Skip to main content
NCBI home page
Human Reproduction (Oxford, England) logoLink to Human Reproduction (Oxford, England)
. 2026 Aug 31;41(10):1633–1642. doi: 10.1093/humrep/deag130

A Western-style diet exacerbates male infertility in M1ap knockout mice

Brendan J Houston 1,✉, Joseph Nguyen 2, Nadja Rotte 3, Frank Tüttelmann 4, Corinna Friedrich 5, D Jo Merriner 6, Anne E O’Connor 7, Moira K O’Bryan 8,b, Jessica E M Dunleavy 9,b
PMCID: PMC13635463  PMID: 42671480

Abstract

STUDY QUESTION

What are the individual and combined effects of a common genetic cause of human male infertility (loss of M1AP function) and a negative lifestyle factor (a Western diet) on male fertility, spermatogenesis, and sperm quality in mice?

SUMMARY ANSWER

The loss of M1AP and a Western diet separately led to subfertility (a form infertility) in male mice and in combination subfertility was worsened.

WHAT IS KNOWN ALREADY

Genetics and lifestyle factors individually play important roles in male infertility aetiology. How lifestyle factors influence common genetic causes of infertility are unknown.

STUDY DESIGN, SIZE, DURATION

We generated knockout M1ap mice (M1ap−/−-) and investigated the effects of genotype (wild type or knockout) and diet (control or Western diet) or genotype and age (young or aged) on male fertility and sperm parameters.

PARTICIPANTS/MATERIALS, SETTINGS, METHODS

C57BL6/J mice: wild type (M1ap+/+) and M1ap knockout (M1ap−/−) at 10–12 (young) weeks or 26–28 weeks old (aged), on a control of Western (high-fat and high-sugar) diet and age. We evaluated male fertility, testis and epididymis histology, and sperm quality (motility, morphology, and count).

MAIN RESULTS AND THE ROLE OF CHANCE

Compared to the individual gene deletion or diet treatments, the combined M1ap−/− and Western diet group had more abnormal germ cells, sloughed germ cells and resulted in fewer pups per litter. In accordance, sperm motility and morphology in the combination group were more significantly compromised compared to individual experimental groups.

LARGE SCALE DATA

N/A.

LIMITATIONS, REASONS FOR CAUTION

While the mutant mouse mimics the genetic variants seen in many infertile men, this is a mouse model study, meaning findings should be validated in a human cohort where possible.

WIDER IMPLICATIONS OF THE FINDINGS

Taken together, our data highlight that genetic and lifestyle factors can interact to exacerbate male infertility. This study sets a precedent for an improved consideration of how genetic, lifestyle and environmental factors contribute to infertility aetiology. These data inform a clinical foundation for lifestyle interventions for men presenting at infertility clinics prior to medically assisted reproduction.

FUNDING

This project was supported by a Society for Reproductive Biology Career Development Award to B.J.H., National Health and Medical Research Council project grant (APP1120356) awarded to M.K.O.B., an Australia–Germany Joint Research Co-operation Scheme (UA-DAAD) grant (57511796) awarded to M.K.O.B., J.E.M.D., and F.T., and the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation) within the Clinical Research Unit ‘Male Germ Cells’ (CRU326, project number 329621271) awarded to F.T. and C.F.

DISCLOSURES

N/A.

Keywords: M1AP, male infertility, genetic variants, Western diet, sperm quality

Introduction

Male infertility is a common, highly heterogeneous disease that impacts at least 7% of men worldwide (Krausz and Riera-Escamilla, 2018). As predicted by the many thousands of genes expressed in the testis, including many that are enriched in expression compared to other tissues, male infertility has a strong genetic component (Schultz et al., 2003; Djureinovic et al., 2014; Fagerberg et al., 2014; Uhlen et al., 2015; Wyrwoll et al., 2020; Houston et al., 2021a, 2024b; Nagirnaja et al., 2022; Oud et al., 2022). Compelling data indicate that lifestyle and environmental exposures also play an important role in shaping the environment within which sperm are formed, and thus male fertility (Durairajanayagam, 2018; Houston et al., 2018a; Kimmins et al., 2024). Known risk factors include exposure to a variety of endocrine disrupting chemicals, pesticides, excessive heat, radiation, select medicines, a poor diet, and other gonadotoxic compounds, with numerous reports of their negative effects on sperm quality (Houston et al., 2016, 2018b; Skakkebæk et al., 2022; Kolaitis et al., 2023; Kimmins et al., 2024; Gillespie et al., 2025). Such environmental and lifestyle factors are predicted to be key drivers of declining sperm counts that have been observed worldwide (Levine et al., 2017, 2023; Kimmins et al., 2024). While genetic and lifestyle factors are each considered to play key roles in the causality of male fertility, how such factors interact remains poorly understood and could have significant impact on infertility aetiology (Houston et al., 2021a, b).

To better understand male infertility holistically, it is essential to understand the overlapping contributions of genetic and lifestyle factors. This includes investigating the consequence of genetic causes of male fertility that may cause subfertility, which could be compounded by lifestyle exposures, i.e. a two-hit scenario (Guma et al., 2023; Chen et al., 2025).

In recent years, there has been a notable emphasis on defining the genetic causes of male infertility (Oud et al., 2020, 2021, 2022; Houston et al., 2021c; Nagirnaja et al., 2022). Meanwhile, a significant portion of the genetic causes of human male infertility, or subfertility, likely remain unidentified (Houston et al., 2021c; Nagirnaja et al., 2022). Compelling studies have revealed damaging bi-allelic genetic variants in M1AP as relatively frequently associated with human male infertility (Wyrwoll et al., 2020; Rotte et al., 2025). M1AP encodes meiosis 1 associated protein that promotes recruitment of TEX11 to the ZZS complex and aids in DNA recombination during prophase I of meiosis (De Muyt et al., 2018; Li et al., 2023; Rotte et al., 2025). Of those men suffering from infertility with damaging M1AP variants that have been studied, 65% present with non-obstructive azoospermia due to meiotic arrest (Wyrwoll et al., 2020; Rotte et al., 2025). The remaining 35% of infertile men present with varying degrees of severe oligozoospermia (cryptozoospermia). This variability in genotype–phenotype relationship suggests that the effects of the loss of M1AP function during meiosis may be exacerbated by lifestyle factors, or equally, could be improved by the removal of negative environmental insults. This hypothesis is supported by the phenotype of M1ap knockout mice, which present with oligozoospermia due to meiotic defects and are subfertile (Arango et al., 2013).

