Skip to main content
Genetics logoLink to Genetics
. 2006 Aug;173(4):2021–2031. doi: 10.1534/genetics.106.058651

Patterns of Nucleotide Polymorphism Distinguish Temperate and Tropical Wild Isolates of Caenorhabditis briggsae

Asher D Cutter *,1, Marie-Anne Félix †, Antoine Barrière †, Deborah Charlesworth *
PMCID: PMC1569728  PMID: 16783011

Abstract

Caenorhabditis briggsae provides a natural comparison species for the model nematode C. elegans, given their similar morphology, life history, and hermaphroditic mode of reproduction. Despite C. briggsae boasting a published genome sequence and establishing Caenorhabditis as a model genus for genetics and development, little is known about genetic variation across the geographic range of this species. In this study, we greatly expand the collection of natural isolates and characterize patterns of nucleotide variation for six loci in 63 strains from three continents. The pattern of polymorphisms reveals differentiation between C. briggsae strains found in temperate localities in the northern hemisphere from those sampled near the Tropic of Cancer, with diversity within the tropical region comparable to what is found for C. elegans in Europe. As in C. elegans, linkage disequilibrium is pervasive, although recombination is evident among some variant sites, indicating that outcrossing has occurred at a low rate in the history of the sample. In contrast to C. elegans, temperate regions harbor extremely little variation, perhaps reflecting colonization and recent expansion of C. briggsae into northern latitudes. We discuss these findings in relation to their implications for selection, demographic history, and the persistence of self-fertilization.


QUANTIFICATION of population genetic variation in nature is key to understanding the forces responsible for shaping evolutionary change. The processes of mutation, drift, recombination, demography, and selection each likely contribute to patterns of genetic variation in Caenorhabditis nematodes, although their relative strength within and among species remains unclear. The nematode Caenorhabditis elegans, a model for diverse areas of biology, has a recent but growing literature in population genetics (Graustein et al. 2002; Jovelin et al. 2003; Sivasundar and Hey 2003; Barrière and Félix 2005; Haber et al. 2005; Sivasundar and Hey 2005; Cutter 2006). The evolutionary context of population processes in C. elegans will be greatly informed by understanding patterns of genetic variation in related species, for which relatively few data are available (Thomas and Wilson 1991; Graustein et al. 2002; Jovelin et al. 2003). This notion of the benefits of comparative work motivated the recent genome sequencing of the congener C. briggsae and ongoing sequencing projects for other species of Caenorhabditis (Stein et al. 2003). Indeed, genetic mapping and mutant generation efforts in C. briggsae are developing Caenorhabditis into a model genus for which C. elegans is a convenient stepping stone. Morphologically, these two species are exceedingly similar, with only subtle differences in traditional systematic characters, such as morphology of the male tail and excretory pore (Nigon and Dougherty 1949; Fitch and Emmons 1995; Baird 2001; Wang and Chamberlin 2002; Félix 2004), despite an estimated divergence of many millions of years (Coghlan and Wolfe 2002; Stein et al. 2003). C. briggsae shares the same selfing mode of reproduction as C. elegans and is androdioecious, although phylogenetic analyses and the molecular genetics of sex determination argue that the similar mating systems probably evolved independently (Kiontke et al. 2004; Nayak et al. 2005; Hill et al. 2006). These two species also have partially sympatric geographic distributions and were isolated together on several occasions, although species ranges are poorly characterized in both species. More importantly for molecular evolutionary work, other currently known species in the genus share common ancestors more recently with C. briggsae than with C. elegans (Kiontke et al. 2004; Kiontke and Sudhaus 2006). In addition, recent work in C. briggsae has shown heritable variation for male reproductive structures (Baird et al. 2005) and cell lineage properties of hermaphrodite vulva development (Delattre and Felix 2001). Some cross-species hybrids form partially developed embryos (Baird et al. 1992; Baird and Yen 2000; Hill and L'Hernault 2001; Baird 2002), potentially permitting a Caenorhabditis model for speciation. These factors make it desirable to acquire a general understanding of the patterning of natural genetic variation in C. briggsae.

Understanding population genetic variation helps to illuminate the scope of selective, neutral, and demographic processes shaping genomes. One important factor in Caenorhabditis, as well as in many other groups of animals and plants (Jarne and Charlesworth 1993), is the presence of self-fertilization. Self-fertilization can profoundly affect how new mutations (beneficial, detrimental, and neutral) spread in a species through its effects on increased homozygosity, reduced genetic variation, reduced effective recombination, and population subdivision (Charlesworth 2003). Population structure induced by selfing can also affect the fixation probabilities for newly arising alleles through dependencies on interdemic migration rates and colonization–extinction dynamics, which influence effective population sizes (Wade and McCauley 1988; Pannell and Charlesworth 1999; Wakeley and Aliacar 2001; Pannell 2003; Peters et al. 2003). Ecologically, self-fertilizing hermaphrodites are able to colonize new habitats as solitary individuals but may also be subject to inbreeding depression (Baker 1955; Lande and Schemske 1985; Charlesworth and Charlesworth 1987). Thus, self-fertilization can result in a cascade of genetic consequences with important implications for adaptation and genome evolution.

In an effort to characterize natural variation in the self-fertile C. briggsae, we have collected 57 new isolates from two continents, for which we assayed nucleotide polymorphism at six loci. Surveys of diversity that use nucleotide sequence data provide several advantages over other common measures of genetic variation by using well-defined regions that are expected to conform to known mutational dynamics. Consequently, the extensive population genetic theory that has developed for such variants can be applied to the resulting data and, given the developing resources in C. briggsae, analysis of known regions allows integration with genomic information and a window into genome evolution. The pattern of polymorphisms in this study reveals differentiation between C. briggsae strains found in temperate localities in the northern hemisphere and those sampled near the Tropic of Cancer, with diversity within the tropical region comparable to what is found for C. elegans in Europe. In contrast with C. elegans, exceptionally little polymorphism is present among European samples of C. briggsae, possibly reflecting colonization and recent expansion of C. briggsae in temperate latitudes. However, broader and denser geographic sampling of both C. briggsae and C. elegans is necessary to clearly define the full extent of their sympatry, population subdivision, and genetic diversity.

MATERIALS AND METHODS

Nematode populations:

We include 63 isohermaphrodite strains of C. briggsae in this study, including 6 obtained from the Caenorhabditis Genetics Center (Table 1; Figure 1). The majority of these strains were collected from eight sites across France (Frechendets, Paris, Hermanville, Merlet, Marsas, Beauchene, Obernai, Viosne Valley) from compost heaps (Marsas, Frechendets, Le Blanc, Hermanville), snails (under mulberry tree, Oxychilus sp., Merlet; rotting Helix aspersa, Paris), soil and detritus from a vegetable garden (Obernai), soil below a mulberry tree (Merlet), and soil from a road embankment along a cultivated field (Viosne Valley). Nematodes were isolated and identified as previously described (Barrière and Félix 2005), with developmental timing consistent with their having been in the dauer stage at the time of collection in most cases, with the exception of the sample from Obernai in which all stages were present. We also isolated one new strain in Reykjavik, Iceland (a cemetery flower bed), two new strains from mainland China (mushroom compost in farmyard, JU725; soil and compost in cabbage field, JU726), and six new strains in Taipei, Taiwan (China) (Table 1). The new Taiwanese strains derive from two localities within Taipei: a piece of rotting wood from a private garden in Tienmu (ED3033–ED3037) and a sample from a flower bed in a public garden in Chungcheng (ED3032). Individual nematodes were isolated from the samples, with species identity confirmed with mating tests or sequencing of the small-subunit ribosomal RNA gene (Floyd et al. 2002). Strains are available upon request (http://www2.ijm.jussieu.fr/worms).

