Skip to main content
NCBI home page

This is a preprint.

It has not yet been peer reviewed by a journal.

The National Library of Medicine is running a pilot to include preprints that result from research funded by NIH in PMC and PubMed.

bioRxiv logoLink to bioRxiv
[Preprint]. 2026 Aug 13:2026.08.12.744527. [Version 1] doi: 10.64898/2026.08.12.744527

Loss of Hnf1b in differentiated proximal tubule cells uncovers nephron segment plasticity

Zeinab Dehghani-Ghobadi 1,2, Eunah Chung 1,2, Azadeh Haghighitalab 1,2, Mohammed Sayed 3, Christopher Ahn 3, Yueh-Chiang Hu 4,5, Hee-Woong Lim 3,5, Joo-Seop Park 1,2,*
PMCID: PMC13640791  PMID: 42845647

Abstract

HNF1B is a transcription factor required for proximal tubule (PT) specification during kidney development, but whether it is also required to maintain PT identity after differentiation remains unknown. Using PT-specific genetic deletion in mice, we found that loss of Hnf1b in differentiated PT cells causes cyst formation and early postnatal lethality. PT-specific transcriptomic analysis revealed downregulation of PT-specific gene programs, including Hnf4a and PT-enriched transport and metabolic genes. Strikingly, Hnf1b-deficient PT cells ectopically activated podocyte-specific genes, including Wt1 and Nphs1, demonstrating that PT cells retain the capacity to engage alternative nephron segment programs when identity-stabilizing mechanisms are disrupted. In addition, loss of Hnf1b disrupted epithelial integrity, as evidenced by reduced epithelial adhesion gene expression and induction of mesenchymal markers. Wnt/β-catenin signaling was also aberrantly activated, suggesting broader dysregulation of epithelial homeostasis. These findings establish HNF1B as a critical post-specification regulator of PT identity that sustains PT-specific transcriptional programs and actively suppresses alternative segmental identity programs.

INTRODUCTION

During mammalian kidney development, mesenchymal nephron progenitors (mNPs) become epithelialized to form renal vesicles, which subsequently differentiate into the major nephron segments, including podocytes, parietal epithelial cells, proximal tubule (PT), loop of Henle, distal tubule, and connecting tubule (1, 2). The PT, the largest nephron segment, performs the majority of solute and water reabsorption, a process essential for systemic homeostasis (3–5). To sustain these functions, PT cells maintain high metabolic activity and a transcriptional program enriched for transporters and metabolic enzymes (3, 6–8). Loss of PT differentiation is observed in kidney disease and maladaptive repair, highlighting the importance of understanding the mechanisms that actively sustain PT identity (9–11). While the mechanisms that specify nephron segments during development have been studied (2, 12), the transcriptional programs that actively maintain PT identity remain poorly understood.

HNF1B is a key transcription factor required for nephron segmentation (13–17). Heterozygous mutations in HNF1B are among the most common monogenic causes of congenital kidney disease in humans, leading to renal cysts, hypoplasia, and tubulointerstitial disease, often referred to as maturity-onset diabetes of the young type 5 (MODY5) or renal cysts and diabetes (RCAD) syndrome (18–20). In both mouse and zebrafish, Hnf1b is required for proper proximo-distal patterning of the nephron during development (13, 14, 16, 17). Mouse studies defining this role have relied on early deletion models driven by Six2Cre or Wnt4Cre, which delete Hnf1b before or during epithelialization of mNPs (14, 16, 17). These models demonstrate that loss of Hnf1b causes glomerulocyst formation, disrupts development of mature nephron segments, and blocks expression of HNF4A, a transcription factor required for PT differentiation (6, 21). In addition, studies using KspCre or Pkhd1Cre have established important roles for Hnf1b in the collecting duct epithelium (22–33). Collectively, these studies have largely focused on Hnf1b function either during early nephrogenesis or in the collecting duct, leaving its role in maintaining segment-specific gene expression programs in differentiated PT cells largely unexplored.

To address this gap, we generated a mouse model in which Hnf1b is conditionally deleted from PT cells after their formation using the PT-specific Slc34a1Cre driver (34). Unlike previously used Cre drivers, Slc34a1Cre targets PT cells after segmental identity has been established, enabling direct assessment of Hnf1b function in differentiated PT cells. We isolated PT cells by fluorescence-activated cell sorting (FACS) and performed transcriptomic profiling, histological characterization, and lineage tracing. This strategy enables direct assessment of whether Hnf1b is required to sustain PT identity after segment specification. Here, we show that loss of Hnf1b in differentiated PT cells leads to pronounced disruption of PT-specific transcriptional programs and ectopic activation of podocyte-associated genes, revealing an unexpected degree of nephron segment plasticity. These findings demonstrate that PT identity is not a fixed endpoint of differentiation but instead requires active transcriptional maintenance and suppression of alternative nephron segment programs.

RESULTS

HNF1B maintains PT identity and suppresses ectopic podocyte gene programs

In the developing mouse kidney, Hnf1b is expressed in all renal epithelial cells except podocytes (Supplemental Figure 1A and 1B). Although Hnf1b is required for Hnf4a expression during PT specification (14, 16), it remains unknown whether Hnf1b is also required to maintain PT identity after segmental identity has been established. To address this, we conditionally deleted Hnf1b using Slc34a1Cre, which is expressed specifically in differentiated PT cells in the developing mouse kidney (34). This approach permits Hnf1b-dependent activation of Hnf4a during PT specification to proceed normally, with deletion occurring only after PT segmental identity is established, thereby isolating the role of Hnf1b in identity maintenance from its earlier role in PT specification. Most Hnf1b mutant mice developed severe polycystic kidneys and died by postnatal day 10 (Figure 1A). To determine whether cyst-lining cells originated from Hnf1b-deficient PT cells rather than other nephron segments, we performed lineage tracing using Slc34a1Cre-mediated activation of the Rosa26-Sun1 GFP reporter. The majority of cyst-lining epithelial cells were Sun1-positive and HNF1B-negative, confirming that the cysts arose from recombined PT cells (Figure 1B).

Figure 1. Loss of Hnf1b in PT cells leads to a polycystic kidney phenotype.

Figure 1.

Open in a new tab

(A) H&E staining shows extensive cyst formation in Hnf1b mutant kidneys. Higher-magnification views (insets) of the regions outlined in black reveal normal renal corpuscle morphology in control kidneys, whereas Hnf1b mutant kidneys exhibit dilated Bowman’s space (black arrowheads).

(B) Lineage tracing with Slc34a1Cre-mediated activation of the Rosa26-Sun1 reporter shows that the cyst-lining epithelial cells originate from Slc34a1+ PT cells. These SUN1+ cells lack HNF1B, indicating that cyst formation occurs within Hnf1b-deficient PT cells.

(A, B) Representative images from four biological replicates per genotype are shown. Stage: postnatal day 9; Scale bar: 100 μm.

