Skip to main content
Nanoscale Advances logoLink to Nanoscale Advances
. 2026 Sep 30. Online ahead of print. doi: 10.1039/d6na00437g

Near-infrared light-controlled catalytic hairpin assembly fluorescent biosensor for the sensitive and specific detection of fibroblast activation protein

Jiayi Wu a,✉, Xingchun Zheng a, Jinhua Huang a, En Chen a
PMCID: PMC13624721  PMID: 42819034

Abstract

Fibroblast activation protein (FAP) is significantly upregulated in activated cardiac fibroblasts after myocardial infarction, and its serum concentration is negatively correlated with cardiac function, infarct size, and ischemia score. It is an ideal biomarker for early diagnosis and prognosis evaluation of cardiovascular disease. In this work, a fluorescent biosensor based on a near-infrared light-controlled catalytic hairpin assembly (CHA) signal amplification strategy was developed for highly sensitive and specific detection of FAP. First, upconversion nanoparticles (UCNPs) are synthesized, and then the surface of the UCNP is modified with sodium citrate via electrostatic adsorption to introduce carboxyl groups, resulting in the formation of carboxyl-functionalized UCNPs. Finally, they were covalently coupled with the photo-controlled hairpin probe (H1) through amide condensation. Under 808 nm illumination, UCNPs emit ultraviolet light to cleave the photocleavable (PC) linker of H1, exposing the S1 binding site. Competitive displacement of free S1 by target FAP initiates CHA cycle amplification, achieving significant recovery of Cy5 fluorescence. Under optimal conditions, the biosensor exhibited a good linear response to FAP, with a detection range of 0.5–6 ng mL−1 and a limit of detection as low as 0.384 ng mL−1. The results of the human serum spiked recovery experiment revealed a recovery rate of 98.2% to 103.4%, with an RSD of less than 4.6%. The constructed biosensor has the benefits of high sensitivity, specificity, good stability, and resistance to matrix interference, demonstrating good potential for application in FAP-related detection.


Fibroblast activation protein (FAP) is significantly upregulated in activated cardiac fibroblasts after myocardial infarction, and its serum concentration is negatively correlated with cardiac function, infarct size, and ischemia score.graphic file with name d6na00437g-ga.webp

1. Introduction

Myocardial infarction is currently a major cause of death on a global scale.1 After myocardial infarction, a large number of myocardial cells in the infarction area die, which can induce the activation of cardiac fibroblasts and the secretion of extracellular matrix proteins to maintain the integrity of the heart structure.2 Recent studies have shown that fibroblast activation protein (FAP) is an important surface marker for activating cardiac fibroblasts.3 Previous studies have shown that FAP expression is noticeably upregulated in the left ventricular myocardial tissue of patients with hypertrophic cardiomyopathy and ischemic heart failure.4,5 In the serum of patients with myocardial infarction and ischemic heart failure, the concentration of FAP is negatively correlated with cardiac function, infarct size, and ischemic score, indicating that the FAP concentration has good diagnostic and prognostic value.6 Therefore, developing sensitive and efficient FAP detection methods has important clinical significance.

At present, the main methods for detecting FAP include western blotting,7 immunohistochemistry,8 polymerase chain reaction (PCR),9 and enzyme-linked immunosorbent assay (ELISA).10 Despite their availability, these techniques suffer from limitations, including large sample requirements, low sensitivity, and complex operations, which limit the practical application of the FAP in disease diagnosis.11 In contrast, optical analysis, especially fluorescence analysis, has attracted much attention due to its simple operation, real-time imaging, and high sensitivity and has become a powerful tool for real-time dynamic detection of FAP.12 However, the design of existing fluorescent probes is mostly based on the activity of proline exonuclease (exonuclease) and endopeptidase (endonuclease) in FAP.13 Although mature substrate screening systems have been established and fluorescent probes have made progress in FAP research, such probes are still prone to cross recognition with source enzymes such as dipeptidyl peptidase-4 and prolyl oligopeptidase in complex physiological environments, resulting in limited detection specificity.14,15 Nucleic acid aptamers are a type of single-stranded nucleic acid molecule with a specific recognition function,16 and their affinity and specificity are comparable to those of antibodies.17 Fluorescent probes based on nucleic acid aptamers have proven effective for the identification of nucleic acids,18 proteins,19 and other biomolecules,20 providing new ideas for the highly specific recognition of FAP. However, their detection sensitivity is still limited, especially when the expression level of FAP is low in the early stages of the disease. To meet clinical detection requirements, combining signal amplification strategies is necessary.

Current signal amplification strategies include mainly rolling circle amplification (RCA),21 hybridization chain reaction (HCR),22 catalytic hairpin assembly (CHA),23 and CRISPR/Cas-related signal amplification systems.24 Among them, CHA is an enzyme-free isothermal nucleic acid amplification approach that has the advantages of mild reaction conditions, high amplification efficiency, low background signal, and no need for protease involvement.25,26 Moreover, multi-amplification strategies including CHA have been integrated with other amplification strategies (such as HCR) and dual-mode readouts for ultra-sensitive and portable detection of diverse targets, demonstrating its broad adaptability in biosensing.27–32 However, traditional CHA fluorescent probes are usually in a “normally on” state, and are susceptible to non-specific interference in complex biological matrices, leading to untargeted hairpin opening, high background signals, and false positive results.33,34 Consequently, it is desirable to design a novel fluorescence sensing system with tunable activation to minimize background interference and improve assay specificity. The emergence of upconversion nanoparticles (UCNPs) has provided an opportunity to address the aforementioned issues. UCNPs are a type of anti-Stokes luminescent nanomaterial that can emit ultraviolet light (365 nm) under near-infrared light (such as 808 nm) excitation35 and are used for the photo-controlled cleavage of DNA chains, achieving the selective activation of CHA reactions and ultimately achieving the quantitative detection of targets through the recovery of fluorescence signals such as Cy5. Owing to the use of near-infrared light as the excitation source, this system can effectively avoid background interference caused by non-specific triggering in biological samples,36 thus having significant application advantages in fluorescence biosensing.37 Based on the above advantages, combining the NIR light control characteristics of UCNPs with the signal amplification of CHA is predicted to provide sensitive and specific detection of FAP.