TABLE 1.

C. briggsae strains included in this study

Strains Location (nearest city) Latitude (N) Source
VT847 Hawaii, United States 20° 57′ CGC
JU726 Chengyang, Guandong, China 21° 13′ This study
AF16 Ahmedabad, India 23° 01′ CGC
JU725 Yangshuo, Guangxi, China 24° 46′ This study
ED3032 Taipei, Taiwan, China 25° 02′ This study
ED3033–ED3037 Taipei, Taiwan, China 25° 02′ This study
HK104 Okayama, Hirusen, Japan 34° 40′ CGC
HK105 Sendai, Aobayama, Japan 38° 16′ CGC
PB826 Hueston Woods St. Pk., OH, United States 39° 34′ CGC
PB800 Dayton, OH, United States 39° 53′ CGC
JU516 Marsas, France 43° 02′ This study
JU793–JU797 Frechendets, France 43° 04′ This study
JU348–JU358 Merlet, France 44° 26′ This study
JU757 Le Blanc, France 46° 37′ This study
JU441 Beauchene, France 47° 55′ This study
JU835–JU846 Obernai, France 48° 27′ This study
JU279, JU280, JU296 Paris, France 48° 50′ This study
JU372–JU377, JU379–JU383 Viosne Valley, Oise, France 49° 04′ This study
JU403–JU405 Hermanville, France 49° 17′ This study
JU439 Reykjavik, Iceland 64° 08′ This study

CGC, Caenorhabditis Genetics Center.

Figure 1.—

Figure 1.—

Geographic distribution of C. briggsae sampling sites.

Molecular methods and genetics:

DNA was isolated using an NaOH digestion protocol for single individuals or groups of ≤5 individuals for each of the 63 strains of C. briggsae (Floyd et al. 2002). We selected for resequencing in these strains the putative orthologs of six genes from C. elegans chromosomes II and X that were assessed for polymorphism previously in C. elegans (Cutter 2006). Primers were designed to span a long (>500 bp) intron in each of these loci on the basis of Wormbase annotations for C. briggsae (Table 2). However, because of evolutionary changes in intron size and location, the specific C. briggsae regions that were sequenced are not all homologous with the C. elegans introns sequenced by Cutter (2006), despite lying within orthologous genes. In the case of one C. elegans gene (D1005.1), a convincing ortholog in C. briggsae with adequate primers could not be found, so the putative ortholog of a nearby C. elegans locus was used instead (C. briggsae CBG24509 homologous to C. elegans F09E10.5). Both strands were sequenced on an ABI 3730 automated sequencer by the University of Edinburgh sequencing facility.

TABLE 2.

Feature statistics of sequenced loci

Locus ID C. briggsae gene Ultra-contig Super-contig C. elegans ortholog Forward primer Reverse primer Size
p09 CBG19635 cb25.fpc4131 c001701154.Contig2 Y25C1A.5 (II) TTGATAAGCCAACCCCAGTC GAGATTGGCAGCAAGGAATC 843
p10 CBG03684 cb25.fpc0071 c009701346.Contig1 ZK430.1 (II) TGGAAATGTGGATGCGAGTA TTGAAGTCGTCCCAGGATTC 779
p11 CBG20775 cb25.fpc4206 c002000737.Contig8 E01G4.6 (II) AATCCAGCAAGGTCTCTCCA TCCACGTTGGATGACAAGAA 863
p12 CBG14460 cb25.fpc3857 c000600869.Contig1 R160.7 (X) TTGGAATAAACCTCGTCCAGA GATCCTGAGCCACACGAAGT 787
p13 CBG16368 cb25.fpc4033 c005600403.Contig1 T24D11.1 (X) AAAAAGCGTCCGAATCACAT GGAATATCGCGTTGGATGAC 792
p14 CBG24509 cb25.NA_175 c013101146.Contig1 F09E10.5 (near D1005.1) (X) TCATGACCAACAAAGAAATGC TCAACCAAGAACGTCTCGAA 777

Because a fully integrated genetic map with contiguous genome sequence is not yet available for C. briggsae, we mapped these loci relative to each other. Restriction and length polymorphisms in four of the five polymorphic loci allowed us to score genotypes in a set of 94 recombinant inbred lines (RIL) and in their parental strains (AF16 and HK104) that are being used for the C. briggsae mapping project (http://snp.wustl.edu/snp-research/c-briggsae; supplemental Table 1 at http://www.genetics.org/supplemental/); the RIL were constructed by S. Baird, who kindly provided DNA samples. We then inferred linkage groups and recombination distances between loci using the Kosambi mapping function in MapManager QTX b20 (http://www.mapmanager.org).

Sequence analysis:

Sequencher v.4.0 and BioEdit were used for sequence alignment and manual editing to confirm sequence quality and to remove primer sequences. Calculations of diversity from pairwise differences (π) and from the number of segregating sites (θ) (Watterson 1975; Nei and Li 1979), linkage disequilibrium, recombination, and tests of neutrality were performed using DnaSP v.4.10.04 (Rozas et al. 2003), RecMin (Myers and Griffiths 2003), and LIAN v.3.1 (Haubold and Hudson 2000). We focus on diversity at silent sites (synonymous and intronic positions; πsi and θsi), which compose the majority of the data set. Sites associated with indels or incomplete data were excluded from the analyses. Neighbor-joining trees were constructed with PAUP* v.4.0 using concatenated sequences, but should not be used to infer phylogenetic relationships between strains because of the evidence for recombination in these data (see below). Consequently, we also used SplitsTree4 (Huson and Bryant 2006) to graphically represent the relationships between haplotypes so as to include evidence for recombination.

RESULTS

In 4164 bp of C. briggsae sequence across six loci, we identified 35 single nucleotide polymorphisms, 11 indel polymorphisms, plus an SNP that occurred within an indel (Figure 2). Overall silent-site nucleotide polymorphism is low, with πsi and θsi estimated to be ∼0.2% among tropical samples (Table 3). No polymorphisms were found in the 789 bp of coding sites (182.67 of which are synonymous) or in the 738 bp surveyed for locus p11. The variants include 18 transitions and 17 transversions, corresponding to a low transition:transversion ratio (ts/tv) of 1.06, a nonsignificant difference from the lower bound estimate for ts/tv in C. elegans (1.3–1.6, binomial P = 0.068) (Koch et al. 2000; Denver et al. 2003, 2004; Cutter 2006). Length variants were present in four of the six loci and include five single-base indels, two double-base indels, and individual indels 3 and 4 bp in length (Figure 2). An additional indel complex in locus p10 appears to be composed of 10- and 38-bp indels as well as a single nucleotide polymorphism. Some of these indels were associated with simple repeats, including two indels forming part of an A3–4C5–6 motif in p10, an A7–8 motif in p12, and two indels as part of an A7–8C2–3 motif in locus p13.

Figure 2.—

Figure 2.—

Summary of sequenced regions, polymorphisms, and haplotypes. Loci are indicated along the bottom, demarcated by alternating backgrounds (p12 and p13 localize to the X chromosome, p10 to chromosome II). Positions of polymorphisms within the sequence for each locus are listed across the top with indel lengths in parentheses. Only the first base is shown for indel polymorphisms, except for p10, in which an SNP overlaps an indel. Strain names for each haplotype are listed along the right; strains for 47 identical French haplotypes are given in Table 1.

TABLE 3.

