Description
For Macharios MM, Hernandez YD, Breen PC, Dowen RH. 2025. Partial loss of the vitellogenins confers a fitness disadvantage but does not impact brood size in C. elegans . microPublication Biology. 10.17912/micropub.biology.001789, the authors have discovered genotyping anomalies for the vit-2 ( ok3211 ) allele used in their publication. The discovery impacts the genotype of two strains used in their study. The authors requested corrections to the article to update the genotypes of the strains used, and to rephrase the phenotypes reported in the context of the partial loss of vitellogenin function. The corrections made to the article are as follows:
Title
Original : "Loss of the vitellogenins confers a fitness disadvantage but does not impact brood size in C. elegans"
Corrected : "Partial loss of the vitellogenins confers a fitness disadvantage but does not impact brood size in C. elegans"
Abstract
Original : "Using Caenorhabditis elegans , we tested whether vitellogenesis, or the deposition of lipid-rich yolk into oocytes, is required for reproductive output and metabolic balance by creating a strain lacking all six vitellogenin genes ( vit-1-6 )."
Corrected : "Using Caenorhabditis elegans , we tested whether vitellogenesis, or the deposition of lipid-rich yolk into oocytes, is required for reproductive output and metabolic balance by creating a strain lacking five of the six vitellogenin genes ( vit-1/3/4/5/6 )."
Original : "However, progeny survival during L1 starvation was impaired in vit-1-6 animals."
Corrected : "However, progeny survival during L1 starvation was impaired in vit-1/3/4/5/6 animals."
Figure Title
Original : “Creation and characterization of a strain carrying mutations in all six vitellogenin” genes
Corrected : “Creation and characterization of a strain carrying mutations in five of the six vitellogenin genes”
Figure Legend
Original : “The vit-3-6 mutations were introduced into the vit-2(ok3211) vit-1(ok2616) double mutant to generate the vit-1-6 sextuple mutant.”
Corrected : “The vit-3-6 mutations were introduced into the vit-1(ok2616) mutant to generate the vit-1/3/4/5/6 quintuple mutant.”
Original : “(B) An SDS-PAGE gel containing protein lysates from wild-type, rme-2(b1008) , vit-2(ok3211) vit-1(ok2616) , and vit-1-6 animals (25 individuals per lane) stained with Coomassie blue R-250.”
Corrected : “(B) An SDS-PAGE gel containing protein lysates from wild-type, rme-2(b1008) , vit-2(ok2616) vit-1(ok3211) , and vit-1/3/4/5/6 animals (25 individuals per lane) stained with Coomassie blue R-250.”
Original : “(D) Brood size measurements for wild-type, rme-2(b1008) , vit-2(ok3211) vit-1(ok2616) , and vit-1-6 animals.”
Corrected : “(D) Brood size measurements for wild-type, rme-2(b1008) , vit-2(ok2616) vit-1(ok3211) , and vit-1/3/4/5/6 animals.”
Description
Original : “To further understand the physiological consequence of total loss of vitellogenin protein, we generated a novel strain that contains loss-of-function mutations in all six vitellogenin genes ( vit-1-6 ).”
Corrected : “To further understand the physiological consequence of partial loss of vitellogenin protein, we generated a novel strain that contains loss-of-function mutations in five of the six vitellogenin genes ( vit-1/3/4/5/6 ).”
Original : “These nonsense mutations were introduced into the vit-2(ok3211) vit-1(ok2616) double mutant, yielding the vit-1-5 mutant.”
Corrected : “These nonsense mutations were introduced into the vit-1(ok2616) mutant, yielding the vit-1/3/4/5 mutant.”
Original : “After verifying the quintuple mutant strain by genotyping and Sanger sequencing of each locus, we engineered a premature stop codon mutation into the vit-6 locus via CRISPR/Cas9 (Figure 1A), thereby generating the vit-1-6 mutant.”
Corrected : “After verifying the quadruple mutant strain by genotyping and Sanger sequencing of each locus, we engineered a premature stop codon mutation into the vit-6 locus via CRISPR/Cas9 (Figure 1A), thereby generating the vit-1/3/4/5/6 quintuple mutant.
Original : “To validate that our loss-of-function alleles impaired VIT protein production, we stained SDS-PAGE gels containing protein lysates from wild-type animals, the rme-2(b1008) mutant, the vit-2 vit-1 double mutant, and the vit-1-6 sextuple mutant with Coomassie blue to visualize the highly abundant yolk proteins (Figure 1B).”