In this work, NIR light control technology, nucleic acid aptamer technology, isothermal nucleic acid amplification technology, and fluorescence analysis were used to construct a novel fluorescence biosensing strategy for FAP detection (Scheme 1). In this system, the FAP can specifically recognize the spatial structure of the SPT, thereby competitively replacing S1 in the S1-SPT double chain so that it is in a free state. At the same time, under 808 nm excitation, UCNPs emit ultraviolet light and cut off the photocleavable (PC) linker on the hairpin structure H1, exposing the binding site with S1. Subsequently, free S1 undergoes complementary base pairing with H1, opening the hairpin structure of H1 and exposing its recognition binding site with H2. After opening, H1 further hybridizes with hairpin probes H2 modified with Cy5 and BHQ2 at the ends, forming a double-stranded complex. In the initial state, the spatial distance between Cy5 and BHQ2 is relatively close, and the fluorescence is efficiently quenched. When the H2 hairpin structure is opened, the distance between Cy5 and BHQ2 increases, the fluorescence quenching effect is relieved, and the Cy5 fluorescence signal is significantly restored. Meanwhile, S1 is once again replaced with a free state. The released free S1 can continuously participate in the next round of H1 open-loop reactions, thereby initiating CHA cycle amplification. In addition, by replacing adapter sequences, it can be expanded into a universal protein biomarker detection platform.

Scheme 1. Schematic diagram of the developed bioprobe for the detection of FAP.

Scheme 1

2. Experimental section

2.1. Reagents and instruments

2.1.1. Reagents

The primary chemical reagents utilized in this work including sodium hydroxide, anhydrous ethanol, and cyclohexane, were obtained from Sinopharm Chemical Reagents Co., Ltd; TmCl3·6H2O, GdCl3·6H2O, YbCl3·6H2O, NdCl3·6H2O, oleic acid (OA), 1-octadecene (ODE), ammonium fluoride, sodium citrate dihydrate (SCD), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC), and N-hydroxy succinimide (NHS) were obtained from Aladdin Chemical Reagents Co., Ltd; argon gas was supplied by Fuzhou Huaxinda Gas Co., Ltd. The DNA employed in this study was obtained from Bioengineering (Shanghai) Co., Ltd. The DNA sequences are as follows:

H1 : GGCATC/iPCLink/TGACCTCTGTGCTGCTTATATTTTTTTTTTTTAGCAGCACAGAGGTCAGATGCC

H2:/Cy5/TATATTTTTTTTTTTTTGACCTCTGTGCTGCTAAAAAAAAAAAATATAAGCAGCAC/BHQ2/

S1 : GGCATCTGACCTCTGTGCTGCT

SPT : AGCAGCACAGAGGTCAGATGCCGCAGGCAGCTGCCATTAGTCTCTATCCGTGACGGTATGCCTATGCGTGCTACCGTGAA

2.1.2. Instruments

A JEM-2100F transmission electron microscope (TEM) was employed to characterize the morphology and structural features of the nanomaterials. X-ray powder diffraction (XRD) patterns were obtained using a Japanese Miniflex 600 diffractometer. A Nicolet 5700 infrared spectrometer was used to perform Fourier transform infrared spectroscopy (FTIR) analysis. Zeta potential measurements were carried out using a Nano-ZS90 zeta potential analyzer. The upconversion excitation and emission spectra were obtained using a FluoroMax-4 spectrometer.

2.2. Preparation and modification of UCNPs

2.2.1. Preparation of NaGdF4:Yb,Tm

In this study, NaGdF4:Yb,Tm upconversion nanoparticles were fabricated by a high-temperature coprecipitation approach, with the entire synthesis process conducted under an inert argon atmosphere. First, 0.112 g of GdCl3·6H2O (0.3 mmol), 0.267 g of YbCl3·6H2O (0.69 mmol), and 0.0038 g of TmCl3·6H2O (0.01 mmol) were placed in a 100 mL three-neck flask, after which 6 mL of OA and 15 mL of ODE were added. The aforementioned mixed solution was warmed to 160 °C, and the temperature was maintained until the solids were completely dissolved. Alternatively, 0.148 g ammonium fluoride and 0.10 g sodium hydroxide were dissolved in 5 mL of methanol. This methanol solution was added dropwise to the aforementioned cooled mixture, followed by heating to 40 °C and holding for 30 min to trigger the nucleation reaction. The reaction system was subsequently heated to 110 °C and held at that temperature for 30 min to facilitate the removal of residual water and methanol, after which it was further heated to 300 °C and held for 1 h to complete the growth of the nanocrystals. Finally, the product was collected by centrifugal separation, and the product was rinsed three times with an ethanol–cyclohexane mixed solvent to remove the unreacted raw materials and free surfactants. The resulting NaGdF4:Yb, Tm was redispersed in 5.0 mL of cyclohexane, resulting in a UCNP dispersion solution with a concentration of 32.07 mg mL−1.

2.2.2. Preparation of NaGdF4:Yb, Tm@NaGdF4, Yb,Nd

This study employed the same high-temperature coprecipitation method to fabricate core-shell-structured nanoparticles. The experiments were conducted under an inert argon atmosphere. First, 0.0892 g of GdCl3·6H2O (0.48 mmol), 0.0155 g of YbCl3·6H2O (0.08 mmol), and 0.0431 g of NdCl3·6H2O (0.24 mmol) hydrate rare-earth chlorides were placed in a 100 mL three-neck round-bottom flask, after which 6 mL of OA and 15 mL of ODE were added. The reaction system was warmed to 160 °C, and maintained for 30 min until the solid reagent completely dissolved. To the system, 5 mL of the bare-core UCNP cyclohexane dispersion prepared in Section 2.2.1 was added, and the mixture was stirred at 80 °C for 30 min; then, the temperature was increased to 110 °C and held for 30 min to remove the cyclohexane from the system. Alternatively, 0.148 g of ammonium fluoride (NH4F) and 0.10 g of sodium hydroxide (NaOH) were mixed together, dissolved in 5 mL of methanol solution, and slowly introduced into the preformed suspension. The temperature was held at 40 °C for 30 min to induce slow growth of the shell layer. The temperature was then increased to 110 °C and sustained for 20 min to facilitate the complete removal of residual moisture and methanol from the system. Finally, the temperature was increased to 300 °C and held constant for 1 h, completing the crystallization of the core–shell nanocrystals. Finally, the product was cooled to room temperature, collected by centrifugation, and then purified by washing with an ethanol–cyclohexane mixed solvent. Finally, the prepared core–shell-structured UCNPs were redispersed in 5.0 mL of cyclohexane, resulting in a core–shell UCNP dispersion solution with a concentration of 37.69 mg mL−1.

