Skip to main content
Reproductive Biology and Endocrinology : RB&E logoLink to Reproductive Biology and Endocrinology : RB&E
. 2006 Jul 27;4:39. doi: 10.1186/1477-7827-4-39

Identification of new participants in the rainbow trout (Oncorhynchus mykiss) oocyte maturation and ovulation processes using cDNA microarrays

Julien Bobe 1,✉, Jerôme Montfort 1, Thaovi Nguyen 1, Alexis Fostier 1
PMCID: PMC1570352  PMID: 16872517

Abstract

Background

The hormonal control of oocyte maturation and ovulation as well as the molecular mechanisms of nuclear maturation have been thoroughly studied in fish. In contrast, the other molecular events occurring in the ovary during post-vitellogenesis have received far less attention.

Methods

Nylon microarrays displaying 9152 rainbow trout cDNAs were hybridized using RNA samples originating from ovarian tissue collected during late vitellogenesis, post-vitellogenesis and oocyte maturation. Differentially expressed genes were identified using a statistical analysis. A supervised clustering analysis was performed using only differentially expressed genes in order to identify gene clusters exhibiting similar expression profiles. In addition, specific genes were selected and their preovulatory ovarian expression was analyzed using real-time PCR.

Results

From the statistical analysis, 310 differentially expressed genes were identified. Among those genes, 90 were up-regulated at the time of oocyte maturation while 220 exhibited an opposite pattern. After clustering analysis, 90 clones belonging to 3 gene clusters exhibiting the most remarkable expression patterns were kept for further analysis. Using real-time PCR analysis, we observed a strong up-regulation of ion and water transport genes such as aquaporin 4 (aqp4) and pendrin (slc26). In addition, a dramatic up-regulation of vasotocin (avt) gene was observed. Furthermore, angiotensin-converting-enzyme 2 (ace2), coagulation factor V (cf5), adam 22, and the chemokine cxcl14 genes exhibited a sharp up-regulation at the time of oocyte maturation. Finally, ovarian aromatase (cyp19a1) exhibited a dramatic down-regulation over the post-vitellogenic period while a down-regulation of Cytidine monophosphate-N-acetylneuraminic acid hydroxylase (cmah) was observed at the time of oocyte maturation.

Conclusion

We showed the over or under expression of more that 300 genes, most of them being previously unstudied or unknown in the fish preovulatory ovary. Our data confirmed the down-regulation of estrogen synthesis genes during the preovulatory period. In addition, the strong up-regulation of aqp4 and slc26 genes prior to ovulation suggests their participation in the oocyte hydration process occurring at that time. Furthermore, among the most up-regulated clones, several genes such as cxcl14, ace2, adam22, cf5 have pro-inflammatory, vasodilatory, proteolytics and coagulatory functions. The identity and expression patterns of those genes support the theory comparing ovulation to an inflammatory-like reaction.

Background

In fish, as in other lower vertebrates, the post-vitellogenic period is very important for the completion of the oogenetic process. During this step, the follicle-enclosed post-vitellogenic oocyte undergoes several key events such as the final acquisition of the ability to resume meiosis in response to the maturation-inducing steroid (MIS), the resumption of the meiotic process and, finally, its release from the surrounding follicular layers. In addition, the whole follicle (oocyte and surrounding follicular cells) undergoes a progressive differentiation ultimately leading to the release of a metaphase 2 oocyte. The key hormonal and molecular events involved in the control of meiosis resumption have been thoroughly studied and many studies have been dedicated to the action of gonadotropins, the regulation of steroidogenenic events and the action of the MIS (see [1-6] for review). However, the associated follicular or extra-follicular events involved in concomitant processes such as oocyte-follicular cells cross talk and ovulationmechanisms have received far less attention. Nevertheless, several researchgroups have studied the periovulatory ovarian physiology using classical biochemical or histological tools and, later, molecular approaches. Thus, several studies have dealt with ovarian proteases in their participation in the ovulatory process [7-9]. Differential display PCR and suppressive subtractive hybridization (SSH) approaches have also been developed in order to identify new differentially regulated genes in the fish periovulatory ovary [10-13]. In addition, numerous candidate gene studies have also been performed in the fish periovulatory ovary. Apart from genes related to hormonal controls, these studies were mostly dedicated to some specific gene families such as TGF beta family [14,15] or connexins [16,17]. Finally, fewer studies have simultaneously analyzed the expression profiles of several genes belonging to different families [18,19]. However, in contrast to other biological processes, such as immune response [20], the post-vitellogenic period has never benefited from genome-wide transcriptomic studies that could provide a global view of the molecular events occurring in the post-vitellogenic ovary undergoing oocyte maturation. In this context, the present study aimed at performing a transcriptomic analysis of the post-vitellogenic rainbow (Oncorhynchus mykiss) trout ovary. In order to do so, 9152-gene rainbow trout cDNA microarrays were hybridized using RNA samples originating from rainbow trout ovarian tissue collected during late vitellogenesis, post-vitellogenesis and oocyte maturation. A statistical analysis was performed in order to identify all the genes exhibiting a differential expression over this period. In addition, a supervised clustering analysis was performed using only the differentially expressed genes in order to identify groups (or clusters) of genes exhibiting similar expression profiles. Furthermore, as a first step in a long-term transcriptomic analysis of the rainbow trout post-vitellogenic ovary, we deliberately chose to focus on 3 gene clusters exhibiting the most remarkable expression patterns. Finally, specific genes were selected in each cluster based on the novelty of their putative identity and/or function. For each gene, a real-time PCR analysis of their ovarian expression profiles was performed using additional ovarian RNA samples.

