Skip to main content
The EMBO Journal logoLink to The EMBO Journal
. 2001 Apr 2;20(7):1605–1619. doi: 10.1093/emboj/20.7.1605

An unusual C2-domain in the active-zone protein piccolo: implications for Ca2+ regulation of neurotransmitter release

Stefan H Gerber, Jesus Garcia 1, Josep Rizo 1, Thomas C Südhof 2
PMCID: PMC145501  PMID: 11285225

Abstract

Ca2+ regulation of neurotransmitter release is thought to require multiple Ca2+ sensors with distinct affinities. However, no low-affinity Ca2+ sensor has been identified at the synapse. We now show that piccolo/aczonin, a recently described active-zone protein with C-terminal C2A- and C2B-domains, constitutes a presynaptic low-affinity Ca2+ sensor. Ca2+ binds to piccolo by virtue of its C2A-domain via an unusual mechanism that involves a large conformational change. The distinct Ca2+-binding properties of the piccolo C2A- domain are mediated by an evolutionarily conserved sequence at the bottom of the C2A-domain, which may fold back towards the Ca2+-binding sites on the top. Point mutations in this bottom sequence inactivate it, transforming low-affinity Ca2+ binding (100–200 µM in the presence of phospholipids) into high-affinity Ca2+ binding (12–14 µM). The unusual Ca2+-binding mode of the piccolo C2A-domain reveals that C2-domains are mechanistically more versatile than previously envisaged. The low Ca2+ affinity of the piccolo C2A-domain suggests that piccolo could function in short-term synaptic plasticity when Ca2+ concentrations accumulate during repetitive stimulation.

Keywords: C2-domain/Ca2+-binding protein/exocytosis/neurotransmitter release/synaptic plasticity

Introduction

Synaptic transmission constitutes the major mechanism by which neurons communicate. When an action potential depolarizes a presynaptic nerve terminal, Ca2+ influx triggers neurotransmitter release, leading to a postsynaptic signal (Katz, 1969). Ca2+ probably stimulates release by binding to Ca2+ sensors of moderately high affinity (∼10 µM at the calyx synapse; Bollmann et al., 2000; Schneggenburger and Neher, 2000). Ca2+ stimulates two components of release: a fast synchronous component that accounts for the majority of release, and a slow asynchronous component that accounts for only a small percentage (Geppert et al., 1994; Goda and Stevens, 1994; Atluri and Regehr, 1998). Both components exhibit a high degree of Ca2+ cooperativity (Dodge and Rahamimoff, 1967; Goda and Stevens, 1994). In addition to acutely triggering release, Ca2+ regulates release during short- and long-term presynaptic plasticity (Katz and Miledi, 1968; Zucker, 1989; Dobrunz et al., 1997; Dittman et al., 2000). Short-term synaptic plasticity is at least partly induced by accumulation of residual Ca2+ after repeated stimulations of a synapse (Zucker, 1989; Delaney and Tank, 1994; Kamiya and Zucker, 1994). Short-term synaptic plasticity shapes the properties of neuronal networks, and is of major importance for understanding how the brain processes information (Dobrunz and Stevens, 1999; Gil et al., 1999). Modeling of the synaptic responses during repetitive stimulation revealed that besides the Ca2+ sensors that trigger release, at least two additional Ca2+ sensors have to be invoked to explain the observed dynamics of short-term synaptic plasticity (Dittman et al., 2000).

The various actions of Ca2+ at the synapse are probably mediated by separate Ca2+ sensors with distinct regulatory functions. Several Ca2+-binding proteins have been identified that could potentially serve as synaptic Ca2+ sensors, e.g. synaptotagmins I–XIII, rabphilin, Doc2s, synapsins and calmodulin. Interestingly, most candidate Ca2+ sensors at the synapse bind Ca2+ via a widespread Ca2+-binding module, the C2-domain (Brose et al., 1992; Davletov and Südhof, 1993; Shirataki et al., 1993; Li et al., 1994, 1995; Südhof and Rizo, 1996). C2-domains are often found in membrane trafficking and signal transduction proteins where they mediate the Ca2+-dependent recruitment of proteins to phospholipid membranes (reviewed in Nalefski and Falke, 1996; Rizo and Südhof, 1998). All C2-domains are composed of a stable β-sandwich with flexible loops on top and at the bottom. Most (but not all) C2-domains bind Ca2+. Usually 2–3 Ca2+ ions are coordinated at closely spaced sites, which are formed by the flexible top loops (Sutton et al., 1995; Shao et al., 1996; Essen et al., 1997; Perisic et al., 1998; Rizo and Südhof, 1998; Sutton and Sprang, 1998; Ubach et al., 1998, 1999). Intrinsic Ca2+ binding tends to be non-cooperative and of low affinity, probably because the bound Ca2+ ions contain empty coordination sites. For example, in the synaptotagmin I C2A-domain, the intrinsic Ca2+-binding affinities for the first, second and third Ca2+ ions are ∼50 µM, ∼500 µM and >10 mM, respectively (Ubach et al., 1998; Fernández-Chacón et al., 2001). The majority of C2-domains that bind to Ca2+ also bind to phospholipid membranes and form a Ca2+–C2-domain–phospholipid complex (Davletov and Südhof, 1993; Shao et al., 1996; Uellner et al., 1997; Lomasney et al., 1999; Perisic et al., 1999). Strikingly, phospholipid membranes increase the overall Ca2+ affinity of all C2-domains tested (2–20 µM), and convert non-cooperative Ca2+ binding into cooperative Ca2+ binding (Davletov and Südhof, 1993; Li et al., 1995; Shao et al., 1996; Hixon et al., 1998; Nalefski et al., 1998; Perisic et al., 1998). Phospholipids probably achieve this effect by providing additional coordination sites for the incompletely ligated Ca2+ ions at the top of the C2- domains (Zhang et al., 1998; Verdaguer et al., 1999). The Ca2+ affinity of C2-domains in the presence of phospholipids is thought to be their most physiologically relevant Ca2+ affinity because their intrinsic Ca2+ affinity is too low to be involved in intracellular signaling. This conclusion is supported by the fact that Ca2+-dependent phospholipid binding is the normal function for C2-domains, at least in signal transduction proteins such as protein kinase C (PKC) and phospholipases.

Functionally, the best characterized putative synaptic Ca2+ sensor is the synaptic vesicle protein synaptotagmin I (Perin et al., 1990; Geppert et al., 1991; Brose et al., 1992; reviewed in Südhof and Rizo, 1996). Using knockout mice, synaptotagmin I was shown to be essential for fast Ca2+-triggered release in the hippocampus, but not for release stimulated by Ca2+-independent agonists such as α-latrotoxin and hypertonic sucrose (Geppert et al., 1994). In knockin mice containing a point mutation in the C2A-domain of synaptotagmin I, the overall Ca2+ affinity of synaptotagmin I correlated with the apparent Ca2+ affinity of transmitter release (Fernández-Chacón et al., 2001), suggesting that synaptotagmin I is a major Ca2+ sensor for fast transmitter release. However, all of the currently characterized synaptic Ca2+-binding proteins, including synaptotagmin I, have relatively high Ca2+ affinities (<20 µM). Although many synaptic proteins could potentially serve as Ca2+ sensors (e.g. >10 synaptotagmins, calmodulin, rabphilin, synapsins), no synaptic Ca2+-binding protein has yet been identified that has a lower Ca2+ affinity consistent with selective activation by the increased levels of residual Ca2+ that accumulate during repetitive stimulation. In the current study, we have examined the Ca2+-binding properties of a recently discovered active-zone protein called aczonin (Wang et al., 1999) or piccolo (Fenster et al., 2000). Our studies reveal that by virtue of its C-terminal C2A-domain, piccolo/aczonin exhibits unusual Ca2+-binding properties that differ from those of any other C2-domain containing synaptic Ca2+ sensors. These results uncover a novel mechanism of Ca2+ binding by a C2-domain in which Ca2+ binds cooperatively to the C2-domain and induces a conformational change in the entire domain. The relatively low apparent Ca2+ affinity of piccolo even in the presence of phospholipids is consistent with a potential role as a Ca2+ sensor in short-term synaptic plasticity when high Ca2+ concentrations accumulate during repetitive stimulation.

Results

Structure of the C2-domains of piccolo

Databank searches identified an anonymous human cDNA sequence (KIAA0559; DDBJ/EMBL/GenBank accession No. AB011131) that exhibits a high degree of homology to the presynaptic active-zone protein bassoon (tom Diek et al., 1998). The homology extends over the entire KIAA0559 coding region except for the C-terminus, where KIAA0559 contains PDZ- and C2-domains that are absent from bassoon. Indeed, recently published studies of the mouse, chicken and rat homologs of KIAA0559, named aczonin (Wang et al., 1999) or piccolo (Fenster et al., 2000), revealed that KIAA0559 encodes a bassoon-like protein that is highly enriched in the active zone. Both bassoon and piccolo are large proteins (>400 kDa) primarily composed of zinc finger sequences and of sequences with a high propensity for coiled-coil formation. Piccolo and bassoon are synthesized in multiple alternatively spliced forms. Of these, alternative splicing of the C-terminus of piccolo is particularly noteworthy. It generates a less-abundant ‘long’ form that includes two C2-domains (referred to as C2A- and C2B-domains), and a more abundant ‘short’ form with only the single C2A-domain (Figure 1A; Wang et al., 1999). In independently isolated overlapping cDNA clones encoding the C-terminal half of rat piccolo, we generally confirmed the previously published sequences except that additional alternative splicing of piccolo N-terminal to the PDZ domain was observed (data not shown).

graphic file with name cde168f1.jpg

Fig. 1. Structure of piccolo/aczonin. (A) Domain structures of the short and long splice variants of piccolo/aczonin, and design of the recombinant GST fusion proteins used for the current experiments. Only the C-termini of two alternatively spliced variants of piccolo are shown, with residue numbers (corresponding to the rat short and the mouse long form; Wang et al., 1999; Fenster et al., 2000) indicated above the domains. (B) Sequence alignments of the C2-domains of mouse piccolo (mPic.), rat synaptotagmins I (rSI) and VII (rSVII) and rat rabphilin (rRb). On the left, ‘A’ and ‘B’ denote C2A- and C2B-domains, respectively. Residues present in at least 50% of the sequences are highlighted with a structure-based color code: yellow, top loops; blue, β-strands; green, bottom loops; red, bottom α-helix specific for C2B-domains of synaptotagmins and rabphilin. Aspartates and serines in the top loops involved in Ca2+ binding are highlighted in black and marked by arrowheads. (C) Structure of the Ca2+-binding sites of the synaptotagmin I C2A-domain (Ubach et al., 1998), and model for the Ca2+-binding sites of the piccolo C2A-domain based on the sequence homology between these domains (see B). Only the Ca2+ ligands are drawn. The positions of other residues are indicated by small solid circles along the curves that symbolize the two sequence loops that form the Ca2+-binding region (loops 1 and 3). The three Ca2+-binding sites are indicated as solid circles labeled Ca1, Ca2 and Ca3.