2.2.3. NaGdF4:Yb, Tm@NaGdF4, Yb,Nd core–shell modification

To enhance the biocompatibility of oil-soluble UCNPs, in this study nanoparticle surfaces were modified via ligand exchange to prepare citrate-coated water-soluble upconversion nanoparticles (Cit-UCNPs). The oleic acid ligands on the nanoparticle surface were replaced with citrates, resulting in the functionalization of the carboxyl groups on the nanoparticle surface. The experimental procedure was carried out as detailed below: initially, 1 g of sodium citrate and 30.0 mL of diethylene glycol were introduced into a 100 mL three-neck flask. The temperature was increased to 110 °C, and the reaction was maintained for 30 min. When the mixed solution naturally cooled to 50 °C, 10 mg of core–shell UCNPs was dissolved in 5.0 mL of trichloromethane-toluene mixed solvent (volume ratio v/v = 3 : 2), and the resulting dispersion was then added dropwise to the aforementioned reaction system. The reaction system was subsequently heated to 130 °C and maintained to allow the volatilization of trichloromethane and toluene from the system. After the organic solvent completely evaporated, the temperature was increased to 180 °C under argon protection and maintained for 90 min to complete the ligand exchange. When the reaction concluded, the system was naturally cooled and centrifuged at 11 000 rpm for 10 min to collect the precipitate. The precipitate was subsequently rinsed three times with ultrapure water–ethanol to strip away residual ligands and impurities. Finally, the purified Cit-UCNPs were dispersed in 5.0 mL of ultrapure water to obtain a Cit-UCNP dispersion solution with a concentration of 1.4 mg mL−1.

2.3. Construction of sensors for Cit-UCNP@DNA

In this study, an amide covalent coupling reaction was used to stably modify DNA hairpin structures onto the surface of Cit-UCNPs to construct functionalized nanocomposites. The specific procedure is as follows: first, the four DNA strands (H1, H2, S1, and SPT) were dissolved in TE buffer to formulate a stock solution with a concentration of 10 µM. Ten microliters of S1 solution and 30 µL of SPT solution were accurately transferred for mixing, achieving a dilution ratio of 1 µM (volume ratio of 1 : 3); 10 µL each of the H1 and H2 stock solutions were separately transferred for later use. The prepared DNA mixture, H1 solution, and H2 solution were placed in a metal bath, annealed at 95 °C for 5 min, and then cooled naturally to complete the DNA chain pretreatment. 100 µL of the Cit-UCNP (1.4 mg mL−1) dispersion was placed in a glass sample bottle, 500 µL of MES buffer was added to adjust the system environment, and then 1 mg of EDC and 2 mg of NHS were sequentially introduced. The solution was stirred for 30 min to promote the reactivity of the carboxyl groups on the nanoparticle surfaces. 10 µL of the pretreated H1 solution was added to the activated system and incubated for 3 hours in a 37 °C constant-temperature shaker to achieve covalent modification of the H1 chain via amide bonding. After the reaction was complete, the samples were centrifuged. Afterward, 100 µL of PBS buffer was introduced into the precipitate for resuspension, yielding the Cit-UCNP@H1 complex solution, denoted as U–H1, which was stored at room temperature for later use. Additionally, 10 µL of the H2 stock solution was diluted with 90 µL of PBS to prepare a 1 µM H2 solution, which should be stored for later use.

2.4. Fluorescence detection of the FAP

Afterward, 10 µL of the aforementioned pretreated 1 µM S1–SPT mixture was added to the system at various concentrations, and the final protein concentration gradients were set at 0.5, 1, 2, 4, and 6 ng mL−1. The mixed system was incubated at room temperature for 60 min to fully trigger the protein recognition reaction. Subsequently, 14 µL of U–H1 solution and 14 µL of H2 stock solution were introduced, and the total mixture was brought to a final volume of 200 µL using PBS. The system was then irradiated with 808 nm NIR light at a power density of 2.0 W cm−2 for 20 min to initiate the amplification reaction. After the illumination period, the samples were incubated at 37 °C for 90 min to ensure that the amplification reaction was complete. Finally, using a wavelength of 625 nm as the excitation wavelength, the fluorescence spectral signal of the sample was detected and recorded within the wavelength range of 650–700 nm. All the experimental groups underwent three parallel experiments to minimize experimental errors and ensure data reliability.

2.5. Fluorescence determination of FAP in actual samples

To validate the performance of this fluorescent biosensor in complex real-world specimens, in this study, human serum was chosen as the biological matrix for the spiked recovery experiment, with FAP spiked at final concentrations of 0.8, 1.5, and 2.5 ng mL−1. Sample processing and fluorescence detection were performed in strict accordance with the experimental protocol described in Section 2.4 of this work. By calculating the addition recovery rates of samples in each group, the analytical accuracy and practical feasibility of this detection method in complex biological samples were validated.

3. Results and discussion

3.1. Construction of fluorescent sensing probes

The fluorescent sensing probe constructed in this work utilizes the NIR light control characteristics of UCNPs to overcome the high background signal and false positive problems caused by the “normally on” state of traditional CHA probes, significantly improving the accuracy of detection. To verify the successful construction of the fluorescent sensing probe, the nanomaterials were first characterized using transmission electron microscopy (TEM). As presented in Fig. 1A, the synthesized core UCNP was hexagonal in shape, with an average diameter of approximately 18.53 nm. Similarly, the core–shell UCNP crystal maintained a hexagonal crystal structure, with its size increasing to approximately 23.25 nm (Fig. 1B), suggesting the formation of a core–shell structure. To further determine the composition of the prepared core–shell particles, energy dispersive spectroscopy (EDS) was conducted, and the results are shown in Fig. 1C and D. Elements such as Nd, Yb, and Tm were detected, further validating the fabrication of the core–shell UCNP structure. Subsequently, X-ray diffraction (XRD) was used to analyze the crystal structure of the core UCNP and core–shell UCNP, as presented in Fig. 1E. The XRD peak positions (2θ) of the bare core and core–shell UCNP are in agreement with the diffraction peaks of the hexagonal NaGdF4 standard card at 17.005°, 29.655°, 30.002°, 42.717°, 52.88°, and 53.446°. These findings not only indicate that the prepared nanomaterials have a pure hexagonal crystal phase, high crystallinity, and no impurity peaks but also prove that the construction of the core–shell structure does not alter the crystal phase of the original core UCNP, which is in agreement with the findings displayed in Fig. 1(A–D).

