When drug repurposing backfires: antagonistic effects of ivermectin on cisplatin therapy in oral cancer

Abstract

Background

Cisplatin (CIS) remains the gold standard chemotherapeutic agent for the management of oral cancer. However, its clinical efficacy is frequently limited by chemoresistance and dose-dependent toxicities. Ivermectin (IVM), a well-established antiparasitic agent with emerging anticancer properties, has been proposed as a potential adjuvant capable of enhancing the antitumor efficacy of CIS.

Methods

In vitro experiments were conducted on HN9 oral squamous cell carcinoma cells, while OEC normal epithelial cells served as control. The experimental evaluation comprised the MTT assay for cell viability, Annexin V/propidium iodide (PI) staining for apoptosis detection, cell cycle distribution analysis, quantitative real-time PCR (RT-qPCR) for the assessment of apoptotic, anti-apoptotic, and inflammatory gene expression, and oxidative stress assay.

Results

Contrary to expectations, the CIS–IVM combination demonstrated an antagonistic interaction in HN9 cells. This was evidenced by reduced cytotoxicity of the combination treatment compared to CIS monotherapy, as determined by the MTT assay. Additionally, the combination attenuated CIS-induced S-phase arrest and was associated with decreased expression of pro-apoptotic markers (BAX and Caspase-3). Differential modulation of TNF-α expression and glutathione levels further suggested complex interactions affecting inflammatory and oxidative stress pathways. These findings indicate that IVM may interfere with CIS-induced cytotoxicity, potentially through its antioxidant and anti-inflammatory properties.

Conclusions

The present study demonstrated an unexpected antagonistic interaction between CIS and IVM in HN9 oral cancer cells. Further investigations are warranted to elucidate the underlying molecular mechanisms and to determine whether similar effects occur in other oral cancer models or in vivo settings.

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1186/s40360-026-01198-w.

Highlights

Reduced cytotoxicity of the cisplatin-ivermectin combination compared to cisplatin alone in HN9 oral cancer cells.

Attenuation of S-phase cell cycle arrest when ivermectin is combined with cisplatin.

The combination treatment showed diminished expression of apoptotic markers (BAX and Caspase-3) compared to cisplatin alone.

Differential effects on TNF-α expression and glutathione levels between single-drug and combination treatments.

Ivermectin appears to attenuate the cytotoxic, pro-apoptotic, and cell cycle arresting effects of cisplatin in the oral cancer cell line.

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1186/s40360-026-01198-w.

Background

Oral cancer remains a major global health burden, characterized by high morbidity and mortality and substantial functional and psychosocial consequences for affected patients [1]. The disease most commonly arises within the oral cavity and may involve the gingiva, tongue, lips, floor of the mouth, and buccal mucosa, with a strong propensity for local invasion and regional metastasis [2]. Malignant transformation is driven by uncontrolled cellular proliferation, genomic instability, and dysregulated apoptotic mechanisms, ultimately leading to tumor formation, tissue destruction, and disease progression. Tobacco use and excessive alcohol consumption remain the principal risk factors for oral cancer, acting synergistically to promote carcinogenesis [3, 4]. Additional etiological contributors include ultraviolet radiation exposure, human papillomavirus (HPV) infection, inadequate intake of fruits and vegetables, genetic susceptibility, and potentially malignant oral disorders such as leukoplakia [5]. Importantly, early detection of oral cancer markedly improves treatment responsiveness and survival outcomes, underscoring the urgent need for improved preventive, diagnostic, and therapeutic strategies [6].

In this context, ongoing research continues to focus on elucidating the molecular pathways involved in oral carcinogenesis and identifying novel therapeutic targets. Advances in cancer biology have facilitated the development of more precise treatment approaches aimed at enhancing therapeutic efficacy while minimizing toxicity. These efforts are critical to improving prevention strategies, enabling earlier diagnosis, and optimizing clinical outcomes for patients with oral malignancies [7, 8].