Summary of C. briggsae nucleotide polymorphism

Diversity: πsi
Diversity: θsi
Segregating sites: S
Locus ID Tropicala Temperateb CGC Strainsc Tropicala Temperateb CGC Strainsc Tropicala Temperateb CGC Strainsc
p09 0.00072 0 0.00067 0.00071 0 0.00088 1 0 1
p10 0.00285 0.00018 0.01251 0.00241 0.00072 0.01141 4 2 15
p11 0 0 0 0 0 0 0 0 0
p12 0.00106 0 0.00425 0.00112 0 0.00349 2 0 5
p13 0.00790 0.00006 0.00498 0.00590 0.00036 0.00655 10 1 9
p14 0.00111 0 0.00144 0.00118 0 0.00146 2 0 2
Concatenated 0.00232 0.00004 0.00404 0.00193 0.00019 0.00403 19 3 32
Average 0.00227 0.00004 0.00398 0.00189 0.00018 0.00397 3.2 0.5 5.3
a

Ten samples from latitudes ≤25°N.

b

Fifty-three samples from latitudes ≥34°N.

c

Six samples from the Caenorhabditis Genetics Center used in Graustein et al. (2002).

An exceptionally low level of polymorphism is represented among the 53 samples from temperate latitudes (34–64° N: France; Iceland; Japan; Ohio, United States), including only three polymorphic sites with a corresponding pairwise silent-site diversity estimate of πsi = 0.00004. Indeed, 48 isolates from eight sites across France and Iceland all share the same multilocus haplotype (Figure 2). This finding was a surprise, given the normal levels of diversity observed for C. elegans in similar samples in some of the same locations (Barrière and Félix 2005; Cutter 2006). In contrast, the 10 more tropical samples (20–25° N: China; India; Hawaii, USA) harbor nearly all of the diversity identified in the species (πsi = 0.0023). Given our structured sampling scheme among the French collections, it would seem appropriate to use a subsampling method to estimate diversity (Lessard and Wakeley 2004); however, the near absence of polymorphism in these samples limits the utility of such an approach. Nevertheless, inclusion of only a single individual from each temperate locality in calculating diversity yields πsi = 0.00016 (θsi = 0.00027). In addition to the difference in overall levels of diversity between temperate and tropical isolates, haplotype patterns clearly distinguish C. briggsae between tropical and temperate regions. There are 14 fixed single nucleotide differences and three indels from four different loci differentiating the temperate from tropical strains. This temperate–tropical dichotomy is reflected clearly both in the table of polymorphisms and in a neighbor-joining tree of haplotypes (Figures 2 and 3). Although genealogies with two long ancestral branches are typical of neutral genealogies, particularly for highly inbreeding species, such genealogies are generally not expected to be associated with geography or to partition the same individuals repeatedly for different loci.

Figure 3.—

Figure 3.—

Unrooted p-distance neighbor-joining tree (A) and neighbor network (B) of C. briggsae multilocus haplotypes. Reticulation in B indicates possible recombination between haplotypes. Numbers above or below a branch indicate bootstrap support percentages ≥75% out of 1000 replicates. Strain designations are as in Table 1.

The clear differentiation between isolates from temperate and tropical localities led us to explore other features of the polymorphism data separately for these two classes of samples. In particular, we were interested in whether or not the samples showed evidence for departure from a neutral equilibrium scenario with no selection, population structure, or changes in population size. By comparing diversity estimates on the basis of pairwise differences (π) or the number of segregating sites (θ), we quantified departures from the neutral expectation with Tajima's D and Fu and Li's D* statistics (Watterson 1975; Nei and Li 1979; Tajima 1989; Fu and Li 1993). The two diversity estimators (π and θ) should yield similar values at neutral equilibrium, resulting in values of D and D* that approach zero, whereas non-neutral demographic processes affect θ and π differently and can lead to positive (e.g., population contraction or structure) or negative (e.g., population growth) D and D*. For the 10 tropical samples, nominal values of D (and D*) were positive on average (mean D = 0.37, D* = 0.43; Table 4), with locus p13 significantly so (D* = 1.46, P < 0.05). The low overall diversity makes it difficult to ascertain whether there is a general trend of positive skew in the frequency spectrum (i.e., D > 0, a deficit of rare alleles); if so, then this suggests that population structure or a population contraction may underlie part of the pattern of variation in the tropical samples (Charlesworth et al. 1993), although our sampling of low-latitude regions is too sparse to test these ideas more rigorously. In contrast to the tropical samples, the two polymorphic loci among the temperate samples both exhibit nonsignificant negative values for D and D* (Table 4). Coupled with the extreme lack of polymorphism among the European, Japanese, and continental United States samples, this might correspond to a recent colonization of northerly latitudes followed by population expansion.

TABLE 4.

Skews in the frequency spectrum for tropical and temperate samples

Tajima's D
Fu and Li's D*
Locus ID Tropical Temperate Tropical Temperate
p09 0.01 0.80
p10 0.69 −1.31 0.45 −0.91
p11
p12 −0.18 −0.28
p13 1.50 −1.09 1.46a −1.86
p14 −0.18 −0.28
Concatenated 0.96 −1.58 0.93 −1.75
Average 0.37 −1.20 0.43 −1.39
a

P < 0.05.

The pattern of polymorphisms for these six loci indicates that recombination has occurred in the history of the sample. Using a conservative method based on the four-gamete test (Hudson and Kaplan 1985), a minimum of Rm = 2 recombination events is evident, whereas an alternative approach suggests a minimum of Rh = 3 recombination events (Myers and Griffiths 2003). In addition to the historical recombination predicted to have occurred between loci (p10–p12, p12–p13), the Myers and Griffiths (2003) method predicts intralocus recombination for locus p12. We also quantified linkage disequilibrium between pairs of polymorphic sites among the samples collected in tropical regions. Although the average values of the r2 measure of linkage disequilibrium were high both within and between loci (Table 5), no individual pair of sites deviated significantly for Fisher's exact tests after applying the conservative Bonferroni correction for multiple tests, given only 10 samples. However, a multilocus statistic that considers all sites together (IA = 0.232; Haubold and Hudson 2000) identifies significant linkage disequilibrium overall (P = 0.01), despite the lack of power to detect specific pairs of sites with significant linkage disequilibrium.

TABLE 5.

Average linkage disequilibrium (r2) between each pair of loci

Mean r2
Locus ID p09 p10 p12 p13 p14
p09 NA
p10 0.497 0.495
p12 0.038 0.178 0.259
p13 0.059 0.238 0.258 0.857
p14 0.246 0.204 0.201 0.489 0.048

NA, not applicable.

Our linkage analysis, in which we scored restriction polymorphisms in a set of recombinant inbred lines, allowed us to place loci p12 and p13 on the same linkage group, separated by ∼27.1 cM. From the locations of ultra-contigs for p12 and p13 on the preliminary C. briggsae SNP map v.3.1 (http://snp.wustl.edu/snp-research/c-briggsae/), we infer that they reside on the X chromosome like their orthologs in C. elegans. Two other loci (p09, p10) showed independent segregation, and we were unable to score the remaining two loci (no polymorphic sites in p11, no polymorphic restriction sites in p14). However, super-contig locations for both p10 and p11 on the SNP map indicate locations on C. briggsae chromosome II, with a separation of ∼22.3 cM (the C. elegans orthologs lie on chromosome II).

Given that mutation accumulation experiments suggest that C. elegans and C. briggsae have roughly similar mutation rates, although the rate in C. briggsae may be somewhat higher (Baer et al. 2005), we can apply direct estimates of the C. elegans neutral mutation rate to the C. briggsae diversity information to infer its effective population size (Ne). Assuming that C. briggsae populations are at equilibrium (i.e., θ = 4Neμ) and that the neutral mutation rate μ = 9.0 × 10−9 (Denver et al. 2004), we estimate the effective population size of C. briggsae in tropical regions to be ∼6 × 104. If the neutral mutation rate in C. briggsae is higher than that of C. elegans and if population structure is present in the tropical samples, then this value of Ne will be an overestimate (Baer et al. 2005).