Fig. 1. (A) TEM image of the core UCNP (scale: 50 nm); (B) TEM image of the core–shell UCNP (scale: 100 nm); (C and D) EDS images of the core–shell UCNP; (E) XRD patterns of the core UCNP and core–shell UCNP; (F) FTIR spectra of the core UCNP, core–shell UCNP, and Cit-UCNP; (G) zeta potential changes at different modification stages.

Fig. 1

To construct fluorescent sensing probes and improve the biocompatibility of UCNPs, sodium citrate was used to modify the surface of UCNPs (Cit-UCNPs), and an aminated hairpin probe (H1) was grafted onto the surface of Cit-UCNPs through an amide reaction. First, Fourier transform infrared spectroscopy (FTIR) is utilized to verify the changes in the surface functional groups of the nanomaterials. As displayed in Fig. 1F, the infrared spectrum of core UCNPs, with characteristic peaks located at 2923.6, 2848.7, 1553.8, and 1466.6 cm−1, corresponds to the –OH stretching mode of OA molecules, the –CH2 stretching vibration of long alkyl chains, and the asymmetric and symmetric stretching vibration of –COO−, respectively. Relative to those of the core UCNP, the infrared spectral characteristic peak positions of the core–shell UCNP are basically the same, suggesting that the core–shell coating does not change the functional group type of UCNPs. After surface modification with citric acid ligands, the intensities of the characteristic peaks at 2923.6 and 2848.7 cm−1 in the FTIR spectrum significantly decreased, while the characteristic absorption peak of the carboxylic acid group shifted to 1600 cm−1 and 1392.3 cm−1, respectively. These changes in the FTIR results confirmed that the citric acid molecules successfully exchanged the original OA ligand from the surface of UCNPs, laying the foundation for the construction of fluorescent probes. Further validation of the modification effects of each step using the zeta potential was conducted, using ultra-pure water as the dispersion medium, and the samples were prepared as uniform dispersion solutions. The measurements were conducted at a constant temperature of 25 °C. Each sample was tested in parallel 3 times, and the results are shown in Fig. 1G. After modification with sodium citrate, the zeta potential of UCNPs decreased from +13.8 mV to −15.7 mV, attributed to the ionization of surface carboxyl groups (–COOH) in the buffer solution, which released H+ and negatively charged the particles. After binding to the negatively charged H1 single chain (with negatively charged phosphate groups), the potential further decreased to −26.8 mV, indicating that H1 was immobilized onto the surface of UCNPs and that the assembly of the fluorescent sensing probe was complete.

3.2. FAP detection principle and feasibility

An NIR photocatalytic hairpin self-assembled fluorescence sensing system for FAP detection was developed in this work. As illustrated in Fig. 2A, FAP specifically recognizes SPT and competitively replaces free S1. Under 808 nm excitation, UCNPs emit 365 nm ultraviolet light to cleave the PC linker on H1, thereby uncovering the S1 binding site. Free S1 hybridizes with H1, opening the hairpin structure and exposing the H2 recognition site. Subsequently, H1 hybridized with H2 was modified with Cy5/BHQ2 at the end, separating Cy5 from BHQ2 and restoring the fluorescence signal. At the same time, the released S1 loop triggers CHA amplification. Quantitative determination of FAP can be accomplished by measuring the fluorescence intensity of Cy5.

Fig. 2. (A) Schematic illustration of the NIR light-controlled CHA fluorescence sensing mechanism for FAP detection; (B) fluorescence emission spectra of the core UCNP and core–shell UCNP under 808 nm excitation; (C) energy transfer principle diagram of the core–shell UCNP structure; (D) PAGE analysis of the photoactivation and CHA reaction mechanism (lane 1: S1-SPT duplex; lane 2: S1-SPT + FAP; lane 3: U–H1; lane 4: U–H1 under 808 nm irradiation; lane 5: H2; lane 6: S1-SPT + FAP + U–H1 (without H2); lane 7: complete system (S1-SPT + FAP + U–H1 + H2) under 808 nm irradiation); (E and F) fluorescence emission spectra of the sensing system under different experimental conditions measured at 663 nm.

Fig. 2

To verify the feasibility of controlling the sensing probe with NIR light, we analyzed the fluorescence spectra of the fabricated core UCNP and core–shell UCNP when excited at 808 nm, as shown in Fig. 2B. Both exhibit emission peaks at around 365 nm, which originate mainly from the 1D2 → 3H6 energy level transition of Tm3+ ions. Under 808 nm excitation, Yb3+ ions act as sensitizers, absorbing NIR photons and transferring energy to Tm3+ ions via energy transfer upconversion (ETU). Subsequently, Tm3+ undergoes multiple excited-state absorption and cross-relaxation processes, ultimately achieving a transition from the high-energy level 1D2 to the ground state 3H6, resulting in the emission of ultraviolet light at around 365 nm. Moreover, the fluorescence intensity of the core–shell UCNP is substantially stronger than that of the naked-core UCNP because of the energy capture center Tm3+ and the NaGdF4:Yb,Nd active shell grown in the core region. This shell structure not only achieves an efficient energy shift in the NIR photon upconversion process but also effectively inhibits luminescence quenching induced by surface defects and surface ligands, hence yielding high-purity upconversion luminescence. Fig. 2C provides a schematic of the energy transfer mechanism for the core–shell structure. The above results indicate that under 808 nm excitation, the 365 nm ultraviolet light emitted by UCNPs can be used to cut the PC bond on the hairpin structure H1, confirming the feasibility of this NIR light control strategy.

Polyacrylamide gel electrophoresis (PAGE) was further utilized to corroborate the photoactivation and catalytic hairpin assembly (CHA) mechanisms of the fluorescent probe. As displayed in Fig. 2D, lane 1 presents a single uniform band corresponding to the intact S1-SPT probe, which verifies its stable structure. Lanes 3–5 indicate that H1 and H2 hairpins fail to undergo spontaneous self-assembly and that near-infrared irradiation does not damage their structural integrity. Lanes 2 and 6 prove that FAP can specifically recognize the SPT strand and competitively displace the S1 trigger strand, thereby initiating the subsequent CHA reaction. However, the CHA reaction cannot be initiated with H1 alone. Distinct long-chain assembled products are observed in the complete reaction system in lane 7, while no target products emerge in the control groups. Collectively, these findings confirm that FAP specifically recognizes SPT and releases free S1 to activate cyclic CHA amplification, validating the theoretical feasibility of the established sensing assay.

