down
Q8N806	Putative E3 ubiquitin-protein ligase UBR7	UBR7	9.2	0.375124543	0.005350465	Down
P43487	Ran-specific GTPase-activating protein	RANBP1	68.7	0.374223081	8.35462E-05	Down
O14545	TRAF-type zinc finger domain-containing protein 1	TRAFD1	12	0.373666398	0.005152338	Down
Q01658	Protein Dr1	DR1	37.5	0.373199528	0.000330686	Down
Q9UKU0	Long-chain-fatty-acid--CoA ligase 6	ACSL6	36.9	0.370567494	0.000148664	Down
Q15386	Ubiquitin-protein ligase E3C	UBE3C	18.8	0.369997809	0.000318821	Down
Q9NTJ4	Alpha-mannosidase 2C1	MAN2C1	18.4	0.369868382	5.80136E-05	Down
O75190	DnaJ homolog subfamily B member 6	DNAJB6	21.5	0.367790909	0.002729214	Down
P06746	DNA polymerase beta	POLB	30.1	0.366984106	0.005369402	Down
P48643	T-complex protein 1 subunit epsilon	CCT5	78.6	0.366763671	2.35593E-06	Down
Q9NXV6	CDKN2A-interacting protein	CDKN2AIP	25	0.366386855	0.000182844	Down
Q86V81	THO complex subunit 4	ALYREF	46.7	0.366249608	5.45271E-05	Down
P30519	Heme oxygenase 2	HMOX2	65.8	0.366161352	2.42499E-05	Down
Q9HB71	Calcyclin-binding protein	CACYBP	74.6	0.36489396	8.40862E-05	Down
Q8NBX0	Saccharopine dehydrogenase-like oxidoreductase	SCCPDH	66.9	0.364776188	1.83142E-05	Down
P23258	Tubulin gamma-1 chain	TUBG1	48.6	0.364630889	8.53438E-06	Down
P23921	Ribonucleoside-diphosphate reductase large subunit	RRM1	13.5	0.364005741	0.007472791	Down
P51784	Ubiquitin carboxyl-terminal hydrolase 11	USP11	22	0.363882563	0.001499893	Down
Q15785	Mitochondrial import receptor subunit TOM34	TOMM34	71.2	0.363874937	1.76524E-05	Down
O96019	Actin-like protein 6A	ACTL6A	56.6	0.362860061	4.73625E-06	Down
Q6P2P2	Protein arginine N-methyltransferase 9	PRMT9	9.8	0.362800108	0.002061298	Down
Q9H9P8	L-2-hydroxyglutarate dehydrogenase, mitochondrial	L2HGDH	13.8	0.361852416	0.007143871	Down
P83916	Chromobox protein homolog 1	CBX1	34.6	0.361545502	0.001378869	Down
Q9Y5L0	Transportin-3	TNPO3	30.4	0.360681643	0.001643691	Down
P78371	T-complex protein 1 subunit beta	CCT2	75.1	0.359619108	1.3882E-05	Down
Q13099	Intraflagellar transport protein 88 homolog	IFT88	17.2	0.359186094	0.006299303	Down
Q6JEL2	Kelch-like protein 10	KLHL10	23	0.359163835	0.029579751	Down
Q9UNX4	WD repeat-containing protein 3	WDR3	6.8	0.359025436	0.019893951	Down
Q9BPY3	Protein FAM118B	FAM118B	8.5	0.356305801	0.002719425	Down
P51114	RNA-binding protein FXR1	FXR1	48.5	0.353534899	5.57111E-06	Down
Q8NHU6	Tudor domain-containing protein 7	TDRD7	16.9	0.352309038	0.01009721	Down
A6NHR9	Structural maintenance of chromosomes flexible hinge domain-containing protein 1	SMCHD1	19.4	0.351691033	8.32637E-06	Down
Q05048	Cleavage stimulation factor subunit 1	CSTF1	29.5	0.348047088	0.001878489	Down
Q9BXF6	Rab11 family-interacting protein 5	RAB11FIP5	14.5	0.347596974	0.03268072	Down
O00410	Importin-5	IPO5	63.6	0.347553719	8.16274E-07	Down
Q9UGI8	Testin	TES	59.9	0.346599076	0.000434806	Down
Q01469	Fatty acid-binding protein 5	FABP5	71.1	0.346173811	0.000208161	Down
Q96A08	Histone H2B type 1-A	H2BC1	52.8	0.345364122	5.99485E-05	Down
Q9Y2Z0	Protein SGT1 homolog	SUGT1	63.8	0.34067434	0.000196122	Down
Q9NVI1	Fanconi anemia group I protein	FANCI	11.2	0.339603103	0.004671103	Down
Q9P2I0	Cleavage and polyadenylation specificity factor subunit 2	CPSF2	15.7	0.339182212	0.000555614	Down
Q9NWH9	SAFB-like transcription modulator	SLTM	13.5	0.338972829	0.000549594	Down
Q9NRY5	Protein FAM114A2	FAM114A2	46.5	0.336907715	5.16099E-06	Down
P39748	Flap endonuclease 1	FEN1	31.1	0.336883896	0.008196008	Down
Q9BS86	Zona pellucida-binding protein 1	ZPBP	33.6	0.335743889	0.007764577	Down
O95473	Synaptogyrin-4	SYNGR4	9.8	0.333940439	0.033843904	Down
Q15631	Translin	TSN	71.9	0.333042982	5.46083E-05	Down
Q8N9F7	Lysophospholipase D GDPD1	GDPD1	38.2	0.331213322	0.001675591	Down
Q8WW22	DnaJ homolog subfamily A member 4	DNAJA4	29.5	0.330231295	6.30042E-05	Down
Q9H9Q2	COP9 signalosome complex subunit 7b	COPS7B	35.6	0.32863735	0.00047379	Down
Q96RL1	BRCA1-A complex subunit RAP80	UIMC1	13.2	0.328123736	0.007934527	Down
Q9P2K5	Myelin expression factor 2	MYEF2	35.2	0.327597117	1.13931E-05	Down
Q96HA9	Peroxisomal membrane protein 11C	PEX11G	15.8	0.324578422	0.00311432	Down
Q9UNN5	FAS-associated factor 1	FAF1	14.6	0.323585881	1.41051E-05	Down
Q86WT1	Tetratricopeptide repeat protein 30A	TTC30A	15.6	0.322956811	0.006431236	Down
P60520	Gamma-aminobutyric acid receptor-associated protein-like 2	GABARAPL2	48.7	0.322395108	0.000165406	Down
Q9Y265	RuvB-like 1	RUVBL1	75.9	0.321748765	1.57355E-05	Down
Q08752	Peptidyl-prolyl cis-trans isomerase D	PPID	56.2	0.318761555	0.005459018	Down
Q9Y217	Myotubularin-related protein 6	MTMR6	28.5	0.318518209	0.000451739	Down
Q58FF6	Putative heat shock protein HSP 90-beta 4	HSP90AB4P	11.7	0.318291349	0.009965339	Down
Q9Y4L1	Hypoxia up-regulated protein 1	HYOU1	50.2	0.312545107	2.22166E-05	Down
Q6PJT7	Zinc finger CCCH domain-containing protein 14	ZC3H14	20.2	0.309518309	0.00670567	Down
Q6X784	Zona pellucida-binding protein 2	ZPBP2	22.8	0.308533434	0.000409678	Down
O15084	Serine/threonine-protein phosphatase 6 regulatory ankyrin repeat subunit A	ANKRD28	13.8	0.307268036	0.006581804	Down
Q6FI81	Anamorsin	CIAPIN1	67.6	0.304302209	9.30556E-06	Down
O15479	Melanoma-associated antigen B2	MAGEB2	28.5	0.302748549	0.001852571	Down
P07900	Heat shock protein HSP 90-alpha	HSP90AA1	63.4	0.302670146	4.14959E-05	Down
Q9BV44	tRNA (guanine (6)-N2)-methyltransferase THUMP3	THUMPD3	26.2	0.30208967	2.5727E-06	Down
Q14C86	GTPase-activating protein and VPS9 domain-containing protein 1	GAPVD1	19.4	0.301819783	9.73063E-05	Down
Q15102	Platelet-activating factor acetylhydrolase IB subunit alpha1	PAFAH1B3	70.1	0.301761078	0.003274367	Down
Q13619	Cullin-4A	CUL4A	46.5	0.301316375	0.003194908	Down