Of global relevance, obesity is prevalent in men of reproductive age (Welfare AIoHa, 2022; NIH, 2026) and is often caused by poor diet. As such, in this study, we aimed to explore the potential for an interaction between genetic and lifestyle factors on male infertility, using a subfertile M1ap−/− mouse model and an unhealthy Western-style high-fat and high-sugar diet. An additional cohort of mice was also aged on a standard (control) diet to explore the compounding effects of age and genotype on fertility. Our data reveal that a high-fat and high-sugar Western diet exacerbates subfertility in a M1ap−/− mouse model. Notably, for several parameters, a negative impact of Western diet was observed in the M1ap−/− mouse model but not in M1ap+/+, providing strong evidence for an interaction between genetic and lifestyle factors in male infertility aetiology that could be of relevance for human reproduction. Our proof-of-concept study highlights the complex factors affecting male fertility and supports a push towards a more holistic understanding of the causes of infertility, for improved treatment.

Materials and methods

Ethics statement

All experiments involving mice adhered to ethics guidelines published by the Australian National Health and Medical Research Council (NHMRC). Mouse experiments were approved by the University of Melbourne Animal Ethics Committee (applications 30244 and 32004). Mice were housed in standard conditions, at 22°C on a 14-h light cycle and 50–60% humidity, with standard environmental enrichment.

M1AP expression analysis

Tissue expression data for M1AP and M1ap were collected from NCBI (Fagerberg et al., 2014; Yue et al., 2014).

Knockout mouse production

Knockout mice were generated on a C57BL/6J background at the Monash Genome Modification Platform (Clayton, VIC, Australia). A sequence of 1517 bp, containing exon 4 and flanking intronic regions, was removed using CRISPR/Cas9 technology. To do so, the full length M1ap mouse transcript (ENSMUST00000113980.4) was targeted using CRISPR guide RNA sequences: ACGCAGTGTACATGCATGAG and CCGTCACATTTACGCTGCAT. Gene sequence changes were identified with Sanger sequencing. Mice heterozygous for the deletion were inter-crossed to produce homozygous individuals and wild type (M1ap+/+) controls. Genotyping was performed by Transnetyx (Corvoda, USA) using proprietary primers. M1ap transcript level was assessed via quantitative RT-PCR on testis cDNA relative to Hprt and Ppia (O’Bryan et al., 2025). M1ap primers in the deleted region included 5′-GGAGCGTTCAGACTCACCAT-3′ forward and 5′-GATGATCCTTGGCTCTGGAA-3′ reverse. M1ap primers upstream of the deleted region included 5′-GTGAGGCCTTGCAGAACTTC-3′ forward and 5′-AGTTCCCTCTCACTTGCACA-3′ reverse. Hprt primers included 5′-AGTCCCAGCGTCGTGATTAG-3′ forward and 5′-TTTCCAAATCCTCGGCATAA-3′ reverse. Ppia primers included 5′-CGTCTCCTTCGAGCTGTTT-3′ forward and 5′-CCCTGGCACATGAATCCT-3′ reverse.

Western diet and age treatment

To test the effects of poor diet on male fertility in wild type and M1ap mutant males, mice were fed ad libitum on a Western-style diet of 21% fat, 34.1% sugar, 19% protein (SF00-219, Specialty Feeds, Glen Forrest, WA, Australia), which has been shown to increase mouse body, liver, and subcutaneous fat weight compared to a standard, lower calorie diet of 7% fat, 10% sugar (Bodden et al., 2022). In our study, control mice of both genotypes (M1ap+/+ and M1ap−/−) were fed on BARASTOC mice breeder cube feed—8.5% fat, 25% starch, 20% protein (Ridley Corporation, Melbourne, VIC, Australia). Mice were fed on the specific diet from weaning until fertility assessment or dissection, as detailed below.

A separate cohort of mice were phenotyped at 26 weeks of age to separately investigate the combined effects of age and M1ap loss on male fertility. These mice were reared on the standard BARASTOC diet post-weaning.

Fertility analysis

Mice were aged to 10 weeks of age (young cohort) or 26 weeks of age (aged cohort) and their fertility assessed using an established pipeline (Houston et al., 2021a), with timing outlined in Fig. 1C. Briefly, at least 5 male mice of each genotype and treatment were set up to mate with two wild-type females each (6–12 weeks old). At least three males were used for aged breeding analyses. During the overnight mating period (until two females were successfully mated), males were co-housed with females and fed on the control diet, then placed back on their respective diets during the morning to afternoon period. Litter sizes were recorded as the number of pups generated per plug, where zero denotes a successful plug but no offspring. At 12 (young) or 28 (aged) weeks of age, males were culled and weighed. One testis and epididymis were dissected, weighed, and fixed in Bouin’s solution for 5 h then submerged in 70% ethanol until processing for histological assessment (Houston et al., 2021a). Remaining testes and epididymides were snap frozen on dry ice for calculation of daily sperm production and epididymal sperm counts using the Triton-X-100 solubilization and sonication method as described previously (Dunleavy et al., 2021). Gonadal fat pads were also weighed and fixed in Bouin’s solution for 5 h before histological processing as above, then stained with haematoxylin and eosin. Images were taken and adipocyte size (n ≥ 20 cells/animal) was measured using ImageJ (Bodden et al., 2022). Liver and seminal vesicle weights were recorded.

Figure 1.

Diagrams of the gene map for mouse M1ap and experimental workflow used in this study.

Open in a new tab

M1ap knockout design and experimental strategy. (A) M1AP/M1ap expression in human and mouse tissues as highlighted by RNA sequencing. (B) Mouse M1ap gene map, noting exons 1–10. Grey arrows denote CRISPR cut sites for removal of exon 4. (C) Timeline for mouse experiments. Mice were weaned onto a control or Western diet and aged to 10 weeks before mating followed by dissection at 12 weeks of age. Mice on a control diet were also aged to ∼26 weeks before mating and dissection. (D) Testis M1ap expression was assessed in each genotype relative to Hprt and Ppia and then normalized to wild type (M1ap+/+) levels. White circles denote wild-type males (M1ap+/+) and black circles denote M1ap knockout males (M1ap−/−). **P < 0.01, ***P < 0.001.