The presence of C2-domains in piccolo/aczonin suggests that it is a potential Ca2+ sensor at the active zone. The combination of the PDZ- and the C2A- domains in piccolo is attractive because it indicates a possible mechanism by which piccolo could be bound to a Ca2+-independent target via its PDZ-domain, and recruit additional Ca2+-dependent targets via the C2A-domain. As a first step towards understanding the function of piccolo, we analyzed the sequences of its C2-domains. Databank searches revealed that the piccolo C2A-domain is closely related to the C2A-domains of synaptotagmins and rabphilin (Figure 1B). The major difference between the C2A-domains of synaptotagmins and piccolo is that piccolo contains a unique bottom sequence of 11 residues between β-strands 3 and 4, which is absent from synaptotagmins. In the top loops, the piccolo C2A-domain includes all of the residues that are involved in Ca2+ binding in the synaptotagmin I C2A-domain (Ubach et al., 1998). This allows formulation of a model for potential Ca2+-binding sites in the piccolo C2A-domain (Figure 1C), which suggests that the Ca2+-binding properties of the piccolo C2A-domain should be similar to those of the synaptotagmin C2A- domains.

In contrast to the similarity between the C2A-domains of piccolo and synaptotagmin, the alternatively spliced C2B-domain of piccolo is quite different from other C2-domains in the databanks (Figure 1B). The piccolo C2B-domain lacks four of the five canonical aspartate residues involved in Ca2+ binding in C2-domains, suggesting that the piccolo C2B-domain does not function as a Ca2+-binding domain. In addition, the piccolo C2B-domain does not contain the bottom α-helix between β-strands 7 and 8 that is characteristic for C2B-domains in synaptotagmins or rabphilin (highlighted in red in the alignment of Figure 1B; Ubach et al., 1999), or the atypical sequences that characterize the RIM C2-domains (Wang et al., 1997, 2000). Other C2-domains lacking Ca2+-binding sites have been described previously, e.g. in PKCδ and synaptotagmins IV and XI (von Poser et al., 1997; Pappa et al., 1998). However, the piccolo C2B-domain is equally dissimilar to these C2-domains and to classical C2-domains, suggesting that the piccolo C2B-domain does not belong to a general class of atypical C2-domains (data not shown). Since the C2B-domain is present only in a minority of the piccolo transcripts and is unlikely to bind Ca2+, it was not investigated further in the present study.

Piccolo exhibits unusual Ca2+-binding properties

To test whether the C2A-domain of piccolo binds Ca2+ and to characterize its Ca2+-binding properties, we used a combination of circular dichroism (CD) and NMR spectroscopy. The CD spectrum of the Ca2+-free piccolo C2A-domain is characteristic for a β-sheet protein, and exhibits only slight changes upon addition of 30 mM Ca2+ (data not shown). A similar behavior was previously observed for the synaptotagmin I C2A-domain (Shao et al., 1997). NMR spectroscopy, however, revealed that Ca2+ induces major alterations in the 1H-15N heteronuclear single quantum correlation (HSQC) spectrum of the piccolo C2A-domain, demonstrating that Ca2+ binds to this domain (Figure 2A). These shifts were qualitatively different from those found in the synaptotagmin C2A-domain, in which Ca2+ binding selectively changes only 1H-15N HSQC cross-peaks from the Ca2+-binding region but not from any other part of the C2A-domain (Shao et al., 1996, 1998). In contrast, significant Ca2+-dependent shifts were observed for the majority of cross-peaks of the piccolo C2A-domain (Figure 2A), which suggests that Ca2+ binding to this domain results in a change of the entire piccolo C2A-domain. In addition to the widespread shifts in 1H-15N HSQC cross-peaks, Ca2+ also induced substantial resonance broadening due to dimerization (see below).

graphic file with name cde168f2.jpg

Fig. 2. Analysis of the Ca2+-binding properties of the piccolo C2A-domain by NMR spectroscopy. (A) 1H-15N HSQC spectra of the isolated C2A-domain from piccolo recorded in the absence (black contours) and presence (red contours) of 30 mM Ca2+. Spectra are superimposed to demonstrate widespread Ca2+-dependent cross-peak shifts. (B) Expansions illustrating the progressive changes in the cross-peaks caused by increasing concentrations of Ca2+. The cross-peaks shown are identified in (A) by arrows in the 1H-15N HSQC spectra. Cross-peak positions are displayed at 0.0, 1.0, 2.5, 4.0 and 30.0 mM Ca2+ from top to bottom. Note that in contrast to the gradual cross-peak movements observed for the synaptotagmin C2A-domain (Shao et al., 1996), the Ca2+-free cross-peaks disappear concomitant with the appearance of Ca2+-bound cross-peaks. (C) 1H-15N HSQC spectra of the mutant C2A-domain from piccolo with the double aspartate-to-alanine substitutions in the Ca2+-binding loops (D4668A/D4674A; Figure 1) in the absence (black contours) or presence (red contours) of 30 mM Ca2+. Note the lack of Ca2+-dependent cross-peak shifts in the mutant.

The two most likely causes for the widespread Ca2+-dependent shifts in 1H-15N HSQC cross-peaks of the piccolo C2A-domain are: (i) an overall conformational change, or (ii) a global instability of the Ca2+-free C2A-domain with stabilization of the domain by Ca2+ binding. To distinguish between these possibilities, we performed temperature-denaturation experiments monitored by CD. These demonstrated that the Ca2+-free piccolo C2A-domain is remarkably stable, with a denaturation temperature of 70°C, and thus is not an intrinsically unstable domain. Addition of 30 mM Ca2+ shifted the denaturation temperature to 80°C, similar to other C2A-domains (data not shown). Together, the CD and NMR data indicate that Ca2+ binding to the piccolo C2A-domain causes a general conformational change, suggesting a mechanism for Ca2+-dependent interactions that is quite distinct from the C2A-domain of synaptotagmin.

The large difference between the effects of Ca2+ on the C2A-domain of piccolo versus that of synaptotagmin is unexpected in view of the similarity between their presumptive Ca2+-binding sites (see Figure 1C). This difference was confirmed, however, by Ca2+ titrations monitored with 1H-15N HSQC spectra (Figure 2B). For the synaptotagmin I C2A-domain, incremental increases in Ca2+ cause progressive movements of cross-peaks from the Ca2+-free to the Ca2+-bound positions (Shao et al., 1996). The observation of three components along these titration curves demonstrated binding of three Ca2+ ions with intrinsic affinities of ∼50 µM to >10 mM Ca2+, and no binding cooperativity (Ubach et al., 1998; Fernández-Chacón et al., 2001). The progressive Ca2+-dependent movements of cross-peaks in the synaptotagmin I C2A-domain reflect a fast exchange between Ca2+-free and -bound states on the NMR time scale, as expected for a low-affinity Ca2+ sensor that does not exhibit significant conformational changes. A very different behavior was observed for the cross-peaks of the piccolo C2A-domain: cross-peaks characteristic for the Ca2+-free form disappeared with increasing Ca2+, with the concomitant appearance of the corresponding cross-peaks from the Ca2+-bound form. Thus, instead of a gradual progression, there was a digital switch (exemplified for the cross-peaks in the expansions of Figure 2B), reflecting a slow exchange between the Ca2+-free and -bound states. The slow exchange between Ca2+-free and -bound states implies that the on-rate(s) for Ca2+ binding to the piccolo C2A-domain is well below the diffusion limit, in support of the notion that Ca2+ binding involves a significant conformational change. Ca2+ titrations demonstrated that the piccolo C2A-domain exhibits an intrinsic Ca2+ affinity of ∼1.5 mM, and that binding is cooperative with an apparent Hill coefficient of >2 (Figure 8, Table I and data not shown). Although the slow exchange, low affinity and line broadening in the 1H-15N HSQC cross-peaks of the Ca2+-bound piccolo C2A-domain hinder determination of the exact number of Ca2+-binding sites, the Hill coefficient confirms binding of multiple Ca2+ ions, as predicted by the sequence alignment (Figure 1).

graphic file with name cde168f8.jpg

Fig. 8. NMR spectra of wild-type and mutant piccolo C2A-domains. (A and B) Superpositions of 1H-15N HSQC spectra of the wild-type piccolo C2A-domain (black contours) and the V4690S/V4691S mutant (red contours) in the absence (A) and presence (B) of saturating Ca2+ concentrations (30 mM for wild type and 10 mM for the mutant). (C) Expansions of 1H-15N HSQC spectra of wild-type piccolo C2A-domain, the V4690S/V4691S mutant (VV) and the V4688S/M4689S mutant (VM) acquired at the Ca2+ concentrations described on the left (in millimolar). The expansions illustrate the disappearance of a cross-peak from the Ca2+-free form and the concomitant appearance of the cross-peak from the Ca2+-bound form (identified by arrows in A and B) with increasing Ca2+ concentrations. (D) Ca2+ dependence of the intensity of the cross-peak from the Ca2+-bound form appearing in (C). The intensities were normalized to the intensity of the cross-peak at Ca2+ saturation. Solid lines represent curve fitting of the data to a standard Hill equation; the resulting Ca2+-binding parameters are summarized in Table I. For clarity, the plot only shows data obtained up to 5 mM Ca2+, but the fits were obtained using data up to 30 mM Ca2+ for wild type and up to 10 mM Ca2+ for the mutants (see Table I).