Q9Y3B8	Oligoribonuclease, mitochondrial	REXO2	34.6	0.300480568	0.001293145	Down
Q9NP61	ADP-ribosylation factor GTPase-activating protein 3	ARFGAP3	18.8	0.297044436	0.00032937	Down
P49321	Nuclear autoantigenic sperm protein	NASP	53.6	0.296239676	3.23854E-05	Down
P68431	Histone H3.1	H3C12	58.8	0.295619925	0.00029078	Down
Q99447	Ethanolamine-phosphate cytidylyltransferase	PCYT2	36.2	0.294221422	6.43744E-05	Down
Q7Z2X7	P antigen family member 2	PAGE2	48.6	0.294178668	0.012980856	Down
P22090	40S ribosomal protein S4, Y isoform 1	RPS4Y1	42.6	0.294168813	0.000412985	Down
Q5JVF3	PCI domain-containing protein 2	PCID2	38.3	0.293956167	1.40065E-06	Down
Q5SRE5	Nucleoporin NUP188	NUP188	13.9	0.292468789	0.000601071	Down
P08174	Complement decay-accelerating factor	CD55	26.5	0.291548563	0.045322254	Down
Q9Y266	Nuclear migration protein nudC	NUDC	51.7	0.289316479	0.000135121	Down
Q5W111	SPRY domain-containing protein 7	SPRYD7	33.2	0.286630029	0.003682965	Down
O43291	Kunitz-type protease inhibitor 2	SPINT2	17.5	0.28585972	2.26014E-05	Down
Q96S59	Ran-binding protein 9	RANBP9	12.6	0.285806135	0.012813262	Down
Q8NEL9	Phospholipase DDHD1	DDHD1	11.2	0.2821922	0.004282644	Down
Q96RS6	NudC domain-containing protein 1	NUDCD1	25.2	0.281930198	0.001677238	Down
Q9BW83	Intraflagellar transport protein 27 homolog	IFT27	44.6	0.280508886	3.65024E-05	Down
P58340	Myeloid leukemia factor 1	MLF1	15.3	0.27944123	0.000130747	Down
Q8TDY3	Actin-related protein T2	ACTRT2	21.8	0.277725757	0.026504197	Down
Q14257	Reticulocalbin-2	RCN2	61.2	0.275546712	0.000615076	Down
Q9Y230	RuvB-like 2	RUVBL2	73.9	0.275347519	3.60614E-06	Down
P55060	Exportin-2	CSE1L	60.1	0.274882715	4.50061E-05	Down
O00139	Kinesin-like protein KIF2A	KIF2A	17.8	0.274207569	0.034353732	Down
Q9H4F8	SPARC-related modular calcium-binding protein 1	SMOC1	29.3	0.273961671	7.67541E-05	Down
O43924	Retinal rod rhodopsin-sensitive cGMP 3,5-cyclic phosphodiesterase subunit delta	PDE6D	33.3	0.273093626	0.000105776	Down
P41236	Protein phosphatase inhibitor 2	PPP1R2	37.6	0.272930395	8.79823E-06	Down
Q9UBU8	Mortality factor 4-like protein 1	MORF4L1	39	0.271060539	0.018038315	Down
P34896	Serine hydroxymethyltransferase, cytosolic	SHMT1	46.6	0.270974811	0.00012223	Down
Q9HB07	MYG1 exonuclease	MYG1	38.8	0.270464329	7.68885E-05	Down
Q9BWU0	Kanadaptin	SLC4A1AP	12.4	0.270325117	0.000675729	Down
Q6ZP01	RNA-binding protein 44	RBM44	15.5	0.268749184	0.000616262	Down
O75525	KH domain-containing, RNA-binding, signal transduction-associated protein 3	KHDRBS3	24	0.267662507	5.02622E-06	Down
Q9HCD5	Nuclear receptor coactivator 5	NCOA5	44.2	0.263495932	0.000991713	Down
Q6P2E9	Enhancer of mRNA-decapping protein 4	EDC4	28.7	0.263389813	0.000206495	Down
P49736	DNA replication licensing factor MCM2	MCM2	35	0.262439038	0.024010117	Down
Q9H6S0	3-5 RNA helicase YTHDC2	YTHDC2	17	0.262120223	9.99402E-07	Down
O76003	Glutaredoxin-3	GLRX3	54.3	0.261717071	3.39553E-05	Down
Q9NRP2	COX assembly mitochondrial protein 2 homolog	CMC2	53.2	0.259003395	6.76039E-06	Down
Q9UKF6	Cleavage and polyadenylation specificity factor subunit 3	CPSF3	17.5	0.258842054	0.001226184	Down
P52701	DNA mismatch repair protein Msh6	MSH6	25	0.257172453	0.000397356	Down
Q6P996	Pyridoxal-dependent decarboxylase domain-containing protein 1	PDXDC1	35.8	0.256454186	8.90901E-05	Down
O14929	Histone acetyltransferase type B catalytic subunit	HAT1	11.7	0.256233336	0.000155219	Down
Q12926	ELAV-like protein 2	ELAVL2	25.3	0.254522797	0.005366316	Down
Q96ER3	Protein SAAL1	SAAL1	9.7	0.254113725	0.003671349	Down
Q86W34	Archaemetzincin-2	AMZ2	9.7	0.250733984	2.5728E-05	Down
P0DJD4	RNA-binding motif protein, Y chromosome, family 1 member C	RBMY1C	30	0.25065812	0.030919587	Down
Q9HD26	Golgi-associated PDZ and coiled-coil motif-containing protein	GOPC	37.7	0.250462117	6.71233E-05	Down
Q8WW43	Gamma-secretase subunit APH-1B	APH 1B	7.8	0.249218459	1.10967E-05	Down
P12821	Angiotensin-converting enzyme	ACE	15.9	0.248352167	7.35379E-05	Down
Q8WYA0	Intraflagellar transport protein 81 homolog	IFT81	19.8	0.247510504	0.007531799	Down
Q12798	Centrin-1	CETN1	24.4	0.243329496	8.66879E-05	Down
Q9BYZ2	L-lactate dehydrogenase A-like 6B	LDHAL6B	23.9	0.242406834	0.022485587	Down
Q7L8S5	OTU domain-containing protein 6A	OTUD6A	37.2	0.242234275	0.001586538	Down
Q9NTM9	Copper homeostasis protein cutC homolog	CUTC	46.5	0.241219895	0.00262825	Down
Q9H0L4	Cleavage stimulation factor subunit 2 tau variant	CSTF2T	29.9	0.238838408	1.67218E-06	Down
Q8IX01	SURP and G-patch domain-containing protein 2	SUGP2	39.9	0.238726807	0.000193222	Down
Q7Z4H3	5-deoxynucleotidase HDDC2	HDDC2	80.4	0.238302592	0.000105534	Down
Q8TBP5	Membrane protein FAM174A	FAM174A	4.7	0.238257468	0.000241223	Down
P59282	Tubulin polymerization-promoting protein family member 2	TPPP2	22.4	0.237255249	0.003280082	Down
Q96EP5	DAZ-associated protein 1	DAZAP1	36.4	0.236431879	2.28668E-06	Down
Q9BZE9	Tether containing UBX domain for GLUT4	ASPSCR1	25	0.235350101	5.81943E-05	Down
Q9UJT2	Testis-specific serine kinase substrate	TSKS	28.9	0.234258199	0.006295102	Down
O00148	ATP-dependent RNA helicase DDX39A	DDX39A	63.9	0.233222017	0.00542937	Down
Q5T8P6	RNA-binding protein 26	RBM26	12.3	0.232151873	0.000968347	Down
O95456	Proteasome assembly chaperone 1	PSMG1	51.7	0.231965364	3.12612E-05	Down
Q9NXZ2	Probable ATP-dependent RNA helicase DDX43	DDX43	27.8	0.231719453	0.012103066	Down
P29803	Pyruvate dehydrogenase E1 component subunit alpha, testis-specific form, mitochondrial	PDHA2	28.6	0.228859628	0.000154751	Down
Q8IYF3	Testis-expressed protein 11	TEX11	14.9	0.223694275	0.005973299	Down
Q01534	Testis-specific Y-encoded protein 1	TSPY1	20.5	0.222527876	0.001695804	Down