To further verify the feasibility and photosensitivity of the sensing system, multiple parallel control experiments were conducted, and the fluorescence spectra of each group were measured at 663 nm. As presented in Fig. 2E and F, only under the dual conditions of the presence of FAP and simultaneous exposure to NIR light could the system produce a significant fluorescence signal. In contrast, no significant fluorescence enhancement was observed in the control group lacking FAP or light exposure. The above results indicate that NIR light irradiation is necessary for activating the sensing system. The presence of FAP can specifically trigger CHA signal amplification, and increasing the concentration of H1 can further enhance the fluorescence response signal. These findings fully demonstrate the feasibility and photo-specificity of the constructed NIR photo-controlled CHA fluorescence sensing strategy.

3.3. Optimization of detection parameters

Before the target FAP was quantitatively detected, key experimental parameters affecting the CHA reaction process and Cy5 fluorescence recovery efficiency, including the 808 nm laser irradiation time and the dosage of hairpin probes H1 and H2, were optimized to improve the detection performance. First, the impact of an 808 nm laser irradiation duration (0–25 min) on the Cy5 fluorescence recovery intensity at 663 nm was examined, with the laser power density fixed at 2.0 W cm−2. As illustrated in Fig. 3A and B, the fluorescence intensity of Cy5 displayed a significant upward trend with the prolongation of illumination time, reaching its maximum value at 20 min. Continuing to extend the irradiation time to 25 min did not result in further enhancement of the fluorescence signal. Therefore, the optimal irradiation time for 808 nm laser-induced Cy5 fluorescence recovery was determined to be 20 min. Second, single-factor optimization was performed on the dosage of the H1 probe at a concentration of 1 µM (6–16 µL). As depicted in Fig. 3C and D, with the increase in H1 dosage, the fluorescence intensity of Cy5 increased and then fell, peaking at an H1 dosage of 14 µL. Based on this, the optimal addition volume of H1 in this system is determined to be 14 µL. Using the same concentration (1 µM) of H2 solution, single-factor optimization was performed within the range of 6–16 µ L. As displayed in Fig. 3E and F, the trend of the fluorescence recovery intensity of Cy5 was similar to that of H1 and reached its maximum value at a H2 dosage of 14 µL. Therefore, the optimal amount of H2 in this system is determined to be 14 µL.

Fig. 3. (A) Full fluorescence emission spectra under different 808 nm illumination times; (B) the corresponding fluorescence intensity at 663 nm; (C) full fluorescence emission spectra at different H1 dosages; (D) the corresponding fluorescence intensity at 663 nm; (E) full fluorescence emission spectra at different H2 dosages; (F) the corresponding fluorescence intensity at 663 nm.

Fig. 3

3.4. Testing performance of the constructed probe

To investigate the detection performance of the constructed UCNP@H1 sensing probe, fluorescence quantitative analysis targeting FAP was conducted under optimal experimental conditions. To explore the response pattern between the sensor fluorescence signal and the FAP concentration, a FAP concentration gradient of 0.5–6 ng mL−1 was used, and the detection operation followed the approach outlined in Section 2.4. The fluorescence response of the UCNP@H1 biosensor to different concentrations of FAP is presented in Fig. 4A. As the concentration of FAP gradually increased, the fluorescence of Cy5 was significantly restored, and the overall fluorescence intensity showed a stable upward trend. These findings suggest that the target FAP can efficiently activate the fluorescence response mechanism of the sensor and that the fluorescence output signal is sensitive to changes in the FAP concentration, preliminarily confirming that the biosensor can be used for the quantitative detection of FAP. To further establish a quantitative detection model for FAP, fluorescence signals at the 663 nm characteristic wavelength were extracted, and the linear correlation between the fluorescence recovery efficiency and the FAP concentration was analyzed. As displayed in Fig. 4B, the fluorescence recovery efficiency at 663 nm was linearly positively correlated with the FAP concentration within the concentration range of 0.5–6 ng mL−1. The standard curve equation obtained by linear fitting is Y = 18 944.49X + 198 265.82, with a coefficient of determination R2 of 0.9948. A higher R2 value indicates that the fitting model has high reliability and small error, indicating that the DNA-functionalized UCNP biosensor constructed in this study has excellent linear response ability and stable quantitative detection performance for FAP in this detection interval. Based on the standard curve, the limit of detection (LOD) of the biosensor for FAP was assessed using the triple standard deviation method, which was 0.384 ng mL−1, better than those of some previously described methods for detecting FAP (Table 1). The above results indicate that the signal probe constructed in this study can achieve the detection of the analyte FAP with high sensitivity and efficiency.

Fig. 4. (A) Fluorescence spectra of the system with varying concentrations of FAP; (B) linear relationship between the fluorescence recovery efficiency and FAP concentration; (C and D) degree of fluorescence recovery of the system in the presence of different proteins; (E) stability test results for 10 consecutive days (every 48 h); (F) intra-batch and inter-batch repeatability evaluation of the sensor.

Fig. 4

Table 1. Comparison of sensitivity with previously reported FAP detection methods.

Material Amplification strategy Time (min) Linear range (ng mL−1) LOD (ng mL−1) Ref.
Enzyme Enzyme-activated 120 0–15000 15 38
Sulfo-OHDF Enzyme-activated 180 50–300 1.59 39
Enzyme Enzyme-activated 40 50–350 1.47 40
Enzyme Self-immolative 90 0–1500 24 41
DCIP-Biotin Enzyme activation 120 0–1000 6.76 42
UCNP/DNA NIR/CHA 90 0.5–6 0.384 This work

To investigate the specific recognition ability of the UCNP@H1 biosensor for FAP, we selected papain, catalase, chymotrypsin and acylase as potential interfering substances. Simultaneously, a mixed experimental group of interfering proteins and FAP was established to investigate the recognition performance of sensors for target proteins in complex coexistence environments. As can be seen in Fig. 4C and D, when compared to that of the blank control group, the fluorescence intensity of the single interfering protein experimental group increased only slightly, and the change in fluorescence amplitude was much lower than that of the FAP experimental group, which can be ignored. However, the mixed experimental group still exhibited a substantial fluorescence recovery effect. The above findings suggest that the as-fabricated UCNP@H1 biosensor exhibits excellent anti-interference ability and can accurately and specifically recognize FAP even in complex systems.