Table I. Ca2+ affinity and Ca2+ cooperativity of wild-type and mutant piccolo C2A-domains in isolation (intrinsic Ca2+ affinity) and in the presence of phospholipids (apparent Ca2+ affinity).

1. Intrinsic Ca2+ affinitiesa,b
Protein domains Kd Hillcoeff. N            
Piccolo C2A-domain 1.52 ± 0.18 mM 2.1 ± 0.2 4
Piccolo C2A-domain V4688S/M4689S 0.80 ± 0.05 mM 2.3 ± 0.1 4
Piccolo C2A-domain V4690S/V4691S 0.82 ± 0.08 mM 2.2 ± 0.1 4
2. Apparent Ca2+ affinities with phospholipid membranesb,c
Protein domains 30% PS/70% PC liposomes
50% PI/50% PC liposomes
  EC50 (µM) Hillcoeff. N EC50 (µM) Hillcoeff. N
Piccolo C2A-domain 164 ± 13 1.9 ± 0.1 16 127 ± 16 1.8 ± 0.2 5
Piccolo C2A-domain V4688S/M4689S 14 ± 1 8.4 ± 2.8 3 not determined    
Piccolo C2A-domain V4688S 97 ± 5 1.7 ± 0.2 3 not determined    
Piccolo C2A-domain M4689S 38 ± 4 1.7 ± 0.3 3 not determined    
Piccolo C2A-domain V4690S/V4691S 12 ± 1 11.0 ± 1.0  3 not determined    
Piccolo C2A-domain Q4692A/N4693A 103 ± 16 1.9 ± 0.5 3 not determined    
Piccolo C2A-domain A4694S 187 ± 28 2.3 ± 0.8 3 not determined    
Piccolo PDZ/C2A-domain 75 ± 8 1.4 ± 0.5 3 49 ± 1 1.2 ± 0.1 2
Synaptotagmin I C2A-domain 12 ± 1 5.9 ± 0.5 3 10 ± 1 4.7 ± 0.3 2

aIntrinsic Ca2+-binding affinities were determined by titrations of purified recombinant proteins monitored with HSQC spectra as described in Figure 8.

bData shown are mean ± SEM from the number of experiments indicated (N).

cAffinities were determined using Ca2+-dependent binding of radiolabeled liposomes with the indicated compositions, performed in triplicate as described in Figure 6.

Ca2+ binds to the top loops of the C2A-domain of piccolo and causes dimerization

In view of the sequence similarity between the piccolo C2A-domain and other C2-domains, especially in the presumptive Ca2+-binding sites (Figure 1), it is surprising that the piccolo C2A-domain has such unusual Ca2+-binding properties. These properties raise the possibility that Ca2+ binds to different sites in the piccolo C2A- domain than in other C2-domains. To test this directly, we mutated two aspartate residues in the presumptive Ca2+-binding sites of the piccolo C2A-domain and substituted them for alanines. We then examined Ca2+ binding to the mutant C2A-domain by NMR spectroscopy (Figure 2C). Superposition of the 1H-15N HSQC spectra of the mutant in the absence and presence of 30 mM Ca2+ showed that the mutation abolished all Ca2+-dependent chemical shift changes, and thus rendered the domain unable to bind Ca2+. Nevertheless, the overall spectrum of the mutant domain was similar to that of the Ca2+-free wild-type domain, demonstrating that the mutant domain was still folded normally. These data confirm that Ca2+ binds similarly to the top loops of the synaptotagmin and piccolo C2A-domains, in spite of the different structural consequences of Ca2+ binding to these C2-domains.

The cross-peak broadening observed for the Ca2+-bound form of the piccolo C2A-domain suggests that Ca2+ binding leads to oligomerization. To explore this hypothesis, we analyzed the piccolo C2A-domain by equilibrium ultracentrifugation (data not shown). In the absence of Ca2+, the C2A-domain was monomeric, in agreement with the narrow line widths observed by NMR spectroscopy. In the presence of 15 mM Ca2+, however, the C2A-domain migrated at an apparent mol. wt of 30 588, and the sedimentation data are best fit to a monomer/dimer equilibrium with a dissociation constant of 4.3 µM. Similar data were obtained in the presence of 30 mM Ca2+, which yielded a slight increase in the calculated mol. wt (32 362) and a decrease in the dimer dissociation constant (1.7 µM; data not shown). The results suggest that Ca2+ binding to the piccolo C2A-domain leads to dimerization, with a more complete formation of the dimer at 30 mM Ca2+, as expected from the low intrinsic Ca2+ affinity.

Ca2+-dependent phospholipid binding to the C2A-domain of piccolo

The best characterized and most widely shared functional property of C2-domains is Ca2+-dependent phospholipid binding. To test whether Ca2+ also induces phospholipid binding to the piccolo C2A-domain, we used a standard assay in which immobilized glutathione S-transferase (GST) fusion proteins are used as an affinity matrix for Ca2+-dependent interactions with radioactively labeled liposomes (Davletov and Südhof, 1993). The immobilized GST fusion proteins are incubated with liposomes of defined phospholipid composition in buffers containing various concentrations of divalent cations and NaCl. Bound liposomes are then separated from free liposomes by low-speed centrifugation and washing of the beads, with the specificity of binding estimated by use of control GST fusion proteins.

In a first set of experiments, we employed liposomes with four different phospholipid compositions: 100% phosphatidylcholine (PC); 30% phosphatidylserine (PS) with 70% PC; 50% phosphatidylinositol (PI) with 50% PC; and 50% phosphatidylethanolamine (PE) with 50% PC (Figure 3). The GST fusion protein of the piccolo C2A-domain bound selectively to negatively charged phospholipids (PS and PI) in the presence of Ca2+, while a control GST fusion protein containing the PDZ-domain of piccolo did not interact with any liposomes in the absence or presence of Ca2+. Furthermore, the aspartate-to-alanine substitutions in the Ca2+-binding loops of the piccolo C2A-domain that ablate Ca2+ binding (see Figure 2C) completely abolish Ca2+-dependent phospholipid binding (Figure 3). These data demonstrate that Ca2+ binding to the piccolo C2A-domain triggers phospholipid binding in a specific reaction.

graphic file with name cde168f3.jpg

Fig. 3. Ca2+-dependent phospholipid binding by the C2A-domain of piccolo. Purified GST fusion proteins from rat piccolo containing the PDZ-domain (GST–Pic-PDZ) (A), the C2A-domain (GST–Pic-C2A) (B) or the mutant C2A-domain (GST–Pic-C2AD4668A/D4674A substituting two Ca2+-binding aspartates for alanines) (C) were immobilized on glutathione beads. 3H-labeled liposomes composed of 100% PC, 30% PS/70% PC, 50% PI/50% PC, or 50% PE/50% PC were used in binding experiments with the three GST fusion proteins in the presence or absence of 1 mM free Ca2+ (see Materials and methods). Note the expanded scale of the graphs of the GST–PDZ domain and the mutant C2-domain to illustrate the small amount of background binding. Data are mean ± SEM from a representative experiment performed in triplicate.

We next tested whether Ca2+-dependent phospholipid binding is specific for Ca2+, or can also be induced by other divalent cations. In these experiments we directly compared the C2A-domains of piccolo and synaptotagmin I to evaluate their relative Ca2+ specificity. Since some of the cation concentrations used were high and might cause liposome precipitation, we included GST as a negative control for the binding proteins and 100% PC liposomes as a negative control for the phospholipids. For both the piccolo and the synaptotagmin C2A-domain, no difference in binding between 1 and 10 mM Ca2+ was observed, indicating that these Ca2+ concentrations were saturating for phospholipid binding. Since no binding was obtained with 10 mM Mg2+, binding was specific for Ca2+ versus Mg2+. At least with PI-containing liposomes, the piccolo C2A-domain exhibited a higher Ca2+ specificity than the synaptotagmin C2A-domain (Figure 4). Sr2+ and Ba2+ partly substituted for Ca2+ in the synaptotagmin C2A- domain, whereas they were much less effective for the piccolo C2A-domain. GST alone did not bind any liposomes under any condition, nor did PC interact with either C2A-domain, demonstrating that binding is specific (Figure 4).

graphic file with name cde168f4.jpg

Fig. 4. Divalent cation specificity of phospholipid binding to the C2A-domains of synaptotagmin I and piccolo. GST alone (as a control), and the GST fusion proteins of the C2A-domain of synaptotagmin I (GST–SytI-C2A) and of piccolo (GST–Pic-C2A) were used in phospholipid-binding assays in the presence of the indicated concentrations of Ca2+, Ba2+, Sr2+ and Mg2+ using liposomes composed of 50% PI/50% PC or 100% PC. Data are mean ± SEM from a representative experiment performed in triplicate.