O94788	Retinal dehydrogenase 2	ALDH1A2	42.1	0.22228691	0.01488603	Down
P26583	High mobility group protein B2	HMGB2	37.3	0.221333758	3.1935E-05	Down
Q5QJ74	Tubulin-specific chaperone cofactor E-like protein	TBCEL	27.1	0.221269535	1.74217E-05	Down
Q5T160	Probable arginine--tRNA ligase, mitochondrial	RARS2	25.4	0.220912106	0.000675141	Down
Q53H82	Endoribonuclease LACTB2	LACTB2	58	0.220646924	6.83956E-06	Down
P22681	E3 ubiquitin-protein ligase CBL	CBL	17.2	0.21540205	0.000234835	Down
Q8IYS8	Biorientation of chromosomes in cell division protein 1-like 2	BOD1L2	32.6	0.208856806	0.000138992	Down
P51157	Ras-related protein Rab-28	RAB28	27.6	0.208587327	0.000123183	Down
Q13439	Golgin subfamily A member 4	GOLGA4	12.4	0.207833352	0.000670746	Down
P16989	Y-box-binding protein 3	YBX3	43.5	0.207502541	1.55363E-05	Down
Q9UJ98	Cohesin subunit SA-3	STAG3	12.7	0.200341036	0.033087297	Down
Q96G97	Seipin	BSCL2	14.6	0.198851975	0.001889958	Down
Q969U7	Proteasome assembly chaperone 2	PSMG2	30.3	0.19783139	0.000123756	Down
P38432	Coilin	COIL	11.6	0.195813414	1.51471E-05	Down
P11388	DNA topoisomerase 2-alpha	TOP2A	48.4	0.195237171	0.000217213	Down
Q8IWB6	Inactive serine/threonine-protein kinase TEX14	TEX14	16	0.194613723	0.014556939	Down
Q86VY4	Testis-specific Y-encoded-like protein 5	TSPYL5	48.4	0.193537196	0.000509055	Down
P36969	Phospholipid hydroperoxide glutathione peroxidase	GPX4	53.8	0.192889493	1.473E-05	Down
Q99417	c-Myc-binding protein	MYCBP	73.8	0.190980962	4.79706E-06	Down
Q9UJ83	2-hydroxyacyl-CoA lyase 1	HACL1	31.1	0.190482465	0.001578318	Down
P22732	Solute carrier family 2, facilitated glucose transporter member 5	SLC2A5	8.2	0.188850997	0.004979908	Down
Q9BXT4	Tudor domain-containing protein 1	TDRD1	12.5	0.186467962	0.008240926	Down
Q86VQ6	Thioredoxin reductase 3	TXNRD3	14.3	0.186132393	0.001928466	Down
O75602	Sperm-associated antigen 6	SPAG6	27.9	0.185449729	0.003727954	Down
Q96M93	Adenosine deaminase domain-containing protein 1	ADAD1	31.8	0.1849367	9.16556E-05	Down
P07311	Acylphosphatase-1	ACYP1	67.7	0.184166769	4.30942E-06	Down
Q9NX58	Cell growth-regulating nucleolar protein	LYAR	35.4	0.183644209	3.0121E-05	Down
Q8TC59	Piwi-like protein 2	PIWIL2	39.6	0.18353431	0.011463061	Down
P43358	Melanoma-associated antigen 4	MAGEA4	36.3	0.180181224	0.006411925	Down
O95749	Geranylgeranyl pyrophosphate synthase	GGPS1	19	0.180127729	0.005571598	Down
Q02539	Histone H1.1	H1-1	43.3	0.179275703	0.000757662	Down
Q96QG7	Myotubularin-related protein 9	MTMR9	30.1	0.177349454	0.000863179	Down
Q9NT62	Ubiquitin-like-conjugating enzyme ATG3	ATG3	36.9	0.17397001	0.000192648	Down
Q02790	Peptidyl-prolyl cis-trans isomerase FKBP4	FKBP4	76.9	0.172467548	3.49987E-05	Down
P51854	Transketolase-like protein 1	TKTL1	74.5	0.170795111	0.00027854	Down
P52292	Importin subunit alpha-1	KPNA2	54.4	0.169574072	6.68963E-05	Down
O95757	Heat shock 70 kDa protein 4L	HSPA4L	75.4	0.167756354	2.1699E-06	Down
Q9UG01	Intraflagellar transport protein 172 homolog	IFT172	15.6	0.167269543	0.000481112	Down
Q9NZL4	Hsp70-binding protein 1	HSPBP1	25.9	0.167159062	2.30489E-06	Down
Q9NU22	Midasin	MDN1	9.7	0.161861268	0.000115977	Down
Q14566	DNA replication licensing factor MCM6	MCM6	34	0.160410349	0.000725784	Down
Q8NEZ3	WD repeat-containing protein 19	WDR19	17.4	0.159937479	0.005124219	Down
P30154	Serine/threonine-protein phosphatase 2A 65 kDa regulatory subunit A beta isoform	PPP2R1B	46.9	0.158769494	0.000613386	Down
O43432	Eukaryotic translation initiation factor 4 gamma 3	EIF4G3	16.9	0.157455968	0.000532645	Down
Q86X27	Ras-specific guanine nucleotide-releasing factor RalGPS2	RALGPS2	29.7	0.156785479	0.001108182	Down
Q6NXR0	Interferon-inducible GTPase 5	IRGC	31.7	0.155653231	0.000640226	Down
Q14997	Proteasome activator complex subunit 4	PSME4	18.1	0.155393666	4.10949E-06	Down
Q8IY45	Protein AMN1 homolog	AMN1	27.5	0.152665144	3.63113E-05	Down
Q9HBV2	Sperm acrosome membrane-associated protein 1	SPACA1	23.8	0.152582283	2.53304E-06	Down
Q8IVD9	NudC domain-containing protein 3	NUDCD3	32.4	0.150971293	0.001275078	Down
Q9UHL0	ATP-dependent RNA helicase DDX25	DDX25	24	0.148743382	0.009178572	Down
Q8TAA3	Proteasome subunit alpha-type 8	PSMA8	52	0.148287333	0.000343316	Down
Q86YB8	ERO1-like protein beta	ERO1B	21	0.142724964	0.00179529	Down
Q9NZW5	Protein PALS2	PALS2	37.6	0.141827596	0.000273506	Down
Q9BXU1	Serine/threonine-protein kinase 31	STK31	57.4	0.139980957	0.00026899	Down
Q5JQC4	Cancer/testis antigen 47A	CT47A12	28.5	0.138041739	0.02629752	Down
Q9HBG6	Intraflagellar transport protein 122 homolog	IFT122	31.9	0.135832886	0.000668641	Down
Q9UKA9	Polypyrimidine tract-binding protein 2	PTBP2	52	0.133785651	0.000247815	Down
Q9BVM2	Protein DPCD	DPCD	55.7	0.133737904	0.000297606	Down
Q9HAV4	Exportin-5	XPO5	22.8	0.130958636	8.95771E-06	Down
Q9UI38	Probable threonine protease PRSS50	PRSS50	24.4	0.130104727	0.001343991	Down
Q9BTE6	Alanyl-tRNA editing protein Aarsd1	AARSD1	51.2	0.129547571	0.002555728	Down
Q9H9A5	CCR4-NOT transcription complex subunit 10	CNOT10	12.2	0.128899158	0.000179706	Down
O43379	WD repeat-containing protein 62	WDR62	24.6	0.128757461	0.00325907	Down
Q9NQI0	Probable ATP-dependent RNA helicase DDX4	DDX4	54.8	0.128154751	5.65704E-06	Down
Q14676	Mediator of DNA damage checkpoint protein 1	MDC1	16.1	0.12783743	9.2104E-05	Down
Q8TEX9	Importin-4	IPO4	34.8	0.127827888	0.000103567	Down
P25205	DNA replication licensing factor MCM3	MCM3	39.2	0.125998937	2.82878E-05	Down
O00519	Fatty-acid amide hydrolase 1	FAAH	28.5	0.125956733	0.000982134	Down
P0DPH 7	Tubulin alpha-3C chain	TUBA3C	70.4	0.12585703	0.00190099	Down
Q14669	E3 ubiquitin-protein ligase TRIP12	TRIP12	15.7	0.125404079	6.06622E-05	Down