For histological analyses, 5 µm tissue sections were cut. Testis sections were stained with periodic acid and Schiff’s reagents and haematoxylin. Epididymis sections were stained with haematoxylin and eosin. Round spermatid numbers were counted in Stage VIII seminiferous tubules (n ≥ 10 tubules/animal, n ≥ 3/genotype) (Houston et al., 2022b). Germ cell apoptosis was assessed by dual staining testis sections with cleaved-Caspase 3 and cleaved-Caspase 7 as detailed previously (Dunleavy et al., 2023). The number of positive cells was counted per seminiferous tubule (n = 50/animal, n = 3–4/genotype). Data are presented as the average number of positive cells per tubule per biological replicate (per mouse), but each data point per mouse was used for statistical analysis using a zero-inflated negative binomial regression (zinb package) in RStudio (2025.09.2 Build 418, USA). The number of positive cells was fit into the model as a response variable. Genotype and diet and their interaction were assigned as fixed effects and animal identifier as a random effect.

Sperm motility and morphology analysis

Sperm were collected from the cauda epididymis via retrograde air perfusion of the vas deferens using the backflushing technique (Houston et al., 2021b). Sperm were resuspended in MT6 medium at 37°C for 10 min prior to motility assessment via computer-assisted semen analysis (Houston et al., 2021b). Remaining sperm were washed and diluted in 1 × PBS then dried onto SuperFrost slides (Epredia, USA). Sperm were fixed in 90% ethanol for 2 min, washed in water and stained with Mayer’s haematoxylin for 10 min, Scott’s tap water substitute for 2 min and eosin (Amber Scientific, Australia) for 1 min to investigate sperm structure. Sperm mid-piece and full tail length measurements were measured using ImageJ (version 1.52k, USA). Sperm head shape normality was assessed manually as a binary normal or abnormal (Houston et al., 2024a), noting no abnormalities in sperm tail development were observed.

Statistical analysis

Statistical analyses were performed in Prism 10 (GraphPad, San Diego, USA) or RStudio (described above). A two-way ANOVA was undertaken to determine the effects of genotype, diet or an interaction between both factors, on each biological parameter. A post hoc Dunnett’s multiple comparison was used to compare genotypes on the same diet or between the same genotype on a different diet. When comparing between two genotypes alone, data were assessed via an unpaired Student’s t-test. A P-value <0.05 was considered statistically significant.

Results

Establishment of experimental models

In this study, we aimed to explore the combined impacts of a genetic and a lifestyle factor on male fertility using a subfertile M1ap−/− mouse model. M1AP expression is highly testis-enriched in adult humans and mice (Fig. 1A) and M1AP has an established role in male meiosis (Arango et al., 2013). To generate our loss of function M1ap model, we used CRISPR to remove exon 4 of the full length M1ap coding transcript, introducing a premature stop codon in exon 5 (Fig. 1B). The M1ap deletion was confirmed by Sanger sequencing and by quantitative RT-PCR using primers targeting exon 4 (Fig. 1D, P < 0.001). Primers targeting exon 2 (upstream of the deletion) revealed M1ap expression was reduced by 86% in the knockout model (Fig. 1D, P < 0.01), where any residual transcripts would have little to no protein function. These data reveal our M1ap mouse model recapitulates the biological situation of men containing damaging M1AP genetic variants. M1ap+/+ (wild type) and M1ap−/− (knockout) mice were then fed on a control or Western diet prior to mating at 10 weeks of age, followed by dissection at 12 weeks of age (Fig. 1C).

We first sought to assess the effect of Western diet treatment on body weight and fat mass in male M1ap+/+ mice (Supplementary Fig. S1). Exposure to a Western diet led to a significant increase in body weight (33.12 in Western versus 28.9 g in control, P = 0.0002), gonadal fat pad weight (566.2 versus 249.7 mg, P < 0.0001) and adipocyte size (5135 versus 2982 µm2, P < 0.0001), and liver weight (1.85 versus 1.41 g, P = 0.0027). These data replicate a previous study (Bodden et al., 2022).

Male fertility is impacted by both the loss of M1AP and a Western diet

The loss of M1ap in male mice on a control diet resulted in subfertility (Fig. 2A, Supplementary Fig. S2A), highlighted by a 70% reduction in litter size (2.5 pups/litter) compared to M1ap+/+ males (8.25 pups/litter, P < 0.0001). Notably, the loss of M1ap also resulted in a 50% reduction in pregnancy rate per copulatory plug (Fig. 2B). Equally, male fertility was negatively impacted in M1ap+/+ mice fed a Western diet (Fig. 2A). Specifically, M1ap+/+ males on a Western diet produced litters sizes on average 37% smaller than those on a control diet (5.2 pups/litter in Western diet versus 8.25 in control, P = 0.015) but no effects on pregnancy rate were observed (Fig. 2B). Notably, the combined effect of M1ap loss and a Western diet further exacerbated subfertility in M1ap−/− males (Fig. 2A). While M1ap−/− males on a control diet produced 2.5 pups/litter, those exposed to a Western diet produced an average litter size of 0.37 pups/litter (P = 0.015). This equates to a 98% reduction in litter size compared to M1ap+/+ males raised on a control diet. Similarly, when M1ap−/− males were fed on a Western diet, pregnancy rate was reduced by 82% compared to M1ap+/+ males on a control diet. These data support a negative interaction between M1ap loss and diet on male fertility.

Figure 2.

Graphs and data on the effects of M1ap loss and Western diet treatment on reproductive organ parameters and body rate in mice.

Open in a new tab

M1AP and diet modulate optimal male fertility in mice. (A) Litter size measured following plug mating, where 0 denotes no pregnancy. (B) Pregnancy rate as a percentage of all successful mating attempts where the female became pregnant. (C) Body weight. (D) Testis weight. (E) Epididymis weight. White circles denote wild type males (M1ap+/+) and black circles denote M1ap knockout males (M1ap−/−). Abbreviations: CD = control diet; WD = Western diet. ****P < 0.0001, ***P < 0.001, *P < 0.05.

At a whole animal level, the deletion of M1ap did not impact body weight compared to M1ap+/+ males (Fig. 2C, P = 0.95). The Western diet increased body weight in M1ap+/+ males by 15% compared to control animals (P < 0.0001). A similar increase in body weight was measured in M1ap−/− males on a Western diet compared to those on a control diet (P = 0.01), highlighting that diet but not the presence of M1AP modulates body weight. As reported previously (Arango et al., 2013), the absence of M1ap resulted in a substantial reduction in testis weight compared to M1ap+/+ males (Fig. 2D, P < 0.0001). Aligning with this reduction in testis weight, epididymis weight was significantly reduced in M1ap−/− males on a control diet (Fig. 2E, P < 0.0001). Testis and epididymis weights were not significantly changed by exposure to a Western diet in M1ap+/+ males (Fig. 2D and E). While testis weights of M1ap−/− males fed a Western diet were significantly reduced compared to M1ap+/+ males of both diet groups (P < 0.0001), they were 15% heavier than M1ap−/− males fed a control diet (Fig. 2D, P = 0.0008).