Electrostatic interactions in Ca2+-dependent phospholipid binding to the C2A-domain of piccolo

We next examined the role of electrostatic interactions in Ca2+-dependent phospholipid binding to the piccolo C2A-domain by testing the effect of increasing NaCl concentrations (and therefore increasing ionic strength) on binding. A series of liposomes with different phospholipid compositions was employed to control for the effects of ionic surface density on the liposomes, and to exclude artifacts due to particular phospholipid headgroups (Figure 5). At low ionic strength, the overall phospholipid-binding specificities of the synaptotagmin and piccolo C2A-domains were very similar. As observed above, both domains bind to all negatively charged phospholipids [PS, PI, phosphatidylinositolphosphate (PIP) and phosphatidylinositol bisphosphate (PIP2)] as a function of Ca2+, but not to neutral phospholipids (PE and PC; Figure 5). The piccolo C2A-domain binds relatively fewer liposomes than the synaptotagmin C2A-domain, especially liposomes containing PI and PIP, possibly because binding is less tight. NaCl blocked phospholipid binding to the piccolo C2A-domain at low concentrations (<0.3 M NaCl). In contrast, higher NaCl concentrations (>0.3 M NaCl) were required to inhibit phospholipid binding to the synaptotagmin I C2A-domain, which is known to require electrostatic interaction for phospholipid binding (Davletov et al., 1998; Zhang et al., 1998; however, for a divergent view see Bai et al., 2000). Only for PIP2 was the synaptotagmin C2A-domain as sensitive to ionic strength as the piccolo C2A-domain. These results show that similarly to the synaptotagmin I C2A-domain, the piccolo C2A-domain requires electrostatic interactions for phospholipid binding. However, the interpretation of these results is more complicated for the piccolo C2A-domain than for the synaptotagmin C2A-domain because a conformational change is required for Ca2+ binding in the piccolo C2A-domain. Thus, high salt could inhibit phospholipid binding either by interfering with electrostatic interactions between the phospholipid headgroups and the top of the C2A-domain, as in the synaptotagmin C2A-domain, or by blocking the Ca2+-dependent conformational change of the piccolo C2A-domain (see below).

graphic file with name cde168f5.jpg

Fig. 5. Effect of phospholipid composition and NaCl concentration on Ca2+-dependent liposome binding to the C2A-domains of synaptotagmin I and piccolo. Immobilized GST fusion proteins of the C2A-domains of synaptotagmin I (GST–SytI-C2A) and piccolo (GST–Pic-C2A) were used in phospholipid-binding assays in the presence of increasing concentrations of NaCl as indicated, with or without 1 mM Ca2+. Liposomes were composed of 100% PC, 30% PS/70% PC, 50% PE/50% PC, 50% PI/50% PC, 15% PIP/85% PC, or 10% PIP2/90% PC. Note differences in scale between graphs. Data are mean ± SEM from a representative experiment performed in triplicate.

Ca2+ affinity for phospholipid binding

We next determined the apparent Ca2+ affinity of the piccolo C2A-domain in the presence of phospholipids, again in direct comparison with the synaptotagmin I C2A-domain (Figure 6). For this purpose we measured the Ca2+ concentration dependence of phospholipid binding to the C2A-domain, using Ca2+/EGTA buffers to clamp the free Ca2+ concentration and liposomes with either PS or PI in order to avoid phospholipid-specific artifacts. Our results reveal an apparent Ca2+ affinity of the piccolo C2A-domain in the presence of phospholipids of ∼0.16 and ∼0.13 mM for PS- and PI-containing liposomes, respectively (Figure 6). Thus, the apparent Ca2+ affinity of the piccolo C2A-domain is considerably higher in the presence of phospholipids than its intrinsic Ca2+ affinity in the absence of phospholipids (∼1.5 mM; see above), probably because the phospholipids provide additional coordination sites for the bound Ca2+ ions and thereby increase the apparent Ca2+ affinity (Zhang et al., 1998). The apparent Ca2+ affinity of the piccolo C2A-domain during phospholipid binding was, however, 10 times lower than that of the synaptotagmin C2A-domain measured in the same experiments, and exhibited a lower Ca2+ cooperativity, as manifested in the Hill coefficient (Hillcoeff) (Figure 6). These results were reproducibly obtained in multiple experiments (summarized in Table I).

graphic file with name cde168f6.jpg

Fig. 6. Ca2+ concentration dependence of phospholipid binding to the C2A-domain of synaptotagmin I (SytI), piccolo (Pic) and the combined PDZ- and C2A-domains of piccolo. Phospholipid-binding reactions with the immobilized GST fusion proteins of the indicated C2-domains were carried out in Ca2+/EGTA buffers to clamp the free Ca2+ concentration. For each experiment, a GST-only control was performed for high Ca2+ concentrations to exclude artifactual Ca2+-dependent lipid precipitation (open symbol in each panel). Titrations were carried out with liposomes composed of 30% PC/70% PC (PS; top panels), or 50% PI/50% PC (PI; bottom panels). The Ca2+ concentration corresponding to half-maximal binding (EC50) and the apparent calculated cooperativity (Hillcoeff) are shown for each experiment in the corresponding panels. Data are mean ± SEM from a representative experiment performed in triplicate; results from multiple experiments are summarized in Table I.

In piccolo, the C2A-domain is expressed at the C-terminus of a long polypeptide chain, and is N-terminally preceded by a PDZ-domain and a linker sequence. To study whether the PDZ-domain and linker influence the Ca2+-binding properties of the piccolo C2A-domain, we examined a recombinant protein of piccolo that includes both the PDZ- and the C2A-domain (Figure 1A) by NMR spectroscopy and phospholipid binding measurements (Figure 6, Table I and data not shown). Superposition of the 1H-15N spectra of the PDZ/C2A-domain fragment with those of the isolated C2A- domain did not reveal significant differences in the C2A-domain cross-peaks between the isolated C2A- domain and the C2A-domain coupled to the PDZ-domain (data not shown). The Ca2+-induced changes in the 1H-15N HSQC spectra of the PDZ/C2A-domain fragment were similar to those observed in the isolated C2A-domain. A Ca2+ titration of these changes also yielded comparable results to those obtained in the absence of the PDZ- domain. Together these results suggest that the overall conformation and intrinsic Ca2+-binding ability of the C2A-domain are similar in isolation and in the context of the PDZ-domain. Furthermore, the overall phospholipid-binding properties of the PDZ/C2A-double domain protein were similar to those of the C2A-domain alone, suggesting that the C2A-domain is also active in the context of multiple domains. However, the apparent Ca2+ affinity of the PDZ/C2A-domain protein was significantly higher than that of the C2A-domain alone (Figure 6; Table I). This difference was found for both PI- and PS-containing liposomes, indicating that they are not a phospholipid-specific artifact.

The low Ca2+ affinity of the piccolo C2A-domain depends on a unique bottom sequence

To identify the basis for the unusual structural and functional properties of the piccolo C2A-domain—its low Ca2+ affinity and large Ca2+-dependent conformational change—we analyzed its sequence. We observed a single striking feature in the piccolo C2-domain that is absent from other C2-domains: an 11 residue sequence inserted between β-strands 3 and 4 (Figure 1B). This sequence is characterized by four central hydrophobic residues flanked by glutamines (QVMVVQ); its potential importance is highlighted by the fact that it is completely conserved between rat, mouse, human and chicken piccolo (Figure 7A). Since this sequence is inserted in a region that in other C2-domains forms a loop on the bottom surface (which does not bind Ca2+), the possibility arises that the unique bottom sequence in the piccolo C2A-domain confers onto the bottom surface the ability to bind Ca2+. This would effectively create independent Ca2+-binding sites on the top and bottom of the domain. However, two findings rule out this possibility. First, as described above (Figures 2 and 3), mutations in the top loops of the C2A-domain completely abolish Ca2+ binding; thus, the domain does not contain a second independent Ca2+-binding region on the bottom. Secondly, the unique bottom sequence does not contain hydrophilic residues that are essential for forming Ca2+-binding sites, but is instead characterized by conserved hydrophobic residues (Figure 7A).

graphic file with name cde168f7.jpg

Fig. 7. Evolutionary conservation of the unique bottom sequence in the piccolo C2A-domain, and localization of the sequence in a model of the C2A-domain. (A) Alignment of the primary structures of mouse, rat, human and chicken piccolo C2A-domains in the region containing the piccolo-specific bottom sequence (bold type) that was mutated in the experiments described in Figures 8 and 9 and Table I. Amino acid substitutions are underlined and shown in italic. (B) Model of the piccolo C2A-domain with three bound Ca2+ ions on top (orange spheres) and the unusual sequence that is specific for the C2A-domain on the bottom (shown in yellow). The model proposes that the unique bottom sequence folds back towards the top Ca2+-binding loops of the C2A-domain. The bottom sequence could either directly influence Ca2+ binding to the top loops, or stabilize the Ca2+-free conformation of the overall C2A-domain and thereby indirectly influence Ca2+ binding. The model is based on the structure of the synaptotagmin C2A-domain where the 11 residue loop has been manually inserted in an arbitrary conformation (prepared with the MOLSCRIPT program; Kraulis, 1991).

Since the bottom sequence does not form an independent Ca2+-binding site on the Ca2+-independent lower surface of the C2A-domain, it would have to modulate the top Ca2+-binding loops if it was indeed responsible for the unusual Ca2+-binding properties of the piccolo C2A-domain. To test the importance of the unique 11 residue sequence at the bottom of the piccolo C2A-domain for the unusual Ca2+-binding properties of the C2A- domain, we introduced a series of point mutations into this sequence. We then examined the effects of these mutations using Ca2+-dependent phospholipid binding to measure the apparent Ca2+ affinity of the C2A-domain (Table I), and NMR spectroscopy to study changes in the structure and the intrinsic Ca2+ affinity of the C2A-domain (Figure 8). To evaluate the effects of these mutations, we propose a working model (Figure 7B). This model suggests that the bottom sequence folds back towards the top Ca2+-binding loops in the Ca2+-free state of the piccolo C2A-domain, and either directly affects the top Ca2+-binding loops or indirectly stabilizes the Ca2+-free state of the C2A-domain. According to this model, Ca2+ would then trigger an overall conformational change in the C2A-domain because the folded-back sequence has to be released in order for Ca2+ to bind.