Methods

Animal and tissue collection

Investigations were conducted according to the guiding principles for the use and care of laboratory animals and in compliance with French and European regulations on animal welfare. Two year old female rainbow trout (Oncorhynchus mykiss) were obtained during their first reproductive season from our experimental fish farm (Sizun, France) and held under natural photoperiod in a re-circulated water system in INRA experimental facilities (Rennes, France). The water temperature was kept constant at 12°C. Ovaries were sampled from individual females during late vitellogenesis (N = 6), post-vitellogenesis (N = 6) and during oocyte maturation (N = 6). Oocyte developmental stage was assessed under binocular microscope according to previously described criteria [21,22]. Late vitellogenic samples were collected at the end of the vitellogenic process, approximately 3–4 weeks before expected ovulation. At this stage, germinal vesicle is not visible and no polarized cytoplasm area can be observed. Post-vitellogenic samples were collected 2–3 weeks later but before any noticeable morphological changes in yolk structure due to the process of meiosis resumption. At this stage, oocytes can display a subperipheral or peripheral germinal vesicle. When germinal vesicle is not visible, a dark mass of polarized cytoplasm can be observed. Oocyte maturation samples were collected after meiosis resumption. Those samples were thus collected after yolk clarification and around the time of germinal vesicle breakdown (GVBD). For tissue collection, trout were deeply anesthetized in 2-phenoxyethanol, killed by a blow on the head and bled by gill arch section. Ovaries were then dissected out of the body cavity under sterile conditions. Ovarian aliquots were frozen in liquid nitrogen and stored at -80°C until RNA extraction.

RNA extraction and reverse transcription

Ovarian tissue was homogenized in Trizol reagent (Invitrogen, Cergy Pontoise, France) at a ratio of 100 mg per ml of reagent and total RNA was extracted according to manufacturer's instruction. Due to yolk abundance in rainbow trout full-grown oocytes, total RNA was subsequently re-purified using a Nucleospin RNA 2 kit (Macherey Nagel, Germany) to obtain genomic grade RNA quality.

cDNA microarrays

Nylon micro-arrays (7.6 × 2.6 cm) were obtained from INRA-GADIE (Jouy-en-Josas, France) [23]. A set of 9152 distinct rainbow trout cDNA clones originating from a pooled-tissues library [24] were spotted in duplicates after PCR amplification. PCR products were spotted onto Hybond N+ membranes as described by Nguyen et al. [25]. This rainbow trout generic array was deposited in Gene Expression Omnibus (GEO) database (Platform# GPL 3650) [26].

Hybridization

RNA samples originating from 13 ovarian samples (late vitellogenesis, N = 3; post-vitellogenesis, N = 4 and oocyte maturation N = 6) were used for microarray hybridization according to the following procedure. Hybridizations were carried out as described by Bertucci et al. [27], with minor modifications, at INRA AGENAE genomic facility (Rennes). A first hybridization was performed using a 33P-labelled oligonucleotide (TAATACGACTCACTATAGGG which is present at the extremity of each PCR product) to monitor the amount of cDNA in each spot. After stripping (3 hours 68°c, 0.1× SSC, 0.2% SDS), arrays were prehybridized for 1 h at 65°C in hybridization solution (5× Denhardt's, 5× SSC, 0.5% SDS). Complex probes were prepared from 3 μg of RNA of each sample by simultaneous reverse transcription and labeling for 1 hour at 42°C in the presence of 50 μCi [alpha-33P] dCTP, 5 μM dCTP, 0.8 mM each dATP, dTTP, dGTP and 200 units M-MLV SuperScript RNase H-reverse transcriptase (GIBCO BRL) in 30 μL final volume. RNA was degraded by treatment at 68°C for 30 min with 1 μl 10% SDS, 1 μl 0.5 M EDTA and 3 μl 3 M NaOH, and then equilibrated at room temperature for 15 min. Neutralization was done by adding 10 μl 1 M Tris-HCl plus 3 μl 2N HCl. Arrays were incubated with the corresponding denatured labeled cDNAs for 18 h at 65°C in hybridization solution. After 3 washes (1 hours 68°C, 0.1× SSC 0.2% SDS), arrays were exposed 65 hours to phosphor-imaging plates before scanning using a FUJI BAS 5000. Signal intensities were quantified using ArrayGauge software (FujifilmMedical Systems, Stanford, CT) and deposited in GEO database (Series# GSE 4871).

Microarray signal processing

Low oligonucleotide signals (lower than three times the background level) were excluded from the analysis. After this filtering step, signal processing was performed using the vector oligonucleotide data to correct each spot signal by the actual amount of DNA present in each spot. After correction, signal was normalized by dividing each gene expression value by the median value of the array.

Microarray data analysis

A statistical analysis was performed in order to identify differentially expressed genes between late vitellogenic, post-vitellogenic and maturing groups using SAM software[28]. Three 2-by-2 statistical analyses were performed in order to compare each group with the two other ones. In addition, a comparison was performed between samples taken prior to meiosis resumption (from late and post-vitellogenic females, N = 7) and during oocyte maturation (N = 6). For each comparison, the lowest false discovery rate (FDR) was used to identify differentially abundant genes. All genes identified in at least one of the above comparisons were kept for clustering analysis in order to characterize the expression profiles of statistically relevant genes. For supervised clustering analysis [29], data was log transformed, median-centered and an average linkage clustering was performed using CLUSTER software [29]. Clusters were visualized using TREEVIEW software [29].

Data mining

Rainbow trout sequences originating from INRA Agenae [24] and USDA [30] EST sequencing programs were used to generate publicly available contigs [31]. The 8th version (Om.8, released January 2006) was used for BlastX [32] comparison against the Swiss-Prot database (January 2006) [33]. The score of each alignment was retrieved after performing a BlastX comparison. In addition, for each EST spotted onto the membrane, the accession number of the corresponding rainbow trout cluster (Unigene Trout, January 2006), if any, was retrieved from the UniGene database [34].