To define the transcriptional consequences of Hnf1b loss, we performed bulk RNA-seq on FACS-isolated PT cells from Hnf1b mutant and littermate control kidneys (Supplemental Table 1). Differential expression analysis identified 4,029 significantly altered genes, comprising 2,212 upregulated and 1,817 downregulated transcripts (fold change >2, FDR <0.01; Supplemental Figure 1C). To determine which nephron cell types most closely matched the transcriptional changes observed in Hnf1b-deficient PT cells, we projected module scores derived from differentially expressed genes onto a single-cell RNA sequencing (scRNA-seq) reference dataset of the developing mouse kidney (34–36). Downregulated genes mapped predominantly to the PT cluster, indicating loss of PT-specific transcriptional programs (Supplemental Figure 1D), whereas upregulated genes mapped primarily to the podocyte cluster, suggesting aberrant activation of a podocyte-associated transcriptional program in Hnf1b-deficient PT cells (Supplemental Figure 1E). Figure 2 highlights representative differentially expressed genes. Heatmaps demonstrate that these gene expression changes are consistent across both sexes, while dot plot analysis using scRNA-seq data shows that downregulated genes are enriched in PT cells and their progenitors, whereas upregulated genes are preferentially expressed in podocytes and their progenitors. Gene Ontology and KEGG pathway analyses further supported these findings: downregulated genes were enriched for PT metabolic functions, including fatty acid β-oxidation, mitochondrial transport, oxidative phosphorylation, and peroxisome metabolism, while upregulated genes were enriched for extracellular matrix organization, Wnt signaling, and developmental pathways (Supplemental Figure 2).

Figure 2. Identification of differentially expressed genes in Hnf1b-deficient PT cells.

Figure 2.

Open in a new tab

Bulk RNA-seq analysis of FACS-isolated PT cells at postnatal day 1 reveals differentially expressed genes between control and Hnf1b mutant kidneys, as shown in the heatmap. In mutant kidneys, PT-enriched genes are downregulated (A), whereas podocyte-associated genes are upregulated (B). These expression changes were observed in both male and female mice. Color intensity represents the magnitude of expression change, with blue indicating decreased and red indicating increased expression. The dot plot displays cell–type–specific expression of marker genes based on previously published single-cell RNA-seq data from mouse kidneys at E18.5 or P0 (GSE214024). Dot color indicates the average expression level of each gene within a given cell type, whereas dot size represents the percentage of cells expressing that gene.

These transcriptional changes were validated at the cellular level. Immunofluorescence confirmed that canonical PT marker expression, including HNF4A, ASS1, LRP2, MIOX, PCK1, GATM, SLC34A1, and SLC5A2, was markedly diminished or absent in Sun1-positive Hnf1b-deficient PT cells, along with loss of Lotus tetragonolobus lectin (LTL) staining (Figure 3). PT marker expression was retained in a subset of Sun1-negative cells, indicating escape from Cre-mediated recombination and retention of HNF1B expression in a minority of PT cells. Ectopic activation of the podocyte gene program in Hnf1b-deficient PT cells was confirmed by immunofluorescence and Hybridization Chain Reaction Fluorescence In Situ Hybridization (HCR-FISH). In control kidneys, podocyte marker genes were expressed exclusively in podocytes. In Hnf1b mutant kidneys, these markers were aberrantly detected in Sun1-positive PT cells, with ectopic WT1 protein confirmed by immunofluorescence (Figure 4A), ectopic Nphs1 and Plat by HCR-FISH (Figure 4B), and ectopic Cldn5 and Mafb by HCR-FISH (Supplemental Figure 3). Together, these findings identify HNF1B as a critical factor required to maintain PT identity, whose loss disrupts the PT transcriptional program and causes ectopic activation of podocyte-associated gene expression.

Figure 3. HNF1B is required to maintain PT identity.

Figure 3.

Open in a new tab

The mutant kidney exhibits marked reductions in HNF4A expression and PT markers, including ASS1, LRP2, MIOX, PCK1, GATM, SLC34A1, and SLC5A2, together with diminished LTL staining. These findings indicate loss of PT differentiation following Hnf1b deletion and are consistent with disruption of HNF4A-dependent transcriptional programs. Representative images from four biological replicates per genotype are shown. H: Hoechst stain; Stage: postnatal day 9; Scale bar: 200 μm.

Figure 4. Loss of Hnf1b in PT cells induces ectopic activation of podocyte-associated genes.

Figure 4.

Open in a new tab

(A) In control kidneys, WT1 expression is restricted to podocytes and absent from most SUN1+ cells. In contrast, Hnf1b mutant kidneys exhibit ectopic WT1 expression in SUN1+ PT cells.

(B) HCR-FISH demonstrates induction of podocyte-associated genes in Hnf1b mutant PT cells. In control kidneys, Plat and Nphs1 expression is restricted to podocytes. In Hnf1b mutant kidneys, both genes are ectopically expressed in SUN1+ cells.

(A, B) Representative images from four biological replicates per genotype are shown. Stage: postnatal day 9; Scale bar: 100 μm.

Slc34a1Cre-mediated Hnf1b deletion causes medullary cysts in PT-derived descending thin limb cells

Following Hnf1b deletion, renal cysts were first detected exclusively in the medulla during early postnatal stages (Supplemental Figure 4), with cortical cysts emerging at later time points (Figure 1). This spatiotemporal pattern suggests that cystogenesis initiates within the medulla and subsequently progresses to the cortex, implying that specific medullary cell populations may be particularly susceptible to cyst formation. Consistent with this, prior lineage-tracing studies demonstrated that Slc34a1Cre targets not only PT cells but also a subset of descending thin limb (DTL) cells, which are derived from PT cells during kidney development (34). To define the segmental identity of medullary cyst-lining epithelial cells, we analyzed nephron segment-specific marker expression. Cyst-lining cells were negative for SLC12A1, AQP2, and GATA3, excluding thick ascending limb and collecting duct identities. Of the markers examined, only AQP1 was detected. However, AQP1 expression was restricted to a subset of Sun1-positive cyst-lining cells, whereas the majority were AQP1-negative (Supplemental Figure 5A), suggesting that medullary cyst-lining cells do not uniformly retain DTL identity.

Because loss of AQP1 expression could reflect disruption of DTL differentiation rather than exclusion of a DTL origin, we next examined whether Hnf1b deletion affects the Hnf1b-Hnf4a-Aqp1 regulatory axis in PT-derived DTL cells. Our previous work demonstrated that a subset of DTL cells is derived from PT cells and that loss of Hnf4a impairs AQP1 expression in the DTL (34). Because Hnf1b is required for Hnf4a expression, we predicted that Hnf1b deletion using Slc34a1Cre would similarly disrupt AQP1 expression in PT-derived DTL cells. To test this, we performed co-immunostaining for AQP1, PECAM1, and Sun1. Because AQP1 protein is expressed in both the DTL and vasa recta within the renal papilla (34, 37), this approach enabled discrimination of vascular structures (AQP1-positive, PECAM1-positive) from DTL epithelium, while simultaneously identifying recombined (Sun1-positive) and non-recombined (Sun1-negative) cells. Consistent with this regulatory relationship, a subset of recombined PT-derived DTL cells retained AQP1 expression, whereas the majority lost AQP1 expression following Hnf1b deletion (Supplemental Figure 5B), indicating compromised DTL identity in the absence of Hnf1b.