We first replaced the four central hydrophobic amino acids of the unique bottom sequence with serines, changing two residues at a time (mutations V4688S/M4689S and V4690S/V4691S). Both substitutions caused a dramatic, >10-fold increase in the apparent Ca2+ affinity of the piccolo C2A-domain in the presence of phospholipids (Table I). These mutant piccolo C2A-domains exhibited a Ca2+ affinity that resembles that of other phospholipid-binding C2-domains, e.g. those of synaptotagmin and PKC, suggesting that the hydrophobic residues in the unique bottom sequence are responsible for lowering the apparent Ca2+ affinity of the C2A-domain. In addition to increasing the apparent Ca2+ affinity, the double amino acid substitutions in the bottom sequence augmented the apparent cooperativity of Ca2+ binding dramatically (Table I). The observed Hill coefficients suggest a hypercooperativity that may be due to the fact that the bound phospholipid liposomes effectively represent a solid phase that couples multiple C2A-domains into a single binding reaction. We next explored the effects of single amino acid substitutions in the central hydrophobic sequence on the apparent Ca2+ affinity in the presence of phospholipids. Replacing valine, the first hydrophobic residue in the unique sequence, with serine (V4688S) had a small effect on Ca2+ affinity, but replacing the following methionine (M4689S) increased the apparent Ca2+ affinity almost as much as the double amino acid substitutions (Table I). We also tested mutations in the adjacent QN sequence (Q4692A/N4693A) and the subsequent alanine residue (A4694S). The QN substitution had only a moderate effect on Ca2+ affinity, while the following single amino acid substitution had no effect. Together, these data show that the central hydrophobic residues in the unique 11-amino-acid insertion at the bottom of the piccolo C2A-domain are essential for the low apparent Ca2+ affinity of the piccolo C2A-domain.

Structural consequences of the loop mutations

To examine how the bottom sequence influences Ca2+ binding by the top loops of the piccolo C2A-domain, we studied the two mutants with the largest increase in apparent Ca2+ affinity, V4688S/M4689S and V4690S/V4691S (Table I), by NMR spectroscopy. Comparison of the 1H-15N HSQC spectra of both mutants with and without Ca2+ showed that Ca2+ still caused changes in most cross-peaks in both mutants (Figure 8 and data not shown); therefore, the mutants still experienced an overall conformational change upon Ca2+ binding. Furthermore, Ca2+-dependent line broadening was observed for both mutant C2A-domains, indicating that they still dimerize. However, superposition of the 1H-15N HSQC spectra of the wild-type and the V4690S/V4691S mutant C2A- domains revealed that the spectra were very different for the Ca2+-free forms of the C2A-domain, but nearly identical for the Ca2+-bound forms (Figure 8). Similar results were obtained for the V4688S/M4689S mutant C2A-domain (data not shown), which indicates that the loop mutations selectively perturb the conformation of the Ca2+-free but not the Ca2+-bound form of the C2A-domain. We also performed Ca2+ titrations of the two mutant and the wild-type C2A-domains to compare their intrinsic Ca2+ affinities. Both mutants exhibited a nearly 2-fold higher Ca2+ affinity than the wild-type C2A-domain, but a comparable Ca2+ cooperativity (Figure 8C and D; Table I). Together, these results strongly suggest that the bottom sequence stabilizes a conformation of the wild-type piccolo C2A-domain that is unable to bind Ca2+, and that the hydrophobic residues in the sequence are essential for this stabilization. Elucidation of the precise mechanism by which the bottom sequence achieves this effect on Ca2+ binding will require an atomic structure of the domain.

Independent of the mechanism by which the bottom sequence stabilizes the Ca2+-free conformation of the C2A-domain, the fact that the hydrophobic residues of this sequence are required suggests that these residues participate in tertiary hydrophobic contacts in the Ca2+-free but not the Ca2+-bound form. This hypothesis predicts that the NaCl sensitivity of Ca2+-dependent phospholipid binding to the piccolo C2A-domain (Figure 5) may be due, at least in part, to these hydrophobic contacts, since such contacts (which need to be broken for Ca2+ binding) would be strengthened by increasing NaCl concentrations. To test this hypothesis, we examined whether the mutant C2A-domains exhibit a change in the NaCl sensitivity of Ca2+-dependent phospholipid binding (Figure 9). Gratifyingly, Ca2+-dependent phospholipid binding to the mutant piccolo C2A-domains was much more resistant to increasing ionic strength than that to the wild-type C2A-domain. This effect was particularly pronounced for the V4690S/V4691S mutant C2A-domain, which exhibited no decrease in phospholipid binding at 0.3 M NaCl, whereas the wild-type C2A-domain was almost completely inhibited at this NaCl concentration (Figure 9).

graphic file with name cde168f9.jpg

Fig. 9. Effect of increasing NaCl concentrations on Ca2+-dependent liposome binding to wild-type (WT) and mutant piccolo C2A-domains. Ca2+-dependent phospholipid-binding measurements were carried out with immobilized GST fusion proteins of the wild-type and mutant piccolo C2A-domains as described for Figures 3 and 5 using liposomes composed of 30% PS/70% PC. Ca2+-binding affinities of these mutants determined in multiple independent experiments are summarized in Table I. To facilitate comparisons, results were normalized for the amount of binding observed in 0.1 M NaCl. Data are mean ± SEM from a representative experiment performed in triplicate.

Discussion

Piccolo/aczonin is a recently described presynaptic protein that is selectively localized to the active zone of synapses (Cases-Langhoff et al., 1996; Wang et al., 1999; Fenster et al., 2000; reviewed in Garner et al., 2000). Piccolo is a very large protein (∼500 kDa) containing multiple domains, many of which are alternatively spliced. The C-terminus of piccolo is composed of a PDZ- and a C2A-domain that are present in all known splice variants, and a C2B-domain that is present in a subset of splice variants (Wang et al., 1999). The piccolo C2A-domain is similar to those of synaptotagmins and other proteins, and includes all of the residues in the top Ca2+-binding loops that coordinate the three Ca2+ ions in the synaptotagmin C2A-domain (Figure 1; Ubach et al., 1998). Since piccolo is one of the few proteins known to be specifically localized to the presynaptic active zone (Garner et al., 2000), a localization that would be ideally suited for regulating neurotransmitter release, we set out to examine the possibility that piccolo constitutes a presynaptic Ca2+ sensor due to the presence of its C2A-domain. Our results demonstrate that piccolo is a presynaptic Ca2+-binding protein by virtue of its C2A-domain, which exhibits unexpected Ca2+-binding properties that differ from those of other C2-domain proteins. Our data show that Ca2+ binds to the piccolo C2A-domain with low affinity but high specificity, and causes a major conformational change in the overall domain. Surprisingly, mutagenesis revealed that the low Ca2+ affinity of the piccolo C2A-domain depends on a unique sequence predicted to be located at the bottom of the C2A-domain. This result suggests that the unique bottom sequence influences Ca2+ binding to the top loops of the C2A-domain, indicating that the bottom sequence may fold back towards the top loops to modulate Ca2+ binding. The structural studies on the mutant C2A-domains showed that the bottom sequence stabilizes the Ca2+-free domain and thus regulates Ca2+ binding indirectly by hindering the conformational change that is required for Ca2+ binding. Based on the low affinity but high specificity of Ca2+ binding to piccolo, we propose that piccolo plays a selective regulatory role at the synapse when Ca2+ accumulates in nerve terminals after repetitive stimulation, such as during processes of short-term synaptic plasticity.

The C2A-domain of piccolo exhibits the following similarities to other Ca2+-binding C2-domains. (i) Its sequence is very similar to that of other C2-domains. Especially the top loops of the piccolo C2A-domain are almost identical to those of other Ca2+-binding C2- domains, with full conservation of all residues involved in Ca2+ binding (Figure 1). (ii) Ca2+ appears to bind to the top loops of the piccolo C2A-domain since Ca2+ binding was abolished when two of the five aspartates in the loops were substituted for alanines (Figures 2 and 3). (iii) Ca2+ triggers phospholipid binding to the piccolo C2A-domain in a promiscuous reaction that requires negatively charged phospholipids (Figures 3–5). (iv) Similar to other C2-domains, the piccolo C2A-domain is specific for Ca2+ over Mg2+, and slightly more selective than other C2-domains for Ca2+ over Ba2+ and Sr2+ (Figure 4). (v) The apparent Ca2+ affinity of the piccolo C2A-domain in the presence of phospholipids is 10-fold higher than its intrinsic Ca2+ affinity. This suggests that similarly to the C2A-domain of synaptotagmin I (Zhang et al., 1998) and the C2-domain of PKCα (Verdaguer et al., 1999), bound phospholipids provide additional Ca2+ coordination sites and thereby increase the apparent Ca2+ affinity.

In spite of these similarities, however, the properties of the C2A-domain of piccolo are strikingly different from those of any other currently characterized C2-domain, suggesting that it falls into a novel class. (i) Ca2+ binding causes chemical shift changes in virtually all cross-peaks in the HSQC spectrum of the piccolo C2A-domain. Thus, Ca2+ binding triggers a global conformational change in the C2A-domain of piccolo (Figure 2). By contrast, in other C2-domains Ca2+ only has a local effect at the binding region, as exemplified by the Ca2+-free and -bound structures of the synaptotagmin I and phospholipase Cδ C2-domains (Essen et al., 1997; Shao et al., 1998). (ii) Consistent with a conformational change, intrinsic Ca2+ binding to the piccolo C2A-domain is cooperative (Figures 2 and 8). This result suggests that the Ca2+-binding sites on top of the C2A-domain are not filled sequentially but simultaneously, in parallel with the conformational switch. (iii) Ca2+ binding to the piccolo C2A-domain induces dimerization, which may be the consequence of the overall conformational change. (iv) The piccolo C2A-domain exhibits a lower apparent Ca2+ affinity in the presence of phospholipids (130– 160 µM) than other phospholipid-binding C2-domains (2–20 µM; Figure 7; Table I; Davletov and Südhof, 1993; Li et al., 1995; Shao et al., 1996; Essen et al., 1997; Nalefski et al., 1998). In the more natural context of the PDZ-/C2A-domain tandem, this affinity increased to 50–70 µM (Table I). Although apparent Ca2+ affinities measured for ternary complexes such as C2-domain– Ca2+–phospholipids need to be interpreted with caution since they depend on the concentrations of the components, our data directly compared the properties of the piccolo and the synaptotagmin C2A-domains, suggesting that the relative Ca2+ affinities of these C2-domains are likely to be correct.