Real-time PCR analysis

Real-time PCR was performed using all RNA (N = 18) samples including those used for microarray analysis. Several over and under expressed clones belonging to three selected remarkable clusters, were selected according to their putative identity and/or function for analysis. Reverse transcription and real time PCR were performed as previously described [19]. Briefly, 3 μg of total RNA were reverse transcribed using 200 units of Moloney murine Leukemia virus (MMLV) reverse transcriptase (Promega, Madison, WI) and 0.5 μg random hexamers (Promega) per μg of total RNA according to manufacturer's instruction. RNA and dNTPs were denatured for 6 min at 70°C, then chilled on ice for 5 min before the reverse transcription master mix was added. Reverse transcription was performed at 37°C for 1 hour and 15 min followed by a 15 min incubation step at 70°C. Control reactions were run without MMLV reverse transcriptase and used as negative controls in the real-time PCR study. Real-time PCR experiments were conducted using an I-Cycler IQ (Biorad, Hercules, CA). Reverse transcription products were diluted to 1/25, and 5 μl were used for each real-time PCR reaction. Triplicates were run for each RT product. Real-time PCR was performed using a real-time PCR kit provided with a SYBR Green fluorophore (Eurogentec, Belgium) according to the manufacturer's instructions and using 600 nM of each primer. After a 2 min incubation step at 50°C and a 10 min incubation step at 95°C, the amplification was performed using the following cycle: 95°C, 20 sec; 60°C, 1 min, 40 times. For all primer pairs, the relative abundance of target cDNA within sample set was calculated from a serially diluted ovarian cDNA pool using the I-Cycler IQ software. This dilution curve was used to ensure that PCR efficiency was within an 80–100% range and that amplification was linear within sample set. After amplification, a fusion curve was obtained using the following protocol: 10 sec holding followed by a 0.5°C increase, repeated 80 times and starting at 55°C. The level of 18S RNA in each sample was measured and used for target genes abundance normalization within sample set. In addition to the genes identified from the transcriptomic analysis, a widely used standard gene, elongation factor 1 alpha (ef1α), was monitored using the same sample set to validate the normalization procedure. GenBank accession number and primer sequences are shown in table 1. Statistical analyses were performed using Statistica 7.0 software (Statsoft, Tulsa, OK). Differences between ovarian developments stages were analyzed using non parametric U tests.

Table 1.

Primer used for the real-time PCR study. For each target gene, full and abbreviated names, GenBank accession number of the corresponding rainbow trout sequence and primer sequences are shown. The clone # is consistent with clone numbering in Figure 1 and Tables 2–4.

Target gene Abbreviated name GenBank # Clone # Forward sequence Reverse sequence
ovarian aromatase cyp19a1 BX083177 196
198
CTCTCCTCTCATACCTCAGGTT AGAGGAACTGCTGAGTATGAAT
vitamin K dependent protein S precursor protein S BX320624 199
200
ACATGTGGGGGATGTTCATT GAGGCCATGTTACGGTTTTG
Cytidine monophosphate-N-acetylneuraminic acid hydroxylase cmah BX878414 212 GGAGGCCTGTTCATCAAAGA CCTGTGTGAAGCTGTCAGGA
coagulation factor V cf5 BX879767 235 AGGGACACACACACACATCC GAGTTACTGCACGCACCTGA
pendrin or solute carrier family 26 slc26 BX873066 236 CATGCATGGATTCATGGAATAA TGGATTGGGTGACATCAACA
vasotocin avt CA375992 238 GAGGCTGGAGGAAGAGTGTG TTCTGTTTGCTGGGTGACTG
angiotensin-converting enzyme 2 ace2 BX867294 245 AACAACAGGAAGCCAGGATG CGTTCCACATGTATGCCTTG
CXC chemokine L14 cxcl14 BX868653 250 CAAAGGGAACGAGTGAGAGAA GCCTGATGGCCAACTTAAAC
A Disintegrin And Metalloproteinases 22 adam22 CA363158 258 CCCGACTAGGAGAGTTGCAG ATCATCACATGACCCCCACT
serine protease 23 sp23 BX087643 296 ACTGCCGAGAAGGATGAAGA CCTCAGCAAGGGAAGTGAAG
aquaporin 4 aqp4 BX885214 305
306
TGTCATTACCAGCCAACTGC TGAGACAGCCCTCCAGAAGT
elongation factor 1 alpha ef1α AF498320 AGCGCAATCAGCCTGAGAGGTA GCTGGACAAGCTGAAGGCTGAG
18S ribosomal RNA 18S AF308535 CGGAGGTTCGAAGACGATCA TCGCTAGTTGGCATCGTTTAT

Results

Statistical analysis and supervised clustering

After signal processing, 8263 clones out of 9152 were kept for further analysis. From the statistical analysis, 310 clones were found to exhibit a differential abundance between at least 2 of the studied ovarian stages (late vitellogenesis, post-vitellogenesis and oocyte maturation). For all SAM analyses performed, the false discovery rate (FDR) was always lower than 0.7%. Among the 310 identified clones, 90 were up-regulated during oocyte maturation while 220 exhibited an opposite pattern. A clustering analysis was performed using only expression data of the 310 identified clones in order to characterize the expression profiles of those genes. The clustering analysis clearly separated the over from the under expressed genes (Figure 1). The number of each clone (1–310) in the clustering analysis (Figure 1) was kept in subsequent tables 1, 2, 3, 4 and in the text. Within down-regulated genes, a cluster of 32 genes (cluster 1, Figure 1) was characterized by high expression levels during late vitellogenesis, low levels during oocyte maturation and intermediate or variable levels during post-vitellogenesis (Figure 1). Within up-regulated clones, a cluster of 44 genes (cluster 2, Figure 1) was characterized by a strong over expression at the time of meiosis resumption while a cluster of 14 genes (cluster 3, Figure 1) exhibited a very low expression during late and post-vitellogenesis and an up-regulation before meiosis resumption (Figure 1).

Figure 1.

Figure 1

Supervised average linkage clustering analysis of 310 genes in the rainbow trout ovary during late vitellogenesis (Late Vit), post vitellogenesis (post-Vit) and oocyte maturation. Each row represents a gene and each column represents an ovarian RNA sample. The dendrogram on the left represents correlation distances between the profiles of studied genes. The 17 samples are supervised according to the natural time-course of oogenesis. For each gene the expression level within sample set is indicated using a color intensity scale. Red and green are used for over and under expression respectively while black is used for median expression.