A separate cohort of M1ap+/+ and M1ap−/− males was aged to 26 weeks on a control diet before mating and dissection (Supplementary Fig. S2). Consistent with previous studies (Hu et al., 2018; Houston et al., 2022a,b; O’Bryan et al., 2025), ageing mice did not significantly impact the fertility of M1ap+/+ males. Litter sizes (P = 0.12, Supplementary Fig. S2B and C), and testis (P = 0.99, Supplementary Fig. S2D) weight were comparable to young M1ap+/+ males, while epididymis weight was moderately increased (P = 0.049, Supplementary Fig. S2E). Examination of aged M1ap males, revealed that age did not exacerbate the M1ap-/- phenotype. M1ap-/- males were subfertile and produced litter sizes comparable to young M1ap-/- males (4.8 pups/litter in aged M1ap−/− versus 2.5 in young, Supplementary Fig. S2C), P = 0.17 (comparison not graphed). As was seen in younger animals, the testis weights of aged M1ap−/− males was significantly reduced compared to aged-matched controls. Weights were comparable to those of young M1ap−/− males (P = 0.77, Supplementary Fig. S2B). Epididymis weights in aged M1ap−/− males were similarly reduced compared to aged M1ap+/+ controls. Like as was observed for aged M1ap+/+ males, epididymis weight in M1ap−/− males increased compared to young M1ap−/− males (P = 0.01, Supplementary Fig. S2C). Collectively, these results highlighted that diet but not age plays a significant role in the severity of infertility in M1ap−/− males.

M1AP is required for meiosis and quantitatively normal sperm production

We next investigated spermatogenesis in young M1ap+/+ and M1ap−/− males fed a Western and control diet (Fig. 3, Supplementary Fig. S3A and B). In M1ap+/+ mice fed on a control diet, sperm production was complete and robust (Fig. 3A, Supplementary Fig. S3A). By contrast, a severe hypospermatogenesis phenotype (H) was observed in males lacking M1ap (Fig. 3A), characterized by defects in spermatocytes undergoing meiosis (arrows), consistent with previous findings (Arango et al., 2013). Defects in M1ap−/− control diet males included germ cell death (Supplementary Fig. S3B and E, notably in developmentally arrested metaphase spermatocytes), sperm head shaping abnormalities (Supplementary Fig. S3F), vacuoles in the seminiferous epithelium (Supplementary Fig. S3G), and germ cell sloughing (Supplementary Fig. S3H). While spermatogenesis was largely normal in M1ap+/+ males fed a Western diet, there was an increased frequency of pyknotic (dying) germ cells that were frequently present near the lumen of tubules (Fig. 3A inset, arrows, Supplementary Fig. S3C). M1ap−/− males fed a Western diet presented with similar defects to those on a control diet. Meiosis abnormalities (arrows) including germ cell sloughing and epithelial vacuolation, leading to hypospermatogenesis, were notably observed (Supplementary Fig. S3D). We quantified the frequency of these defects across tubules in each treatment group (Fig. 3B–D). Germ cells with abnormal morphology (abnormal chromatin structure) were observed 210% more frequently in M1ap−/− males compared to M1ap+/+ on a control diet (Fig. 3B, P < 0.0001). Abnormal germ cells were also detected in M1ap+/+ males fed on a Western diet, which were 183% more common than in M1ap+/+ males on a control diet (P < 0.0001). Feeding M1ap−/− males a Western diet exacerbated the frequency of abnormal germ cells by 25% compared to control diet-fed M1ap−/− males (Fig. 3B, P = 0.0031) and 37% compared to M1ap+/+ males on a Western diet. A similar finding was observed for germ cell sloughing (Fig. 3C), which was elevated by 189% in M1ap−/− males compared to M1ap+/+ (P = 0.017) on a control diet. A Western diet increased germ cell sloughing in M1ap+/+ males, which was elevated by 181% compared those on a control diet (P = 0.021). Sloughing was also exacerbated in the combination group, where feeding M1ap−/− males a Western diet increased sloughing by 127% compared to M1ap−/− males on a control diet (P = 0.0003) and 133% compared to M1ap+/+ males on a Western diet (P = 0.0002). The presence of vacuoles in the seminiferous epithelium was elevated in M1ap−/− males fed on a control diet (P = 0.034, Fig. 3D) but not M1ap+/+ males fed a Western diet. Feeding M1ap−/− males a Western diet further elevated the frequency of vacuoles (P = 0.0008, Fig. 3D) compared to M1ap−/− on a control diet, thus worsening the hypospermatogenesis phenotype. These findings were further evidenced by a 554% elevation in apoptotic germ cells in M1ap−/− males fed a control diet, compared to M1ap+/+ males (Fig. 3E, P < 0.0001). While feeding M1ap+/+ males a Western diet increased germ cell apoptosis by 98% (P = 0.011), the diet challenge did not exacerbate germ cell apoptosis in M1ap−/− males fed a Western diet compared to M1ap−/− males on the control diet (P = 0.99). These findings highlight that exposure to a Western diet will exacerbate the presence of abnormal germ cells, sloughing and vacuoles in the presence of M1ap−/− loss-of-function.

Figure 3.

Images and data on the effects of M1ap loss and Western diet treatment on testis function in mice.

Open in a new tab

A Western diet exacerbates the presence of abnormal germ cells in the testis of M1ap−/− males. (A) Testis histology. Orange arrows indicate dying spermatocytes, orange Hs indicate hypospermatogenic tubules. Inset: black arrows indicate abnormal dying cells. Scale bars = 50 µm. (B–D) The percentage of tubules in which abnormal cells, sloughed cells, or vacuoles, respectively. (E) Caspase positive cells per tubule. (F–H) Stage VIII tubule size, lumen size, and round spermatid count, respectively. (I) Daily sperm production. (J) Epididymal sperm count. White circles denote wild-type males (M1ap+/+) and black circles denote M1ap knockout males (M1ap−/−). Abbreviations: CD = control diet; WD = Western diet. ****P < 0.0001, ***P < 0.001, **P < 0.01, *P < 0.05.