Cisplatin (CIS), a platinum-based chemotherapeutic agent introduced in the 1960s, remains a cornerstone in the treatment of various solid tumors, including head and neck cancers, lung cancer, and testicular malignancies [9, 10]. Its antineoplastic activity is primarily mediated through the formation of intra- and inter-strand DNA crosslinks, which disrupt DNA replication and transcription, ultimately triggering cell cycle arrest and apoptosis in rapidly proliferating cancer cells [11, 12]. The CIS-configuration of the molecule is essential for its biological activity, allowing aquation within the intracellular environment and subsequent covalent binding to DNA bases [12]. Despite its clinical effectiveness, the therapeutic use of CIS is limited by severe dose-dependent toxicities, including nephrotoxicity, ototoxicity, and neurotoxicity, which significantly compromise patient quality of life and restrict long-term treatment regimens [13]. Consequently, considerable research effort has been directed toward developing less toxic platinum analogues and exploring combination strategies that may enhance antitumor efficacy while reducing adverse effects. Notably, the success of CIS has stimulated broader interest in metal-based chemotherapeutics as viable cancer treatment options [14].

Ivermectin (IVM) is a well-established antiparasitic agent with an extensive safety record in both human and veterinary medicine. In recent years, it has attracted growing attention as a potential anticancer agent following evidence from multiple preclinical studies demonstrating its inhibitory effects on cancer cell proliferation [15]. IVM has shown anticancer activity across a range of malignancies, including breast, colon, and lung cancers, through modulation of several key oncogenic pathways [16]. Among its proposed mechanisms, IVM inhibits the WNT/β-catenin signaling pathway, which is frequently dysregulated in cancer and contributes to tumor growth and therapeutic resistance [17]. In addition, IVM interferes with the Akt/mTOR signaling axis, promotes autophagy, and activates p21-activated kinase 1 (PAK1), collectively leading to growth inhibition and cancer cell death [18].

Importantly, IVM has also been reported to enhance the efficacy of conventional chemotherapeutic agents, raising the possibility of dose reduction and toxicity mitigation. Furthermore, its ability to target cancer stem cells, key drivers of tumor recurrence and metastasis, suggests a potential role in improving long-term disease control and preventing relapse [16].

Combination therapy represents a central strategy in modern oncology, leveraging multiple agents to target complementary molecular pathways, enhance therapeutic efficacy, and overcome drug resistance. This approach has gained increasing relevance with the emergence of drug repurposing strategies, whereby existing medications are combined with standard anticancer treatments to improve clinical outcomes and personalize therapy [19, 20].

Accordingly, the present study aimed to investigate the anticancer effects of combining IVM with CIS in oral cancer cells in vitro. Based on evidence from other cancer models demonstrating the anticancer and chemosensitizing properties of IVM, we hypothesized that IVM would synergistically enhance CIS-induced cytotoxicity and apoptosis. This hypothesis was evaluated through a comprehensive assessment of cell viability (MTT assay), apoptosis induction, cell cycle distribution, expression of apoptotic, anti-apoptotic, and inflammatory genes using quantitative PCR, and analysis of oxidative stress parameters.

Materials and methods

Materials

Normal Oral Epithelial (OEC) and Human Tongue Squamous Cell Carcinoma (HN9) cell lines were sourced from the Nanotechnology Research Centre (NTRC) at the British University in Egypt (Cairo, Egypt). IVM was provided in powder form by Sigma-Aldrich, while CIS was acquired from Mylan Pharmaceuticals (Greece). The cell culture medium, Dulbecco’s Modified Eagle’s Medium (DMEM), along with fetal bovine serum (FBS), was obtained from Gibco (Thermo Fisher Scientific, USA). An antibiotic-antimycotic mixture containing 100 U/mL of penicillin, 0.1 U/mL of streptomycin, and 0.25 µg/mL of amphotericin B was procured from Lonza^® (USA).

Cell culture

In a high-glucose DMEM solution formulated with 10% FBS and 1% antibiotic/antimycotic mixture, OEC and HN9 cells were incubated at 37 °C and 5% CO₂ in a humidified incubator until 80% confluency, as mentioned in previous studies [21].

Cell viability assay (MTT assay)

In a 96-well plate, OEC and HN9 cells were seeded (10 × 10³ cells/well) and incubated for 24 h. The cells were treated with serial dilutions of CIS (ranging from 64 to 1 µM) and IVM (ranging from 30 to 0.94 µM). After 48 h of incubation, the drug solutions were removed and replaced with fresh culture medium containing 5 mg/ml MTT solution. After a 4-hour incubation, the supernatant was carefully removed, and 100 µL of DMSO was added to each well to dissolve the formazan crystals that had formed. The violet colour of the formazan crystals produced by viable cells was assessed using a microplate reader (Multiscan GO; USA) at 570 nm. The 50% and 20% inhibitory concentrations (IC₅₀ and IC₂₀) of the drugs were calculated using nonlinear regression with Confidence Interval (CI) 95%, utilizing GraphPad Prism software. An additional combination experiment was performed using CIS and IVM at starting concentrations of 100 µM each (100–0.78 µM).