Q99543	DnaJ homolog subfamily C member 2	DNAJC2	25.9	0.123319798	0.0001146	Down
P57678	Gem-associated protein 4	GEMIN4	12.9	0.121238983	0.010462678	Down
Q15645	Pachytene checkpoint protein 2 homolog	TRIP13	53	0.118948796	5.25452E-05	Down
Q9NQ48	Leucine zipper transcription factor-like protein 1	LZTFL1	59.9	0.118703722	1.70505E-05	Down
Q15506	Sperm surface protein Sp17	SPA17	58.9	0.117925561	0.000215012	Down
Q13416	Origin recognition complex subunit 2	ORC2	9	0.116141304	0.004585538	Down
Q9UHD1	Cysteine and histidine-rich domain-containing protein 1	CHORDC1	47.9	0.115728777	0.000131359	Down
Q9H892	Tetratricopeptide repeat protein 12	TTC12	20	0.115212867	0.002007926	Down
Q7L266	Isoaspartyl peptidase/L-asparaginase	ASRGL1	53.9	0.113312495	0.001653855	Down
P33992	DNA replication licensing factor MCM5	MCM5	33	0.109440832	0.000628039	Down
O43805	Microtubule nucleation factor SSNA1	SSNA1	55.5	0.109236745	0.003754853	Down
Q9NQ86	E3 ubiquitin-protein ligase TRIM36	TRIM36	34.9	0.107908768	0.000341585	Down
Q5RHP9	Glutamate-rich protein 3	ERICH3	13.1	0.107844065	0.001594893	Down
P54652	Heat shock-related 70 kDa protein 2	HSPA2	82.5	0.106510489	1.68723E-06	Down
Q96RL7	Intermembrane lipid transfer protein VPS13A	VPS13A	27.9	0.105606874	2.91425E-05	Down
P33991	DNA replication licensing factor MCM4	MCM4	30.8	0.104852818	6.54176E-05	Down
Q5TGJ6	Hepatoma-derived growth factor-like protein 1	HDGFL1	20.3	0.104705627	0.000110035	Down
P07864	L-lactate dehydrogenase C chain	LDHC	75.3	0.104449403	7.5415E-05	Down
Q96IC2	RNA exonuclease 5	REXO5	32.4	0.104043398	0.008532066	Down
Q96LB3	Intraflagellar transport protein 74 homolog	IFT74	35.2	0.103523865	0.00073919	Down
Q0VDF9	Heat shock 70 kDa protein 14	HSPA14	53.2	0.101979582	1.64115E-05	Down
A3KN83	Protein strawberry notch homolog 1	SBNO1	18.9	0.10110776	0.002146545	Down
Q99986	Serine/threonine-protein kinase VRK1	VRK1	35.6	0.100067615	3.64907E-05	Down
Q92526	T-complex protein 1 subunit zeta-2	CCT6B	56	0.098598337	2.12163E-05	Down
Q01813	ATP-dependent 6-phosphofructokinase, platelet type	PFKP	46.8	0.098232272	1.18992E-05	Down
Q3V6T2	Girdin	CCDC88A	14.3	0.097209737	0.001339317	Down
Q9BY14	Testis-expressed protein 101	TEX101	29.3	0.096876382	0.000203199	Down
Q8N9W5	Dynein axonemal assembly factor 3	DNAAF3	20.3	0.096862852	0.02086332	Down
Q99965	Disintegrin and metalloproteinase domain-containing protein 2	ADAM2	29.3	0.096398668	2.88995E-05	Down
O14556	Glyceraldehyde-3-phosphate dehydrogenase, testis-specific	GAPDHS	50.2	0.095675497	0.003175785	Down
Q6ZNB6	NF-X1-type zinc finger protein NFXL1	NFXL1	25.8	0.094640452	0.002204154	Down
Q9HCN8	Stromal cell-derived factor 2-like protein 1	SDF2L1	43.4	0.094369175	0.00024962	Down
Q9H0I9	Transketolase-like protein 2	TKTL2	61.7	0.092771339	6.12943E-05	Down
Q96JY0	Protein maelstrom homolog	MAEL	23.5	0.092506828	0.020881862	Down
Q9Y614	Actin-like protein 7B	ACTL7B	37.1	0.089971919	0.004666833	Down
Q1ZYL8	Izumo sperm-egg fusion protein 4	IZUMO4	24.1	0.088499373	0.002100248	Down
Q8NDV3	Structural maintenance of chromosomes protein 1B	SMC1B	36.5	0.087471049	1.33318E-05	Down
P33993	DNA replication licensing factor MCM7	MCM7	36.2	0.085077693	3.66754E-06	Down
Q13508	Ecto-ADP-ribosyltransferase 3	ART3	37	0.081736849	0.000233612	Down
P10323	Acrosin	ACR	37.3	0.07894371	8.17898E-05	Down
Q9P2L0	WD repeat-containing protein 35	WDR35	29.8	0.074438013	0.000227758	Down
P34931	Heat shock 70 kDa protein 1-like	HSPA1L	54.4	0.072082919	0.019382589	Down
Q68DQ2	Very large A-kinase anchor protein	CRYBG3	21.9	0.071883227	1.45362E-05	Down
Q8NCM8	Cytoplasmic dynein 2 heavy chain 1	DYNC2H1	10.3	0.071414562	0.000356759	Down
Q96C74	Ropporin-1-like protein	ROPN1L	40	0.068024771	0.005652977	Down
Q9H4B8	Dipeptidase 3	DPEP3	44.9	0.067216285	3.52383E-07	Down
O75526	RNA-binding motif protein, X-linked-like-2	RBMXL2	32.9	0.066089982	0.00299892	Down
Q9Y2T7	Y-box-binding protein 2	YBX2	64.8	0.065418133	0.002030736	Down
Q9H0C2	ADP/ATP translocase 4	SLC25A31	46	0.065234609	0.00347623	Down
Q15154	Pericentriolar material 1 protein	PCM1	23.9	0.061712223	0.000645504	Down
Q96FT9	Intraflagellar transport protein 43 homolog	IFT43	21.6	0.061380776	0.010673981	Down
Q8NDW8	Tetratricopeptide repeat protein 21A	TTC21A	25.8	0.061028982	0.000333729	Down
O60522	Tudor domain-containing protein 6	TDRD6	19.1	0.057296164	2.98225E-05	Down
Q14410	Glycerol kinase 2	GK2	28.2	0.055624401	0.000418763	Down
Q6NUT2	Probable C-mannosyltransferase DPY19L2	DPY19L2	24.7	0.054915999	4.77744E-06	Down
O14967	Calmegin	CLGN	52.1	0.051277734	0.000731137	Down
Q9UFC0	Leucine-rich repeat and WD repeat-containing protein 1	LRWD1	35.1	0.051261956	2.29904E-06	Down
Q8TDB8	Solute carrier family 2, facilitated glucose transporter member 14	SLC2A14	15.6	0.050359031	0.002729296	Down
O75800	Zinc finger MYND domain-containing protein 10	ZMYND10	27.7	0.049547539	0.018457824	Down
Q8NA61	Protein chibby homolog 2	CBY2	48.2	0.036890965	2.21842E-06	Down
Q8NEB7	Acrosin-binding protein	ACRBP	34.3	0.032955267	4.09348E-05	Down
Q96J94	Piwi-like protein 1	PIWIL1	49.6	0.032790149	2.60606E-06	Down
O75969	A-kinase anchor protein 3	AKAP3	51.8	0.026450492	0.00312269	Down
Q9BZQ2	Testicular spindle-associated protein SHCBP1L	SHCBP1L	27.7	0.026354987	0.002102442	Down
Q96KC9	Calcium-binding and spermatid-specific protein 1	CABS1	45.1	0.025401913	0.006772622	Down
Q9H322	Variable charge X-linked protein 2	VCX2	13.7	0.024738418	0.014583729	Down
P07205	Phosphoglycerate kinase 2	PGK2	80.1	0.020074907	5.60505E-06	Down
Q9BZX4	Ropporin-1B	ROPN1B	70.8	0.019408204	0.00095517	Down
Q5JQC9	A-kinase anchor protein 4	AKAP4	60.8	0.011723847	2.12378E-06	Down