Loss of Hnf1b disrupts epithelial polarity and promotes proliferative remodeling

Because epithelial polarity is critical for maintenance of tubular architecture and is frequently disrupted in cystic kidney disease (38, 39), we examined whether these processes were affected following Hnf1b deletion in PT cells. Immunostaining demonstrated loss of the adherens junction protein E-cadherin (CDH1) in Hnf1b-deficient PT cells, accompanied by increased expression of the mesenchymal markers Vimentin (VIM) and Transgelin (TAGLN) within mutant tubules and adjacent stromal cells (Figure 5). Assessment of polarity markers further revealed disruption of apical-basal organization. In Sun1-positive PT cells in control kidneys, PARD6B localized to the apical domain, whereas LAMA1 formed a continuous basement membrane (Supplemental Figure 6). In contrast, Hnf1b-deficient Sun1-positive PTs lacked apical PARD6B and exhibited reduced or mislocalized LAMA1 staining , indicating impaired epithelial polarity and basement membrane organization (Supplemental Figure 6).

Figure 5. PT-specific deletion of Hnf1b reduces CDH1 expression and induces mesenchymal marker expression.

Figure 5.

Open in a new tab

Immunostaining of mutant kidneys shows reduced expression of the epithelial marker CDH1 (E-cadherin) in SUN1+ PT cells, together with induction of the mesenchymal markers VIM (Vimentin) and TAGLN (Transgelin) in SUN1+ PT cells and adjacent stromal cells. The regions outlined by dotted boxes in the left panels are shown at higher magnification in the corresponding panels on the right. Representative images from four biological replicates per genotype are shown. Stage: postnatal day 9; Scale bar: 50 μm.

Because epithelial dysfunction in cystic kidney disease is commonly associated with increased proliferation (40), we next examined cell proliferation in mutant kidneys. Ki67 staining demonstrated increased proliferation following Hnf1b deletion, including within Sun1-positive PT-derived epithelial cells and cortical nephrogenic regions, and quantification confirmed a significant increase in the percentage of Sun1-positive cells co-expressing Ki67 compared with controls (Supplemental Figure 7A). RNA-seq analysis additionally identified increased expression of Igf2, a mitogenic growth factor, in Hnf1b-deficient PT cells (Supplemental Table 1). Consistent with a potential role in driving epithelial proliferation, HCR-FISH revealed minimal Igf2 expression in control kidneys, whereas mutant kidneys exhibited increased Igf2 signal in Sun1-positive PT-derived cells and cortical nephrogenic regions, with quantification confirming a significant increase in Igf2-positive area compared with controls (Supplemental Figure 7B). Together, these findings demonstrate that loss of Hnf1b disrupts epithelial organization, drives a proliferative epithelial response, and induces expression of the mitogenic factor Igf2 in PT-derived cells.

Loss of Hnf1b in PTs activates Wnt-associated transcriptional programs and stromal remodeling

RNA-seq analysis of FACS-isolated Sunl-positive PT cells identified canonical Wnt/β-catenin signaling as one of the most significantly enriched pathways following Hnf1b deletion (Supplemental Figure 2B). Consistent with this enrichment, Hnf1b-deficient PT cells exhibited increased expression of multiple Wnt ligand genes, including Wnt11, Wnt7b, Wnt4, Wnt5a, Wnt5b, and Wnt16, with particularly strong induction of Wnt11 and Wnt7b (Supplemental Table 1). In parallel, mutant kidneys demonstrated increased expression of the canonical Wnt/β-catenin target genes LEF1 and PAX2 (Figures 6A and 6B) (41,42). In control kidneys, LEF1 expression was largely restricted to medullary stromal cells, with only rare Sun1-negative cortical cells showing detectable signal (Figure 6A). Following Hnf1b deletion, LEF1 expression was markedly expanded within the cortex and was detected in both Sun1-positive PT-derived epithelial cells and adjacent Sun1-negative stromal cells. Similarly, whereas PAX2 expression in control kidneys was strongest in the collecting duct and only weakly detected in Sun1-positive PT cells, Hnf1b-deficient Sun1-positive PT cells exhibited strong ectopic PAX2 expression (Figure 6B). Together, these findings indicate that loss of Hnf1b induces acquisition of a Wnt ligand-expressing epithelial state accompanied by activation of canonical Wnt/β-catenin-dependent transcriptional programs.

Figure 6. Loss of Hnf1b in PT cells activates canonical Wnt target genes in tubular and adjacent stromal cells.

Figure 6.

Open in a new tab

(A) In control kidneys, LEF1, a Wnt/β-catenin target gene, is largely restricted to the medulla, whereas mutant kidneys exhibit expanded cortical LEF1 expression in both SUN1+ PT–derived cells and adjacent SUN1− stromal cells. Yellow arrowheads indicate cortical LEF1+ stromal cells. Dotted boxes denote regions shown at higher magnification in the corresponding panels on the right.

(B) PAX2, another Wnt/β-catenin target gene, is ectopically expressed in Hnf1b-deficient SUN1+ PT cells compared with controls. Dotted boxes denote regions shown at higher magnification in the corresponding right panels.

(A, B) Representative images from four biological replicates per genotype are shown. Stage: postnatal day 9; Scale bar: 100 μm.

Activation of Wnt signaling was not restricted to PT-derived epithelial cells but was also associated with remodeling of adjacent stromal populations. While PBX1-positive stromal cells were only sparsely present in the cortex of control kidneys, they were markedly expanded following Slc34a1Cre-mediated Hnf1b deletion (Figure 7A). Mutant kidneys also exhibited increased expression of PDGFRB in stromal cells together with enhanced interstitial collagen deposition detected by Picrosirius Red staining (Figure 7B and Supplemental Figure 8), indicating stromal expansion and progressive interstitial fibrosis. Collectively, these results demonstrate that loss of Hnflb in PT cells activates Wnt/β-catenin-associated transcriptional programs within both epithelial and stromal compartments and promotes remodeling of the renal interstitium.

Figure 7. Hnf1b deficiency in PT cells promotes expansion of the cortical stromal compartment.

Figure 7.

Open in a new tab

(A) PBX1-positive stromal cells are markedly expanded within the cortical interstitium of Hnf1b mutant kidneys and accumulate around renal tubules. In control kidneys, PBX1 expression is largely restricted to the medulla, with only rare PBX1-positive stromal cells present in the cortex. Quantification revealed a significant increase in PBX1-positive cortical area in mutant kidneys compared with controls.

(B) In control kidneys, PDGFRB expression is largely confined to sparse interstitial cells, with additional staining in glomeruli and Bowman’s capsule. In contrast, Hnf1b mutant kidneys exhibit marked expansion of PDGFRB-positive cells throughout the cortical tubulointerstitium. Quantification demonstrated a significant increase in PDGFRB-positive interstitial area in mutant kidneys compared with controls.

(A, B) Four biological replicates were analyzed per genotype. Each dot represents one animal, and the images are representative of these samples. Data are presented as mean ± SEM. Statistical significance was assessed using an unpaired two-tailed Student’s t test. **P < 0.01. Stage, postnatal day 9; Scale bars, 100 μm.