The combination index (CI) was calculated to assess the interaction between the researched drugs, whether it was synergistic, additive, or antagonist. This assessment was conducted using the Chou-Talalay method according to the following equation:

Combination index (CI) =

Where, d1 and d2 are the respective concentrations of IVM and CIS used in combination to reach 50% cell viability, and D1 and D2 are the concentrations of the drug caused 50% cell viability when used alone. The effect of the combination is reported to be synergistic if CI < 0.8, additive if CI ranges from 0.8 to 1.2, and antagonist if CI > 1.2 [22].

Apoptosis assay

In T-75 flasks, 4 × 10⁶ cells were initially seeded and incubated overnight to ensure proper adherence. The following day, fresh medium served as the control group, while cells were treated with the IC₂₀ of CIS, IVM (1.79 μm), and a combination of both. To prepare cell pellets, the drug-treated cells were trypsinized, washed twice with PBS, and centrifuged for 5 min. The resulting cell pellets were resuspended in PBS and kept on ice until ready for flow cytometry analysis. Next, 1 µL of Annexin V-FITC solution and 5 µL of dissolved PI were added to 100 µL of cell suspension from each sample, followed by a 15-minute incubation in the dark on ice. Finally, 400 µL of ice-cold 1× binding buffer was added to each sample. Apoptotic cells were identified using a CytoFlex flow cytometer (Beckman Coulter, CA, USA), and the data were analyzed using the CytExpert software (Beckman Coulter, CA, USA).

Cell cycle analysis

Three separate experiments were performed to analyze the cell cycle. In the initial assay, cells were treated with CIS_IC20, IVM (1.79 µM), and a combination of both, while fresh medium served as the control. In the second experiment, the groups were treated with the CIS_IC20, IVM _IC50, and their combination, with fresh medium used as the control. An additional experiment was conducted using CIS _IC50, IVM _IC50, and their combination, with fresh medium used as the control, and the results are presented as Supplementary Data I. For all experiments, cell fixation involved resuspending the cell pellets in 2 mL of 60% cold ethanol, maintaining them at 4 °C, and washing with PBS [21]. The fixed cells were subsequently resuspended in 1 mL of nucleic acid staining solution and incubated in the dark at 37 °C for 20 min. Flow cytometry analysis was conducted using CytExpert software (Beckman Coulter, CA, USA), with at least 10,000 events recorded for each sample.

Apoptosis/proinflammatory-related markers expression

Expression levels of apoptotic markers (BAX and Caspase-3), anti-apoptotic marker (BCL-2), and inflammatory marker (TNF-α) were assessed in both experiments by real-time quantitative polymerase chain reaction (RT-qPCR) analysis. Data analysis was conducted using the 2 − ΔΔCt method. Cells were seeded in T-25 flasks and exposed to the respective drugs for 48 h. RNA was extracted from the cell pellets using an RNA extraction kit (QIAGEN, Hilden, Germany). Subsequently, complementary DNA (cDNA) was synthesized through reverse transcription using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, MA, USA). The synthesized cDNA was then amplified and quantified using SYBR Green Supermix (Bio-Rad) on a Bio-Rad RT-qPCR system [23]. GAPDH was used as a reference housekeeping gene. The primer sequences utilized in the experiments are detailed in Table 1.

Table 1.