Table 2.

Differentially regulated clones belonging to cluster 1.

Clone name # GenBank Sigenae contig Swissprot_hit_description Score Unigene
tcac0002.b.13 189 BX081818 tcac0002c.b.13_3.1.s.om.8 YBOX1_RAT (P62961) Nuclease sensitive element binding protein 1 (Y-box binding protein 1) (YB-1) 528 Omy.6894
tcay0023.c.11 190 BX311374 tcav0002c.e.18_3.1.s.om.8 IF2B_HUMAN (P20042) Eukaryotic translation initiation factor 2 subunit 2 (eIF-2-beta) 1096 Omy.8419
tcay0023.a.19 191 BX310198 tcay0023b.a.19_3.1.s.om.8
tcay0002b.h.16_3.1.s.om.8
ST1S3_BRARE (Q7T2V2) Cytosolic sulfotransferase 3 (EC 2.8.2.-) (SULT1 ST3) 1267 Omy.9054
tcba0022.f.09 192 BX868083 tcay0021b.l.08_3.1.s.om.8 NCPR_SALTR (P19618) NADPH – cytochrome P450 reductase (EC 1.6.2.4) (CPR) (P450R) (Fragments) 1536 Omy.22976
tcay0017.l.02 193 BX307506 tcay0017b.l.02_3.1.s.om.8
tcay0017b.l.02_5.1.s.om.8
NIPM_HUMAN (O43920) NADH-ubiquinone oxidoreductase 15 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) 382 Omy.3888
tcac0006.f.17 194 BX085016 tcac0006c.f.17_5.1.s.om.8
tcac0001c.e.23_3.1.s.om.8
CP2J3_RAT (P51590) Cytochrome P450 2J3 (EC 1.14.14.1) (CYPIIJ3) 712 Omy.18165
tcba0023.m.01 195 BX867932 tcay0010b.o.13_3.1.s.om.8 EXOS3_HUMAN (Q9NQT5) Exosome complex exonuclease RRP40 (EC 3.1.13) 668 Omy.7234
tcac0004.f.21 196 BX083177 tcac0004c.f.21_5.1.s.om.8
tcac0004c.f.21_3.1.s.om.8
CP19A_ORYLA (Q92087) Cytochrome P450 19A1 (EC 1.14.14.1) (Aromatase) (CYPXIX) (Estrogen synthetase) (P-450AROM) 879 Omy.241
tcac0002.f.11 197 BX081889 tcac0002c.f.11_3.1.s.om.8 RNPC2_HUMAN (Q14498) RNA-binding region containing protein 2 (Hepatocellular carcinoma protein 1) (Splicing factor HCC1) 1708 Omy.1045
tcbk0013.n.16 198 BX876154 tcac0004c.f.21_3.1.s.om.8 CP19A_ORYLA (Q92087) Cytochrome P450 19A1 (EC 1.14.14.1) (Aromatase) (CYPXIX) (Estrogen synthetase) (P-450AROM) 879 Omy.241
tcbk0006.j.01 199 BX874921 tcav0003c.p.16_5.1.s.om.8 PROS_BOVIN (P07224) Vitamin K-dependent protein S precursor 415 Omy.4204
tcay0036.n.19 200 BX320625 tcav0003c.p.16_3.1.s.om.8
tcav0003c.p.16_5.1.s.om.8
PROS_BOVIN (P07224) Vitamin K-dependent protein S precursor 415 Omy.4204
tcba0006.l.19 201 BX860777 tcay0018b.i.17_3.1.s.om.8 TFR1_CRIGR (Q07891) Transferrin receptor protein 1 (TfR1) (TR) (TfR) (Trfr) 968 Omy.16719
tcag0002.n.03 202 CT962587 tcag0002b.n.03_5.1.s.om.8 CP1A3_ONCMY (Q92109) Cytochrome P450 1A3 (EC 1.14.14.1) (CYP1A3) (CYP1A1) 2563 Omy.11738
tcab0003.h.21 203 BX080053 tcab0003c.h.21_5.1.s.om.8 RT30_MOUSE (Q9D0G0) Mitochondrial 28S ribosomal protein S30 (S30mt) (MRP-S30) 104 Omy.16941
tcak0001.o.11 204 tcaa0001c.e.22_5.1.s.om.8 RL4A_XENLA (P08429) 60S ribosomal protein L4-A (L1A) 1161 Omy.806
tcbk0003.k.18 205 BX874857 tcay0003b.p.21_3.1.s.om.8 RDH3_RAT (P50169) Retinol dehydrogenase 3 (EC 1.1.1.105) (Retinol dehydrogenase type I) (RODH I) 834 Omy.2974
tcay0037.m.03 206 BX319609 tcay0010b.o.11_3.1.s.om.8 GCST_MOUSE (Q8CFA2) Aminomethyltransferase, mitochondrial precursor (EC 2.1.2.10) (Glycine cleavage system T protein) (GCVT) 1289 Omy.6341
1RT64O23_A_H12 207 CA358010 tcac0005c.k.07_3.1.s.om.8 KAD2_BOVIN (P08166) Adenylate kinase isoenzyme 2, mitochondrial (EC 2.7.4.3) (ATP-AMP transphosphorylase) 979 Omy.10546
tcbk0003.b.17 208 BX873257 tcay0016b.b.23_3.1.s.om.8 UNKNOWN Omy.8692
tcay0009.k.05 209 BX302690 tcay0009b.k.05_3.1.s.om.8
tcay0009b.k.05_5.1.s.om.8
HM13_MOUSE (Q9D8V0) Minor histocompatibility antigen H13 (EC 3.4.99.-) (Signal peptide peptidase) (Presenilin-like protein 3) 1015 Omy.24131
1RT36F13_B_C07 210 CA376488 tcay0002b.c.06_3.1.s.om.8 TCPQ_PONPY (Q5RAP1) T-complex protein 1, theta subunit (TCP-1-theta) (CCT-theta) 2366 Omy.9154
tcaa0001.g.20 211 BX073727 tcaa0001c.g.20_3.1.s.om.8
tcaa0001c.g.20_5.1.s.om.8
TPM4_PIG (P67937) Tropomyosin alpha 4 chain (Tropomyosin 4) 744 Omy.20509
tcbk0034.l.08 212 BX878414 tcbk0003c.j.07_5.1.s.om.8 CMAH_BRARE (Q6GML1) Cytidine monophosphate-N-acetylneuraminic acid hydroxylase (EC 1.14.18.2) 2024 Omy.4470
tcay0031.j.13 213 BX316758 tcaa0002c.f.05_3.1.s.om.8 TPM4_PIG (P67937) Tropomyosin alpha 4 chain (Tropomyosin 4) 772 Omy.8952
tcbk0045.m.11 214 BX884217 tcbk0028c.k.18_5.1.s.om.8 GSTP1_CRIMI (P47954) Glutathione S-transferase P (EC 2.5.1.18) (GST class-pi) 636 Omy.20977
tcbk0037.f.02 215 BX889865 tcbi0036c.o.04_5.1.s.om.8 AT11B_HUMAN (Q9Y2G3) Probable phospholipid-transporting ATPase IF (EC 3.6.3.1) 1193 Omy.18989
1RT146H05_B_D03 216 CA350003 tcbk0038c.p.05_5.1.s.om.8 HSP47_CHICK (P13731) 47 kDa heat shock protein precursor 904 Omy.24697
1RT138M15_A_G08 217 CA386530 UNKNOWN
1RT129O11_A_H06 218 CA385378 CA385378.1.s.om.8 JPH2_HUMAN (Q9BR39) Junctophilin-2 (Junctophilin type 2) (JP-2) 554
1RT148P13_B_H07 219 CA368032 CA350754.1.s.om.8 CI010_HUMAN (Q9NZB2) Protein C9orf10 103
tcbk0039.a.06 220 BX886884 tcbk0007c.f.07_5.1.s.om.8 MDP1_PIG (P22412) Microsomal dipeptidase precursor (EC 3.4.13.19) (MDP) (Dehydropeptidase-I) (Renal dipeptidase) (RDP) 1230 Omy.21182