DISCUSSION

Our findings demonstrate that Hnf1b is required not only for nephron patterning during development but also for active maintenance of PT identity after segmental identity has been established. Using a post-specification deletion strategy, we show that loss of Hnf1b in established PT cells results in marked disruption of PT-specific transcriptional programs and ectopic induction of podocyte-associated genes, revealing a previously unappreciated degree of segmental plasticity within differentiated nephron epithelia. Importantly, activation of podocyte-associated genes in Hnf1b-deficient PT cells indicates engagement of an alternative nephron segment program rather than generalized dedifferentiation. Together, these findings establish Hnf1b as a critical regulator of PT identity and support a model in which differentiated nephron epithelia require continuous transcriptional enforcement to maintain segment-specific identity and suppress alternative nephron segment programs.

Loss of Hnf1b resulted in reduced expression of key PT identity genes, including Hnf4a, and widespread suppression of PT transport and metabolic programs. Previous studies showed that developmental Hnf1b haploinsufficiency delays PT differentiation and reduces expression of PT-enriched transport and metabolic genes (43), while transcriptional profiling of Hnf1b-deficient zebrafish PTs revealed broad suppression of solute-transporter genes (44). More recently, deletion of Hnf1b in renal tubular epithelial cells was shown to induce loss of epithelial differentiation and CKD-like pathology in adult kidneys, further supporting a postdevelopmental role for Hnf1b in maintenance of tubular epithelial homeostasis (24). Given that Hnf4a governs the transcriptional networks that define PT differentiation and function (6, 21, 45), loss of Hnf4a expression likely represents a key mechanistic link between Hnf1b deficiency and disruption of the PT differentiation program. Importantly, the Hnf1b–Hnf4a regulatory axis may also explain defects observed in the medullary DTL. Our previous study demonstrated that a subset of DTL cells is derived from the PT lineage and that Hnf4a is required for Aqp1 expression in the DTL, suggesting that Hnf4a acts during a PT-to-DTL transitional stage rather than in mature DTL cells (34). Consistent with this model, PT-derived DTL cells lose AQP1 expression following Hnf1b deletion, indicating impaired maintenance of DTL identity. Thus, disruption of Hnf4a-dependent transcriptional programs established in PT-derived precursor cells likely contributes to both PT and DTL abnormalities in Hnf1b-deficient kidneys.

Our findings also reveal an unanticipated role for Hnf1b in suppressing podocyte gene programs within differentiated PT cells. In zebrafish pronephros, knockdown of the Hnf1b orthologs hnf1aa and hnf1ab results in expansion of the wt1 expression domain into the region normally occupied by the PT segment, leading to the conclusion that Hnf1b suppresses podocyte fate during nephrogenesis (13). Because conditional deletion of Hnf1b in mice using Six2Cre or Wnt4Cre did not induce ectopic Wt1 expression (14, 16, 17), the zebrafish phenotype was generally interpreted as a developmental consequence of defective nephron patterning. Our results challenge this interpretation. By deleting Hnf1b after PT segmental identity is established, we demonstrate that differentiated mouse PT cells activate podocyte-associated genes, including Wt1 and Nphs1, following loss of Hnf1b. These findings suggest that the zebrafish and mouse phenotypes reflect a conserved function of Hnf1b in suppressing podocyte transcriptional programs within PT cells. Importantly, because early deletion models disrupt PT formation itself, they could not reveal this post-specification role.

In addition to transcriptional reprogramming, Hnf1b deficiency disrupted epithelial organization. Loss of Hnf1b resulted in reduced expression of E-cadherin (CDH1), induction of the mesenchymal markers VIM and TAGLN, and defects in apical-basal polarity. HNF1B loss has been shown to activate mesenchymal and profibrotic programs in renal epithelial cells (25). In ureteric bud–derived epithelia, Hnf1b deletion also disrupted cell–cell contacts, apicobasal polarity, and basement membrane organization (46). Similar abnormalities have been described in cyst-lining epithelia in polycystic kidney disease, suggesting that epithelial destabilization is a common feature of cystogenesis (38, 47, 48). Despite these abnormalities, Hnf1b-deficient cells remained organized as epithelial structures lining tubules and cysts, indicating partial destabilization of epithelial identity rather than complete epithelial collapse. These observations suggest that Hnf1b coordinates both the transcriptional and structural components of PT differentiation and that loss of Hnf1b creates a cellular environment permissive for cyst initiation.

In addition to disrupting PT identity and epithelial organization, Hnf1b deficiency was associated with increased epithelial proliferation and activation of developmental growth and signaling programs. Mutant kidneys exhibited increased Ki67 labeling together with induction of Igf2, a fetal growth factor that is highly expressed during nephrogenesis and subsequently downregulated following kidney maturation (49–51). Loss of Hnf1b was also accompanied by increased expression of multiple Wnt ligands, particularly Wnt7b and Wnt11, together with elevated expression of canonical Wnt/β-catenin target genes including Lef1 and Pax2. The induction of Lef1 is consistent with previous evidence that HNF1B restrains canonical Wnt signaling through direct transcriptional repression of Lef1 in renal epithelial cells (52). Because both IGF2 and Wnt signaling regulate cellular growth during kidney development, reactivation of these pathways may contribute to the hyperproliferative phenotype observed in Hnf1b-deficient PT cells. Activation of Wnt signaling was not restricted to the epithelium. Expansion of LEF1+ and PBX1+ stromal populations, together with increased numbers of PDGFRB-positive cells and enhanced interstitial collagen deposition, indicates activation of developmental epithelial-stromal signaling pathways and progressive interstitial remodeling. Our findings are consistent with recent evidence that HNF1B loss in adult renal tubular cells causes interstitial fibrosis and progressive CKD (24). These observations are also notable in light of the tubulointerstitial changes observed in patients with RCAD, in whom heterozygous HNF1B mutations are associated with hyperuricemic nephropathy and autosomal dominant tubulointerstitial kidney disease (53). Together, these findings suggest that the interstitial remodeling observed in our model may reflect a conserved pathological response to HNF1B dysfunction. Similar epithelial-stromal Wnt interactions have been implicated in renal fibrosis, where epithelial-derived Wnt ligands activate β-catenin signaling in neighboring stromal cells (54). Together with previous studies demonstrating that pharmacologic or genetic inhibition of canonical Wnt/β-catenin signaling ameliorates cystogenesis in mouse models of polycystic kidney disease (55), our findings support a model in which loss of Hnflb reactivates developmental growth and signaling pathways, including Igf2 and Wnt/β-catenin signaling, that contribute to epithelial proliferation, stromal remodeling, and cyst progression.

Overall, our findings demonstrate that mature nephron segments require continuous activity of identitymaintaining transcription factors to preserve their differentiated state and suppress alternative segment-specific programs. By extending the role of Hnf1b beyond early nephron patterning, this work identifies active maintenance of nephron segment identity as a fundamental requirement for epithelial homeostasis and reveals how disruption of this process can lead to epithelial destabilization, developmental pathway reactivation, and cystogenesis.

METHODS

Sex as a biological variable

Both male and female mice were used in this study, with equal representation of each sex. Mutant and control animals of both sexes were included in all analyses unless otherwise indicated. Sex-based differences were assessed, and no appreciable differences were observed between male and female mice across the measured outcomes. Therefore, data from male and female animals were pooled for subsequent analyses.