The sequence of the primers utilized in the study

Gene	Forward primer	Reverse primer
GAPDH	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG
BAX	GCCTCCTCTCCTACTTTG	CTCAGCCCATCTTCTTCC
BCL2	ACAGGAGCTATACTCCAGGACA	GATCATACCCGTCATGGGGATA
Caspase-3	CATGGAAGCGAATCAATGGACT	CTGTACCAGACCGAGATGTCA
TNF-α	ATGTTGTAGCAAACCCTCAAGC	AGGACCTGGGAGTAGATGAGG

Oxidative marker assay

The concentration of reduced glutathione (GSH), expressed in mg/dl, was measured in HN9 cells to evaluate oxidative stress levels following treatment with different drug concentrations. Two independent experiments were performed. In the first experiment, cells were cultured with CIS_IC20, IVM (1,79 μm), and their combinations. In the second experiment, the cells were treated with CIS_IC20, IVM_IC50, and CIS_IC20+IVM_IC50 combinations. GSH levels were measured using a commercial colorimetric kit (Bio-Diagnostic). Cell lysates were prepared for analysis as described in the kit protocol. The assay is based on the reduction of 5,5’-dithiobis (2-nitrobenzoic acid) (DNTB) by GSH within the sample, producing a yellow product, 5-thio-2-nitrobenzoic acid (TNB) [24]. The absorbance of TNB was measured at 405 nm using a microplate reader.

Statistical analysis

Statistical analysis was carried out using one-way or two-way ANOVA, followed by post-hoc Tukey’s test, using GraphPad Prism software (version 6.0). The results are presented as mean ± standard deviation (SD), and differences were considered statistically significant at p < 0.05.

Results

Cell viability assay (MTT assay)

MTT assays were conducted to assess the effects of CIS and IVM on the viability of OEC and HN9 cells. The cells were treated with serial dilutions of both drugs individually: CIS (64 µM -1 µM) and IVM (30 µM – 0.94µM) for 48 h. A dose-dependent decrease in cell viability was observed in both cell lines following exposure to CIS (1–64 µM) and IVM (1–30 µM) concentrations. Subsequently, the IC₅₀ and IC₂₀ values for each drug were calculated. CIS exhibited an IC₅₀ value of 15.2 µM in OEC cells and 11.5 µM in HN9 cells, whereas the IC₂₀ value was 4.5 µM in the HN9 cell line (Fig. 1A). For IVM, the IC₅₀ values were 12.36 µM in OEC cells and 9.2 µM in HN9 cells, with an IC₂₀ value of 6 µM in HN9 cells (Fig. 1B).

Fig. 1.

MTT assays. (A) MTT assay results using CIS serial dilutions in OEC and HN9 cell lines. (B) MTT assay results using IVM serial dilutions on OEC and HN9 cell lines. (C) MTT assay using IVM-safe concentration and IC₂₀ of CIS on HN9 cells. (D) MTT assay using the IC₅₀ of IVM and IC₂₀ of CIS in HN9 cells. (E) MTT assay showing the IC₅₀ of CIS + IVM combination. Cells were incubated for 2 days, and the results are expressed as mean viability ± SD. All samples were analyzed in six replicates, and the experiment was conducted three independent times. Statistical analysis was calculated using one-way ANOVA followed by Tukey’s post-hoc test

A combination of CIS and IVM was employed in the MTT assay to assess the potential synergistic interaction between CIS and IVM. Initially, HN9 cells were treated with a combination of the IC₂₀ of CIS (4.5 µM) and a non-toxic dose of IVM (1.79 µM), which maintained cell viability of > 90. The results revealed that no statistical difference in cell viability was detected between the CIS_IC20 and CIS_IC20+IVM treated groups, with mean values of cell viability 75.67 ± 1.52 and 73.67 ± 1.12, respectively (p > 0.05) (Fig. 1C), suggesting that no beneficial effect was observed using the CIS and IVM combination at these concentrations.

To further validate the previous observations, the experiment was repeated in the present study using CIS_IC20, IVM_IC50 (9.2 µM), and their combination to determine whether a higher concentration of IVM could potentiate the cytotoxic effects of CIS. The mean cell viability values in CIS_IC20 were 77.59%± 2.6, IVM_IC50 was 44.8% ± 0.8, and with CIS_IC20+IVM_IC50 was 45.47% ± 2.14, indicating no significant difference between the IVM_IC50 and CIS_IC20+IVM_IC50 groups. These results further showed the antagonistic interaction between CIS and IVM as IVM is cancelling or attenuating the cytotoxic effect of CIS when administered together (Fig. 1D). All subsequent assays were performed using the previously used methods to confirm this observation.

We conducted another experiment using CIS_IC50 combined with IVM _IC50. Similar to our previous results, this combination resulted in a marked reduction of the cytotoxic effect of CIS, suggesting a potential antagonistic interaction. The results are presented as a Supplementary Data I.