Table 3.

Differentially regulated clones belonging to cluster 2

Clone name # GenBank Sigenae Contig swissprot_hit_description Score Unigene
1RT85J04_D_E02 222 CA345139 CA345139.1.s.om.8 UNKNOWN
1RT62P05_B_H03 223 CA352834 CA352834.1.s.om.8 TIM14_BRARE (Q6PBT7) Mitochondrial import inner membrane translocase subunit TIM14 (DnaJ homolog subfamily C member 19) 525 Omy.10044
1RT124G08_C_D04 224 CA359690 tcay0005b.b.16_3.1.s.om.8 CITE2_HUMAN (Q99967) Cbp/p300-interacting transactivator 2 (MSG-related protein 1) (MRG1 protein) (P35srj) 208 Omy.6626
tcay0013.c.09 225 BX305023 tcay0013b.c.09_3.1.s.om.8 CALD1_HUMAN (Q05682) Caldesmon (CDM) 298 Omy.9824
1RT110O02_C_H01 226 CA366638 CA366638.1.s.om.8 FTHFD_PONPY (Q5RFM9) 10-formyltetrahydrofolate dehydrogenase (EC 1.5.1.6) (10-FTHFDH) (Aldehyde dehydrogenase 1 family member L1) 755
tcad0009.n.15 227 BX081106 tcad0009a.n.15_3.1.s.om.8 GPX4_PIG (P36968) Phospholipid hydroperoxide glutathione peroxidase, mitochondrial precursor (EC 1.11.1.12) (PHGPx) (GPX-4) 633 Omy.18352
tcac0005.m.05 228 BX083339 tcac0005c.m.05_3.1.s.om.8 CP8B1_MOUSE (O88962) Cytochrome P450 8B1 (EC 1.14.-.-) (CYPVIIIB1) 466 Omy.1855
tcay0037.g.24 229 BX320606 tcay0037b.g.24_3.1.s.om.8 NOE2_HUMAN (O95897) Noelin-2 precursor (Olfactomedin-2) 571 Omy.278
1RT148F22_D_C11 230 CA368141 CA368141.1.s.om.8 ETS2_CHICK (P10157) C-ETS-2 protein 654
1RT41I23_A_E12 231 CA376743 CA376743.1.s.om.8 UNKNOWN
tcbk0013.j.22 232 BX872432 tcbk0006c.l.19_5.1.s.om.8 GPC3_HUMAN (P51654) Glypican-3 precursor (GTR2-2) (MXR7) 300 Omy.25417
tcba0030.f.01 233 BX865931 tcay0001b.n.04_3.1.s.om.8 BASI_HUMAN (P35613) Basigin precursor (CD147 antigen) (Leukocyte activation antigen M6) (Collagenase stimulatory factor) 427 Omy.19589
1RT164G02_C_D01 234 CA387850 tcbk0061c.m.06_5.1.s.om.8 SGK2_HUMAN (Q9HBY8) Serine/threonine-protein kinase Sgk2 (EC 2.7.1.37) (Serum/glucocorticoid regulated kinase 2) 1247 Omy.9898
tcbk0057.a.03 235 BX879767 tcba0016c.m.19_5.1.s.om.8 FA5_BOVIN (Q28107) Coagulation factor V precursor (Activated protein C cofactor) 832 Omy.16361
tcbk0013.j.13 236 BX873066 tcbk0013c.j.13_5.1.s.om.8 PEND_HUMAN (O43511) Pendrin (Sodium-independent chloride/iodide transporter) (Solute carrier family 26 member 4) 521
1RT38L12_D_F06 237 CA377239 CA377239.1.s.om.8 DMD_CANFA (O97592) Dystrophin 660
1RT34L03_B_F02 238 CA375992 tcai0003a.h.04_5.1.s.om.8 NEU3_ONCKE (P16041) Vasotocin-neurophysin VT 1 precursor 716 Omy.12737
1RT113L09_B_F05 239 CA365239 tcbk0019c.d.02_5.1.s.om.8 NEU1_ONCKE (Q91166) Isoticin-neurophysin IT 1 875 Omy.13912
tcbk0048.p.10 240 BX884149 tcbk0048c.p.10_5.1.s.om.8 COLL4_MIMIV (Q5UPS7) Collagen-like protein 4 224 Omy.14306
tcbk0046.i.17 241 BX884287 tcbk0046c.i.17_5.1.s.om.8 COPT1_MOUSE (Q8K211) High-affinity copper uptake protein 1 (CTR1) 640
tcbk0004.a.22 242 BX876662 tcbk0004c.a.22_5.1.s.om.8 RGS18_HUMAN (Q9NS28) Regulator of G-protein signaling 18 (RGS18) 467 Omy.15619