In agreement with the germ cell loss in young M1ap−/− testes, testis tubule area was reduced by 35% compared to M1ap+/+ males in the control diet treatment group (Fig. 3F, P < 0.001). The Western diet did not affect tubule area size in M1ap+/+ males (P = 0.70). Notably, tubule size in M1ap−/− males fed a Western diet was 23% smaller than M1ap+/+ males (P < 0.0001), but 22% larger than M1ap−/− males on a control diet (P = 0.003). This increase in tubule area in the combination group compared to M1ap−/− control diet males is consistent with the elevated testis weight data above (Fig. 2D). The cause for this elevation was found to be an 89% increase in lumen size in M1ap−/− males fed a Western versus control diet (P = 0.017, Fig. 3G), suggestive of fluid retention due to abnormal efferent duct function (Eddy et al., 1996; Oh et al., 2023). While all M1ap−/− western diet mice displayed elevated lumen size compared to M1ap−/− males on a control diet, one male had seminiferous tubule lumen area that was twice the area of M1ap+/+ males (Fig. 3G—arrow, Supplementary Fig. S4). Compared to M1ap+/+ males, very few sperm were apparent within the cauda epididymis of this male (Supplementary Fig. S4E and F). Deletion of M1ap significantly reduced round spermatid numbers compared to M1ap+/+ males in both diet groups (P < 0.0001, Fig. 3H). Numbers were unchanged in M1ap+/+ fed a Western diet compared to control diet, and the Western diet did not worsen the reduction in round spermatids in the M1ap−/− model compared to the control diet. This pattern was mirrored in daily sperm production (Fig. 3I) and epididymal sperm counts (Fig. 3J), which were significantly reduced in M1ap−/− males fed on a control diet compared to M1ap+/+ males on a control diet (P < 0.0001) but not affected in M1ap+/+ males on a Western diet. Exposure to a Western diet did not further exacerbate the reductions in daily sperm production (P = 0.61) or epididymal sperm count (P = 0.42) observed in M1ap−/− males.

In M1ap+/+ males on a control diet, the epididymis was replete with sperm and sloughed germ cells were not detected (Fig. 4A). Consistent with findings in the testis, fewer sperm were present in the epididymis of M1ap−/− males on a control diet and immature sloughed germ cells were frequently observed, at a higher rate than in M1ap+/+ males on a control diet (Fig. 4B; P < 0.0001). No noticeable effects of a Western diet were observed on epididymis histology in M1ap+/+ males (Fig. 4A). However, the Western diet exacerbated the frequency of abnormal immature sloughed germ cells in the epididymides of M1ap−/− males (Fig. 4B; P = 0.0027).

Figure 4.

Images and data on the effects of M1ap loss and Western diet treatment on epididmymis and sperm function in mice.

Open in a new tab

A Western diet worsens deficits in progressive motility and sperm head morphology observed in M1ap−/− males. (A) Cauda epididymis histology. Arrows indicate premature and abnormal germ cells in M1ap−/− males. Scale bars = 50 µm. (B) Quantification of immature germ cells in the epididymis. (C) Sperm morphology. (D) Sperm motility. (E) Sperm progressive motility. (F) Sperm curvilinear velocity; each measured by computer-assisted semen analysis. (G) The percentage of sperm with normal head shape. (H) Sperm tail length. White circles denote wild-type males (M1ap+/+) and black circles denote M1ap knockout males (M1ap−/−). Abbreviations: CD = control diet; WD = Western diet. ****P < 0.0001, **P < 0.01, *P < 0.05.

We next explored the effects of a gene and diet interaction on sperm quality. This analysis revealed striking abnormalities in sperm head shape in sperm from M1ap−/− males compared to M1ap+/+ males on a control diet (Fig. 4C and G). Specifically, 52% of sperm from M1ap−/− males were normally shaped, compared to 94% in M1ap+/+ on a control diet (P < 0.0001). In M1ap+/+ males, the incidence of sperm morphological abnormalities was unaffected by exposure to a Western diet (P = 0.92). By contrast, the negative impact of M1ap loss on sperm morphology was significantly exacerbated by a Western diet (Fig. 4C and G), where only 36% of sperm were normally shaped (P < 0.0001 compared to all other groups). Further, the loss of M1ap−/− significantly reduced total sperm motility compared to M1ap+/+ males on a control diet (Fig. 4D, P = 0.026). No effects of a Western diet on total sperm motility were, however, seen in M1ap+/+ males (P = 0.79), nor did the Western diet worsen motility in M1ap−/− males (P = 0.85) compared to M1ap−/− males on the control diet. By contrast, progressive motility (Fig. 4E) was significantly reduced in M1ap−/− males on a control diet compared to M1ap+/+ males (46% versus 59%, P = 0.001). While the Western diet had no effect on progressive motility in M1ap+/+ males (P = 0.62), it worsened progressive motility in M1ap−/− males compared to those fed a control diet (38% versus 46%, P = 0.007). Finally, the loss of M1ap impaired curvilinear velocity (VCL) by 15% compared to M1ap+/+ males (Fig. 4F, P = 0.003). No effects of the Western diet treatment on VCL were observed in M1ap+/+ (P = 0.42) or M1ap−/− males (P = 0.49). Sperm tail length was unaffected by genotype and diet treatment (Fig. 4H). Together, these data evidence the existence of genotype and environment interactions influencing key sperm parameters required for male fertility.

Discussion

In this study, we aimed to test the individual and combined effects of a genetic and lifestyle factor in the severity of male infertility, as a proof-of-concept for genetic and lifestyle/environmental interactions more broadly. We used a M1ap loss of function mouse model, as damaging variants in M1AP have been relatively commonly associated with human male infertility (Wyrwoll et al., 2020; Khan et al., 2025; Rotte et al., 2025). The genetic manipulation of M1ap in our mouse reflects the damaging effects of loss-of-function variants discovered in these men. There is also evidence of a spectrum of severity in infertility presentation in such men, suggestive of an additional component to their infertility aetiology. While in wild type (control) male mice a Western diet alone did not significantly compromise sperm parameters, including total motility, morphology and count in this study, it did compromise male fertility compared to controls as evidenced by a reduced litter size. Exposure to a Western diet exacerbated several genetically induced abnormalities in the M1ap−/− model, including the incidence of germ cell death and abnormal germ cell morphology, immature germ cells within the epididymis and sperm progressive motility. Collectively, these data demonstrate that genetic factors and environmental exposures can interact to negatively impact male fertility. Specifically, in the absence of M1ap function, exposure to a Western diet pushes sperm number and function significantly further below the fertility threshold, specifically 0.37 pups/litter compared to 2.5 on a control diet. The revelation of this interaction provides weight to exploring dietary interventions for men carrying damaging M1AP variants who present for fertility assessment, prior to more invasive medically assisted reproduction interventions.