Generation of the conditional Hnf1b (Hnf1bc) mouse line

A conditional Hnf1b allele was generated by flanking exon 2 with loxP sites using CRISPR/Cas9–mediated genome editing, resulting a frameshift and loss of Hnf1b function upon Cre recombination. Two single-guide RNAs targeting intronic regions upstream (Sg299; ACTGTTGCTTGTGTCCCAGG) and downstream (Sg300; GTGTAACTACTTGTGTAGCA) of exon 2 were used together with single-stranded donor oligonucleotides containing loxP sequences. CRISPR reagents were delivered to fertilized zygotes by sequential electroporation, and edited embryos were transferred into pseudopregnant CD-1 females. Offspring were screened for loxP site insertion by PCR and validated by Sanger sequencing. One founder line (#1665) carrying both loxP sites was used to establish the Hnf1b conditional (Hnf1bc) mouse line. Genotyping PCR was performed using CCTTAGTTTCCCCTCCACCAAGA and CACCCTGAAGGCCTTTTCAGTGT. This reaction yields a 142-bp amplicon for the wild-type Hnf1b allele and a 200-bp amplicon for the conditional Hnf1b allele.

Mice and breeding strategy

PT-specific deletion of Hnf1b was achieved using the Slc34a1eGFPCre (Slc34a1Cre; JAX: 040319) allele, which drives constitutive Cre expression in differentiated PT cells (34). For lineage tracing and isolation of recombined PT cells, we used the Rosa26-Sun1 (JAX: 021039) and Rosa26-NuTRAP (JAX: 029899) reporter alleles. Rosa26-Sun1 expresses a SUN1-superfolder GFP fusion protein at the nuclear envelope following Cre-mediated recombination (56), enabling lineage tracing and histologic analysis of recombined cells. Rosa26-NuTRAP expresses EGFP-tagged ribosomal protein L10a following Cre-mediated recombination (57) and was used for fluorescence-activated cell sorting (FACS) and bulk RNA-seq analysis. For lineage-tracing experiments, Slc34a1Cre/Cre; Hnf1bc/+ mice were crossed with Hnf1bc/c; Rosa26Sun1/Sun1 mice to generate Hnf1b mutant mice (Slc34a1Cre/+; Hnf1bc/c; Rosa26Sun1/+) and littermate controls (Slc34a1Cre/+; Hnf1bc/+; Rosa26Sun1/+). For FACS and bulk RNA-seq experiments, the Rosa26-Sun1 allele was replaced with Rosa26-NuTRAP. All mice in this report were bred and maintained in a mixed genetic background. Animals were centrally managed by Northwestern University Center for Comparative Medicine (CCM), an animal care facility that operates within full compliance of the NIH guidelines. Mice were monitored daily and housed in a controlled environment with a 12-hour light/12-hour dark cycle, with ad libitum access to water and a standard chow diet. At the first sign of pain, suffering or distress, mice were euthanized. Humane end points were established to include lethargy, labored breathing, or swelling.

Fluorescence-activated cell sorting (FACS) and bulk RNA-seq

FACS and bulk RNA sequencing were performed on Hnf1b mutant and control kidneys, wherein Slc34a1Cre was used to activate the Rosa26-NuTrap reporter and delete the conditional Hnf1b allele. Kidneys at postnatal day 1 (P1) were dissociated using TrypLE Select Enzyme 10X (Gibco) and mechanical pipetting. Cells were washed, resuspended in PBS containing 1% FBS and 10 mM EDTA, and filtered through 40 μm nylon strainers. GFP-positive cells were isolated using a BD FACSAria SORP system at the Northwestern University RHLCCC Flow Cytometry Facility, supported by NIH grants 1S10OD011996-01 and 1S10OD026814-01. mRNA was isolated from total RNA using the NEBNext Poly(A) mRNA Magnetic Isolation Module (E7490L, New England Biolabs). Fragmentation of mRNA and cDNA synthesis were performed using NEBNext RNA First Strand Synthesis Module (E7525L) and NEBNext RNA Second Strand Synthesis Module (E6111L). The cDNA’s were processed to sequencing libraries using ThruPLEX DNA-seq 12S Kit (R400675 and R400695, Takara). Libraries were sequenced on Illumina NovaSeq X Plus or Element AVITI at the NUSeq Core facility at Northwestern University.

RNA-seq analysis

Paired-end RNA-seq reads were mapped to the UCSC mouse reference genome (mm10) using the STAR aligner (58). Only uniquely aligned reads were used for differential gene analysis. Gene-level read counts were obtained using FeatureCounts, with the following parameters: “-s 2 -O --fracOverlap 0.8” (59). Differential expression analysis was conducted using the DESeq2 package (60). Genes exhibiting an absolute fold-change > 2.0 and FDR < 0.01 were considered significantly differentially expressed. Gene ontology (GO) analysis was performed using EnrichR (61). Gene expression profiles of selected genes were visualized using single-cell RNA-seq datasets from mouse kidneys at embryonic day 18.5 and postnatal day 0 (GSE214024 and GSE275601) (34, 35). Dot plots and module score projections were generated in Seurat (62). Module scores for bulk RNA-seq differentially expressed genes were calculated using the AddModuleScore function and projected onto the UMAP embedding.

Immunofluorescence staining and microscopy

Kidneys from mutant and control animals of both sexes were analyzed. For immunofluorescence analyses, biological replicates consisted of kidneys collected from independent animals; two control and four mutant biological replicates were examined, unless otherwise indicated. Tissue preparation, staining and imaging were performed in parallel for each experiment to minimize technical variation. Sample size was determined by litter size and breeding outcomes. No formal sample size calculation was performed. No exclusion criteria were defined, and no animals or data points were removed from the analysis. Samples were processed in randomized order, and control and mutant kidneys were embedded within the same block to reduce batch effects. The investigator was aware of sample genotypes during processing and analysis. Kidneys were fixed in phosphate-buffered saline (PBS) containing 4% paraformaldehyde (PFA) for 20 minutes and then incubated overnight at 4°C in PBS containing 10% sucrose. Tissues were embedded in OCT compound (Thermo Fisher Scientific) and stored at −80°C. Cryosections (8 μm) were incubated overnight at 4°C in PBS containing 0.1% Triton X-100, 5% heat-inactivated sheep serum, and primary antibodies (Supplemental Table 2). Fluorophore-labeled secondary antibodies were sourced from Invitrogen or Jackson ImmunoResearch (Supplemental Table 2). All images were obtained using a Nikon Ti2 widefield microscope.