In addition, the stability of the developed biosensor was evaluated for 10 consecutive days. The U–H1 sensor was stored in PBS buffer (10 mM, pH 7.4) at room temperature (25 °C) in the dark, and FAP detection was performed every 48 h, with triplicate measurements at each time point. As shown in Fig. 4E, during the testing period, there was no significant fluctuation in the fluorescence response of the sensor to 6 ng mL−1 FAP at 663 nm, and the relative standard deviation (RSD) of the fluorescence signal was 1.53%. To further evaluate its repeatability, the variation in the intra-assay and inter-assay measurements was studied. As depicted in Fig. 4F, the RSD values of the changes in the fluorescence signal are 1.06% and 1.53%, respectively. The above findings demonstrate that the biosensor exhibits excellent stability and reproducibility for FAP detection.

3.5. Real sample analysis

To further evaluate the practical suitability and reliability of the constructed UCNP@H1 biosensor, we used human serum as the actual detection matrix to quantitatively analyze the FAP in the sample. Healthy human serum was used in the experiments, and spiked recoveries were obtained using the standard addition method. As displayed in Table 2, the spiked recovery rate of FAP in human serum samples ranged from 98.2% to 103.4%, with an RSD (n = 3) of less than 4.6%. The above findings suggest that the UCNP@H1 biosensor can work stably in complex body fluid matrices and has good detection accuracy and repeatability for FAP in serum samples, making it suitable for practical biological sample detection.

Table 2. Results of spiked recovery detection of FAP in serum using biosensors (n = 3).

Samples Added (ng mL−1) Found (ng mL−1) Recovery (%) RSD (%)
Serum1 0.8 0.827 ± 0.024 103.4 3.0
1.5 1.473 ± 0.018 98.2 1.2
2.5 2.496 ± 0.043 99.8 1.7
Serum2 0.8 0.794 ± 0.037 99.3 4.6
1.5 1.526 ± 0.041 101.7 2.7
2.5 2.489 ± 0.028 99.7 1.1

4. Conclusion

In this study, an upconversion fluorescent biosensor based on an NIR photocatalytic CHA signal amplification strategy was developed for high-sensitivity and high-specificity quantitative detection of FAP. UCNPs with a core–shell structure was first prepared, after which a single probe was constructed through an amide reaction. Based on the characteristics of 808 nm NIR light exciting UCNPs to emit 365 nm ultraviolet light, precise cleavage of the PC linker on the H1 hairpin probe was achieved; thus, a light-controlled activated CHA signal amplification system was established. Experiments have shown that significant fluorescence signals can only be generated in the system when the FAP target and NIR light are present simultaneously, effectively avoiding the high background signal and false positive problems caused by the “always active” traditional CHA probe. Under optimal conditions, the linear detection range of the sensor for FAP ranged from 0.5–6 ng mL−1, with an LOD as low as 0.384 ng mL−1, demonstrating good quantitative detection capability. The results of the human serum spiked recovery experiment revealed that the spiked recovery rate ranged from 98.2% to 103.4%, and the RSD was less than 4.6%, confirming that the biosensor still maintains high detection accuracy and reliability in complex biological matrices and has potential for practical sample detection applications. In summary, the NIR light-controlled CHA signal amplification fluorescent biosensor constructed in this work achieved highly sensitive and specific determination of FAP. In addition, this strategy can be expanded into a universal protein biomarker detection platform by replacing adapter sequences, which has good prospects for promotion and application. To study the kinetic contributions from the photocleavage process and the CHA cyclic amplification reaction, we will quantify the photocleavage yield of the PC linker under optimized irradiation conditions in future work. To evaluate the potential of FAP as a biomarker for disease, further exploration will be conducted to investigate the correlation between FAP expression levels in patients and the disease severity.

5. Ethical statement

Serum samples were collected from Fujian Medical University Union Hospital (Fuzhou, China) with written informed consent obtained from all participants. All animal procedures were performed in accordance with the Guidelines for Care and Use of Laboratory Animals of Fujian Medical University Union Hospital and approved by the Animal Ethics Committee of Fujian Medical University Union Hospital.

Author contributions

Jiayi Wu, Xingchun Zheng and Jinhua Huang designed research. Jiayi Wu, Xingchun Zheng and En Chen performed the experiments. Jiayi Wu and Xingchun Zheng analyzed the data. All authors wrote and revised the manuscript.

Conflicts of interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgments

This work was supported by the Fujian Provincial Natural Science Foundation (2020J011018).

Data availability

The authors confirm that the data supporting the findings of this study are available within the article.