tcba0003.a.09 243 BX857105 tcav0003c.k.16_3.1.s.om.8 UNKNOWN Omy.11100
tcba0030.e.12 244 BX866986 tcay0011b.j.07_5.1.s.om.8 RNF24_HUMAN (Q9Y225) RING finger protein 24 286
tcba0024.c.13 245 BX867294 tcav0002c.k.18_3.1.s.om.8 ACE2_HUMAN (Q9BYF1) Angiotensin-converting enzyme 2 precursor (EC 3.4.17.-) 1058 Omy.5193
1RT105A23_A_A12 246 CA363171 tcad0009a.b.12_3.1.s.om.8 GA45B_HUMAN (O75293) Growth arrest and DNA-damage-inducible protein GADD45 563 Omy.24221
tcbk0035.k.02 247 BX885992 tcbk0021c.h.17_5.1.s.om.8 FOXO3_HUMAN (O43524) Forkhead box protein O3A 880 Omy.21283
1RT148E11_A_C06 248 CA367914 tcay0003b.j.08_3.1.s.om.8 FOXO3_HUMAN (O43524) Forkhead box protein O3A 692 Omy.25125
tcbk0048.o.16 249 BX885768 tcbk0048c.o.16_5.1.s.om.8 SMOO_HUMAN (P53814) Smoothelin 717
tcba0028.m.20 250 BX868653 tcav0001c.p.02_3.1.s.om.8 SCYBE_HUMAN (O95715) Small inducible cytokine B14 precursor (CXCL14) 319 Omy.2735
tcbk0053.e.07 251 BX879710 tcbk0053c.e.07_5.1.s.om.8 LFC_TACTR (P28175) Limulus clotting factor C precursor (EC 3.4.21.84) (FC) 183
tcba0018.p.09 252 BX864334 tcba0018c.p.09_5.1.s.om.8 SGK2_HUMAN (Q9HBY8) Serine/threonine-protein kinase Sgk2 (EC 2.7.1.37) 1407 Omy.16859
tcba0013.e.11 253 BX863135 tcba0013c.e.11_5.1.s.om.8 RAMP1_RAT (Q9JJ74) Receptor activity-modifying protein 1 precursor 400
tcba0016.h.07 254 BX863955 tcay0023b.e.18_3.1.s.om.8 ACY3_HUMAN (Q96HD9) Aspartoacylase-2 (EC 3.5.1.15) (Aminoacylase-3) (ACY-3) (Acylase III) (Hepatitis C virus core-binding protein 1) (HCBP1) 695 Omy.12550
tcba0028.o.19 255 BX866157 tcay0013b.p.20_3.1.s.om.8 VISL1_RAT (P62762) Visinin-like protein 1 (VILIP) 967 Omy.19419
1RT106P06_D_H03 256 CA365853 tcba0005c.a.01_5.1.s.om.8 MAFB_RAT (P54842) Transcription factor MafB (MAF1) 210 Omy.24386
1RT98J03_B_E02 257 CA357072 tcay0038b.i.24_5.1.s.om.8 PNPH_BOVIN (P55859) Purine nucleoside phosphorylase (EC 2.4.2.1) 964 Omy.15824
1RT106O19_A_H10 258 CA363158 CA363158.1.s.om.8 ADA22_XENLA (O42596) ADAM 22 precursor (MDC11b) (MDC11.2) 889
1RT62L08_D_F04 259 CA352881 tcac0002c.j.24_3.1.s.om.8 TPP1_CANFA (Q9XSB8) Tripeptidyl-peptidase I precursor (EC 3.4.14.9) 599 Omy.8262
1RT44O11_A_H06 260 CA379089 tcay0014b.n.20_3.1.s.om.8 PSD2_HUMAN (Q13200) 26S proteasome non-ATPase regulatory subunit 2 (Tumor necrosis factor type 1 receptor associated protein 2) (55.11 protein) 1152 Omy.15261
1RT30D15_B_B08 261 CA372310 CA372310.1.s.om.8 KPCD_CANFA (Q5PU49) Protein kinase C, delta type (EC 2.7.1.-) (nPKC-delta) 932
tcbk0050.j.02 262 BX890245 tcbk0050c.j.02_5.1.s.om.8 DMD_HUMAN (P11532) Dystrophin 1196
1RT31H12_D_D06 263 CA375388 tcay0024b.g.05_3.1.s.om.8 UNKNOWN Omy.4071
tcba0014.c.14 264 BX863437 tcav0005c.h.17_3.1.s.om.8 ELOV1_MOUSE (Q9JLJ5) Elongation of very long chain fatty acids protein 1 187 Omy.22915
tcad0006.j.09 265 BX077787 tcad0006a.j.09_5.1.s.om.8
tcad0006a.j.09_3.1.s.om.8
UNKNOWN Omy.10230

Table 4.

Differentially regulated clones belonging to cluster 3.