An additional combination experiment using serial dilutions of CIS and IVM at starting concentration of 100 µM each (100–0.78 µM). The IC₅₀ of the CIS + IVM combination was calculated to be 27 µM (Fig. 1E). The combination index (CI) calculated for CIS and IVM was 5.283 (> 1), suggesting an antagonistic interaction between both agents.

Apoptosis assay

HN9 cells were treated with CIS_IC20, IVM (1.79 µM), and their combination. Annexin V/PI staining was used to investigate the apoptotic response induced by each drug, both individually and in combination. A significant reduction in in the proportion of viable cells was observed in the CIS₂₀-treated group relative to the control, IVM, and CIS_IC20+IVM groups (p < 0.0001), with mean values of 77.58 ± 1.45, 92.72 ± 0.77, 92.43 ± 0.78, and 90.59 ± 0.88, respectively. Moreover, no significant difference was observed in the percentage of dead cells between the CIS_IC20 and CIS_IC20+IVM groups (p = 0.1746), with mean values of 10.28 ± 0.84 and 9.1 ± 0.66, respectively. Furthermore, the percentage of cells in the early apoptotic phase was significantly elevated in the CIS_IC20 group (7.71 ± 1.11, p < 0.0001) compared with the control (1.52 ± 1.11), IVM (0.53 ± 0.067), and CIS _IC20 + IVM groups (0.70 ± 0.020). IVM reduced early apoptosis compared with the control group; however, this difference was not statistically significant (p = 0.3201).

Collectively, these findings indicate that CIS_IC20 alone triggers higher apoptosis in HN9 cells than IVM or CIS_IC20+ IVM, implying a potential antagonistic interaction between the two drugs (Fig. 2A, B).

Fig. 2.

Apoptosis assay via Annexin V/PI demonstrating the percentage of apoptosis. (A) Dot plots (Annexin V-FITC versus PI) showing the population of living, early apoptotic, late apoptotic, and dead cells following exposure to CIS, IVM, and CIS + IVM for 48 h. (B) Statistical analysis of the percentage of live cells, dead cells, and cells in the late and early apoptosis phases. Cells were incubated for 2 days, and the results are presented as mean ± SD. All samples were analyzed in triplicate (n = 3), and the experiment was repeated three times. Statistical analysis was calculated using one-way ANOVA followed by Tukey’s post-hoc test

Cell cycle analysis

To further validate the observed potential antagonistic interaction between CIS and IVM, cell cycle analysis was performed in two independent experiments using different drug concentrations, following the MTT assay. In the first experiment, the cells were treated with CIS_IC20 (4.5 µM), IVM (1.79 µM), and a combination of both. In the second experiment, the cells were cultured with CIS_IC20, IVM_IC50, and CIS_IC20+IVM_IC50. In the first experiment, CIS_IC20 significantly arrested the cell cycle in the S phase by 3.5 folds increase compared to the control group (p < 0.0001), while there was a reduction by 0.7-fold in the CIS_IC20+IVM group relative to the control group (Fig. 3A, C).

Fig. 3.

Analysis of cell cycle progression in HN9 cells after treatment with CIS, IVM, and CIS + IVM combination for 48 h. (A-B) Histograms showing the distribution of cell populations across the different cell cycle phases. (C-D) Statistical analysis showing the percentage of cells in each phase of the cell cycle. Results are demonstrated as mean ± SD. All samples were analyzed in triplicate (n = 3), and the experiment was repeated three times. Statistical analysis was calculated using one-way ANOVA then Tukey’s post-hoc test

The results of the second experiment revealed that CIS_IC20 induced the most significant cell cycle arrest in the S phase compared to the IVM_IC50, CIS_IC20+IVM, and CIS_IC20+IVM_IC50 groups (p < 0.0001) (Fig. 3B, D). Collectively, CIS_IC20 induced S phase cell cycle arrest by a 1.6- fold increase compared to the combination groups.

The expression of apoptosis and proinflammatory markers

The expression of apoptotic markers (BAX, Caspase-3), anti-apoptotic marker (BCL-2), and inflammatory marker (TNF-α) were measured in HN9 cells through two independent experiments to validate previous assay results. Consistent with the MTT assay, the cell cycle analysis was performed in the first experiment, where cells were exposed to CIS_IC20 (4.5 µM), IVM (1.79 µM), and CIS_IC20+IVM combination. In the second experiment, the cells were treated with CIS_IC20, IVM_IC50, and a CIS_IC20+IVM_IC50 combination.