References

  1. Cuesta-Corral M. Montoro-Garrido A. Romero-Miranda A. Islas F. Ramchandani B. Gredilla R. Fernández-Irigoyen J. Santamaría E. Delgado-Valero B. Jiménez-González S. Rodrigues Díez R. Nieto M. L. Cachofeiro V. Martínez-Martínez E. Mitochondrial Transplantation as a New Therapeutic Approach Against Cardiac and Renal Consequences in Male Rats With Myocardial Infarction. Acta Physiol. 2026;242(6):e70231. doi: 10.1111/apha.70231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Sun Y. Ma M. Cao D. Zheng A. Zhang Y. Su Y. Wang J. Xu Y. Zhou M. Tang Y. Liu Y. Ma T. Fan A. Zhang X. Zhu Q. Qin J. Mo C. Xu Y. Zhang L. Xu D. Yue R. Inhibition of Fap Promotes Cardiac Repair by Stabilizing BNP. Circ. Res. 2023;132(5):586–600. doi: 10.1161/CIRCRESAHA.122.320781. [DOI] [PubMed] [Google Scholar]
  3. Li H. Wei Y. Qin Z. Cheng Q. Hong Y. Ru H. Song T. Li L. Hao X. Jin J. Cheng Y. Wu Z. Li S. 18F-FAPI-74 Positron Emission Tomography/Computed Tomography Noninvasively Monitoring the Fibrosis of Cardiac Allograft Vasculopathy. J. Am. Heart Assoc. 2025;14(19):e041169. doi: 10.1161/JAHA.125.041169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Seru Mula W. Pillay V. Hadebe B. Vorster M. Fibroblast Activation Protein Inhibitor (FAPI)-Based Theranostics. Pharmaceuticals. 2025;18(4):522. doi: 10.3390/ph18040522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Su Y. Liu X. Fu N. Dou L. Zhang Q. Zhao J. Yang Qi. Lu C. Yang M.-Fu. Myocardial fibroblast activation imaging in prediction of cardiac functional improvement of non-ischemic heart failure. IJC Heart Vasc. 2025;60:101752. doi: 10.1016/j.ijcha.2025.101752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Joshi S. Loganath K. Barton A. K. Dweck M. R. Newby D. E. Fibroblast activation protein-specific inhibitor imaging in heart failure. Eur. Heart J. 2023;44(Issue Supplement_2):ehad655.732. doi: 10.1093/eurheartj/ehad655.732. [DOI] [Google Scholar]
  7. Janani M. Poorkhani A. Amiriani T. Donyadideh G. Ahmadi F. Jorjanisorkhankalateh Y. Beheshti-Nia F. Kalaei Z. Roudbaraki M. Soltani M. Khori V. Alizadeh A. M. Association of future cancer metastases with fibroblast activation protein-α: a systematic review and meta-analysis. Front. Oncol. 2024;14:1339050. doi: 10.3389/fonc.2024.1339050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Liu J. Ouyang Y. Xia Z. Mai W. Song H. Zhou F. Shen L. Chen K. Li X. Zhuang S. M. Liao J. FAP is a prognostic marker, but not a viable therapeutic target for clinical translation in HNSCC. Cell. Oncol. 2024;47(2):623–638. doi: 10.1007/s13402-023-00888-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Mohmand-Borkowski A. Conover D. O. Rozmyslowicz T. Fibroblast Activation Protein Compared with Other Markers of Activated Smooth Muscle Cells, Extracellular Matrix Turnover and Inflammation in a Mouse Model of Atherosclerosis. Metabolites. 2025;15(4):243. doi: 10.3390/metabo15040243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Čermáková K. Šimková A. Wichterle F. Kryštůfek R. Staňurová J. Vaníčková Z. Bušek P. Konvalinka J. Šácha P. Sensitive quantification of fibroblast activation protein and high-throughput screening for inhibition by FDA-approved compounds. Eur. J. Med. Chem. 2024;280:116948. doi: 10.1016/j.ejmech.2024.116948. [DOI] [PubMed] [Google Scholar]
  11. Chen Y. Du J. Meng X. Wu L. L. Zhang Q. Han X. Zhang L. Wang Q. Hu H. Y. A self-immobilizing near-infrared fluorogenic probe for in vivo imaging of fibroblast activation protein-α. Talanta. 2024;278:126475. doi: 10.1016/j.talanta.2024.126475. [DOI] [PubMed] [Google Scholar]
  12. Shen Y. Wang Z. Ren T. Wen J. Li J. Tang T. Recent Advances in Microfluidic Impedance Detection: Principle, Design and Applications. Micromachines. 2025;16(6):683. doi: 10.3390/mi16060683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Nguyen J. Zabijak M. Poręba M. Chemical probes for enzyme imaging: challenges in design, synthesis and biomedical applications. Chem. Sci. 2025;16(45):21174–21237. doi: 10.1039/d5sc05683g. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Bilinska A. Ballal S. Bal C. Läppchen T. Pilatis E. Menéndez E. Moon E. S. Martin M. Rösch F. Rominger A. Gourni E. Improved FAPI-radiopharmaceutical pharmacokinetics from the perspectives of a dose escalation study. Eur. J. Nucl. Med. Mol. Imaging. 2025;52(9):3238–3251. doi: 10.1007/s00259-025-07141-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Wang S. Cui X. Zhong Z. Zhang J. Photoactivatable Aptamer-Based Biosensors for Point-of-Care Testing: Advances and Applications. Biosensors. 2025;15(6):336. doi: 10.3390/bios15060336. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Zhang S. Li Q. Cao L. Liu W. Yu J. Jing G. Liu W. Li W. Highly sensitive detection of aflatoxin B1 using a personal glucose meter via nucleic acid cascade amplification and alkaline phosphatase–mediated signal transduction. Sens. Actuators, B. 2026;466:140355. doi: 10.1016/j.snb.2026.140355. [DOI] [Google Scholar]
  17. Wang D. X. Wang J. Wang Y. X. Du Y. C. Huang Y. Tang A. N. Cui Y. X. Kong D. M. DNA nanostructure-based nucleic acid probes: construction and biological applications. Chem. Sci. 2021;12(22):7602–7622. doi: 10.1039/d1sc00587a. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Lyu M. Chan C. H. Chen Z. Liu Y. Yu Y. Advantages, applications, and future directions of invivo aptamer SELEX: A review. Mol. Ther.–Nucleic Acids. 2025;36(3):102575. doi: 10.1016/j.omtn.2025.102575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Wei Q. Huang H. Wang S. Liu F. Xu J. Luo Z. A Novel Fluorescent Aptamer Sensor with DNAzyme Signal Amplification for the Detection of CEA in Blood. Sensors. 2023;23(3):1317. doi: 10.3390/s23031317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Huang L. Zhang Z. Recent Advances in the DNA-Mediated Multi-Mode Analytical Methods for Biological Samples. Biosensors. 2023;13(7):693. doi: 10.3390/bios13070693. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kim T. Y. Kim S. Jung J. H. Woo M. A. Paper-Based Radial Flow Assay Integrated to Portable Isothermal Amplification Chip Platform for Colorimetric Detection of Target DNA. BioChip J. 2023:1–11. doi: 10.1007/s13206-023-00101-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Khan A. Khan H. He N. Li Z. Alyahya H. K. Bin Jardan Y. A. Colorimetric aptasensor coupled with a deep-learning-powered smartphone app for programmed death ligand-1 expressing extracellular vesicles. Front. Immunol. 2025;15:1479403. doi: 10.3389/fimmu.2024.1479403. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Mo L. He W. Li Z. Liang D. Qin R. Mo M. Yang C. Lin W. Recent progress in the development of DNA-based biosensors integrated with hybridization chain reaction or catalytic hairpin assembly. Front. Chem. 2023;11:1134863. doi: 10.3389/fchem.2023.1134863. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Yan T. Weng F. Ming Y. Zhu S. Zhu M. Wang C. Guo C. Zhu K. Luminescence Probes in Bio-Applications: From Principle to Practice. Biosensors. 2024;14(7):333. doi: 10.3390/bios14070333. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Huang Y. Chen Z. Huang H. Ding S. Zhang M. Important applications of DNA nanotechnology combined with CRISPR/Cas systems in biotechnology. RSC Adv. 2025;15(8):6208–6230. doi: 10.1039/d4ra08325c. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Zhao L. Yang S. Xu H. Catalytic hairpin self-assembly for biosensing: Classification, influencing factors, and applications. TrAC, Trends Anal. Chem. 2024;171:117508. doi: 10.1016/j.trac.2023.117508. [DOI] [Google Scholar]
  27. Li D. Xia H. Sun Y. Liu W. Liu W. Yu J. Jing G. Zhang J. Li W. Colorimetric aptasensor for the sensitive detection of ochratoxin A based on a triple cascade amplification strategy. Anal. Chim. Acta. 2023;1237:340616. doi: 10.1016/j.aca.2022.340616. [DOI] [PubMed] [Google Scholar]
  28. Gao Y.-P. Huang C. Bai X. Huang K.-J. DNAzyme-mediated CHA-HCR cascade amplification enabling dual-mode electrochemical/colorimetric sensing of ultra-trace lead ions with smartphone readout. Biosens. Bioelectron. 2026;312:119052. doi: 10.1016/j.bios.2026.119052. [DOI] [PubMed] [Google Scholar]
  29. Gao Y.-P. Sun Q. Li B. Li Y. Zeng M. Zhang S. Huang K.-J. Li G. "Dual-signal-on" integrated biosensor for portable miRNA detection: electrochemical and colorimetric strategies induced by multi-mode assembly. Microchem. J. 2025;217:115108. doi: 10.1016/j.microc.2025.115108. [DOI] [Google Scholar]
  30. Gao Y.-P. Huang K.-J. Hou Y.-Y. Wang B.-Y. Xu Q. Shuai H. Xu J. Li G. Nitrogen-doped dodecahedral hollow carbon combined with amplification strategy to construct ultra-sensitive self-powered biosensor for highly stable and real-time monitoring microRNA. Sens. Actuators, B. 2023;387:133816. doi: 10.1016/j.snb.2023.133816. [DOI] [Google Scholar]
  31. Gao Y.-P. Huang K.-J. Wang B.-Y. Xu Q. Shuai H. Li G. Constructed a self-powered sensing platform based on nitrogen-doped hollow carbon nanospheres for ultra-sensitive detection and real-time tracking of double markers. Anal. Chim. Acta. 2023;1267:341333. doi: 10.1016/j.aca.2023.341333. [DOI] [PubMed] [Google Scholar]
  32. Gao Y.-P. Huang K.-J. Wang F.-T. Hou Y.-Y. Zhao L.-D. Wang B.-Y. Xu J. Shuai H. Li G. The self-powered electrochemical biosensing platform with multi-amplification strategy for ultrasensitive detection of microRNA-155. Anal. Chim. Acta. 2023;1239:340702. doi: 10.1016/j.aca.2023.340702. [DOI] [PubMed] [Google Scholar]
  33. Gao C. Zheng P. Liu Q. Han S. Li D. Luo S. Temple H. Xing C. Wang J. Wei Y. Jiang T. Chen W. Recent Advances of Upconversion Nanomaterials in the Biological Field. Nanomaterials. 2021;11(10):2474. doi: 10.3390/nano11102474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Chen W. Cao D. Luminescence Nanomaterials and Applications. Nanomaterials. 2023;13(6):1047. doi: 10.3390/nano13061047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Liu D. Zhu W. Qiu B. Zhang S. An NIR-driven biosensor based on the metal-enhanced fluorescence effect and a signal amplification strategy for miRNA detection. RSC Adv. 2024;14(54):39908–39920. doi: 10.1039/d4ra07080a. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Madirov E. Catros C. Hildebrandt N. Grazon C. Inter-Nanoparticle FRET for Biosensing: Photophysics Versus Size. Angew. Chem., Int. Ed. 2025;64(39):e202510801. doi: 10.1002/anie.202510801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Zhang Y. Wang X. Liu Y. Jia Z. Yang Z. Huang X. Wang J. Upconversion Nanoparticle-Based Luminescence DNA Sensor on Porous Silicon Substrate. Biosensors. 2026;16(2):105. doi: 10.3390/bios16020105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Li Z. Xu J. Chan Li. Shen J. Peng Bo. A FAP-α-activatable near-infrared theranostic probe for fluorescence imaging of pancreatic cancer and potent in vitro photodynamic activity. Bioorg. Chem. 2026;168:109326. doi: 10.1016/j.bioorg.2025.109326. [DOI] [PubMed] [Google Scholar]
  39. Xie C. Wu J. J. Feng Y. Ren T. B. Yuan L. Huan S. Y. Zhang X. B. FAPα-Activated NIR-I Fluorescent Probe with Improved Water Solubility for Tumor Imaging. Anal. Chem. 2026;98(6):4940–4949. doi: 10.1021/acs.analchem.5c07190. [DOI] [PubMed] [Google Scholar]
  40. Feng Y. Xie C. Ren T. B. Xu S. Huang S. Liu S. L. Yuan L. Huan S. Y. Zhang X. B. A General Strategy to Develop Highly Sensitive FAPα Fluorescent Probes for Invasive Cancer Detection. Angew. Chem., Int. Ed. 2025;64(41):e202512588. doi: 10.1002/anie.202512588. [DOI] [PubMed] [Google Scholar]
  41. Xu J. Li Y. Li Z. Shen J. Peng B. A Near-Infrared Off-On Fluorescent Probe for Sensitive and Specific Imaging of Fibroblast Activation Protein-α Activity in Pancreatic Cancer. Luminescence. 2026;41(3):e70430. doi: 10.1002/bio.70430. [DOI] [PubMed] [Google Scholar]
  42. Ling X. Huang Z. Wen Y. An Y. Zhuo W. Chen X. Ding N. Yu C. Wei J. Biotin-guided NIR fluorescent probe for in situ imaging of fibroblast activation protein in human breast cancer tissues. Sens. Actuators, B. 2026;448(Part 2):138970. doi: 10.1016/j.snb.2025.138970. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The authors confirm that the data supporting the findings of this study are available within the article.


Articles from Nanoscale Advances are provided here courtesy of Royal Society of Chemistry

RESOURCES