M1AP functions during meiosis and contributes to DNA recombination by stabilizing ZZS complex intermediates (Li et al., 2023). In its absence, as shown here and previously (Arango et al., 2013), a significant portion of spermatocytes arrest at metaphase. While substantial germ cell arrest occurs in humans and mice lacking M1AP (Arango et al., 2013; Wyrwoll et al., 2020; Rotte et al., 2025), it is not absolutely essential for male fertility, as indicated by subfertility in knockout mice and a spectrum of clinical presentations in infertile men (Arango et al., 2013; Wyrwoll et al., 2020; Khan et al., 2025; Rotte et al., 2025). There also may be fertile men with variants in M1AP who have not been considered due to selection bias but are potentially susceptible to certain environmental factors, which could be explored in future studies. Further, an unhealthy lifestyle may also worsen spermatogenesis in men with bi-allelic loss-of-function M1AP variants, leading to non-obstructive azoospermia. Collectively, while our study adds strong evidence for gene–lifestyle interactions contributing to male infertility aetiology, equivalent studies must be replicated in humans before any clinically applicable conclusions can be made. This includes directly testing whether dietary interventions on infertile men robustly alters semen profiles.

Globally men of reproductive age are being constantly exposed to numerous lifestyle factors that are known to impact spermatogenesis and male fertility (Kimmins et al., 2024). The additive effects of these factors in disrupting molecular pathways, shared by men and animals, should be systematically tested so as to inform clinical interventions. Doing so will improve our understanding of the aetiology of infertility. While not tested in this study, it is anticipated that reverting to a healthy diet would improve fertility in mice and men lacking M1AP. We note that a cycle of spermatogenesis and epididymal maturation in man takes approximately 3 months (WHO, 2025). Fortunately, lifestyle factors such as diet can easily be modified, therefore removing the environmental challenge may shift men (and mice) men with certain genetic susceptibility to infertility or subfertility back into the fertile range, thus avoiding the need for medically assisted reproduction.

Supplementary Material

deag130_Supplementary_Figure_S1
deag130_supplementary_figure_s1.pdf (758.5KB, pdf)
deag130_Supplementary_Figure_S2
deag130_supplementary_figure_s2.pdf (1.1MB, pdf)
deag130_Supplementary_Figure_S3
deag130_supplementary_figure_s3.pdf (2.1MB, pdf)
deag130_Supplementary_Figure_S4
deag130_supplementary_figure_s4.pdf (1.7MB, pdf)

Acknowledgement

The authors thank André Nogueira Alves for help with statistics.

Contributor Information

Brendan J Houston, School of BioSciences and Bio21 Molecular Science and Biotechnology Institute, The University of Melbourne, Parkville, VIC, Australia.

Joseph Nguyen, School of BioSciences and Bio21 Molecular Science and Biotechnology Institute, The University of Melbourne, Parkville, VIC, Australia.

Nadja Rotte, Institute of Reproductive Genetics, Centre of Medical Genetics, University of Münster, Münster, Germany.

Frank Tüttelmann, Institute of Reproductive Genetics, Centre of Medical Genetics, University of Münster, Münster, Germany.

Corinna Friedrich, Institute of Reproductive Genetics, Centre of Medical Genetics, University of Münster, Münster, Germany.

D Jo Merriner, School of BioSciences and Bio21 Molecular Science and Biotechnology Institute, The University of Melbourne, Parkville, VIC, Australia.

Anne E O’Connor, School of BioSciences and Bio21 Molecular Science and Biotechnology Institute, The University of Melbourne, Parkville, VIC, Australia.

Moira K O’Bryan, School of BioSciences and Bio21 Molecular Science and Biotechnology Institute, The University of Melbourne, Parkville, VIC, Australia.

Jessica E M Dunleavy, School of BioSciences and Bio21 Molecular Science and Biotechnology Institute, The University of Melbourne, Parkville, VIC, Australia.

Data availability

The data underlying this article will be shared on reasonable request to the corresponding author.

Authors’ roles

BJH, JN, NR, DJM, AEOC, and JEMD undertook experiments. BJH analyzed the data and drafted the manuscript, which was edited by MKOB and JEMD. BJH, FT, CF, MKOB, and JEMD contributed to study design. BJH, MKOB, and JEMD oversaw the project. All authors edited and approved the final version of the manuscript.

Funding

This project was supported by a Society for Reproductive Biology Career Development Award to B.J.H., National Health and Medical Research Council project grant (APP1120356) awarded to M.K.O.B., an Australia–Germany Joint Research Co-operation Scheme (UA-DAAD) grant (57511796) awarded to M.K.O.B., J.E.M.D., and F.T., and the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation) within the Clinical Research Unit ‘Male Germ Cells’ (CRU326, project number 329621271) awarded to F.T. and C.F.

Disclosures

None to declare.