Clone name # GenBank Sigenae contig swissprot_hit_description Score Unigene
tcav0003.l.01 296 BX087643 tcav0003c.l.01_3.1.s.om.8
tcav0003c.l.01_5.1.s.om.8
PRS23_MOUSE (Q9D6X6) Serine protease 23 precursor (EC 3.4.21.-) 265 Omy.8589
tcbk0008.n.08 297 BX871436 tcac0002c.a.01_3.1.s.om.8 UNKNOWN Omy.10950
tcad0003.m.13 298 BX075335 tcad0003a.m.13_5.1.s.om.8
tcad0003a.m.13_3.1.s.om.8
PPT1_MACFA (Q8HXW6) Palmitoyl-protein thioesterase 1 precursor (EC 3.1.2.22) 1110 Omy.3717
1RT65F10_D_C05 299 CA353171 tcab0001c.m.15_5.1.s.om.8 APOC1_MOUSE (P34928) Apolipoprotein C-I precursor (Apo-CI) (ApoC-I) 123 Omy.20585
tcay0008.f.19 300 BX301535 tcay0008b.f.19_3.1.s.om.8
tcay0008b.f.19_5.1.s.om.8
CLD11_MOUSE (Q60771) Claudin-11 (Oligodendrocyte transmembrane protein) 331 Omy.5138
1RT63M21_A_G11 301 CA357931 tcaa0002c.j.15_3.1.s.om.8 ION3_CARAU (P18520) Intermediate filament protein ON3 1331 Omy.40
1RT67D22_D_B11 302 CA360891 CA360891.1.s.om.8 PTPRF_HUMAN (P10586) Receptor-type tyrosine-protein phosphatase F precursor (EC 3.1.3.48) (LAR protein) (Leukocyte antigen related) 1466 Omy.24653
1RT63G21_A_D11 303 CA357905 tcad0003a.m.13_3.1.s.om.8 PPT1_MACFA (Q8HXW6) Palmitoyl-protein thioesterase 1 precursor (EC 3.1.2.22) 1110 Omy.5643
1RT35E10_C_C05 304 CA376275 CA376275.1.s.om.8 UNKNOWN
tcbk0056.f.03 305 BX880542 tcbk0056c.f.03_5.1.s.om.8 AQP4_RAT (P47863) Aquaporin-4 (AQP-4) (WCH4) (Mercurial-insensitive water channel) 442 Omy.23866
tcbk0036.e.03 306 BX885214 tcbk0036c.e.03_5.1.s.om.8 AQP4_HUMAN (P55087) Aquaporin-4 (AQP-4) (WCH4) (Mercurial-insensitive water channel) 1071 Omy.23866
tcay0007.b.05 307 BX300900 tcay0007b.b.05_3.1.s.om.8 HEPH_RAT (Q920H8) Hephaestin precursor 1085 Omy.25044
tcac0006.o.01 308 BX085175 tcac0006c.o.01_3.1.s.om.8
tcac0006c.o.01_5.1.s.om.8
LTBP2_MOUSE (O08999) Latent transforming growth factor-beta-binding protein 2 precursor 328
tcbk0044.e.02 309 BX889077 tcay0040b.e.18_5.1.s.om.8 UNKNOWN Omy.23994

Identity of differentially expressed cDNAs

The rainbow trout (Oncorhynchus mykiss) genome has not been sequenced and the number of characterized rainbow trout proteins and mRNAs is limited. The identity of studied transcripts was therefore based on the most significant hit obtained after performing a BlastX search against the SwissProt database. For the clones belonging to cluster 1–3, the results of this blast search is presented in tables 2, 3, 4. For each clone, the identity of the best hit in SwissProt and the score value of the BlastX comparison are given. However, this similarity search was performed using all EST sequences available in public databases and not using fully characterized cDNAs displaying the full coding sequence of the transcript. For some of the clones spotted on the trout array, the corresponding mRNA was previously characterized and made available in public databases. The identity of those clones is therefore unambiguous. In contrast, for some other clones, the best hit in SwissProt only gives significant, but incomplete, information. This is especially true for protein family members for which only a phylogenetic analysis will allow a more relevant identification of the gene. However, the name of the best hit was used in the text for clarity reasons.

Cluster 1

This large cluster of 32 clones (# 189–220) was characterized by a clear under expression at the time of oocyte maturation. Among those 32 clones, 29 belonged to a UniGene cluster and 30 had a significant hit in Swiss-Prot (Table 2). Two clones (# 196 and 198) corresponded to rainbow trout ovarian P450 aromatase (cyp19a1) and therefore belonged to the same UniGene cluster (Omy. 241). Similarly, clones # 199 and 200 belonged to UniGene cluster Omy.4204 and exhibited sequence similarity with bovine vitamin K-dependent protein S precursor. In addition, one clone (# 202) corresponding to rainbow trout cyp1a3 (EC 1.14.14.1), was identified while another clone (# 194) was most similar to rat CYP2J3. Finally, this cluster also included clones exhibiting sequence similarity with zebrafish cytidine monophosphate-N-acetylneuraminic acid hydroxylase (cmah) (# 212), salmon NADPH – cytochrome P450 reductase (# 192) and Glutathione S-transferase (# 214). Within cluster 1, cyp19a1 (clones # 196 and 198), vitamin K-dependent protein S precursor (clones # 199 and 200) and cmah (clone # 212) genes were kept for real-time PCR analysis.

Cluster 2

This very large cluster of 44 clones (# 222–265) was characterized by a sharp over expression at the time of meiosis resumption. Among the 44 clones present in this cluster, 30 belonged to a UniGene cluster (Table 3). In addition, 39 clones exhibited a significant hit in SwissProt while 5 clones had no significant sequence similarities with known genes (Table 3). Within this cluster, several genes exhibited inflammation or ovulation-related functions. Thus some of the clones exhibited sequence similarities with human chemokine cxcl14 (clone # 250), clawed frog adam22 (clone # 258) and coagulation factor V (cf5) (clone # 235). In addition, one clone (# 245) exhibited strong sequence similarity with human angiotensin-converting enzyme 2 precursor (ace2). Two clones (# 238 and 239) exhibited strong sequence similarity with salmon (Oncorhynchus keta) vasotocin-neurophysin (avt) and isotocin-neurophysin respectively. Finally, cluster 3 also contained clones exhibiting sequence similarity with, human Forkhead box protein O3A and human pendrin, also know as solute carrier family 26 member 4 (slc26) (clone # 236). Within cluster 2, cxcl14, adam22, slc26, avt, ace2 and cf5 genes were kept for real-time PCR analysis.