A total of 4772 proteins were quantitatively identified, among which 717 exhibited differential abundance (false discovery rate [FDR] <5%); specifically, 242 proteins were upregulated, and 475 were downregulated in NOA patients (Figure 2c). To illustrate the significantly different protein abundances between the groups, a volcano plot based on the fold change and P value is displayed in Figure 2d. Hierarchical clustering analysis at the protein level revealed distinct protein clusters (Figure 2e).

Subcellular localization of all the DEPs was conducted using the prediction software CELLO,12 and the results are displayed in a pie chart (Figure 2f). Given that protein domains can alter fundamental protein functions, domain prediction was performed for these proteins (Figure 3a). The analysis revealed a predominant enrichment of domains associated with membrane repair and vesicular trafficking, such as C2 domains. These structural features provide a molecular basis for the involvement of DEPs in spermatogenesis and membrane organization.

Figure 3.

Proteomic analysis of testicular tissue in NOA and OA. (a) Enrichment analysis of protein domains among DEPs. The red-framed boxes indicate the functional domains associated with the differentially expressed protein DYSF. (b) GO functional enrichment analysis of DEPs. The x-axis represents the enrichment factor (rich factor ≤1), which indicates the proportion of DEPs annotated to a GO term relative to all identified proteins annotated to that term. The y-axis shows the statistical results for each category. The bubble color represents the significance of enrichment (calculated based on the P-value from Fisher’s exact test). The color gradient indicates the magnitude of the significance (-log₁₀[P-value]), with colors closer to red indicating a smaller P-value and higher significance. Red-framed boxes highlight biological processes associated with reproduction. (c) KEGG pathway enrichment analysis of DEPs. Red-framed boxes highlight metabolic pathways associated with reproductive processes. NOA: non-obstructive azoospermia; OA: obstructive azoospermia; DEPs: differentially expressed proteins; GO: Gene Ontology; WD: WD repeat; TCP-1/cpn60 chaperonin: T-complex protein 1/chaperonin 60; CH: calponin homology; CS: CHORD and SGT1; Hsp70: 70-kilodalton heat shock protein; C2: protein kinase C conserved region 2; PH: pleckstrin homology; DEAD/DEAH: Asp-Glu-Ala-Asp/His; MCM2/3/5: minichromosome maintenance protein 2/3/5; EGF: epidermal growth factor; BP: biological process; CC: cellular component; MF: molecular function; MCM: minichromosome maintenance.