DISCUSSION

Patterns of nucleotide polymorphism:

The global pattern of polymorphism in C. briggsae reveals a small set of highly similar haplotypes in temperate regions that are distinct from the bulk of the known species diversity present in tropical latitudes. Samples from localities around the Tropic of Cancer are characterized by low levels of silent-site nucleotide diversity, averaging πsi = 0.2%, whereas temperate samples exhibit exceedingly little diversity with πsi = 0.004%. Moreover, fixed differences in four loci clearly differentiate these two classes of samples.

A previous study of polymorphism for two nuclear genes in C. briggsae reported much higher overall levels of diversity than we find for tropical samples (tra-2 πsi = 0.53%, glp-1 πsi = 0.42%; Graustein et al. 2002), whereas data from another study in a sample of four strains yielded a diversity estimate similar to those reported here (odr-3 πsi = 0.19%; Jovelin et al. 2003). We recalculated π and θ using the subset of six strains in our sample that were used by Graustein et al. (2002) and recapitulate their pattern of higher diversity estimates (Table 3). However, these higher values probably reflect a classic effect of population subdivision due to the presence of differentiated tropical and temperate strains in the same sample (Charlesworth 2003). Nevertheless, this differentiation indicates that global species diversity is greater than the 0.2% observed within available tropical samples.

Linkage disequilibrium and recombination:

Overall multilocus linkage disequilibrium is greater than that expected by chance, with high magnitudes of pairwise linkage disequilibrium within and between loci. Despite the presence of linkage disequilibrium within loci, the pattern of polymorphisms also reveals a history of recombination. Depending on the method used, these data indicate the presence of at least two to three recombination events in the history of the sample (Hudson and Kaplan 1985; Myers and Griffiths 2003). Using an approach previously described for C. elegans data (Cutter 2006), we can attempt to roughly infer levels of outcrossing and selfing from interlocus linkage disequilibrium. For the four polymorphic loci that have mapping information (with 50 cM separating independently segregating loci), the levels of linkage disequilibrium among tropical strains imply an outcrossing rate of ∼3.9 × 10−5 (range of values from average LD between locus pairs: 4.2 × 10−6–1.1 × 10−4), assuming that all of the observed linkage disequilibrium is due to self-fertilization and that Ne = 6 × 104. This amount of outcrossing is similar to, but slightly lower than, the low levels inferred from linkage disequilibrium in C. elegans (Barrière and Félix 2005; Cutter 2006), and alternative methods have resulted in even higher outcrossing rate estimates in C. elegans (Barrière and Félix 2005; Sivasundar and Hey 2005). If population structure is present within the tropical sample, then this outcrossing rate estimate may be downwardly biased, although it is possible to remove an effect of structure by sampling single individuals from different subpopulations (Lessard and Wakeley 2004; Cutter 2006). However, it may be expected that C. briggsae will experience lower outcrossing rates than C. elegans, because X-bearing male sperm fertilize oocytes more readily than do nullo-X male sperm in C. briggsae (Lamunyon and Ward 1997), which is likely to decrease equilibrium male frequency and outcrossing (Chasnov and Chow 2002; Stewart and Phillips 2002; Cutter et al. 2003a).

Comparison with C. elegans:

Unlike the distribution of genetic diversity observed in C. elegans, a clear geographic partitioning of variation is evident for C. briggsae (Barrière and Félix 2005; Haber et al. 2005; Cutter 2006). This patterning also is evident in the survey of Graustein et al. (2002), although their sample of only six C. briggsae strains precluded any biogeographic inference about the few haplotypes observed. The differentiation among temperate and tropical latitudes in C. briggsae leads to greater maximum divergence between intraspecific haplotypes in C. briggsae than in C. elegans (Ksi = ∼0.84% vs. ∼0.37%), although variation within the tropical samples is comparable to polymorphism among European C. elegans (πsi = ∼0.2%; Cutter 2006). Variation at orthologous loci is not correlated in the two species. By contrast to European C. elegans, genetic variation is virtually absent among C. briggsae samples within Europe. For the two French localities in which more than one isolate each of C. elegans and C. briggsae were collected, no polymorphism is present for C. briggsae, whereas for C. elegans diversity levels are typical (Merlet πsi = 0.12% and Hermanville πsi = 0.26%; Cutter 2006). This lack of diversity among temperate C. briggsae isolates, coupled with the few variants being present primarily as singletons, suggests that this species may have colonized and expanded in temperate latitudes more recently or from fewer sources than C. elegans. Unfortunately, the present density of sampling of C. briggsae within tropical regions is insufficient to test for population subdivision, which has been observed for C. elegans among sampling localities (Barrière and Félix 2005; Haber et al. 2005; Sivasundar and Hey 2005; Cutter 2006).

In more general terms, nucleotide polymorphism is low and quantitatively similar in C. briggsae and C. elegans. By comparison, the outcrossing C. remanei appears to harbor many times higher levels of genetic variation (Graustein et al. 2002; Jovelin et al. 2003; A. D. Cutter, unpublished data), as do other nematode and Drosophila species (Table 6) (Anderson et al. 1998; Andolfatto 2001). Graustein et al. (2002) argued that the differences in diversity among Caenorhabditis species is too great to be explained solely by the effects of alternative breeding systems and, therefore, that repeated bottlenecks and/or the action of widespread background selection or genetic hitchhiking must be responsible for the discrepancy. The distribution of single nucleotide polymorphisms with respect to recombination rate in C. elegans is suggestive of the action of background selection in the genome (Cutter and Payseur 2003b). Another recent hypothesis regarding demographic effects on C. elegans genetic variation holds that extinction–recolonization dynamics could generate extremely reduced levels of diversity (Sivasundar and Hey 2005), although it is not clear whether this is likely to be an important process globally given the extent of migration (Barrière and Félix 2005; Cutter 2006). An additional scenario that might explain exceptionally low variation in C. elegans and C. briggsae is a recent origin of self-fertilization from a single or small set of progenitors, in which case insufficient time may have elapsed for equilibrium levels of polymorphism to have accumulated. Unfortunately, currently available evidence is insufficient to rule out any of these non-mutually exclusive possibilities.

TABLE 6.

Summary of average nucleotide and microsatellite polymorphism levels for nematode species