In both experimental setups, exposure to CIS_IC20 significantly upregulated BAX expression in HN9 cells compared to all other control and experimental groups(p < 0.0001). In contrast, IVM, either individually or in combination with CIS_IC20, markedly lowered BAX expression levels, indicating that the presence of IVM attenuates the cytotoxic effect of CIS on HN9 cells (Fig. 4A, B).

Fig. 4.

Quantitative determination of apoptotic/proinflammatory-related markers. The cells were incubated for 2 days with CIS, IVM, and CIS+IVM. (A, B) BAX expression; (C, D) BCL-2 expression; (E, F)Caspase-3 expression; and (G, H) TNF-α expression. Gene expression levels were normalized against GAPDH. Results are demonstrated as mean ± SD. All samples were analyzed in triplicate (n = 3), and the experiment was conducted three times. Statistical analysis was calculated using one-way ANOVA followed by Tukey's post-hoc test

In contrast, BCL-2 expression was markedly reduced in the first experimental setup, where cells were treated with CIS_IC20, revealing approximately a five-fold reduction compared to the control, IVM, and CIS_IC20+IVM groups (p < 0.0001). However, in the second experiment, no significant difference was observed between The CIS_IC20 and IVM_IC50 treated groups. The CIS_IC20-treated group exhibited a significantly lower level of BCL-2 expression compared with the CIS_IC20+IVM_IC50 group (p = 0.0024) (Fig. 4C, D).

Caspase-3 expression was assessed in both experimental models. In the first experimental setting, exposure of HN9 cells to CIS_IC20 significantly upregulated caspase-3 expression, with a 2.93-fold increase relative to the control, IVM, and CIS_IC20+IVM groups (p < 0.0001). In the second experimental setting, no statistically significant difference was observed between the CIS_IC20 and CIS_IC20+IVM_IC50 treated groups (p = 0.0882). However, caspase-3 expression in the CIS_IC20 group was markedly elevated than that in the IVM_IC50-treated group (p = 0.0083) (Fig. 4E, F).

Regarding TNF-α expression, cells treated with IVM exhibited the most pronounced reduction in TNF-α expression compared to all other experimental groups. In contrast, CIS_IC20 resulted in the highest TNF-α expression, demonstrating a 1.6-fold increase relative to the control, IVM, and CIS_IC20+IVM groups (p < 0.0001). In the second experimental setup, the CIS_IC20+IVM_IC50 treated group displayed the greatest upregulation of TNF-α, with a 3.4-fold elevation compared to the control, CIS_IC20, and IVM_IC50 groups (p < 0.0001) (Fig.4 G, H).

Oxidative stress

Oxidative stress levels in HN9 cells were evaluated by measuring GSH concentrations (mg/dl), following an experimental design similar to that employed in the MTT assay, cell cycle analysis, and PCR. CIS_IC20 induced the most pronounced reduction in GSH concentration, indicating an increase in oxidative stress and triggering apoptosis (p < 0.0001) in the first experimental setup (Fig. 5A). In the second experiment, CIS_IC20+IVM_IC50 led to the most significant reduction in GSH concentration levels (p < 0.0001), with respect to the control, CIS_IC20, and IVM_IC50 treated groups. Additionally, CIS_IC20 group showed a significant decrease in GSH concentration in comparison to that in the IVM_IC50 group (p < 0.0001) (Fig. 5B).

Fig. 5.