References

  1. Arango NA, Li L, Dabir D, Nicolau F, Pieretti-Vanmarcke R, Koehler C, McCarrey JR, Lu N, Donahoe PK.  Meiosis I arrest abnormalities lead to severe oligozoospermia in meiosis 1 arresting protein (M1ap)-deficient mice. Biol Reprod  2013;88:76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bodden C, Pang TY, Feng Y, Mridha F, Kong G, Li S, Watt MJ, Reichelt AC, Hannan AJ.  Intergenerational effects of a paternal Western diet during adolescence on offspring gut microbiota, stress reactivity, and social behavior. FASEB J  2022;36:e21981. [DOI] [PubMed] [Google Scholar]
  3. Chen K, Luo F, Huang X, Huang K, Liu X, Hu Q, Xu C.  Irreversible male infertility from sleep restriction: a dual hit on testicular steroidogenesis and Keap1-Nrf2-mediated antioxidant defense. Reprod Toxicol  2025;138:109083. [DOI] [PubMed] [Google Scholar]
  4. De Muyt A, Pyatnitskaya A, Andreani J, Ranjha L, Ramus C, Laureau R, Fernandez-Vega A, Holoch D, Girard E, Govin J  et al.  A meiotic XPF-ERCC1-like complex recognizes joint molecule recombination intermediates to promote crossover formation. Genes Dev  2018;32:283–296. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Djureinovic D, Fagerberg L, Hallstrom B, Danielsson A, Lindskog C, Uhlen M, Ponten F.  The human testis-specific proteome defined by transcriptomics and antibody-based profiling. Mol Hum Reprod  2014;20:476–488. [DOI] [PubMed] [Google Scholar]
  6. Dunleavy JEM, Graffeo M, Wozniak K, O’Connor AE, Merriner DJ, Nguyen J, Schittenhelm RB, Houston BJ, O’Bryan MK.  The katanin A-subunits KATNA1 and KATNAL1 act co-operatively in mammalian meiosis and spermiogenesis to achieve male fertility. Development  2023;150:dev201956. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Dunleavy JEM, O’Connor AE, Okuda H, Merriner DJ, O’Bryan MK.  KATNB1 is a master regulator of multiple katanin enzymes in male meiosis and haploid germ cell development. Development  2021;148:dev199922. [DOI] [PubMed] [Google Scholar]
  8. Durairajanayagam D.  Lifestyle causes of male infertility. Arab J Urol  2018;16:10–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Eddy EM, Washburn TF, Bunch DO, Goulding EH, Gladen BC, Lubahn DB, Korach KS.  Targeted disruption of the estrogen receptor gene in male mice causes alteration of spermatogenesis and infertility. Endocrinology  1996;137:4796–4805. [DOI] [PubMed] [Google Scholar]
  10. Fagerberg L, Hallstrom BM, Oksvold P, Kampf C, Djureinovic D, Odeberg J, Habuka M, Tahmasebpoor S, Danielsson A, Edlund K  et al.  Analysis of the human tissue-specific expression by genome-wide integration of transcriptomics and antibody-based proteomics. Mol Cell Proteomics  2014;13:397–406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Gillespie L, Martin JH, Anderson AL, Bernstein IR, Stanger SJ, Trigg NA, Schjenken JE, Gannon AL, Parameswaran S, Smyth SP  et al.  Exposure of mice to environmentally relevant per- and polyfluoroalkyl substances (PFAS) alters the sperm epigenome. Commun Biol  2025;8:1487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Guma E, Cupo L, Ma W, Gallino D, Moquin L, Gratton A, Devenyi GA, Chakravarty MM.  Investigating the “two-hit hypothesis”: effects of prenatal maternal immune activation and adolescent cannabis use on neurodevelopment in mice. Prog Neuropsychopharmacol Biol Psychiatry  2023;120:110642. [DOI] [PubMed] [Google Scholar]
  13. Houston BJ, Conrad DF, O’Bryan MK.  A framework for high-resolution phenotyping of candidate male infertility mutants: from human to mouse. Hum Genet  2021a;140:155–182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Houston BJ, Lopes AM, Laan M, Nagirnaja L, O’Connor AE, Merriner DJ, Nguyen J, Punab M, Riera-Escamilla A, Krausz C  et al.  DDB1- and CUL4-associated factor 12-like protein 1 (Dcaf12l1) is not essential for male fertility in mice. Dev Biol  2022a;490:66–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Houston BJ, Merriner DJ, Stathatos GG, Nguyen JH, O’Connor AE, Lopes AM, Conrad DF, Baker M, Dunleavy JE, O’Bryan MK.  Genetic mutation of Cep76 results in male infertility due to abnormal sperm tail composition. Life Sci Alliance  2024a;7:e202302452. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Houston BJ, Nagirnaja L, Merriner DJ, O’Connor AE, Okuda H, Omurtag K, Smith C, Aston KI, Conrad DF, O’Bryan MK.  The Sertoli cell expressed gene secernin-1 (Scrn1) is dispensable for male fertility in the mouse. Dev Dyn  2021b;250:922–931. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Houston BJ, Nguyen J, Merriner DJ, O’Connor AE, Lopes AM, Nagirnaja L, Friedrich C, Kliesch S, Tuttelmann F, Aston KI  et al.  AXDND1 is required to balance spermatogonial commitment and for sperm tail formation in mice and humans. Cell Death Dis  2024b;15:499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Houston BJ, Nixon B, King BV, Aitken RJ, De Iuliis GN.  Probing the origins of 1,800 MHz radio frequency electromagnetic radiation induced damage in mouse immortalized germ cells and spermatozoa in vitro. Front Public Health  2018a;6:270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Houston BJ, Nixon B, King BV, De Iuliis GN, Aitken RJ.  The effects of radiofrequency electromagnetic radiation on sperm function. Reproduction  2016;152:R263–R276. [DOI] [PubMed] [Google Scholar]
  20. Houston BJ, Nixon B, Martin JH, De Iuliis GN, Trigg NA, Bromfield EG, McEwan KE, Aitken RJ.  Heat exposure induces oxidative stress and DNA damage in the male germ line. Biol Reprod  2018b;98:593–606. [DOI] [PubMed] [Google Scholar]
  21. Houston BJ, O’Connor AE, Wang D, Goodchild G, Merriner DJ, Luan H, Conrad DF, Nagirnaja L, Aston KI, Kliesch S  et al.  Human INHBB gene variant (c.1079T > C: p.Met360Thr) alters testis germ cell content, but does not impact fertility in mice. Endocrinology  2022b;163:bqab269. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Houston BJ, Riera-Escamilla A, Wyrwoll MJ, Salas-Huetos A, Xavier MJ, Nagirnaja L, Friedrich C, Conrad DF, Aston KI, Krausz C  et al.  A systematic review of the validated monogenic causes of human male infertility: 2020 update and a discussion of emerging gene-disease relationships. Hum Reprod Update  2021c;28:15–29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hu J, Merriner DJ, O’Connor AE, Houston BJ, Furic L, Hedger MP, O’Bryan MK.  Epididymal cysteine-rich secretory proteins are required for epididymal sperm maturation and optimal sperm function. Mol Hum Reprod  2018;24:111–122. [DOI] [PubMed] [Google Scholar]