What is the structural basis for the unique Ca2+-binding properties of the piccolo C2A-domain? We identified a unique 11 residue sequence in the piccolo C2A-domain that is absent from other C2-domains, and connects β-strands 3 and 4 at the bottom of the piccolo C2A-domain. Point mutations in hydrophobic residues located in the center of the 11 residue sequence increased the apparent Ca2+ affinity of the piccolo C2A-domain 10-fold, although the mutant C2A-domains still exhibited a Ca2+-dependent conformational change (Figure 8; Table I). 1H-15N HSQC spectra of the Ca2+-free and -bound wild-type and mutant C2A-domains showed that these mutations perturb the Ca2+-free form of the C2A-domain but have little effect on the Ca2+-bound form. This result suggests that a major determinant of the low Ca2+-binding affinity of the C2A-domain is the stability of the Ca2+-free form, which is mediated by hydrophobic interactions of the unique bottom sequence. Consistent with this conclusion, Ca2+-dependent phospholipid binding to the bottom sequence mutants was less sensitive to high ionic strength than Ca2+-dependent phospholipid binding to the wild-type piccolo C2A-domain (Figure 9). Overall, these results demonstrate that Ca2+ binding to the piccolo C2A-domain is governed by a new principle for a C2-domain, a Ca2+-dependent conformational switch that affects the entire C2A-domain even if Ca2+ binding is restricted to the top of the domain. High-resolution structures of the Ca2+-free and -bound forms of the piccolo C2A-domain will be required to determine the mechanisms underlying these fascinating and unusual Ca2+-binding properties.

Ca2+ triggers synaptic vesicle exocytosis in a tightly regulated manner, and additionally regulates short- and long-term synaptic plasticity during repetitive stimulation. Synapses probably contain a multitude of Ca2+ sensors that are activated by different Ca2+ concentrations and that contribute differentially to the many actions of Ca2+ in the nerve terminal. Several Ca2+-binding proteins at the synapse have been identified, which could potentially serve as presynaptic Ca2+ sensors. However, none of these candidate Ca2+ sensors is selectively activated at the higher Ca2+ concentrations that are built up during repetitive stimulation (Kamiya and Zucker, 1994; Dittman et al., 2000). Our results show that piccolo constitutes an unusual synaptic Ca2+ sensor whose Ca2+ affinity is too low to serve as a Ca2+-buffer or as a Ca2+ sensor for release, but appears to be ideally suited for a role during Ca2+-build-up after repetitive stimulation. The slow conformational switch in the piccolo C2A-domain, in contrast to the fast electrostatic switch in the synaptotagmin C2A-domain (Shao et al., 1996, 1997, 1998), also agrees well with this possibility since short-term plasticity has a relatively slow time constant. Studies with genetically altered mice will be required to test this hypothesis.

Materials and methods

Cloning of rat piccolo/aczonin

GenBank searches identified piccolo/aczonin as a potentially novel C2-domain protein in an anonymous human brain cDNA sequence (KIAA0559, accession No. AB011131) and a human expressed sequence tag (EST) clone (accession No. AA319026). Using the EST clone (obtained from the American Type Culture Collection, Manassas, VA) and fragments of subsequently isolated cDNA clones, we screened a rat brain λZAPII cDNA library (Stratagene, La Jolla, CA) by standard procedures (Südhof et al., 1987; Sambrook et al., 1989). We isolated 17 overlapping cDNA clones that cover the entire C-terminal half of the short form of piccolo as revealed by Wang et al. (1999) and Fenster et al. (2000) and published during the course of this study. The sequences of overlapping cDNA clones corresponding to the entire C-terminal half of piccolo were obtained on both strands and were largely identical to the piccolo sequences in the databanks with minor changes and additional splice variants. Of the cDNA clones isolated, clone pBSPic-C51 contained the entire C-terminal coding region of the short form of rat piccolo (residues 4296–4880; see Figure 1A) and was used for construction of all vectors used in the current study.

Construction of expression vectors and protein expression

For production of GST fusion proteins, sequences encoding the C2A-domain (residues 4635–4776), the tandem PDZ- and C2A-domains (residues 4439–4776) and the PDZ domain (residues 4439–4554) of rat piccolo were amplified by PCR using the cDNA clone pBSPic-C51 as template and primers A versus C, B versus C and D versus E (A = CCGGAATTCTAGCCTCTCACCCAATTACAGGAGAG; B = CCGGAATTCCTCATGCAAGGATAAAAATCACC; C = CCCAAGCTTTTAGCTCTCAGTTTGTTCTTTCAG; D = CGCGGATCCCCTCAT GCAAGGATAAAAATCACC; E = CCCAAGCTTTTATGGCGGTTCATGAAGTTCCAG). The PCR products were cloned into the EcoRI–HindIII and BamHI–HindIII sites, respectively, of pGEX-KG (Guan and Dixon, 1991) to yield pGEXPic-C2A, pGEXPicPDZ/C2A and pGEXPicPDZ (Figure 1A). Mutagenesis of D4668 and D4674 into alanines in pGEXPic-C2A was performed using the QuikChange mutagenesis kit (Stratagene, La Jolla, CA) and primers F versus G and H versus I (F = GCAAGAAACCTAGTCCCCAGAGCCAACAATGGCTACTCTGACCCG; G = CGGGTCAGAGTAGCCATTGTTGGCTCTGGGGACTAGGTTTCTTGC; H = CCAACAATGGCTACTCTGCCCCGTTTGTTAAGGTGTAC; I = GTACACCTTAACAAACGGGGCAGAGTAGCCATTGTTGG). Mutations in the bottom loop of the piccolo C2A-domain were made by introducing a SacII site 5′ and a BsiWI site 3′ of the bottom loop using silent site-directed mutagenesis and primers J versus K and L versus M (J = GTGTACCTACTTCCAGGCCGCGGTCAAGTCATGGTTGTC; K = GACAACCATGACTTGACCGCGGCCTGGAAGTAGGTACAC; L = GCAAGTGCTGAGTACAAGAGACGTACGAAATATGTCCAGAAAAGTC; M = GACTTTTCTGGACATATTTCGTACGTCTCTTGTACTCAGCACTTGC). Bottom loop mu tants V4688S/M4689S, V4688S, M4689S, V4690S/V4691S, Q4692A/N4693A and A4694S were then introduced by subcloning anealed oligonucleotides N versus O, P versus Q, R versus S, T versus U, V versus W, X versus Y into the SacII and BsiWI sites, respectively (N = GGTCAAAGCTCAGTTGTCCAGAATGCTAGCGCTGAGTACAAGAGAC; O = GTACGTCTCTTGTACTCAGCGCTAGCATTCTGGACAACTGAGCTTTGACCGC; P = GGTCAAAGCATGGTT GTCCAGAATGCTAGCGCTGAGTACAAGAGAC; Q = GTACGTCTCTTGTACTCAGCGCTAGCATTCTGGACAACCATGCTTTGACCGC; R = GGTCAAGTCTCAGTTGTCCAGAATGCTAGCGCT GAGTACAAGAGAC; S = GTACGTCTCTTGTACTCAGCGCTAGCATTCTGGACAACTGAGACTTGACCGC; T = GGTCAAGTCATGAGCTCACAGAATGCTAGCGCTGAGTACAAGAGAC; U = GTACGTCTCTTGTACTCAGCGCTAGCATTCTGTGAGCTCATGACTTGACCGC; V = GGTCAAGTCATGGTTGTCGCAGCAGCTAGCGCTGAGTACAAGAGAC; W = GTACGTCTCTTGTACTCAGCGCTAGCTGCTGCGACAACCATGACTTGACCGC; X = GGT CAAGTCATGGTTGTCCAGAATTCAAGCGCTGAGTACAAGAGAC; Y = GTACGTCTCTTGTACTCAGCGCTTGAATTCTG GACAACCATGACTTGACCGC). All plasmids were verified by sequencing. Recombinant GST fusion proteins were purified on glutathione–agarose by standard procedures (Guan and Dixon, 1991), and the amounts and purity of the recombinant proteins were standardized on Coomassie Blue-stained SDS–polyacrylamide gels (Laemmli, 1970).