Hybridization Chain Reaction

Hybridization chain reaction (HCR) was performed as previously described with minor modifications (63, 64). Cryosections were washed in 1× PBS and subjected to autofluorescence bleaching using a combined light and hydrogen peroxide treatment. Sections were illuminated with a gooseneck LED desk lamp (5 V, 2 A output) in the presence of an H2O2-based chemical bleaching solution (C762T82, H1070-100ML-CS6; Spectrum Chemicals; Supplemental Table 3) at 4°C for 1 hour. After bleaching, sections were washed at room temperature in 1× PBS (3 × 10 minutes), PBS containing Tween-20 (3 × 5 minutes), and 5× saline sodium citrate with Tween-20 (5× SSC-T; 3 × 5 minutes), followed by a brief rinse in 1× PBS. Sections were then incubated in probe hybridization buffer for 30 minutes at 37°C, followed by overnight hybridization at 37°C with ssDNA probe sets targeting the following mouse transcripts: Mafb (NM_010658), Cldn5 (NM_013805), Nphs1 (NM_019459), Plat (NM_008872), and Igf2 (NM_001122737.2). The following day, sections were incubated in probe wash buffer for 30 minutes at 37°C, followed by two additional washes in probe wash buffer (2 × 15 minutes at 37°C) and washes in 5× SSC-T (3 × 5 minutes at room temperature). For signal amplification, sections were equilibrated in amplification buffer for 30 minutes at room temperature. The buffer was then replaced with amplification buffer containing Amplifier B1 DNA hairpins diluted according to the manufacturer’s instructions, and sections were incubated in the dark to allow hybridization chain reaction–mediated signal amplification. Slides were subsequently washed in 1× PBS (5 minutes) and 5× SSC-T (1 × 5 minutes followed by 2 × 30 minutes) in the dark. Nuclei were counterstained with Hoechst (1:2000 dilution; Invitrogen) for 10 minutes. After mounting, slides were kept at room temperature and protected from light until imaging. Detailed information regarding target genes, probe sequences, and amplifier hairpins is provided in Supplemental Table 4.

Histology and Picrosirius Red staining

Kidneys were fixed in 4% paraformaldehyde (PFA) in PBS overnight and submitted to the Mouse Histology & Phenotyping Laboratory (MHPL) at the Robert H. Lurie Comprehensive Cancer Center of Northwestern University, which is supported by the National Cancer Institute (NCI) P30CA060553. Paraffin sections (3 μm) were stained with hematoxylin and eosin or Picrosirius Red. Brightfield images were acquired using a Nikon Ti2 widefield microscope housed in the Center for Advanced Microscopy/Nikon Imaging Center (RRID: SCR_020996) at Northwestern University. For quantification of collagen deposition, Picrosirius Red–positive area was measured in ImageJ/Fiji using a uniform threshold applied to all images within the same experiment. Collagen deposition was expressed as the percentage of Picrosirius Red–positive area relative to the total analyzed tissue area. Measurements from multiple sections were averaged to generate one value per animal. Quantification was performed blinded to genotype.

Image and cell quantification

PDGFRB-positive, PBX1-positive, and Igf2-positive areas in kidney sections were quantified using ImageJ/Fiji from images acquired under identical imaging settings (65). For each marker, a single threshold was applied uniformly to all images within the same experiment, including control and mutant samples, to define positive signal. Positive area was quantified using the ImageJ area fraction function and expressed as the percentage of the analyzed region of interest (ROI). Igf2 signal was quantified from HCR images, whereas PDGFRB and PBX1 signals were quantified from immunostained kidney sections. Glomeruli, large vessels, and tissueprocessing artifacts were excluded from analysis. PDGFRB-positive area was quantified within the cortical tubulointerstitium, whereas PBX1-positive area and Igf2 signal were quantified within the renal cortex. Approximately three nonoverlapping cortical fields measuring 389.6 × 389.6 μm were analyzed per animal across multiple kidney sections. Field-level measurements were averaged to generate one value per animal. Four animals were analyzed per genotype, with each animal treated as one biological replicate. Quantification was performed in a blinded manner. Cell proliferation was assessed by immunofluorescent staining for Ki67. Approximately three nonoverlapping fields measuring 389.6 × 389.6 μm were analyzed per animal across multiple kidney sections using QuPath (v0.5.1) (66). The numbers of GFP-positive cells and GFP/Ki67 doublepositive cells were determined for each field, and the proliferation index was calculated as the percentage of GFP/Ki67 double-positive cells relative to the total number of GFP-positive cells. Quantification was performed in a blinded manner.

Statistical analyses

All statistical analyses were performed using GraphPad Prism. Comparisons between two groups were conducted using unpaired two-tailed Student’s t-tests. Sample sizes were not predetermined using statistical methods, and data distributions were not formally assessed for normality. Data are presented as mean ± SEM. Statistical significance was defined as P < 0.05 (*), P < 0.01 (**), and P < 0.001 (***).

Supplementary Material

1

Acknowledgments

We thank the Robert H. Lurie Comprehensive Cancer Center of Northwestern University in Chicago, IL, for the use of the Flow Cytometry Core Facility, which provided cell sorting services. The Lurie Cancer Center is supported in part by NCI Cancer Center Support Grant P30 CA060553. We also thank the Northwestern University NUSeq Core Facility for sequencing services.

Funding Support

This work is the result of NIH funding, in whole or in part, and is subject to the NIH Public Access Policy. Through acceptance of this federal funding, the NIH has been given a right to make the work publicly available in PubMed Central. DK125577, DK131052, DK127634, DK120847, and DK120842 to JSP.

Footnotes

Study approval

All animal experiments were approved by the Institutional Animal Care and Use Committees (IACUC) at Northwestern University and Cincinnati Children’s Hospital Medical Center and were conducted in accordance with the NIH Guide for the Care and Use of Laboratory Animals.

Conflict of interest

The authors have declared that no conflict of interest exists.

Data availability

The bulk RNA sequencing data generated in this study have been deposited in the Gene Expression Omnibus (GEO) under accession number GSE318534. All other data supporting the findings of this study are available from the corresponding author upon reasonable request.