Bioinformatic analysis

To elucidate the observed alterations in protein expression, the GO annotation analysis was performed, focusing on biological processes (BP), cellular components (CC), and molecular functions (MF). Our findings suggested that NOA and OA are correlated with distinct functional profiles (Figure 3b). The most significantly enriched biological processes included binding of sperm to zona pellucida, sperm–egg recognition, cell–cell recognition, and spermatid development. Regarding cellular components, the DEPs were primarily localized to minichromosome maintenance (MCM) complex, zona pellucida receptor complex, chaperonin-containing T-complex, and sperm principal piece. In terms of molecular functions, significant enrichments were observed in metallopeptidase activity, tripeptidyl-peptidase activity, steroid hydroxylase activity, and dipeptidase activity.

We also conducted the KEGG pathway annotation analysis to identify key metabolic and signal transduction pathways. The analysis revealed that 717 DEPs were enriched across various significant biological pathways (Figure 3c). The upregulated DEPs were predominantly associated with metabolism of xenobiotics by cytochrome P450, ovarian steroidogenesis, steroid biosynthesis, chemical carcinogenesis-DNA adducts, and drug metabolism-cytochrome P450. These pathways were closely related to reproductive and hormonal regulation, corroborating the GO enrichment results. Conversely, the downregulated DEPs were primarily involved in mRNA surveillance pathway, cell cycle, nucleocytoplasmic transport, RNA degradation, and aminoacyl-tRNA biosynthesis.

Confirmation of DEPs in the expanded sample size via qRT-PCR and Western blot analysis

To corroborate our proteomic findings and explore their functional implications, we selected a set of candidate proteins for confirmation based on the following criteria: (1) significant dysregulation (P < 0.05, FC > 2), (2) central roles in the membrane repair pathway as highlighted by KEGG/PPI analysis, and (3) documented relevance to reproductive or muscular disorders in the literature. This led us to focus on six core DEPs (DYSF, MYOF, CD63, CAV3, CAPN3, and MG53). These samples were further analyzed using qRT-PCR and Western blot analysis in expanded testicular tissue samples from individuals with NOA (n = 37) and OA (n = 28).

The qRT-PCR results revealed that, compared with those in the OA group, the mRNA expressions of DYSF, MYOF, MG53, and CD63 were significantly upregulated in the NOA group (all P < 0.05), whereas those of CAV3 and CAPN3 were significantly downregulated (both P < 0.05; Figure 4a). These findings align with those from the proteomics analysis. Similarly, Western blot analysis revealed that, relative to those in the OA group, the protein expression of DYSF, MYOF, MG53, and CD63 in the NOA group markedly increased (all P < 0.05), while the expressions of CAV3 and CAPN3 were significantly downregulated (both P < 0.05), corroborating the qRT-PCR results (Figure 4b).

Figure 4.

Confirmation experiments for DEPs in proteomics. (a) Quantitative mRNA analysis of DEPs. Intergroup comparisons were conducted via Student’s t-tests, and the statistical data are presented as mean ± s.d. ^**P < 0.05 denotes a significant difference between the NOA group and OA group. (b) Representative Western blot bands of DEPs and protein quantification analyses. Intergroup comparisons were conducted via Mann–Whitney U tests, and the statistical data are presented as median (IQR). ^**P < 0.05 denotes a significant difference between the NOA group and OA group. Differences among group means were assessed using one-way ANOVA followed by Tukey’s multiple comparison test. Mw: molecular weight; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; s.d.: standard deviation; IQR: interquartile range; DEPs: differentially expressed proteins; NOA: non-obstructive azoospermia; OA: obstructive azoospermia; DYSF: dysferlin; MYOF: myoferlin; ANOVA: analysis of variance; CAV3: caveolin-3; CAPN3: calpain-3; MG53: mitsugumin 53; CD63: cluster of differentiation 63.

DISCUSSION

NOA represents a prevalent and severe condition impairing male fertility, yet its etiology largely remains elusive, underscoring the necessity of enhancing our understanding of its underlying mechanisms.13 Recent progress in proteomics has substantially advanced our knowledge of protein dynamics in human cells, significantly contributing to the field of male infertility research. In this study, we embarked on a comprehensive proteomic analysis and confirmatory experiments of testicular tissue from patients with NOA and OA, which was grounded in the examination of disparities in their clinical characteristics. Our analysis revealed substantial differences in protein expression between the groups, offering new insights into the potential mechanisms underlying male infertility.

These molecular insights were consistently reflected in the distinct clinical phenotype of NOA patients. Our clinical observations indicate that men with NOA display markedly reduced testicular volume and elevated serum FSH and LH compared with those with OA. Histopathological analyses revealed an almost complete depletion of germ cells, accompanied by Sertoli cell-only patterns and thickened basement membranes, findings indicative of primary testicular failure. Together, these phenotypic features suggest that the proteomic alterations in NOA are likely attributable to intrinsic spermatogenic dysfunction. Independent evidence supports this conclusion. A recent study consistently shows that NOA patients have smaller testicular volumes and higher gonadotropin concentrations relative to OA, and these metrics are strongly correlated with the degree of spermatogenic impairment.14 Moreover, combined thresholds for testicular size and FSH concentration have proved highly predictive of NOA, facilitating its clinical differentiation from OA.15 Markedly elevated FSH, such as levels exceeding twice the upper normal limit, is also considered a reliable indicator of primary testicular failure and may obviate the need for diagnostic biopsy.16 Although a subset of NOA patients may have normal hormonal profiles,17 our cohort was deliberately selected to minimize such heterogeneity, thereby strengthening the association between clinical phenotype and proteomic findings. To elucidate the molecular basis of these clinical differences, we conducted a comprehensive proteomic comparison between NOA and OA.