Phospholipid-binding assays

Phospholipid-binding assays were performed essentially as described (Davletov and Südhof, 1993; Li et al., 1995) with GST fusion proteins immobilized on glutathione–agarose. Phospholipids (1.75 mg total; Avanti Polar Lipids, Alabaster, AL) were dissolved in chloroform, mixed in the indicated weight ratios with a trace amount (<0.01% of total) of 3H-labeled PC (Amersham Pharmacia Biotech, Piscataway, NJ) and dried under a stream of nitrogen. Dried lipids were resuspended in 10 ml of 50 mM HEPES–NaOH pH 7.4, 0.1 M NaCl by vigorous vortexing for 1 min, sonicated for 5 min in a waterbath sonicator (model G112PIG; Laboratory Supply Co. Inc., Hicksville, NJ; output: 80 kc, 80 W), and centrifuged for 15 min at ∼5000 g to remove aggregates. Binding assays contained ∼25 µg of recombinant protein, with 1 µg of protein/µl of wet glutathione beads. Beads were equilibrated in 0.1 ml of the respective binding buffers [50 mM HEPES–NaOH pH 6.8, 0.1 M NaCl (if not indicated differently), 4 mM Na2EGTA, 8.75 µg of phospholipids with 0.025 µCi of [3H]PC-labeled PC] and either no additions or the respective amounts of divalent cations to produce the free concentrations stated in the figure legends. The mixture was incubated for 10 min at room temperature with vigorous shaking in an Eppendorf shaker, briefly centrifuged, and washed three times with 800 µl of the respective binding buffers. Phospholipid binding was quantified by scintillation counting of the beads (Beckman LS6000SC; Beckman Instruments, Inc., Fullerton, CA). For the composition of Ca2+/EGTA buffers, the respective amount of total Ca2+ needed to achieve a defined free Ca2+ concentration was calculated with commercial software (EqCal for Windows; Biosoft, Ferguson, MO). All buffers were prepared in high-resistance MilliQ water using a 1 M Ca2+ standard solution (Fluka Chemical Corp., Rankonkoma, NY). Binding data were analyzed with the GraphPad Prism program (GraphPad Software, Inc., San Diego, CA) for EC50 and Hillcoeff.

Analytical ultracentrifugation

Sedimentation equilibrium experiments were performed in absorbance mode at 25°C on a Beckman XL-I analytical ultracentrifuge at rotor speeds of 18 000, 20 000 and 22 000 r.p.m. using samples of 5.3, 7.9 and 10.7 µM piccolo C2A-domain dissolved in 20 mM acetate pH 6.0, 150 mM NaCl, and 0, 15 or 30 mM CaCl2. The data were analyzed using MICROCAL ORIGIN software (Beckman) assuming a partial specific volume of 0.735 ml/g and a solvent density of 1 g/ml.

NMR spectroscopy

Recombinant 15N-labeled samples of the isolated C2A-domain from rat piccolo (residues 4635–4776) and of the PDZ/C2A-domain fragment from rat piccolo (residues 4439–4776) were expressed as GST fusion proteins in Escherichia coli BL21(DE3) cells using the same protocols as used previously for the synaptotagmin I C2A-domain (Shao et al., 1997). Uniform 15N-labeling was achieved by growing the bacteria in M9 minimal medium containing 15NH4Cl (Isotec) as the sole nitrogen source. The fusion proteins were isolated by affinity chromatography on glutathione–agarose (Sigma), cleaved with thrombin, and purified by gel filtration on a Superdex 75 column (Pharmacia) (C2A-domain) or cation exchange chromatography on a MonoS column (Pharmacia) (PDZ/C2A-domain fragment). 1H-15N HSQC spectra were acquired using a sensitivity enhanced pulse sequence (Zhang et al., 1994) at 25°C on a Varian INOVA 500 spectrometer. Samples contained 100 µM C2A-domain or 120 µM PDZ/C2A-domain fragment dissolved in 20 mM acetate pH 6.0, 150 mM NaCl, with the specified Ca2+ concentrations. Ca2+ titrations of the wild-type and mutant C2A- domains were performed with 145–155 µM samples dissolved in the same buffer. 1H-15N HSQC spectra were acquired at 0, 0.25, 0.5, 0.75, 0.85, 1, 1.25, 1.75, 2.5, 4, 5 and 10 mM Ca2+ concentrations for the mutant C2A-domains. For wild-type C2A-domain, 1H-15N HSQC were acquired at these Ca2+ concentrations and also at 3.25, 20 and 30 mM Ca2+ because of the lower affinity. Ca2+ affinities and cooperativities were obtained by curve fitting the dependence of the intensities of selected cross-peaks on the Ca2+ concentration to a standard Hill equation using Sigma Plot. Cross-peaks from the Ca2+-free form that disappear with addition of Ca2+, and cross-peaks that appear as a function of Ca2+, were used in the curve fittings, and the affinities and cooperativities obtained were averaged to yield the values described in Table I. Spectral widths of 7600 and 1163 Hz were used in the 1H and 15N dimensions, respectively. Data sets consisted of 2 × 100 free induction decays (FIDs) of 768 complex points, and were zero filled to obtain matrices of 512 × 512 real points after Fourier transformation and removal of the aliphatic part of the spectra. Between 16 and 224 scans per FID were acquired, resulting in total acquisition times of 1–14 h.

Acknowledgments

Acknowledgements

This study was supported by grants from the Welch Foundation (I-1304 to J.R.), the Perot Family Foundation (to T.C.S.), NIH grant NS40944 (to J.R. and T.C.S.) and a fellowship from the Deutsche Forschungsgemeinschaft to S.H.G. We thank Ms I.Leznicki, A.Roth and E.Borowicz for technical assistance, Dr S.Sugita for help with the figures and David Myers for assistance with analytical ultracentrifugation.