Species Location πsia Hb Reference
Ascaris suum/lumbricoides Mitochondria 0.016 Anderson et al. (1993)
Caenorhabditis briggsae Mitochondria 0.044 Graustein et al. (2002)
Caenorhabditis briggsae Nucleus 0.002 Graustein et al. (2002); Jovelin et al. (2003); this study
Caenorhabditis elegans Mitochondria 0.043 Graustein et al. (2002)
Caenorhabditis elegans Nucleus 0.002 0.62 Graustein et al. (2002); Sivasundar and Hey (2003); Barrière and Félix (2005); Haber et al. (2005); Cutter (2006)
Caenorhabditis remanei Mitochondria 0.105 Graustein et al. (2002)
Caenorhabditis remanei Nucleus 0.047 Graustein et al. (2002); Jovelin et al. (2003); Haag and Ackerman (2005); A. D. Cutter (unpublished data)
Dictyocaulus viviparus Mitochondria 0.002 Hu et al. (2002)
Globodera pallida Nucleus 0.47 Picard et al. (2004)
Haemonchus contortus Nucleus 0.093 Beech et al. (1994)
Haemonchus contortus Mitochondria 0.026 Blouin et al. (1995)
Haemonchus placei Mitochondria 0.019 Blouin et al. (1995)
Heligmosomoides polygyrus Mitochondria 0.02 Nieberding et al. (2005)
Heterodera schachtii Nucleus 0.58 Plantard and Porte (2004)
Heterorhabditis marelatus Mitochondria 0.0025 Blouin et al. (1999)
Howardula aoronymphium Mitochondria 0 Jaenike (1996)
Longidorus biformis Nucleus 0.006 Ye et al. (2004)
Longidorus biformis Nucleus 0.109 Ye et al. (2004)
Longidorus diedecturus Nucleus 0.008 Ye et al. (2004)
Longidorus grandis Nucleus 0 Ye et al. (2004)
Longistriata caudabullata Mitochondria 0.012 Brant and Orti (2003)
Mazamastrongylus odocoilei Mitochondria 0.028 Blouin et al. (1995)
Meloidogyne arenaria/incognita/javanica Mitochondria 0.0028 Hugall et al. (1994)
Necator americanus Mitochondria 0.012 Hawdon et al. (2001)
Onchocerca volvulus Mitochondria 0.0001 Keddie et al. (1999)
Ostertagia ostertagi Mitochondria 0.025 Blouin et al. (1992); Blouin et al. (1995)
Strongyloides ratti Mitochondria 0.001 Anderson et al. (1998)
Teladorsagia circumcincta Mitochondria 0.024 Blouin et al. (1995)
Teladorsagia circumcincta Mitochondria 0.022 Braisher et al. (2004)
Teladorsagia circumcincta Mitochondria 0.022 Leignel and Humbert (2001)
Xiphinema americanum Nucleus 0.003 Ye et al. (2004)
Xiphinema americanum Nucleus 0.019 Ye et al. (2004)
Xiphinema bakeri Nucleus 0 Ye et al. (2004)
Xiphinema index Nucleus 0.39 He et al. (2003)
a

Nucleotide diversity.

b

Microsatellite heterozygosity.

Implications for C. briggsae evolution:

What could have led to the differentiation between samples from temperate and tropical latitudes? One possibility is that C. briggsae colonized and recently expanded within temperate latitudes from a small founding population. Consistent with this scenario, the Tajima's D measure of deviation from neutral expectations tends to be negative in temperate samples, which would suggest population expansion if it is a general pattern in the genome (Tajima 1989). Should this scenario of a relatively recent founding and expansion of C. briggsae in temperate regions accurately describe its history, then it is informative to calculate how long ago it may have occurred. For a 60-day generation time (presuming that Caenorhabditis spend most of their lives as dauer larvae, Barrière and Félix 2005) and temperate-region Ne = 1000, a coalescent time of 4Ne generations (with standard deviation also ∼4Ne generations; Li 1997) implies that the time to the most recent common ancestor in temperate samples was ∼700 years ago with a two standard deviation upper bound of ∼2200 years ago (given θ = 0.00004 = 4Neμ, where μ = 9 × 10−9). However, this estimate is subject to an equilibrium assumption that is clearly violated under a scenario of population expansion; the above coalescent time calculation will be an overestimate if the demographic history of the temperate population involves recent growth. Consequently, it seems plausible that C. briggsae may have colonized temperate parts of the world only in the past few hundred years, perhaps in association with human activity. However, it is important to point out that the source of such a founder event is not clear, given the highly distinct temperate-region haplotypes relative to haplotypes known from available tropical samples. Additional sampling of C. briggsae in tropical regions will be necessary to elucidate the likely source population that gave rise to the present inhabitants of more temperate latitudes and to determine whether the dichotomous pattern of interstrain relationships persists.

One of the most obvious environmental differences between tropical and temperate regions is temperature, a variable that is strongly associated with development time in nematodes (Byerly et al. 1976; Anderson and Coleman 1982). It is notable in light of the geographic patterning of genetic variation outlined above that the tropically derived AF16 strain of C. briggsae has near-normal fertility at a temperature of 27.5°, whereas C. elegans is infertile at such high temperatures (Fodor et al. 1983; Grewal 1991). In addition, theoretical models suggest that selection pressures on hermaphrodite fecundity may differ in populations subject to rapid vs. slow development (Cutter 2004). Consequently, it will prove interesting to test for possible adaptations of geographically disparate C. briggsae isolates to temperature tolerance and other factors that correlate with latitudinal differences. Given the simple genetic basis underlying heat tolerance between some strains of C. elegans (Fatt and Dougherty 1963), this may prove to be a promising area of inquiry. The additional findings that interspecific hybrid compatibility differs for temperate (HK104) and tropical (AF16) strains of C. briggsae mated to C. remanei strain EM464 (Baird 2002) and that these C. briggsae strains exhibit heritable differences in male ray pattern development (Baird et al. 2005) suggest that a variety of biological attributes may be amenable to dissection with genetic analysis.

The low effective population size estimated for C. briggsae, like that for C. elegans, implies that targets of weak selection will be acted upon inefficiently. For example, biased usage of alternative codons can be driven by natural selection, provided that effective population sizes are sufficiently large (Ne = ∼106) (Akashi 1999). Codon bias is strongly correlated among orthologous genes of C. elegans and C. briggsae (Cutter and Ward 2005) and the codon bias of genes in C. elegans has been shown to be associated with gene expression, which has been interpreted as evidence of selection for translational efficiency (Stenico et al. 1994; Duret and Mouchiroud 1999; Duret 2000; Marais and Duret 2001; Castillo-Davis and Hartl 2002; Cutter et al. 2003b). How could selection result in these genomic patterns in the context of such low Ne? C. briggsae's outcrossing ancestor likely experienced a much larger effective population size, so present patterns of codon bias might reflect historical patterns of selection. Even in the face of relaxed selection due to smaller Ne, codon usage bias is expected to decay very slowly, on the order of the mutation rate (Marais et al. 2004). Consequently, a relatively recent origin of selfing in C. briggsae (and in C. elegans) may account for the persistence of adaptive codon usage in these species. Indeed, the most divergent C. briggsae strains imply a common ancestor of perhaps 150,000 years ago (given Ks = 0.0084, μ = 9 × 10−9, 60-day generation time), although such a rough calculation is subject to a number of caveats and is expected to underestimate the time since the origin of selfing (Cutter 2006). If this nominally greater coalescent time for extant variation in C. briggsae relative to similar calculations for C. elegans reflects an older origin of self-fertilization in C. briggsae, it might help explain the disparity in male longevity between these two species (McCulloch and Gems 2003) and the precedence of X-bearing male sperm in C. briggsae (Lamunyon and Ward 1997) as a consequence of a greater period of relaxed selection on C. briggsae males. A relatively recent origin of selfing in these species would have important implications for the interpretation of comparative sequence analysis between C. elegans and C. briggsae, because the vast majority of the millions of years of divergence separating them would have occurred in a state of outcrossing, rather than self-fertilization (Coghlan and Wolfe 2002; Stein et al. 2003; Kiontke et al. 2004). We also point out that rough calculations of the time to the most recent common ancestor between C. elegans and C. briggsae, on the basis of synonymous site divergence (Cutter and Payseur 2003a; Stein et al. 2003) and direct estimates of the neutral mutation rate in C. elegans (Denver et al. 2004; Keightley and Charlesworth 2005), suggest a more recent divergence than previous estimates that applied a molecular clock from non-nematode taxa (Coghlan and Wolfe 2002; Stein et al. 2003), due to the estimated worm mutation rate being much higher than for flies or mammals (Denver et al. 2004). Specifically, the data are consistent with a common ancestor of these species occurring 3.1–12.2 million of years ago (MYA) (range from 2.5% Ks percentiles, 1.2–20.7 MYA; Li 1997), depending on assumptions about generation time (30–90 days; faster generation time leads to more recent divergence).