Oxidative stress determination by measuring reduced glutathione levels in HN9 cells after (A) The concentration of GSH in cells treated with CIS_IC20, IVM, and CIS_IC20+IVM (B) The concentration of GSH in cells treated with CIS_IC20, IVM_IC50, and CIS_IC20+IVM_IC50. The obtained data are presented as the mean ± SD. Statistical analysis was performed using one-way ANOVA, followed by Tukey’s post-hoc test

Discussion

The present study provides a comprehensive evaluation of the biological interaction between CIS and IVM in oral epithelial cancer models, integrating functional, molecular, and biochemical endpoints. In a previous study by our research group, Tantawy et al. (2025) investigated the anticancer potential of doxorubicin (DOX) in combination with ivermectin (IVM) in the HN9 tongue squamous cell carcinoma cell line. In that study, the combination of IVM at its safe concentration (1.79 µM) with the IC₂₀ of DOX exhibited promising synergistic effects [25]. These findings suggest that combining IVM with standard chemotherapeutic agents, even at low doses, may potentiate their cytotoxic effects while reducing associated toxicity and resistance. Building on these findings, the present study aimed to evaluate the combinatorial effect of CIS with IVM using a similar experimental design and drug concentration strategy, employing the safe concentration of IVM (1.79 µM) in combination with the IC₂₀ of CIS. Upon observing antagonistic interactions, additional concentration-dependent experiments were conducted to confirm these findings.

While both agents demonstrated independent cytotoxic effects, their combined administration consistently resulted in an antagonistic interaction, whereby IVM attenuated CIS-induced cytotoxicity, apoptosis, cell cycle arrest, and stress signaling. These findings challenge assumptions that repurposed agents with reported anticancer activity necessarily enhance the efficacy of standard chemotherapeutics and underscore the importance of mechanistic validation prior to clinical translation.

CIS remains a cornerstone in the treatment of head and neck squamous cell carcinoma due to its ability to induce DNA crosslinking, replication stress, and mitochondrial-mediated apoptosis [12, 13]. In line with this established mechanism, CIS produced a clear dose-dependent reduction in cell viability in both OEC and HN9 cell lines, accompanied by robust induction of apoptosis, S-phase cell cycle arrest, depletion of intracellular glutathione, and transcriptional activation of pro-apoptotic genes. These coordinated responses reflect effective engagement of DNA damage checkpoints and execution of programmed cell death, hallmarks of CIS sensitivity [26].

IVM alone also reduced cell viability at higher concentrations, consistent with accumulating evidence that it exerts anticancer effects through modulation of chloride channels, mitochondrial membrane potential, autophagy, and WNT/β-catenin signaling [27, 28]. However, despite this intrinsic cytotoxic potential, IVM failed to enhance CIS-mediated effects when administered concurrently. Instead, both low and high concentrations of IVM neutralized or diminished CIS-induced cytotoxicity, suggesting a pharmacodynamic antagonism rather than additive toxicity. This phenomenon highlights the context-dependent nature of drug repurposing and aligns with emerging evidence that pleiotropic agents may exert protective effects against specific chemotherapeutic stressors [29].

The antagonistic interaction was particularly evident in apoptosis assays and gene expression analyses. CIS robustly increased apoptosis in HN9 cells, accompanied by upregulation of BAX and caspase-3 and downregulation of BCL-2, consistent with activation of the intrinsic mitochondrial apoptotic pathway. Although the IVM-alone group exhibited a non-significant trend toward lower early apoptotic cells compared with the untreated control, this unexpected observation should be interpreted with caution, as it may reflect experimental variability or a potential cytoprotective effect of low-dose IVM reported in non-malignant and inflammatory models [30]. Further studies are required to determine whether this finding has biological significance. Notably, CIS + IVM co-treatment failed to further increase apoptotic cell death and partially reversed CIS-induced apoptotic signaling.

These findings suggest that IVM interferes with mitochondrial apoptotic commitment, potentially by stabilizing mitochondrial membranes, modulating ion fluxes, or activating cytoprotective stress-response pathways. Similar anti-apoptotic or cytoprotective effects of IVM have been reported in non-malignant and inflammatory contexts, where it attenuates oxidative injury and suppresses caspase activation [30].

Cell cycle analysis further reinforced this interpretation. CIS-induced S-phase arrest is a canonical response to DNA crosslinking and replication fork stalling, enabling repair or apoptotic elimination of damaged cells [31]. In both experimental models, CIS alone produced the most pronounced S-phase accumulation, whereas co-treatment with IVM significantly reduced this effect. Attenuation of checkpoint enforcement may permit partial cell cycle progression despite unresolved DNA damage, thereby reducing apoptotic signaling and overall cytotoxic efficacy. Disruption of DNA damage response pathways is a recognized mechanism of chemoresistance and has been linked to reduced treatment efficacy in head and neck cancers [32, 33].