References

  1. Atluri P.P. and Regehr,W.G. (1998) Delayed release of neurotransmitter from cerebellar granule cells. J. Neurosci., 18, 8214–8227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bai J., Earles,C.A., Lewis,J.L. and Chapman,E.R. (2000) Membrane-embedded synaptotagmin penetrates cis or trans target membranes and clusters via a novel mechanism. J. Biol. Chem., 275, 25427–25435. [DOI] [PubMed] [Google Scholar]
  3. Bollmann J.H., Sakmann,B. and Borst,J.G. (2000) Calcium sensitivity of glutamate release in a calyx-type terminal. Science, 289, 953–957. [DOI] [PubMed] [Google Scholar]
  4. Brose N., Petrenko,A.G., Südhof,T.C. and Jahn,R. (1992) Synapto tagmin: a Ca2+ sensor on the synaptic vesicle surface. Science, 256, 1021–1025. [DOI] [PubMed] [Google Scholar]
  5. Cases-Langhoff C. et al. (1996) Piccolo, a novel 420 kDa protein associated with the presynaptic cytomatrix. Eur. J. Cell Biol., 69, 214–223. [PubMed] [Google Scholar]
  6. Davletov B. and Südhof,T.C. (1993) A single C2-domain from synaptotagmin I is sufficient for high affinity Ca2+/phospholipid-binding. J. Biol. Chem., 268, 26386–26390. [PubMed] [Google Scholar]
  7. Davletov B., Perisic,O. and Williams,R.L. (1998) Calcium-dependent membrane penetration is a hallmark of the C2-domain of cytosolic phospholipase A2 whereas the C2A-domain of synaptotagmin binds membranes electrostatically. J. Biol. Chem., 273, 19093–19106. [DOI] [PubMed] [Google Scholar]
  8. Delaney K.R. and Tank,D.W. (1994) A quantitative measurement of the dependence of short-term synaptic enhancement on presynaptic residual calcium. J. Neurosci., 14, 5885–5902. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Dittman J.S., Kreitzer,A.C. and Regehr,W.G. (2000) Interplay between facilitation, depression and residual calcium at three presynaptic terminals. J. Neurosci., 20, 1374–1385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Dobrunz L.E. and Stevens,C.F. (1999) Response of hippocampal synapses to natural stimulus patterns. Neuron, 22, 157–166. [DOI] [PubMed] [Google Scholar]
  11. Dobrunz L.E., Huang,E.P. and Stevens,C.F. (1997) Very short-term plasticity in hippocampal synapses. Proc. Natl Acad. Sci. USA, 94, 14843–14847. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Dodge F.A. Jr and Rahamimoff,R. (1967) Co-operative action of calcium ions in transmitter release at the neuromuscular junction. J. Physiol., 193, 419–432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Essen L.-O., Perisic,O., Lynch,D.E., Katan,M. and Williams,R.L. (1997) A ternary metal binding site in the C2-domain of phosphoinositide-specific phospholipase C-1. Biochemistry, 36, 2753–2762. [DOI] [PubMed] [Google Scholar]
  14. Fenster S.D. et al. (2000) Piccolo, a presynaptic zinc finger protein structurally related to bassoon. Neuron, 25, 203–214. [DOI] [PubMed] [Google Scholar]
  15. Fernández-Chacón R. et al. (2001) Synaptotagmin I functions as a Ca2+-regulator of release probability. Nature, 410, 41–49. [DOI] [PubMed] [Google Scholar]
  16. Garner C.C., Kindler,S. and Gundelfinger,E.D. (2000) Molecular determinants of presynaptic active zones. Curr. Opin. Neurobiol., 10, 321–327. [DOI] [PubMed] [Google Scholar]
  17. Geppert M., Archer,B.T.,III and Südhof,T.C. (1991) Synaptotagmin II: a novel differentially distributed form of synaptotagmin. J. Biol. Chem., 266, 13548–13552. [PubMed] [Google Scholar]
  18. Geppert M., Goda,Y., Hammer,R.E., Li,C., Rosahl,T.W., Stevens,C.F. and Südhof,T.C. (1994) Synaptotagmin I: a major Ca2+ sensor for transmitter release at a central synapse. Cell, 79, 717–727. [DOI] [PubMed] [Google Scholar]
  19. Gil Z., Connors,B.W. and Amitai,Y. (1999) Efficacy of thalamocortical and intracortical synaptic connections: quanta, innervation and reliability. Neuron, 23, 385–397. [DOI] [PubMed] [Google Scholar]
  20. Goda Y. and Stevens,C.F. (1994) Two components of transmitter release at a central synapse. Proc. Natl Acad. Sci. USA, 91, 12942–12946. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Guan K.L. and Dixon,J.E. (1991) Eukaryotic proteins expressed in Escherichia coli: an improved thrombin cleavage and purification procedure of fusion proteins with glutathione S-transferase. Anal. Biochem., 192, 262–267. [DOI] [PubMed] [Google Scholar]
  22. Hixon M.S., Ball,A. and Gelb,M.H. (1998) Calcium-dependent and -independent interfacial binding and catalysis of cytosolic group IV phospholipase A2. Biochemistry, 37, 8516–8526. [DOI] [PubMed] [Google Scholar]
  23. Kamiya H. and Zucker,R.S. (1994) Residual Ca2+ and short-term synaptic plasticity. Nature, 371, 603–606. [DOI] [PubMed] [Google Scholar]
  24. Katz B. (1969) The Release of Neural Transmitter Substances. Liverpool University Press, Liverpool, UK.
  25. Katz B. and Miledi,R. (1968) The role of calcium in neuromuscular facilitation. J. Physiol. (Lond.), 195, 481–492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kraulis P.J. (1991) MOLSCRIPT: a program to produce both detailed and schematic plots of protein structures. J. Appl. Crystallogr., 24, 946–950. [Google Scholar]
  27. Laemmli U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680–685. [DOI] [PubMed] [Google Scholar]
  28. Li C., Takei,K., Geppert,M., Daniell,L., Stenius,K., Chapman,E.R., Jahn,R., De Camilli.,P. and Südhof,T.C. (1994) Synaptic targeting of rabphilin-3A, a synaptic vesicle Ca2+/phospholipid-binding protein, depends on rab3A/3C. Neuron, 13, 885–898. [DOI] [PubMed] [Google Scholar]
  29. Li C., Ullrich,B., Zhang,J.Z., Anderson,R.G.W., Brose,N. and Südhof,T.C. (1995) Ca2+-dependent and Ca2+-independent activities of neural and nonneural synaptotagmins. Nature, 375, 594–599. [DOI] [PubMed] [Google Scholar]
  30. Lomasney J.W., Cheng,H.F., Roffler,S.R. and King,K. (1999) Activation of phospholipase C δ1 through C2-domain by a Ca2+– enzyme–phosphatidylserine ternary complex. J. Biol. Chem., 274, 21995–22001. [DOI] [PubMed] [Google Scholar]
  31. Nalefski E.A. and Falke,J.J. (1996) The C2-domain calcium-binding motif: structural and functional diversity. Protein Sci., 5, 2375–2390. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Nalefski E.A., McDonagh,T., Somers,W., Seehra,J., Falke,J.J. and Clark,J.D. (1998) Independent folding and ligand specificity of the C2 calcium-dependent lipid binding domain of cytosolic phospholipase A2. J. Biol. Chem., 273, 1365–1372. [DOI] [PubMed] [Google Scholar]
  33. Pappa H., Murray-Rust,J., Dekker,L.V., Parker,P.J. and McDonald,N.Q. (1998) Crystal structure of the C2-domain from protein kinase C-δ. Structure, 6, 885–894. [DOI] [PubMed] [Google Scholar]
  34. Perin M.S., Fried,V.A., Mignery,G.A., Jahn,R. and Südhof,T.C. (1990) Phospholipid binding by a synaptic vesicle protein homologous to the regulatory region of protein kinase C. Nature, 345, 260–263. [DOI] [PubMed] [Google Scholar]
  35. Perisic O., Fong,S., Lynch,D.E., Bycroft,M. and Williams,R.L. (1998) Crystal structure of a calcium-phospholipid binding domain from cytosolic phospholipase A2. J. Biol. Chem., 273, 1596–1604. [DOI] [PubMed] [Google Scholar]
  36. Perisic O., Paterson,H.F., Mosedale,G., Lara-Gonzalez,S. and Williams,R.L. (1999) Mapping the phospholipid-binding surface and translocation determinants of the C2-domain from cytosolic phospholipase A2. J. Biol. Chem., 274, 14979–14987. [DOI] [PubMed] [Google Scholar]
  37. Rizo J. and Südhof,T.C. (1998) C2-domains, structure and function of a universal Ca2+-binding domain. J. Biol. Chem., 273, 15879–15882. [DOI] [PubMed] [Google Scholar]
  38. Sambrook J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  39. Schneggenburger R. and Neher,E. (2000) Intracellular calcium dependence of transmitter release rates at a fast central synapse. Nature, 406, 889–893. [DOI] [PubMed] [Google Scholar]
  40. Shao X., Davletov,B.A., Sutton,R.B., Südhof,T.C. and Rizo,J. (1996) A bipartite Ca2+-binding motif in C2-domains of synaptotagmin and protein kinase C. Science, 273, 248–251. [DOI] [PubMed] [Google Scholar]
  41. Shao X., Li,C., Fernandez,I., Zhang,X., Südhof,T.C. and Rizo,J. (1997) Synaptotagmin–syntaxin interaction: the C2-domain as a Ca2+-dependent electrostatic switch. Neuron, 18, 133–142. [DOI] [PubMed] [Google Scholar]
  42. Shao X., Fernandez,I., Südhof,T.C. and Rizo,J. (1998) Solution structures of the Ca2+-free and Ca2+-bound C2A-domain of synaptotagmin I: does Ca2+ induce a conformational change? Biochemistry, 37, 16106–16115. [DOI] [PubMed] [Google Scholar]
  43. Shirataki H., Kaibuchi,K., Sakoda,T., Kishida,S., Yamaguchi,T., Wada,K., Miyazaki,M. and Takai,Y. (1993) Rabphilin-3A, a putative target protein for smg p25A/rab3A p25 small GTP-binding protein related to synaptotagmin. Mol. Cell. Biol., 13, 2061–2068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Südhof T.C. and Rizo,J. (1996) Synaptotagmins: C2-domain proteins that regulate membrane traffic. Neuron, 17, 379–388. [DOI] [PubMed] [Google Scholar]
  45. Südhof T.C., Lottspeich,F., Greengard,P., Mehl,E. and Jahn,R. (1987) A synaptic vesicle protein with four transmembrane regions and a novel cytoplasmic domain. Science, 238, 1142–1144. [DOI] [PubMed] [Google Scholar]
  46. Sutton R.B. and Sprang,S.R. (1998) Structure of the protein kinase C phospholipid-binding C2-domain complexed with Ca2+. Structure, 6, 1395–1405. [DOI] [PubMed] [Google Scholar]
  47. Sutton R.B., Davletov,B.A., Berghuis,A.M., Südhof,T.C. and Sprang,S.R. (1995) Structure of the first C2-domain of synaptotagmin I: a novel Ca2+/phospholipid-binding fold. Cell, 80, 929–938. [DOI] [PubMed] [Google Scholar]
  48. tom Dieck S. et al. (1998) Bassoon, a novel zinc-finger CAG/glutamine-repeat protein selectively localized at the active zone of presynaptic nerve terminals. J. Cell Biol., 142, 499–509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Ubach J., Zhang,X., Shao,X., Südhof,T.C. and Rizo,J. (1998) Ca2+ binding to synaptotagmin: how many Ca2+ ions bind to the tip of a C2-domain? EMBO J., 17, 3921–3930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Ubach J., Garcia,J., Nittler,M.P., Südhof,T.C. and Rizo,J. (1999) The C2B-domain of rabphilin: structural variations in a janus-faced domain. Nature Cell Biol., 1, 106–112. [DOI] [PubMed] [Google Scholar]
  51. Uellner R., Zvelebil,M.J., Hopkins,J., Jones,J., MacDougall,L.K., Morgan,B.P., Podack,E., Waterfield,M.D. and Griffiths,G.M. (1997) Perforin is activated by a proteolytic cleavage during biosynthesis which reveals a phospholipid-binding C2-domain. EMBO J., 16, 7287–7296. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Verdaguer N., Corbalan-Garcia,S., Ochoa,W.F., Fita,I. and Gomez-Fernandez,J.C. (1999) Ca2+ bridges the C2-membrane-binding domain of protein kinase Cα directly to phosphatidylserine. EMBO J., 18, 6329–6338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. von Poser C., Ichtchenko,K., Shao,X., Rizo,J. and Südhof,T.C. (1997) The evolutionary pressure to inactivate: a subclass of synaptotagmins with an amino acid substitution that abolishes Ca2+ binding. J. Biol. Chem., 272, 14314–14319. [DOI] [PubMed] [Google Scholar]
  54. Wang X., Kibschull,M., Laue,M.M., Lichte,B., Petrasch-Parwez,E. and Kilimann,M.W. (1999) Aczonin, a 550-kD putative scaffolding protein of presynaptic active zones, shares homology regions with Rim and Bassoon and binds profilin. J. Cell Biol., 147, 151–162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Wang Y., Okamoto,M., Schmitz,R., Hofmann,K. and Südhof,T.C. (1997) RIM: a putative rab3 effector in regulating synaptic vesicle fusion. Nature, 388, 593–598. [DOI] [PubMed] [Google Scholar]
  56. Wang Y., Sugita,S. and Südhof,T.C. (2000) The RIM/NIM family of neuronal SH3-domain proteins: interactions with Rab3 and a new class of neuronal SH3-domain proteins. J. Biol. Chem., 275, 20033–20044. [DOI] [PubMed] [Google Scholar]
  57. Zhang O., Kay,L.E., Olivier,J.P. and Forman-Kay,J.D. (1994) Backbone 1H and 15N resonance assignments of the N-terminal SH3 domain of drk in folded and unfolded states using enhanced-sensitivity pulsed field gradient NMR techniques. J. Biomol. NMR, 4, 845–858. [DOI] [PubMed] [Google Scholar]
  58. Zhang X., Rizo,J. and Südhof,T.C. (1998) Mechanism of phospholipid binding by the C2A-domain of synaptotagmin I. Biochemistry, 37, 12395–12403. [DOI] [PubMed] [Google Scholar]
  59. Zucker R.S. (1989) Short-term synaptic plasticity. Annu. Rev. Neurosci., 12, 13–31. [DOI] [PubMed] [Google Scholar]

Articles from The EMBO Journal are provided here courtesy of Nature Publishing Group

RESOURCES