  24. Khan MR, Akbari A, Nicholas TJ, Castillo-Madeen H, Ajmal M, Haq TU, Laan M, Quinlan AR, Ahuja JS, Shah AA  et al.  Genome sequencing of Pakistani families with male infertility identifies deleterious genotypes in SPAG6, CCDC9, TKTL1, TUBA3C, and M1AP. Andrology  2025;13:1093–1104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kimmins S, Anderson RA, Barratt CLR, Behre HM, Catford SR, De Jonge CJ, Delbes G, Eisenberg ML, Garrido N, Houston BJ  et al.  Frequency, morbidity and equity—the case for increased research on male fertility. Nat Rev Urol  2024;21:102–124. [DOI] [PubMed] [Google Scholar]
  26. Kolaitis ND, Finger BJ, Merriner DJ, Nguyen J, Houston BJ, O’Bryan MK, Stringer JM, Zerafa N, Nguyen N, Hutt KJ  et al.  Impact of chronic multi-generational exposure to an environmentally relevant atrazine concentration on testicular development and function in mice. Cells  2023;12:648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Krausz C, Riera-Escamilla A.  Genetics of male infertility. Nat Rev Urol  2018;15:369–384. [DOI] [PubMed] [Google Scholar]
  28. Levine H, Jorgensen N, Martino-Andrade A, Mendiola J, Weksler-Derri D, Jolles M, Pinotti R, Swan SH.  Temporal trends in sperm count: a systematic review and meta-regression analysis of samples collected globally in the 20th and 21st centuries. Hum Reprod Update  2023;29:157–176. [DOI] [PubMed] [Google Scholar]
  29. Levine H, Jorgensen N, Martino-Andrade A, Mendiola J, Weksler-Derri D, Mindlis I, Pinotti R, Swan SH.  Temporal trends in sperm count: a systematic review and meta-regression analysis. Hum Reprod Update  2017;23:646–659. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Li Y, Wu Y, Khan I, Zhou J, Lu Y, Ye J, Liu J, Xie X, Hu C, Jiang H  et al.  M1AP interacts with the mammalian ZZS complex and promotes male meiotic recombination. EMBO Rep  2023;24:e55778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Nagirnaja L, Lopes AM, Charng WL, Miller B, Stakaitis R, Golubickaite I, Stendahl A, Luan T, Friedrich C, Mahyari E  et al.  Diverse monogenic subforms of human spermatogenic failure. Nat Commun  2022;13:7953. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. NIH. Overweight & obesity statistics. 2026.
  33. O’Bryan MK, Saritas G, Nguyen J, Winge SB, O’Connor AE, Castillo-Madeen H, Conrad DF, Graffeo M, Nosrati R, Dunleavy JEM  et al.  CCDC89 is required for optimal sperm motility and male fertility in mammals. Hum Reprod  2025;40:1616–1628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Oh Y, Kasu M, Bottoms CJ, Douglas JC, Sekulovski N, Hayashi K, MacLean Ii JA.  Rhox8 homeobox gene ablation leads to rete testis abnormality and male subfertility in micedagger. Biol Reprod  2023;109:520–532. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Oud MS, Houston BJ, Volozonoka L, Mastrorosa FK, Holt GS, Alobaidi BKS, deVries PF, Astuti G, Ramos L, McLachlan RI  et al.  Exome sequencing reveals variants in known and novel candidate genes for severe sperm motility disorders. Hum Reprod  2021;36:2597–2611. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Oud MS, Okutman O, Hendricks LAJ, de Vries PF, Houston BJ, Vissers L, O’Bryan MK, Ramos L, Chemes HE, Viville S  et al.  Exome sequencing reveals novel causes as well as new candidate genes for human globozoospermia. Hum Reprod  2020;35:240–252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Oud MS, Smits RM, Smith HE, Mastrorosa FK, Holt GS, Houston BJ, de Vries PF, Alobaidi BKS, Batty LE, Ismail H  et al. ; Genetics of Male Infertility Initiative (GEMINI) consortium. A de novo paradigm for male infertility. Nat Commun  2022;13:154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Rotte N, Dunleavy JEM, Runkel MD, Bosse L, Fietz D, Pilatz A, Kuss J, Dicke AK, Winge SB, Di Persio S  et al.  Genotype-specific differences in infertile men due to loss-of-function variants in M1AP or ZZS genes. EMBO Mol Med  2025;17:1417–1451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Schultz N, Hamra FK, Garbers DL.  A multitude of genes expressed solely in meiotic or postmeiotic spermatogenic cells offers a myriad of contraceptive targets. Proc Natl Acad Sci U S A  2003;100:12201–12206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Skakkebæk NE, Lindahl-Jacobsen R, Levine H, Andersson A-M, Jørgensen N, Main KM, Lidegaard Ø, Priskorn L, Holmboe SA, Bräuner EV  et al.  Environmental factors in declining human fertility. Nat Rev Endocrinol  2022;18:139–157. [DOI] [PubMed] [Google Scholar]
  41. Uhlen M, Fagerberg L, Hallstrom BM, Lindskog C, Oksvold P, Mardinoglu A, Sivertsson A, Kampf C, Sjostedt E, Asplund A  et al.  Proteomics. Tissue-based map of the human proteome. Science  2015;347:1260419. [DOI] [PubMed] [Google Scholar]
  42. Welfare AIoHa. Overweight and obesity. Determinants of health. 2022, https://www.aihw.gov.au/reports/australias-health/overweight-and-obesity#_Toc30499258
  43. WHO. Guideline for the prevention, diagnosis and treatment of infertility. 2025. [PubMed]
  44. Wyrwoll MJ, Temel SG, Nagirnaja L, Oud MS, Lopes AM, van der Heijden GW, Heald JS, Rotte N, Wistuba J, Woste M  et al. ; GEMINI Consortium. Bi-allelic mutations in M1AP are a frequent cause of meiotic arrest and severely impaired spermatogenesis leading to male infertility. Am J Hum Genet  2020;107:342–351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Yue F, Cheng Y, Breschi A, Vierstra J, Wu W, Ryba T, Sandstrom R, Ma Z, Davis C, Pope BD  et al. ; Mouse ENCODE Consortium. A comparative encyclopedia of DNA elements in the mouse genome. Nature  2014;515:355–364. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

deag130_Supplementary_Figure_S1
deag130_supplementary_figure_s1.pdf (758.5KB, pdf)
deag130_Supplementary_Figure_S2
deag130_supplementary_figure_s2.pdf (1.1MB, pdf)
deag130_Supplementary_Figure_S3
deag130_supplementary_figure_s3.pdf (2.1MB, pdf)
deag130_Supplementary_Figure_S4
deag130_supplementary_figure_s4.pdf (1.7MB, pdf)

Data Availability Statement

The data underlying this article will be shared on reasonable request to the corresponding author.

Articles from Human Reproduction (Oxford, England) are provided here courtesy of Oxford University Press

RESOURCES