On the basis of our proteomic comparisons, there are significant differences between NOA and OA. Pathological examinations revealed that about 35.7% of NOA patients exhibited SCOS, while the remaining patients presented spermatogenic arrest, whereas OA samples displayed normal spermatogenesis; thus, differences in cellular composition clearly affect the size and abundance of the proteome.18 However, we identified 717 DEPs, with 242 upregulated and 475 downregulated in NOA, a magnitude of change that exceeds what can be attributed solely to variations in cell composition. Evidence from the literature supports this view: compared with the OA group (approximately 1208 proteins) and the low spermatogenesis group (approximately 1076 proteins), the SCOS group has only approximately 839 detectable proteins, yet hundreds of proteins still differ in abundance between groups, mainly involving integrin signaling, inflammatory responses and cytoskeletal regulation pathways. In addition, microproteomic analysis of isolated Sertoli cells from SCOS and OA showed that cell-adhesion pathways are significantly downregulated and apoptosis-related proteins are upregulated in SCOS cells, consistent with our observation of numerous downregulated proteins and increased apoptotic signaling in whole tissue.19,20 Consistent with this, some studies report that even high extension and freezing treatments can alter sperm proteomes, leading to molecular redistribution.21 In contrast, other researchers argue that the differences between NOA and OA proteomes mainly reflect the loss of germ cells;22 however, the evidence above indicates that even when analyzing the same cell type, hundreds of DEPs can still be detected, suggesting that disease-related signaling pathways and changes in cellular functions are the primary drivers.23 Therefore, when interpreting proteomic differences between NOA and OA, one should consider not only cellular composition but also the deeper biological mechanisms related to Sertoli cell function, apoptosis and interactions with the extracellular matrix.

To move beyond interpreting DEPs solely as reflections of cellular composition differences, we performed GO and KEGG enrichment analyses to elucidate their functional implications. Downregulated DEPs in the NOA group were predominantly enriched in genetic material packaging, chaperone-mediated protein folding and catalytic activities, whereas upregulated DEPs included membrane-repair proteins such as DYSF and MYOF. These patterns suggest impaired protein folding and cell division, accompanied by activation of stress responses; rather, they indicate intrinsic testicular dysfunction. Independent comparative proteomic analysis of formalin-fixed, paraffin-embedded (FFPE) testicular tissues has shown that proteins discriminating OA from NOA are highly enriched in integrin signaling, adherens junctions, and planar cell polarity pathways.19 These pathways govern cytoskeletal remodeling and cell–cell adhesion and thus corroborate our observations of disrupted cell division and extracellular–matrix interactions. Even within a defined cell population, numerous DEPs therefore reflect impaired adhesion and reduced survival, consistent with the upregulation of membrane-repair proteins in our dataset. Correspondingly, proteomic profiling of seminal plasma from azoospermic patients demonstrated that downregulated proteins in SCOS samples are enriched for protein folding, unfolded-protein binding and other chaperone functions.24 Collectively, these findings suggest that stress on protein-folding and chaperone systems underlies NOA, lending support to our hypothesis of defective protein processing. Although some reports attribute NOA–OA proteomic differences solely to germ cell loss, our functional annotations indicate that enrichment of protein-folding, cytoskeletal, and adhesion pathways is more likely to reflect disease-specific molecular alterations. DEPs should therefore be interpreted as indicators of intrinsic pathophysiological mechanisms rather than as simple reflections of residual cell populations.

Having established that the proteomic profile of NOA reflects intrinsic pathophysiological mechanisms, we next focused on a particularly salient finding: among the functionally enriched pathways, the dysregulation of membrane repair machinery emerged as a prominent feature. To confirm these proteomic findings and explore their mechanistic implications, we focused on a set of core repair proteins. Our proteomic data, corroborated by RT-qPCR and Western blot analyses, revealed that the membrane repair proteins (DYSF, MYOF, MG53, and CD63) were significantly upregulated in testicular tissue from patients with NOA, whereas CAV3 and CAPN3 were downregulated. This “up–down” expression profile implies that the membrane repair machinery is activated in a compensatory manner in NOA, while structural scaffolding and protease systems are diminished.25

The upregulated proteins suggest an activated, albeit potentially insufficient, membrane repair response. Within the core repair module, DYSF and MYOF belong to the ferlin family of multi-C2 domain proteins that sense Ca²⁺ and mediate vesicle fusion.26 DYSF is normally abundant in skeletal muscle, and cryo-EM studies show that its C2 domains bind AHNAK nucleoprotein (AHNAK), MG53 and CAV3 to form repair complexes.27 Although other ferlins, such as fer-1-like protein 5 (FER1L5), are known to be predominant in the testis,28 our data revealed a marked increase in DYSF in NOA. Single-cell transcriptomics show DYSF expression in meiosis-stage germ cells.29 Consequently, the observed upregulation likely suggests that DYSF is aberrantly expressed or activated in the remaining somatic cell populations. This hypothesis is consistent with reports that DYSF cooperates with AMPK to promote repair.30 MYOF, possessing seven C2 domains and a DYSF domain that interacts with CAV3,31 regulates endocytosis of receptors such as vascular endothelial growth factor receptor 2 (VEGFR2).32 Single-cell data indicate MYOF is expressed in Sertoli and interstitial cells;28 its upregulation in NOA may reflect attempts to repair the blood–testis barrier, though excessive MYOF could disrupt receptor trafficking and signaling.25 MG53 is a muscle-specific E3 ubiquitin ligase that is hardly detected in normal testis.33 It recognizes exposed phosphatidylserine to nucleate repair patches, and its interaction with CAV3 is critical for resealing.34 The aberrant activation of MG53 we observed in NOA may represent a response to oxidative stress, since MG53 deficiency increases reactive oxygen species (ROS) and germ cell apoptosis.35 CD63, a tetraspanin, does not directly repair membranes but marks and regulates biogenesis of extracellular vesicles.36 CD63-positive epididymal vesicles transfer regulatory factors to spermatozoa,37 and stem cell-derived CD63 vesicles can restore spermatogenesis in NOA models.38 Its upregulation in our data may indicate enhanced local intercellular communication, whereas reduced CD63 in seminal exosomes could impair spermatogenesis.39

In contrast, the downregulation of CAV3 and CAPN3 underscores deficits in structural scaffolding and proteolytic regulation. CAV3, a caveolin predominantly expressed in muscle,40 forms repair caps with DYSF and MG53; its absence causes these proteins to accumulate in the Golgi.41 CAPN3 is a muscle-specific Ca²⁺-dependent protease that cleaves AHNAK to regulate the DYSF complex and participates in acrosome formation and mitochondrial sheath assembly.42 Single-cell sequencing shows that CAPN3 is markedly downregulated in round spermatids.43 Our findings revealed a further reduction of CAPN3 in NOA. Given the clinical associations with acrosomal abnormalities, such insufficiency suggests that CAPN3 may impair sperm maturation. Single-cell sequencing shows CAPN3 is markedly downregulated in round spermatids; our findings of further reduction in NOA, together with clinical associations with acrosomal abnormalities, suggest CAPN3 insufficiency may impair sperm maturation.