Corrected : “To validate that our loss-of-function alleles reduced VIT protein production, we stained SDS-PAGE gels containing protein lysates from wild-type animals, the rme-2(b1008) mutant, the vit-2 vit-1 double mutant, and the vit-1/3/4/5/6 quintuple mutant with Coomassie blue to visualize the highly abundant yolk proteins (Figure 1B).”
Original : “In contrast, the vit-1-6 sextuple mutant displayed severe reductions in VIT protein levels compared to wild-type (Figure 1B).”
Corrected : “In contrast, the vit-1/3/4/5/6 quintuple mutant displayed severe reductions in VIT protein levels compared to wild-type (Figure 1B).”
Original : “While we are confident that the vit-1-6 mutations severely decrease yolk production, we are unable to eliminate the possibility that some VIT protein is synthesized in these animals due to stop codon readthrough.”
Corrected : “While we are confident that the vit-1/3/4/5/6 mutations severely decrease yolk production, we predict that synthesis of YP170B, encoded by the vit-2 gene, remains unaffected in this strain. Moreover, we are unable to eliminate the possibility that some VIT-3/4/5/6 protein is synthesized in these animals due to stop codon readthrough.”
Original : “Given that yolk is responsible for the deposition of lipids into the mature oocyte, we hypothesized that loss of the vit genes would result in lower amounts of embryonic lipids.”
Corrected : “Given that yolk is responsible for the deposition of lipids into the mature oocyte, we hypothesized that partial loss of the vit genes would result in lower amounts of embryonic lipids.”
Original : “Notably, we only found an average reduction of 32% and 21% in Nile Red staining for the vit-1-6 and the rme-2 mutant, respectively, suggesting that additional mechanisms of lipid deposition or de novo synthesis compensate for loss of vitellogenesis.”
Corrected : ” Notably, we only found an average reduction of 32% and 21% in Nile Red staining for the vit-1/3/4/5/6 and the rme-2 mutant, respectively, suggesting that additional mechanisms of lipid deposition or de novo synthesis compensate for loss of vitellogenesis.
Original : “Therefore, we measured the brood size of the vit-2 vit-1 double mutant and the vit-1-6 sextuple mutant and compared them to the broods produced by wild-type and rme-2 animals (Figure 1D).”
Corrected : “Therefore, we measured the brood size of the vit-2 vit-1 double mutant and the vit-1/3/4/5/6 quintuple mutant and compared them to the broods produced by wild-type and rme-2 animals (Figure 1D).”
Original : “Finally, our data suggest that RME-2 plays multiple roles in the germline, consistent with previous findings that it also functions in spermathecal valve dilation and ovulation (Chi and Reinke 2009).”
Corrected : ”Finally, our data suggest that RME-2 plays multiple roles in the germline, consistent with previous findings that it also functions in spermathecal valve dilation and ovulation (Chi and Reinke 2009; Grant and Hirsh 1999).”
Original : “Indeed, the vit-1-6 mutant exhibited lower L1 survival (54%) compared to wild-type (91%) at day 10 of starvation, which persisted to day 15 (Figure 1E).”
Corrected : “Indeed, the vit-1/3/4/5/6 mutant exhibited lower L1 survival (54%) compared to wild-type (91%) at day 10 of starvation, which persisted to day 15 (Figure 1E).”
Original : “The vit-1-6 survival phenotype was more severe than that of the vit-2 vit-1 double mutant; however, no mutant reached the levels of rme-2 mutant, which had a mean survival of 5% by day 10 and no surviving progeny by day 15 (Figure 1E).”
Corrected : “The vit-1/3/4/5/6 survival phenotype was more severe than that of the vit-2 vit-1 double mutant; however, no mutant reached the levels of rme-2 mutant, which had a mean survival of 5% by day 10 and no surviving progeny by day 15 (Figure 1E).”
Original : “Together, these data indicate that loss of yolk provisioning, conferred by either mutation of the six vit genes or rme-2 , impairs L1 starvation survival.”
Corrected : “Together, these data indicate that reduced yolk provisioning, conferred by either mutation of the vit-1/3/4/5/6 genes or rme-2 , impairs L1 starvation survival.”
Original : “It is surprising that the vit-1-6 mutant does not closely phenocopy the rme-2 mutant, as both mutations result in failure to provision yolk to the offspring.”
Corrected : “It is surprising that the vit-1/3/4/5/6 mutant does not closely phenocopy the rme-2 mutant, as both mutants display a deficit in yolk provisioning to the offspring.”
Original : “The dramatic difference in brood size can perhaps be attributed to a defect in the spermatheca valve leading to oocyte damage in the rme-2 mutant (Chi and Reinke 2009); however, an explanation for why the rme-2 mutant displays more severe L1 survival phenotypes compared to the vit-1-6 mutant requires additional studies.”