The obligately outcrossing C. remanei is a closer relative of C. briggsae than either is to C. elegans (Kiontke et al. 2004), but it is not known where unidentified extant members of this genus might reside in the Caenorhabditis phylogeny. Given the large sequence divergence separating the currently described species in this genus, the identification of new sister taxa to available cultured strains will provide an important comparative context for dissecting the origin and evolution of breeding system transitions and other traits. For example, the recent isolation of a new gonochoric Caenorhabditis species (C. sp. 5, JU727; M. A. Félix, unpublished data), for which molecular data indicate a closer relationship with C. briggsae than with other members of this genus (Braendle and Félix 2006; Kiontke and Sudhaus 2006), will greatly facilitate comparative studies of development, breeding systems, speciation, and molecular evolution. As Caenorhabditis develops into a model for comparative genetics and genomics, it is imperative that current phylogenetic gaps are filled through the identification of new species.

Acknowledgments

The Caenorhabditis Genetics Center provided strains that were used in this study and Scott Baird made C. briggsae recombinant inbred lines available for use in mapping. We thank E. Dolgin and T. Johnson for helpful discussion and S. Baird and three anonymous reviewers for comments on the manuscript. This work was funded by the National Science Foundation with International Research Fellowship Program grant 0401897 to A.D.C. and by the Centre Nationale del la Recherche Scientifique and the Ministry of Research of France through a predoctoral fellowship to A.B. and a Biological Resource Center grant.

Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under accession nos. DQ632004–DQ632387.