Taken together, the upregulation of DYSF, MYOF, MG53, and CD63 in NOA likely reflects stress-induced activation of membrane repair and intercellular communication, whereas the downregulation of CAV3 and CAPN3 reveals a loss of structural support and proteolytic regulation. Future work should validate these findings in larger cohorts with single-cell resolution.

While our integrated approach provides important insights into NOA mechanisms, several limitations should be considered. First, the single-center design and modest sample size may affect generalizability, requiring confirmation in larger, multicentric cohorts. Second, our bulk tissue proteomics approach, while informative, cannot resolve cell type-specific contributions, a limitation that could be addressed in future studies using single-cell proteomics or spatial transcriptomics.44 Third, the focus on protein abundance does not capture potentially relevant post-translational modifications that regulate protein function in spermatogenesis.45 Finally, as with all LC-MS/MS-based workflows, the detection of low-abundance signaling proteins may be limited by dynamic range constraints and testicular lipid content, potentially underrepresenting key regulatory pathways. Despite these limitations, which are inherent to discovery-phase proteomic studies, our dataset provides a valuable resource for understanding molecular disruptions in spermatogenic failure.

In conclusion, our proteomic profiling not only confirms the expected protein landscape due to germ cell depletion in NOA but also, more importantly, unveils a distinct signature of dysregulation in testicular cells. This provides a fresh perspective on NOA pathophysiology, moving beyond the germ cell-centric view to consider the role of the testicular somatic environment. The identified DEPs, particularly DYSF, MYOF, and their interacting partners, warrant further investigation as potential biomarkers and contributors to the dysfunctional testicular microenvironment in NOA. Future studies are warranted to validate DEPs in larger cohorts and explore single-cell proteomics to delineate cell type-specific effects.

AUTHOR CONTRIBUTIONS

JHY and HQA were responsible for conceptualization, supervision, project administration, and funding acquisition. ZW and XDL contributed equally to methodology, formal analysis, data curation, and writing original draft. ZW also handled software. XDL and WMS participated in investigation. WMS provided resources (clinical samples). DXZ and XQX were responsible for validation and visualization. JHY, HQA, and XQX contributed to writing, review, and editing. All authors read and approved the final manuscript.

COMPETING INTERESTS

All authors declare no competing interests. The authors declare that the technical services provided by Protein Technology Co., Ltd. (Shanghai, China), do not constitute competing interests as the company had no role in the study design or data interpretation.

SUPPLEMENTARY MATERIALS AND METHODS

1.1 PROTEOMIC ANALYSIS AND BIOINFORMATICS OF TESTIS

Protein Extraction

Five cases of NOA and OA testicular tissue samples were randomly selected for proteomic analysis. The samples were ground into a fine powder in liquid nitrogen and transferred to a 5 ml centrifuge tube, to which four volumes of lysis buffer were added. The mixture was sonicated three times using a high-intensity ultrasonic processor (Scientz, Ningbo, China) under ice-cold conditions and then centrifuged at 12 000 ×g for 10 min at 4°C. The supernatant was collected, and the protein concentration was determined using a BCA protein assay kit (Manufacturer, City, Country), following the manufacturer's instructions.

Employ LC-MS/MS for Label-Free Proteomics Analysis

Before conducting the proteomic analysis, each sample was treated with a final concentration of 10 mM DTT, mixed at 40 ×g at 37°C for 1.5 h. After cooling to room temperature, 20 mM IAA was added to each sample to block the cysteine reduction residues, and the samples were incubated in the dark for 30 min. The samples were then transferred to filters and washed thrice with 100 μl of UA buffer, followed by two washes with 100 μl of 25 mM NH₄HCO₃ buffer. Subsequently, trypsin was added to the samples at a trypsin-to-protein (wt/wt) ratio of 1:50 and incubated at 37°C for 15–18 h (overnight). The resulting peptides were collected as filtrate and desalted using a C18 column (Empore™ SPE C18 (standard density), 7 mm diameter, 3 ml volume (Sigma)). After vacuum centrifugation, the peptides were resuspended in 40 μl of 0.1% (v/v) formic acid. The peptide content was estimated based on the tryptophan and tyrosine frequency in vertebrate proteins, using an extinction coefficient of 1.1 for a 0.1% (g/l) solution at 280 nm.

LC-MS/MS analysis was conducted using a Q mass spectrometer (Thermo Scientific) coupled with Easy nLC (Proxeon Biosystems, now Thermo Fisher Scientific). Samples were resuspended in Buffer A (0.1% formic acid, FA) and subjected to online desalting using a C18 reverse-phase separation column (2 cm × 150 μm, particle size 3 μm). Here, 0.5 μg of peptides were desalted at a flow rate of 3 μl/min, followed by loading onto a C18 trap column (15 cm × 150 μm, particle size 1.9 μm) with a gradient from 5% to 35% Buffer B (0.1% FA, 2% water, 97.9% ACN) at 400 nl/min over 91 minutes. Subsequent peptide separation was performed using a reverse-phase chromatography column (Thermo Scientific Easy Column, 10 cm length, 75 μm inner diameter, 3 μm resin) connected to a C18 reverse-phase analytical column (Thermo Scientific Acclaim PepMap100, 100 μm × 2 cm, nanoViper C18), employing a linear gradient of Buffer B (84% acetonitrile, 0.1% formic acid) at a flow rate of 300 nl/min. The mass spectrometer was operated in positive ion mode, and data were acquired using a data-dependent top 20 method, dynamically selecting the most abundant precursor ions for HCD fragmentation scanning (300-1800 m/z). Mass spectrometry raw data were analyzed using Maxquant software (version 1.6.14), with proteins identified as differentially expressed (DEPs) based on a P < 0.05 and a fold change (FC) ≥1.5. Further methodological details are available in the supplementary materials.

Bioinformatics Analysis of Proteins Associated with the Diagnosis of Azoospermia

Bioinformatics analysis was conducted using InterProScan software to search protein sequences and identify protein domain features from the Pfam database, a member of InterPro. Differentially expressed proteins (DEPs) were analyzed with both the Gene Ontology (GO) database (http://geneontology.org/) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) (http://www.genome.jp/kegg/pathway.html); these analyses employed a P-adjustment and P < 0.05. Additionally, protein–protein interaction (PPI) analysis and visualization were performed using the String database (http://string-db.org/) and Cytoscape software. Key modules in the PPI network were identified using Molecular Complex Detection (MCODE) based on the criteria of an MCODE score ≥20, a degree cutoff of 2, a node score cutoff of 0.2, a maximum depth of 100, and a k-score of 2. Subsequent KEGG analysis focused on the proteins within this module.