REFERENCES

  • 1.McMahon AP. Development of the Mammalian Kidney. Curr Top Dev Biol. 2016;117:31–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Schnell J, Achieng M, and Lindström NO. Principles of human and mouse nephron development. Nature Reviews Nephrology. 2022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Curthoys NP, and Moe OW. Proximal tubule function and response to acidosis. Clin J Am Soc Nephrol. 2014;9(9):1627–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Wessely O, Cerqueira DM, Tran U, Kumar V, Hassey JM, and Romaker D. The bigger the better: determining nephron size in kidney. Pediatr Nephrol. 2014;29(4):525–30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Blaine J, Chonchol M, and Levi M. Renal control of calcium, phosphate, and magnesium homeostasis. Clin J Am Soc Nephrol. 2015;10(7):1257–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Marable SS, Chung E, and Park JS. Hnf4a is required for the development of Cdh6-expressing progenitors into proximal tubules in the mouse kidney. J Am Soc Nephrol. 2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Lee JW, Chou CL, and Knepper MA. Deep Sequencing in Microdissected Renal Tubules Identifies Nephron Segment-Specific Transcriptomes. J Am Soc Nephrol. 2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Chen L, Lee JW, Chou CL, Nair AV, Battistone MA, Paunescu TG, et al. Transcriptomes of major renal collecting duct cell types in mouse identified by single-cell RNA-seq. Proc Natl Acad Sci U S A. 2017;114(46):E9989–E98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Ledru N, Wilson PC, Muto Y, Yoshimura Y, Wu H, Li D, et al. Predicting proximal tubule failed repair drivers through regularized regression analysis of single cell multiomic sequencing. Nat Commun. 2024;15(1):1291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Kusaba T, Lalli M, Kramann R, Kobayashi A, and Humphreys BD. Differentiated kidney epithelial cells repair injured proximal tubule. Proc Natl Acad Sci U S A. 2014;111(4):1527–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Kirita Y, Wu H, Uchimura K, Wilson PC, and Humphreys BD. Cell profiling of mouse acute kidney injury reveals conserved cellular responses to injury. Proc Natl Acad Sci U S A. 2020;117(27):15874–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Desgrange A, and Cereghini S. Nephron Patterning: Lessons from Xenopus, Zebrafish, and Mouse Studies. Cells. 2015;4(3):483–99. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Naylor RW, Przepiorski A, Ren Q, Yu J, and Davidson AJ. HNF1beta Is Essential for Nephron Segmentation during Nephrogenesis. J Am Soc Nephrol. 2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Heliot C, Desgrange A, Buisson I, Prunskaite-Hyyrylainen R, Shan J, Vainio S, et al. HNF1B controls proximal-intermediate nephron segment identity in vertebrates by regulating Notch signalling components and Irx1/2. Development. 2013;140(4):873–85. [DOI] [PubMed] [Google Scholar]
  • 15.Naylor RW, and Davidson AJ. Hnf1beta and nephron segmentation. Pediatr Nephrol. 2014;29(4):659–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Massa F, Garbay S, Bouvier R, Sugitani Y, Noda T, Gubler MC, et al. Hepatocyte nuclear factor 1beta controls nephron tubular development. Development. 2013;140(4):886–96. [DOI] [PubMed] [Google Scholar]
  • 17.Fiorentino A, Christophorou A, Massa F, Garbay S, Chiral M, Ramsing M, et al. Developmental Renal Glomerular Defects at the Origin of Glomerulocystic Disease. Cell reports. 2020;33(4):108304. [DOI] [PubMed] [Google Scholar]
  • 18.Igarashi P, Shao X, McNally BT, and Hiesberger T. Roles of HNF-1beta in kidney development and congenital cystic diseases. Kidney Int. 2005;68(5):1944–7. [DOI] [PubMed] [Google Scholar]
  • 19.Raaijmakers A, Corveleyn A, Devriendt K, van Tienoven TP, Allegaert K, Van Dyck M, et al. Criteria for HNF1B analysis in patients with congenital abnormalities of kidney and urinary tract. Nephrol Dial Transplant. 2015;30(5):835–42. [DOI] [PubMed] [Google Scholar]
  • 20.Clissold RL, Hamilton AJ, Hattersley AT, Ellard S, and Bingham C. HNF1B-associated renal and extra-renal disease-an expanding clinical spectrum. Nat Rev Nephrol. 2015;11(2):102–12. [DOI] [PubMed] [Google Scholar]
  • 21.Marable SS, Chung E, Adam M, Potter SS, and Park JS. Hnf4a deletion in the mouse kidney phenocopies Fanconi renotubular syndrome. JCI Insight. 2018;3(14). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Aboudehen K, Noureddine L, Cobo-Stark P, Avdulov S, Farahani S, Gearhart MD, et al. Hepatocyte Nuclear Factor-1beta Regulates Urinary Concentration and Response to Hypertonicity. J Am Soc Nephrol. 2017;28(10):2887–900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Gresh L, Fischer E, Reimann A, Tanguy M, Garbay S, Shao X, et al. A transcriptional network in polycystic kidney disease. Embo J. 2004;23(7):1657–68. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Isnard P, Makinistoglu MP, Leibovici M, Levinsohn J, Zimmermann N, Cohen C, et al. HNF1B integrates signals in a feed-forward loop driving kidney disease progression. Science. 2026;392(6795):eaea3219. [DOI] [PubMed] [Google Scholar]
  • 25.Chan SC, Zhang Y, Shao A, Avdulov S, Herrera J, Aboudehen K, et al. Mechanism of Fibrosis in HNF1B-Related Autosomal Dominant Tubulointerstitial Kidney Disease. J Am Soc Nephrol. 2018;29(10):2493–509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Patel V, Williams D, Hajarnis S, Hunter R, Pontoglio M, Somlo S, et al. miR-17~92 miRNA cluster promotes kidney cyst growth in polycystic kidney disease. Proc Natl Acad Sci U S A. 2013;110(26):10765–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Hajarnis SS, Patel V, Aboudehen K, Attanasio M, Cobo-Stark P, Pontoglio M, et al. Transcription Factor Hepatocyte Nuclear Factor-1beta (HNF-1beta) Regulates MicroRNA-200 Expression through a Long Noncoding RNA. J Biol Chem. 2015;290(41):24793–805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Lakhia R, Hajarnis S, Williams D, Aboudehen K, Yheskel M, Xing C, et al. MicroRNA-21 Aggravates Cyst Growth in a Model of Polycystic Kidney Disease. J Am Soc Nephrol. 2016;27(8):2319–30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Kompatscher A, de Baaij JHF, Aboudehen K, Hoefnagels A, Igarashi P, Bindels RJM, et al. Loss of transcriptional activation of the potassium channel Kir5.1 by HNF1beta drives autosomal dominant tubulointerstitial kidney disease. Kidney Int. 2017;92(5):1145–56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Chan SC, Zhang Y, Pontoglio M, and Igarashi P. Hepatocyte nuclear factor-1beta regulates Wnt signaling through genome-wide competition with beta-catenin/lymphoid enhancer binding factor. Proc Natl Acad Sci U S A. 2019;116(48):24133–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Weisser I, Eckberg K, D’Amico S, Buttram D, and Aboudehen K. Ablation of Long Noncoding RNA Hoxb3os Exacerbates Cystogenesis in Mouse Polycystic Kidney Disease. J Am Soc Nephrol. 2024;35(1):41–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.D’Amico S, Dar U, Eckberg K, Weisser I, Hossain C, Bronstein R, et al. Loss of Snhg5 disrupts cell-cycle regulation without altering cystogenesis in a mouse model of polycystic kidney disease. Sci Rep. 2026;16(1):4869. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Ma Z, Gong Y, Patel V, Karner CM, Fischer E, Hiesberger T, et al. Mutations of HNF-1beta inhibit epithelial morphogenesis through dysregulation of SOCS-3. Proc Natl Acad Sci U S A. 2007;104(51):20386–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Chung E, Nosrati F, Adam M, Potter A, Sayed M, Ahn C, et al. Proximal Tubule Cells Contribute to the Thin Descending Limb of the Loop of Henle during Mouse Kidney Development. J Am Soc Nephrol. 2025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Rudman-Melnick V, Adam M, Stowers K, Potter A, Ma Q, Chokshi SM, et al. Single-cell sequencing dissects the transcriptional identity of activated fibroblasts and identifies novel persistent distal tubular injury patterns in kidney fibrosis. Sci Rep. 2024;14(1):439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Dehghani-Ghobadi Z, Chung E, Sayed M, Ahn C, Choi HA, Aamoum A, et al. Constitutive YAP activation in distal nephron segments disrupts epithelial identity and nephron patterning. JCI Insight. 2026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Nielsen S, Pallone T, Smith BL, Christensen EI, Agre P, and Maunsbach AB. Aquaporin-1 water channels in short and long loop descending thin limbs and in descending vasa recta in rat kidney. Am J Physiol. 1995;268(6 Pt 2):F1023–37. [DOI] [PubMed] [Google Scholar]