References

  1. Akashi, H., 1999. Inferring the fitness effects of DNA mutations from polymorphism and divergence data: statistical power to detect directional selection under stationarity and free recombination. Genetics 151: 221–238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Anderson, R. V., and D. C. Coleman, 1982. Nematode temperature responses: a niche dimension in populations of bacterial-feeding nematodes. J. Nematol. 14: 69–76. [PMC free article] [PubMed] [Google Scholar]
  3. Anderson, T. J. C., M. S. Blouin and R. N. Beech, 1998. Population biology of parasitic nematodes: Applications of genetic markers. Adv. Parasitol. 41: 219–283. [DOI] [PubMed] [Google Scholar]
  4. Anderson, T. J. C., M. E. Romeroabal and J. Jaenike, 1993. Genetic-structure and epidemiology of Ascaris populations: patterns of host affiliation in Guatemala. Parasitology 107: 319–334. [DOI] [PubMed] [Google Scholar]
  5. Andolfatto, P., 2001. Contrasting patterns of X-linked and autosomal nucleotide variation in Drosophila melanogaster and Drosophila simulans. Mol. Biol. Evol. 18: 279–290. [DOI] [PubMed] [Google Scholar]
  6. Baer, C. F., F. Shaw, C. Steding, M. Baumgartner, A. Hawkins et al., 2005. Comparative evolutionary genetics of spontaneous mutations affecting fitness in rhabditid nematodes. Proc. Natl. Acad. Sci. USA 102: 5785–5790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Baird, S. E., 2001. Strain-specific variation in the pattern of caudal papillae in Caenorhabditis briggsae (Nematoda: Rhabditidae): implications for species identification. Nematology 3: 373–376. [Google Scholar]
  8. Baird, S. E., 2002. Haldane's rule by sexual transformation in Caenorhabditis. Genetics 161: 1349–1353. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Baird, S. E., and W.-C. Yen, 2000. Reproductive isolation in Caenorhabditis: terminal phenotypes of hybrid embryos. Evol. Dev. 2: 9–15. [DOI] [PubMed] [Google Scholar]
  10. Baird, S. E., M. E. Sutherlin and S. W. Emmons, 1992. Reproductive isolation in Rhabditidae (Nematoda, Secernentea): mechanisms that isolate 6 species of 3 genera. Evolution 46: 585–594. [DOI] [PubMed] [Google Scholar]
  11. Baird, S., C. Davidson and J. Bohrer, 2005. The genetics of ray pattern variation in Caenorhabditis briggsae. BMC Evol. Biol. 5: 3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Baker, H. G., 1955. Self compatibility and establishment after long distance dispersal. Evolution 9: 347–349. [Google Scholar]
  13. Barrière, A., and M. A. Félix, 2005. High local genetic diversity and low outcrossing rate in Caenorhabditis elegans natural populations. Curr. Biol. 15: 1176–1184. [DOI] [PubMed] [Google Scholar]
  14. Beech, R. N., R. K. Prichard and M. E. Scott, 1994. Genetic-variability of the beta-tubulin genes in benzimidazole-susceptible benzimidazole-resistant strains of Haemonchus contortus. Genetics 138: 103–110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Blouin, M. S., J. B. Dame, C. A. Tarrant and C. H. Courtney, 1992. Unusual population-genetics of a parasitic nematode: mtDNA variation within and among populations. Evolution 46: 470–476. [DOI] [PubMed] [Google Scholar]
  16. Blouin, M. S., C. A. Yowell, C. H. Courtney and J. B. Dame, 1995. Host movement and the genetic-structure of populations of parasitic nematodes. Genetics 141: 1007–1014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Blouin, M. S., J. Liu and R. E. Berry, 1999. Life cycle variation and the genetic structure of nematode populations. Heredity 83: 253–259. [DOI] [PubMed] [Google Scholar]
  18. Braendle, C., and M. A. Félix, 2006. Sex determination: ways to evolve a hermaphrodite. Curr. Biol. 16: R468–R471. [DOI] [PubMed] [Google Scholar]
  19. Braisher, T. L., N. J. Gemmell, B. T. Grenfell and W. Amos, 2004. Host isolation and patterns of genetic variability in three populations of Teladorsagia from sheep. Int. J. Parasitol. 34: 1197–1204. [DOI] [PubMed] [Google Scholar]
  20. Brant, S. V., and G. Orti, 2003. Evidence for gene flow in parasitic nematodes between two host species of shrews. Mol. Ecol. 12: 2853–2859. [DOI] [PubMed] [Google Scholar]
  21. Byerly, L., R. C. Cassada and R. L. Russell, 1976. Life-cycle of nematode Caenorhabditis elegans. 1. Wild-type growth and reproduction. Dev. Biol. 51: 23–33. [DOI] [PubMed] [Google Scholar]
  22. Castillo-Davis, C. I., and D. L. Hartl, 2002. Genome evolution and developmental constraint in Caenorhabditis elegans. Mol. Biol. Evol. 19: 728–735. [DOI] [PubMed] [Google Scholar]
  23. Charlesworth, B., M. T. Morgan and D. Charlesworth, 1993. The effect of deleterious mutations on neutral molecular variation. Genetics 134: 1289–1303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Charlesworth, D., 2003. Effects of inbreeding on the genetic diversity of populations. Phil. Trans. R. Soc. Lond. B Biol. Sci. 358: 1051–1070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Charlesworth, D., and B. Charlesworth, 1987. Inbreeding depression and its evolutionary consequences. Ann. Rev. Ecol. Syst. 18: 237–268. [Google Scholar]
  26. Chasnov, J. R., and K. L. Chow, 2002. Why are there males in the hermaphroditic species Caenorhabditis elegans? Genetics 160: 983–994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Coghlan, A., and K. H. Wolfe, 2002. Fourfold faster rate of genome rearrangement in nematodes than in Drosophila. Genome Res. 12: 857–867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Cutter, A. D., 2004. Sperm-limited fecundity in nematodes: How many sperm are enough? Evolution 58: 651–655. [PubMed] [Google Scholar]
  29. Cutter, A. D., 2006. Nucleotide polymorphism and linkage disequilibrium in wild populations of the partial selfer Caenorhabditis elegans. Genetics 172: 171–184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Cutter, A. D., and B. A. Payseur, 2003. a Rates of deleterious mutation and the evolution of sex in Caenorhabditis. J. Evol. Biol. 16: 812–822. [DOI] [PubMed] [Google Scholar]
  31. Cutter, A. D., and B. A. Payseur, 2003. b Selection at linked sites in the partial selfer Caenorhabditis elegans. Mol. Biol. Evol. 20: 665–673. [DOI] [PubMed] [Google Scholar]
  32. Cutter, A. D., and S. Ward, 2005. Sexual and temporal dynamics of molecular evolution in C. elegans development. Mol. Biol. Evol. 22: 178–188. [DOI] [PubMed] [Google Scholar]
  33. Cutter, A. D., L. Avilés and S. Ward, 2003. a The proximate determinants of sex ratio in C. elegans populations. Genet. Res. 81: 91–102. [DOI] [PubMed] [Google Scholar]
  34. Cutter, A. D., B. A. Payseur, T. Salcedo, A. M. Estes, J. M. Good et al., 2003. b Molecular correlates of genes exhibiting RNAi phenotypes in Caenorhabditis elegans. Genome Res. 13: 2651–2657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Delattre, M., and M. A. Felix, 2001. Polymorphism and evolution of vulval precursor cell lineages within two nematode genera, Caenorhabditis and Oscheius. Curr. Biol. 11: 631–643. [DOI] [PubMed] [Google Scholar]
  36. Denver, D. R., K. Morris and W. K. Thomas, 2003. Phylogenetics in Caenorhabditis elegans: An analysis of divergence and outcrossing. Mol. Biol. Evol. 20: 393–400. [DOI] [PubMed] [Google Scholar]
  37. Denver, D. R., K. Morris, M. Lynch and W. K. Thomas, 2004. High mutation rate and predominance of insertions in the Caenorhabditis elegans nuclear genome. Nature 430: 679–682. [DOI] [PubMed] [Google Scholar]
  38. Duret, L., 2000. tRNA gene number and codon usage in the C. elegans genome are co-adapted for optimal translation of highly expressed genes. Trends Genet. 16: 287–289. [DOI] [PubMed] [Google Scholar]
  39. Duret, L., and D. Mouchiroud, 1999. Expression pattern and, surprisingly, gene length shape codon usage in Caenorhabditis, Drosophila and Arabidopsis. Proc. Natl. Acad. Sci. USA 96: 4482–4487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Fatt, H. V., and E. C. Dougherty, 1963. Genetic control of differential heat tolerance in 2 strains of nematode Caenorhabditis elegans. Science 141: 266–267. [DOI] [PubMed] [Google Scholar]
  41. Félix, M. A., 2004. Genomes: a helpful cousin for our favourite worm. Curr. Biol. 14: R75–R77. [PubMed] [Google Scholar]
  42. Fitch, D. H. A., and S. W. Emmons, 1995. Variable cell positions and cell contacts underlie morphological evolution of the rays in the male tails of nematodes related to Caenorhabditis elegans. Dev. Biol. 170: 564–582. [DOI] [PubMed] [Google Scholar]
  43. Floyd, R., E. Abebe, A. Papert and M. Blaxter, 2002. Molecular barcodes for soil nematode identification. Mol. Ecol. 11: 839–850. [DOI] [PubMed] [Google Scholar]
  44. Fodor, A., D. L. Riddle, F. K. Nelson and J. W. Golden, 1983. Comparison of a new wild-type Caenorhabditis briggsae with laboratory strains of Caenorhabditis briggsae and C. elegans. Nematologica 29: 203–217. [Google Scholar]
  45. Fu, Y. X., and W. H. Li, 1993. Statistical tests of neutrality of mutations. Genetics 133: 693–709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Graustein, A., J. M. Gaspar, J. R. Walters and M. F. Palopoli, 2002. Levels of DNA polymorphism vary with mating system in the nematode genus Caenorhabditis. Genetics 161: 99–107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Grewal, P. S., 1991. Influence of bacteria and temperature on the reproduction of Caenorhabditis elegans (Nematoda, Rhabditidae) infesting mushrooms (Agaricus bisporus). Nematologica 37: 72–82. [Google Scholar]
  48. Haag, E. S., and A. D. Ackerman, 2005. Intraspecific variation in fem-3 and tra-2, two rapidly coevolving nematode sex-determining genes. Gene 349: 35–42. [DOI] [PubMed] [Google Scholar]
  49. Haber, M., M. Schungel, A. Putz, S. Muller, B. Hasert et al., 2005. Evolutionary history of Caenorhabditis elegans inferred from microsatellites: evidence for spatial and temporal genetic differentiation and the occurrence of outbreeding. Mol. Biol. Evol. 22: 160–173. [DOI] [PubMed] [Google Scholar]
  50. Haubold, B., and R. R. Hudson, 2000. LIAN 3.0: detecting linkage disequilibrium in multilocus data. Bioinformatics 16: 847–848. [DOI] [PubMed] [Google Scholar]