Corrected : “The dramatic difference in brood size can perhaps be accredited to a defect in the spermatheca valve leading to oocyte damage in the rme-2 mutant (Chi and Reinke 2009); however, an explanation for why the rme-2 mutant displays more severe L1 survival phenotypes compared to the vit-1/3/4/5/6 mutant requires additional studies.”
Original : “The vit-1-6 mutant strain provides a useful avenue to explore the metabolic dysfunction in vitellogenin-depleted animals.”
Corrected : “The vit-1/3/4/5/6 mutant strain provides a useful avenue to explore the metabolic dysfunction in vitellogenin-depleted animals.”
Original : “Using Nile Red staining, we found that upon loss of the vitellogenin proteins, embryos still have a substantial amount of lipids, suggesting that multiple lipid synthesis pathways contribute to maternal nutrient provisioning.”
Corrected : “Using Nile Red staining, we found that upon reduction of vitellogenin protein, embryos still have a substantial amount of lipids, suggesting that multiple lipid synthesis pathways contribute to maternal nutrient provisioning.”
Original : “One alternative mechanism for maternal deposition of lipids into the C. elegans germline is through the delivery of malonyl-CoA via gap junctions.”
Corrected : “It is possible that VIT-2 alone is sufficient to deliver lipids to oocytes in the vit-1/3/4/5/6 mutant via the established vitellogenesis pathway. However, an alternative mechanism for maternal deposition of lipids into the C. elegans germline is through the delivery of malonyl-CoA via gap junctions.”
Original : “Perhaps this pathway is heavily utilized when yolk protein expression or function is impaired, as in the vit-1-6 or rme-2 mutants.”
Corrected : “Perhaps this pathway is heavily utilized when yolk protein expression is reduced, as in the vit-1/3/4/5/6 or rme-2 mutants.”
Original : “Here, we used CRISPR-Cas9 genome editing to generate a novel mutant strain containing nonsense mutations in the vit-3 , vit-4 , vit-5 , and vit-6 genes, which were combined with the previously established loss-of-function mutations vit-1(ok2616) and vit-2(ok3211) , to yield the sextuple vit-1-6 mutant.”
Corrected : “Here, we used CRISPR-Cas9 genome editing to generate a novel mutant strain containing nonsense mutations in the vit-3 , vit-4 , vit-5 , and vit-6 genes, which were combined with the previously established vit-1(ok2616) loss-of-function mutation, to yield the quintuple vit-1/3/4/5/6 mutant.”
Original : “Our results indicate that depletion of all six vitellogenin proteins does not confer an abnormal brood size, but rather, the progeny exhibit a reduction in fitness during L1 starvation.”
Corrected : “Our results indicate that depletion of five of the six vitellogenin proteins does not confer an abnormal brood size, but rather, the progeny exhibit a reduction in fitness during L1 starvation.”
Methods
Original : “The sextuple mutant vit-6(rhd332[S320F, W322*]) IV; vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-2(ok3211) vit-1(ok2616) X was generated using CRISPR/Cas9 genomic editing.”
Corrected : “The quintuple mutant vit-6(rhd332[S320F, W322*]) IV; vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-1(ok2616) X was generated using CRISPR/Cas9 genomic editing.”
Original : “The Cas9::crRNA:tracrRNA complexes, as well as the ssODN repair template, were microinjected into the germline of DLS882 to generate DLS976 as previously described (Ghanta and Mello 2020).”
Corrected : “The Cas9::crRNA:tracrRNA complexes, as well as the ssODN repair template, were microinjected into the germline of vit-1(ok2616) animals to generate DLS976 as previously described (Ghanta and Mello 2020).”