  • 38.Wilson PD. Apico-basal polarity in polycystic kidney disease epithelia. Biochim Biophys Acta. 2011;1812(10):1239–48. [DOI] [PubMed] [Google Scholar]
  • 39.Wilson PD. Epithelial cell polarity and disease. Am J Physiol. 1997;272(4 Pt 2):F434–42. [DOI] [PubMed] [Google Scholar]
  • 40.Lee K, Gusella GL, and He JC. Epithelial proliferation and cell cycle dysregulation in kidney injury and disease. Kidney Int. 2021;100(1):67–78. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Filali M, Cheng N, Abbott D, Leontiev V, and Engelhardt JF. Wnt-3A/beta-catenin signaling induces transcription from the LEF-1 promoter. J Biol Chem. 2002;277(36):33398–410. [DOI] [PubMed] [Google Scholar]
  • 42.Deacon P, Concodora CW, Chung E, and Park J-S. β-catenin regulates the formation of multiple nephron segments in the mouse kidney. Scientific Reports. 2019;9(1):15915. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Niborski LL, Paces-Fessy M, Ricci P, Bourgeois A, Magalhaes P, Kuzma-Kuzniarska M, et al. Hnf1b haploinsufficiency differentially affects developmental target genes in a new renal cysts and diabetes mouse model. Dis Model Mech. 2021;14(5). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Sander V, Salleh L, Naylor RW, Schierding W, Sontam DM, O’Sullivan JM, et al. Transcriptional profiling of the zebrafish proximal tubule. Am J Physiol Renal Physiol. 2019. [DOI] [PubMed] [Google Scholar]
  • 45.Yoshimura Y, Muto Y, Omachi K, Miner JH, and Humphreys BD. Elucidating the Proximal Tubule HNF4A Gene Regulatory Network in Human Kidney Organoids. J Am Soc Nephrol. 2023;34(10):1672–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Desgrange A, Heliot C, Skovorodkin I, Akram SU, Heikkila J, Ronkainen VP, et al. HNF1B controls epithelial organization and cell polarity during ureteric bud branching and collecting duct morphogenesis. Development. 2017;144(24):4704–19. [DOI] [PubMed] [Google Scholar]
  • 47.Muto S, Aiba A, Saito Y, Nakao K, Nakamura K, Tomita K, et al. Pioglitazone improves the phenotype and molecular defects of a targeted Pkd1 mutant. Hum Mol Genet. 2002;11(15):1731–42. [DOI] [PubMed] [Google Scholar]
  • 48.Chea SW, and Lee KB. TGF-beta mediated epithelial-mesenchymal transition in autosomal dominant polycystic kidney disease. Yonsei Med J. 2009;50(1):105–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Amri K, Freund N, Duong Van Huyen JP, Merlet-Benichou C, and Lelievre-Pegorier M. Altered nephrogenesis due to maternal diabetes is associated with increased expression of IGF-II/mannose-6-phosphate receptor in the fetal kidney. Diabetes. 2001;50(5):1069–75. [DOI] [PubMed] [Google Scholar]
  • 50.Bach LA, and Hale LJ. Insulin-like growth factors and kidney disease. Am J Kidney Dis. 2015;65(2):327–36. [DOI] [PubMed] [Google Scholar]
  • 51.Levinsohn J, Grindel S, Dumoulin B, Abedini A, Conte C, Huang AZ, et al. Single-cell spatial mapping of human kidney development implicates the microenvironment in guiding cell fate decisions. Nat Genet. 2026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Chan SC, Hajarnis SS, Vrba SM, Patel V, and Igarashi P. Hepatocyte nuclear factor 1beta suppresses canonical Wnt signaling through transcriptional repression of lymphoid enhancer-binding factor 1. J Biol Chem. 2020;295(51):17560–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Izzi C, Dordoni C, Econimo L, Delbarba E, Grati FR, Martin E, et al. Variable Expressivity of HNF1B Nephropathy, From Renal Cysts and Diabetes to Medullary Sponge Kidney Through Tubulo-interstitial Kidney Disease. Kidney Int Rep. 2020;5(12):2341–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Maarouf OH, Aravamudhan A, Rangarajan D, Kusaba T, Zhang V, Welborn J, et al. Paracrine Wnt1 Drives Interstitial Fibrosis without Inflammation by Tubulointerstitial Cross-Talk. J Am Soc Nephrol. 2016;27(3):781–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Li A, Xu Y, Fan S, Meng J, Shen X, Xiao Q, et al. Canonical Wnt inhibitors ameliorate cystogenesis in a mouse ortholog of human ADPKD. JCI Insight. 2018;3(5). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Mo A, Mukamel EA, Davis FP, Luo C, Henry GL, Picard S, et al. Epigenomic signatures of neuronal diversity in the mammalian brain. Neuron. 2015;86(6):1369–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Roh HC, Tsai LT, Lyubetskaya A, Tenen D, Kumari M, and Rosen ED. Simultaneous Transcriptional and Epigenomic Profiling from Specific Cell Types within Heterogeneous Tissues In Vivo. Cell reports. 2017;18(4):1048–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29(1):15–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Liao Y, Smyth GK, and Shi W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics. 2014;30(7):923–30. [DOI] [PubMed] [Google Scholar]
  • 60.Love MI, Huber W, and Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15(12):550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Kuleshov MV, Jones MR, Rouillard AD, Fernandez NF, Duan Q, Wang Z, et al. Enrichr: a comprehensive gene set enrichment analysis web server 2016 update. Nucleic Acids Res. 2016;44(W1):W90–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Hao Y, Hao S, Andersen-Nissen E, Mauck WM 3rd, Zheng S, Butler A, et al. Integrated analysis of multimodal single-cell data. Cell. 2021;184(13):3573–87 e29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Choi HMT, Schwarzkopf M, Fornace ME, Acharya A, Artavanis G, Stegmaier J, et al. Third-generation in situ hybridization chain reaction: multiplexed, quantitative, sensitive, versatile, robust. Development. 2018;145(12). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Dirks RM, and Pierce NA. Triggered amplification by hybridization chain reaction. Proc Natl Acad Sci U S A. 2004;101(43):15275–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al. Fiji: an open-source platform for biological-image analysis. Nat Methods. 2012;9(7):676–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Bankhead P, Loughrey MB, Fernandez JA, Dombrowski Y, McArt DG, Dunne PD, et al. QuPath: Open source software for digital pathology image analysis. Sci Rep. 2017;7(1):16878. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHPP2026.08.12.744527v1-supplement-1.pdf (11KB, pdf)

Data Availability Statement

The bulk RNA sequencing data generated in this study have been deposited in the Gene Expression Omnibus (GEO) under accession number GSE318534. All other data supporting the findings of this study are available from the corresponding author upon reasonable request.

Articles from bioRxiv are provided here courtesy of Cold Spring Harbor Laboratory Preprints

RESOURCES