Inflammatory signaling patterns further illuminate the divergent biological effects of CIS and IVM. CIS induced the highest TNF-α expression, reflecting activation of stress-associated inflammatory pathways that contribute to both cytotoxicity and tissue injury. In contrast, IVM exerted a strong suppressive effect on TNF-α, consistent with its well-documented anti-inflammatory and immunomodulatory properties [34]. While suppression of inflammatory cytokines may be beneficial in non-malignant inflammatory conditions, it may inadvertently blunt stress-mediated apoptotic signaling in cancer cells. The pronounced TNF-α upregulation observed with high-dose CIS + IVM co-treatment likely reflects a compensatory stress response rather than effective pro-apoptotic signaling, particularly given the absence of corresponding increases in apoptosis. This dissociation underscores the complexity of inflammatory signaling in chemotherapy response and supports the notion that IVM modulates CIS-induced stress pathways in a dose- and context-dependent manner.

Oxidative stress analysis provided additional mechanistic insight. CIS-induced depletion of intracellular GSH confirms the central role of oxidative stress in CIS-mediated apoptosis [35, 36]. In the initial experimental model, IVM partially mitigated GSH depletion, suggesting antioxidant or redox-buffering activity that may protect cells from CIS-induced oxidative injury. Such antioxidant effects of IVM have been described in neuronal and inflammatory models and may contribute to its cytoprotective profile [37, 38]. Interestingly, in the second experimental setup, the CIS _IC20+IVM_IC50 combination produced the most pronounced GSH depletion without a corresponding increase in apoptosis. This uncoupling of oxidative stress from apoptotic execution suggests disruption of downstream death signaling, a phenomenon reported when mitochondrial or caspase-dependent pathways are inhibited despite severe redox imbalance [39].

Taken together, these findings indicate that IVM interferes with multiple interconnected mechanisms underlying CIS cytotoxicity, including DNA damage signaling, cell cycle checkpoint activation, apoptotic execution, inflammatory stress responses, and redox homeostasis. Rather than acting synergistically, IVM appears to buffer or reroute CIS-induced stress signals, resulting in reduced anticancer efficacy. From a translational perspective, this antagonistic interaction has important implications. While IVM has shown promise as an anticancer agent in selected models, its concurrent use with platinum-based chemotherapy in oral squamous cell carcinoma may be counterproductive. These results emphasize the necessity of rigorous preclinical evaluation of drug–drug interactions, particularly for repurposed agents with broad biological effects [31].

This study has limitations. Further investigations using a wider range of CIS and IVM concentrations are required to confirm the observed antagonistic interaction. The combination index (CI) was calculated manually using the Chou–Talalay equation based on a single fixed-ratio experimental design. Consequently, 95% confidence intervals for the calculated CI values could not be estimated. Validation in multiple cancer cell lines is necessary to enhance the generalizability of the findings. Mechanistic studies are warranted to elucidate the underlying pathways contributing to the observed antagonism. Future studies should extend these observations to three-dimensional tumor models and in vivo systems to better capture tumor–microenvironment interactions and pharmacokinetic influences. Additionally, sequential rather than concurrent treatment strategies may reveal whether temporal separation can mitigate antagonism or uncover context-specific therapeutic windows.

Conclusion

This study provides clear evidence that IVM antagonizes CIS-induced cytotoxicity in oral cancer cells by interfering with key apoptotic, cell-cycle, inflammatory, and oxidative-stress pathways. These data strongly discourage the uncritical co-administration of IVM with CIS in oral cancer therapy and emphasize the necessity of rigorous mechanistic validation in drug repurposing strategies. Optimizing cancer treatment requires not only identifying agents with anticancer activity but also a precise understanding of how their biological effects interact within complex combination regimens.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

R.T. contributed to the acquisition, analysis, interpretation of data and writing the manuscript S.R. contributed to the design of the work, acquisition, analysis, interpretation of data, writing and revising the manuscript A.G. contributed to the writing and revising the manuscript D.G.contributed to the conception, design of the work, acquisition, writing and revising the manuscript.

Funding

This study was self-funded.

Data availability

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

All authors reviewed the manuscript and agreed to publish.

Disclosure

The manuscript leverages AI exclusively in the Introduction and Discussion, while we explicitly state the accepted limitations of AI-based assistance.

Competing interests

The authors declare no competing interests.