Reagents
Original :
Genotyping:
|
Alleles |
Primer Sequences |
Expected Band Sizes (bp) |
|
vit-1(ok2616) |
For: AGCGTGAGCTCAAGGAGAAGRev: AGCTTCGTATCCACGACGAC |
WT: 3325MT: 1528 |
|
vit-2(ok3211) |
For: ATGGAGCACGCTCTTGCTATRev: TGGGATCTTTCCAGAGATGG |
WT: 1378MT: 525 |
|
vit-3(rhd320) |
For: TCCGCTTTTTGCAAAGTATCRev: TGGTTGACGTGGATCTTGGA |
- EcoRI: 845+ EcoRI: 386 & 409 |
|
vit-4(rhd321) |
For: TACTTTCAGGTCTCTGGACCRev: TTTGTCTAGATGCTGGGCGG |
- EcoRI: 599+ EcoRI: 342 & 257 |
|
vit-5(rhd322) |
For: CAGCACACAAGTTTTCAGGTRev: GATGCTCTTCTTCTCGAAGT |
- EcoRI: 361+ EcoRI: 351 & 10 |
|
vit-6(rhd332) |
For: CGCACCCTCGAAGGAGAATGRev: CAAGAGATGGGTAGCGCATG |
- EcoRI: 820+ EcoRI: 405 & 415 |
Corrected :
Primers
|
Gene |
Primer Pair |
Annealing Temp (ºC) |
Expected Band Sizes (bps) |
|
vit-1(ok2616) |
For: ATCAGTTGTCCGCGGAATTGRev: GGGACATTGGCTCAACTGTG |
59 |
WT: 2399MT: 602 |
|
vit-1(ok2616) |
For: CATCCTCCCAGTCGATACCCRev: GGGACATTGGCTCAACTGTG |
59 |
WT: 1445MT: 0 |
|
vit-2(ok3211) |
For: TCACATGGAAAACGAGGACARev: TGGGATCTTTCCAGAGATGG |
59 |
WT: 1321MT: 600 |
|
vit-3(rhd320) |
For: TCCGCTTTTTGCAAAGTATCRev: TGGTTGACGTGGATCTTGGA |
56 |
- EcoRI: 845+ EcoRI: 386 & 409 |
|
vit-4(rhd321) |
For: TACTTTCAGGTCTCTGGACCRev: TTTGTCTAGATGCTGGGCGG |
57 |
- EcoRI: 599+ EcoRI: 342 & 257 |
|
vit-5(rhd322) |
For: CAGCACACAAGTTTTCAGGTRev: GATGCTCTTCTTCTCGAAGT |
56 |
- EcoRI: 361+ EcoRI: 351 & 10 |
|
vit-6(rhd332) |
For: CGCACCCTCGAAGGAGAATGRev: CAAGAGATGGGTAGCGCATG |
59 |
- EcoRI: 820+ EcoRI: 405 & 415 |
Original :
CRISPR Edits
|
Gene |
crRNA Sequence |
ssODN Repair Sequence |
|
vit-3, vit-4, vit-5 |
ACUUGUCAUUGAAACCACAU |
GTTCAACTTGTCATTGAAACCGAATTCTAAG TGGCTGGAACCAAGAACACCATTCAACAC |
|
vit-6 |
UCUACAACCAGGAAUCCGAA |
CCGAGCTTGTCTACAACCAGGAATTCGAATA GGCTGAGCAACAATGGGCTCAAACTGGAG |
Corrected :
CRISPR
|
Gene(s) |
crRNA |
ssODN |
|
vit-3, vit-4, vit-5 |
ACTTGTCATTGAAACCGAAT |
GTTCAACTTGTCATTGAAACCGAATTCTAA GTGGCTGGAACCAAGAACACCATTCAACAC |
|
vit-6 |
TCTACAACCAGGAATTCGAA |
CCGAGCTTGTCTACAACCAGGAATTCGAAT AGGCTGAGCAACAATGGGCTCAAACTGGAG |
Original :
Strains
|
Strain Name |
Genotype |
Available From |
|
N2 |
Wild-type |
CGC |
|
DH1390 |
rme-2(b1008) IV |
CGC |
|
RB1982 |
vit-1(ok2616) X |
CGC |
|
RB2365 |
vit-2(ok3211) X |
CGC |
|
DLS882 |
vit-2(ok3211) vit-1(ok2616) X |
Upon request |
|
DLS976 |
vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-2(ok3211) vit-1(ok2616) X |
Upon request |
|
DLS1004 |
vit-6(rhd332[S320F, W322*]) IV; vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-2(ok3211) vit-1(ok2616) X |
Upon request |
Corrected :
Strains
|
Strain |
Genotype |
Available From |
|
N2 |
Wild-type |
CGC |
|
DH1390 |
rme-2(b1008) IV |
CGC |
|
RB1982 |
vit-1(ok2616) X |
CGC |
|
RB2365 |
vit-2(ok3211) X |
CGC |
|
DLS882 |
vit-2(ok3211) vit-1(ok2616) X |
Upon request |
|
DLS976 |
vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-1(ok2616) X |
Upon request |
|
DLS1004 |
vit-6(rhd332[S320F, W322*]) IV; vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-1(ok2616) X |
Upon request |
Funding Statement
Supported by National Institute of General Medical Sciences grant R35GM137985 to Robert H. Dowen.