  51. Hawdon, J. M., T. Li, B. Zhan and M. S. Blouin, 2001. Genetic structure of populations of the human hookworm, Necator americanus, in China. Mol. Ecol. 10: 1433–1437. [DOI] [PubMed] [Google Scholar]
  52. He, Y., H. M. Li, D. J. F. Brown, F. Lamberti and M. Moens, 2003. Isolation and characterisation of microsatellites for Xiphinema index using degenerate oligonucleotide primed PCR. Nematology 5: 809–819. [Google Scholar]
  53. Hill, K. L., and S. W. L'Hernault, 2001. Analyses of reproductive interactions that occur after heterospecific matings within the genus Caenorhabditis. Dev. Biol. 232: 105–114. [DOI] [PubMed] [Google Scholar]
  54. Hill, R. C., C. Egydio de Carvalho, J. Salogiannis, B. Schlager, D. Pilgrim et al., 2006. Genetic flexibility in the convergent evolution of hermaphroditism in Caenorhabditis nematodes. Dev. Cell 10: 531–538. [DOI] [PubMed] [Google Scholar]
  55. Hu, M., J. Hoglund, N. B. Chilton, X. Q. Zhu and R. B. Gasser, 2002. Mutation scanning analysis of mitochondria cytochrome c oxidase subunit 1 reveals limited gene flow among bovine lungworm subpopulations in Sweden. Electrophoresis 23: 3357–3363. [DOI] [PubMed] [Google Scholar]
  56. Hudson, R. R., and N. L. Kaplan, 1985. Statistical properties of the number of recombination events in the history of a sample of DNA sequences. Genetics 111: 147–164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Hugall, A., C. Moritz, J. Stanton and D. R. Wolstenholme, 1994. Low, but strongly structured mitochondrial-DNA diversity in root-knot nematodes (Meloidogyne). Genetics 136: 903–912. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Huson, D. H., and D. Bryant, 2006. Application of phylogenetic networks in evolutionary studies. Mol. Biol. Evol. 23: 254–267. [DOI] [PubMed] [Google Scholar]
  59. Jaenike, J., 1996. Rapid evolution of parasitic nematodes: not. Evol. Ecol. 10: 565. [Google Scholar]
  60. Jarne, P., and D. Charlesworth, 1993. The evolution of the selfing rate in functionally hermaphrodite plants and animals. Ann. Rev. Ecol. Syst. 24: 441–466. [Google Scholar]
  61. Jovelin, R., B. C. Ajie and P. C. Phillips, 2003. Molecular evolution and quantitative variation for chemosensory behaviour in the nematode genus Caenorhabditis. Mol. Ecol. 12: 1325–1337. [DOI] [PubMed] [Google Scholar]
  62. Keddie, E. M., T. Higazi, D. Boakye, A. Merriweather, M. C. Wooten et al., 1999. Onchocerca volvulus: limited heterogeneity in the nuclear and mitochondrial genomes. Exp. Parasitol. 93: 198–206. [DOI] [PubMed] [Google Scholar]
  63. Keightley, P. D., and B. Charlesworth, 2005. Genetic instability of C. elegans comes naturally. Trends Genet. 21: 67–70. [DOI] [PubMed] [Google Scholar]
  64. Kiontke, K., and W. Sudhaus, 2006. Ecology of Caenorhabditis species in Wormbook, edited by The C. elegans Research Community (doi/10.1895/wormbook.1.37.1; http://www.wormbook.org). [DOI] [PMC free article] [PubMed]
  65. Kiontke, K., N. P. Gavin, Y. Raynes, C. Roehrig, F. Piano et al., 2004. Caenorhabditis phylogeny predicts convergence of hermaphroditism and extensive intron loss. Proc. Natl. Acad. Sci. USA 101: 9003–9008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Koch, R., H. G. A. M. van Luenen, M. van der Horst, K. L. Thijssen and R. H. A. Plasterk, 2000. Single nucleotide polymorphisms in wild isolates of Caenorhabditis elegans. Genome Res. 10: 1690–1696. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Lamunyon, C. W., and S. Ward, 1997. Increased competitiveness of nematode sperm bearing the male X chromosome. Proc. Natl. Acad. Sci. USA 94: 185–189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Lande, R., and D. W. Schemske, 1985. The evolution of self-fertilization and inbreeding depression in plants. 1. Genetic models. Evolution 39: 24–40. [DOI] [PubMed] [Google Scholar]
  69. Leignel, V., and J. F. Humbert, 2001. Mitochondrial DNA variation in benzimidazole-resistant and -susceptible populations of the small ruminant parasite Teladorsagia circumcincta. J. Hered. 92: 503–506. [DOI] [PubMed] [Google Scholar]
  70. Lessard, S., and J. Wakeley, 2004. The two-locus ancestral graph in a subdivided population: convergence as the number of demes grows in the island model. J. Math. Biol. 48: 275–292. [DOI] [PubMed] [Google Scholar]
  71. Li, W. H., 1997. Molecular Evolution. Sinauer, Sunderland, MA.
  72. Marais, G., and L. Duret, 2001. Synonymous codon usage, accuracy of translation, and gene length in Caenorhabditis elegans. J. Mol. Evol. 52: 275–280. [DOI] [PubMed] [Google Scholar]
  73. Marais, G., B. Charlesworth and S. I. Wright, 2004. Recombination and base composition: the case of the highly self-fertilizing plant Arabidopsis thaliana. Genome Biol. 5: R45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. McCulloch, D., and D. Gems, 2003. Evolution of male longevity bias in nematodes. Aging Cell 2: 165–173. [DOI] [PubMed] [Google Scholar]
  75. Myers, S. R., and R. C. Griffiths, 2003. Bounds on the minimum number of recombination events in a sample history. Genetics 163: 375–394. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Nayak, S., J. Goree and T. Schedl, 2005. fog-2 and the evolution of self-fertile hermaphroditism in Caenorhabditis. PLoS Biology 3: e6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Nei, M., and W. H. Li, 1979. Mathematical-model for studying genetic-variation in terms of restriction endonucleases. Proc. Natl. Acad. Sci. USA 76: 5269–5273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Nieberding, C., R. Libois, C. J. Douady, S. Morand and J. R. Michaux, 2005. Phylogeography of a nematode (Heligmosomoides polygyrus) in the western Palearctic region: Persistence of northern cryptic populations during ice ages? Mol. Ecol. 14: 765–779. [DOI] [PubMed] [Google Scholar]
  79. Nigon, V., and E. C. Dougherty, 1949. Reproductive patterns and attempts at reciprocal crossing of Rhabditis elegans Maupas, 1900, and Rhabditis briggsae Dougherty and Nigon, 1949 (Nematoda: Rhabditidae). J. Exp. Zool. 112: 485–503. [DOI] [PubMed] [Google Scholar]
  80. Pannell, J. R., 2003. Coalescence in a metapopulation with recurrent local extinction and recolonization. Evolution 57: 949–961. [DOI] [PubMed] [Google Scholar]
  81. Pannell, J. R., and B. Charlesworth, 1999. Neutral genetic diversity in a metapopulation with recurrent local extinction and recolonization. Evolution 53: 664–676. [DOI] [PubMed] [Google Scholar]
  82. Peters, A. D., D. L. Halligan, M. C. Whitlock and P. D. Keightley, 2003. Dominance and overdominance of mildly deleterious induced mutations for fitness traits in Caenorhabditis elegans. Genetics 165: 589–599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  83. Picard, D., O. Plantard, M. Scurrah and D. Mugniery, 2004. Inbreeding and population structure of the potato cyst nematode (Globodera pallida) in its native area (Peru). Mol. Ecol. 13: 2899–2908. [DOI] [PubMed] [Google Scholar]
  84. Plantard, O., and C. Porte, 2004. Population genetic structure of the sugar beet cyst nematode Heterodera schachtii: a gonochoristic and amphimictic species with highly inbred but weakly differentiated populations. Mol. Ecol. 13: 33–41. [DOI] [PubMed] [Google Scholar]
  85. Rozas, J., J. C. Sanchez-DelBarrio, X. Messeguer and R. Rozas, 2003. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 19: 2496–2497. [DOI] [PubMed] [Google Scholar]
  86. Sivasundar, A., and J. Hey, 2003. Population genetics of Caenorhabditis elegans: the paradox of low polymorphism in a widespread species. Genetics 163: 147–157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  87. Sivasundar, A., and J. Hey, 2005. Sampling from natural populations using RNAi reveals high outcrossing and population structure in Caenorhabditis elegans. Curr. Biol. 15: 1598–1602. [DOI] [PubMed] [Google Scholar]
  88. Stein, L. D., Z. Bao, D. Blasiar, T. Blumenthal, M. R. Brent et al., 2003. The genome sequence of Caenorhabditis briggsae: A platform for comparative genomics. PLoS Biol. 1: 166–192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  89. Stenico, M., A. T. Lloyd and P. M. Sharp, 1994. Codon usage in Caenorhabditis elegans: delineation of translational selection and mutational biases. Nucleic Acids Res. 22: 2437–2446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  90. Stewart, A. D., and P. C. Phillips, 2002. Selection and maintenance of androdioecy in Caenorhabditis elegans. Genetics 160: 975–982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  91. Tajima, F., 1989. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123: 585–595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  92. Thomas, W. K., and A. C. Wilson, 1991. Mode and tempo of molecular evolution in the nematode Caenorhabditis: cytochrome oxidase-II and calmodulin sequences. Genetics 128: 269–279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  93. Wade, M. J., and D. E. McCauley, 1988. Extinction and recolonization: their effects on the genetic differentiation of local populations. Evolution 42: 995–1005. [DOI] [PubMed] [Google Scholar]
  94. Wakeley, J., and N. Aliacar, 2001. Gene genealogies in a metapopulation. Genetics 159: 893–905. [DOI] [PMC free article] [PubMed] [Google Scholar]
  95. Wang, X., and H. M. Chamberlin, 2002. Multiple regulatory changes contribute to the evolution of the Caenorhabditis lin-48 ovo gene. Genes Dev. 16: 2345–2349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  96. Watterson, G. A., 1975. Number of segregating sites in genetic models without recombination. Theor. Popul. Biol. 7: 256–276. [DOI] [PubMed] [Google Scholar]
  97. Ye, W. M., A. L. Szalanski and R. T. Robbins, 2004. Phylogenetic relationships and genetic variation in Longidorus and Xiphinema species (Nematoda: Longidoridae) using ITS1 sequences of nuclear ribosomal DNA. J. Nematol. 36: 14–19. [PMC free article] [PubMed] [Google Scholar]

Articles from Genetics are provided here courtesy of Oxford University Press

RESOURCES