Cluster 3

This small cluster of 14 clones (# 296–309) was characterized by an over expression occurring earlier than for the genes belonging to cluster 3. Among those 14 clones, 12 belonged to a UniGene cluster and 11 had a significant hit in SwissProt (Table 4). Two clones (# 305 and 306) were most similar to rat and human aquaporin 4 (aqp4) respectively. These 2 clones belonged to the same UniGene cluster (Omy.23866). In addition, one clone (# 296) was most similar to mouse serine protease 23 (sp23). Within cluster 3, aqp4 and sp23 genes were kept for real-time PCR analysis.

Real-time PCR analysis

For all the genes selected for the real-time PCR analysis, a similar up or down regulation was observed between microarray and real-time PCR experiments.

Under expressed genes during oocyte maturation

We observed a dramatic under expression of aromatase (cyp19a1, clones # 196 and 198) in the ovary during the preovulatory period (Figure 2). The mRNA abundance of cyp19a gene during oocyte maturation was more than 200 times lower than during late vitellogenesis. In addition, successive decreases of cyp19a gene expression levels were observed during post-vitellogenesis and during oocyte maturation (Figure 2). The mRNA abundance of vitamin K-dependent protein S precursor gene (clones # 199 and 200) was lower during oocyte maturation than during late or post-vitellogenesis. In contrast, no significant differences were observed between late and post-vitellogenesis (Figure 2). A similar expression profile was observed for Cytidine monophosphate-N-acetylneuraminic acid hydroxylase (cmah) gene (Figure 2).

Figure 2.

Figure 2

Ovarian expression profiles of aromatase (cyp19a1), vitamin K dependent protein S (proteinS) and cytidine monophosphate-N-acetylneuraminic acid hydroxylase (cmah) genes during rainbow trout late oogenesis (mean ± SEM). Ovaries were sampled from separate females during late vitellogenesis (LV, N = 6), post-vitellogenesis (PV, N = 6) and oocyte maturation (MAT, N = 6). The mRNA abundance of each gene was determined by real-time PCR and normalized to the abundance of 18S. Abundance was arbitrarily set to 1 for LV stage and data are expressed as a percentage of the transcript abundance at this stage. Bars sharing the same letter(s) are not significantly different (p < 0.05).

Over expressed genes during oocyte maturation

We observed a strong over expression of aquaporin 4 (aqp4) gene during post-vitellogenesis and at the time of oocyte maturation (Figure 3). The mRNA abundance of aqp4 gene exhibited a 6-fold increase during post-vitellogenesis and a further 12-fold increase during oocyte maturation. In addition, the mRNA abundance of pendrin (slc26) gene exhibited a 1500-fold increase during oocyte maturation while no significant differences were observed between late and post-vitellogenesis. Similarly, vasotocin (avt) mRNA abundance exhibited a 500-fold increase at the time of oocyte maturation (Figure 3). Angiotensin-converting enzyme 2 (ace2) gene expression levels exhibited a 215-fold increase between late vitellogenesis and oocyte maturation (Figure 3). A similar profile was observed for the chemokine cxcl14 gene. The mRNA abundance of this gene exhibited a 35-fold increase between late vitellogenesis and oocyte maturation (Figure 3). The mRNA abundance of coagulation factor V (cf5) gene exhibited a 177-fold increase between late or post-vitellogenesis and oocyte maturation while adam22 mRNA abundance exhibited a 6-fold increase between late or post-vitellogenesis and oocyte maturation (Figure 3). Finally, the mRNA abundance serine protease 23 (sp23) gene monitored during oocyte maturation was higher than in the late vitellogenic ovary. However, this difference was not significantly different (p = 0.078).

Figure 3.

Figure 3

Ovarian expression profiles of angiotensin-converting enzyme 2 (ace2), coagulation factor V (cf5), CXC chemokine L14 (cxcl14), aquaporin 4 (aqp4), pendrin (slc26), vasotocin (avt), serine protease 23 (sp23), ADAM22 (adam22), and elongation factor 1 alpha (ef1α) genes during rainbow trout late oogenesis (mean ± SEM). Ovaries were sampled from separate females during late vitellogenesis (LV, N = 6), post-vitellogenesis (PV, N = 6) and oocyte maturation (MAT, N = 6). The mRNA abundance of each gene was determined by real-time PCR and normalized to the abundance of 18S. Abundance was arbitrarily set to 1 for LV stage and data are expressed as a percentage of the transcript abundance at this stage. Bars sharing the same letter(s) are not significantly different (p < 0.05).

Control gene

The mRNA abundance of elongation factor 1 alpha (ef1α), a translation regulatory protein commonly used as a stable reference, did not exhibit any significant difference over the preovulatory period (Figure 3).

Discussion

Microarray analysis efficiency and reliability

The hybridization of radiolabeled cDNAs with cDNAs deposited on nylon membranes has been used for several decades. However, the use of nylon cDNA microarrays is not very common in comparison to glass slide microarray technology. Nevertheless, this technology has successfully been used for several years [27,35]. In the present study we used similar cDNA manufacturing and hybridization protocols. While most of the 9152 clones used to generate the microarray putatively correspond to distinct genes, a small proportion of genes are represented by 2 distinct clones (e.g clones belonging to the same UniGene cluster). In our data, it is noteworthy that those clones are usually found in the same gene clusters (e.g clones #196 and 198, #199 and 200, #305 and 306). Since the position of clones in the clustering analysis is based on the correlation between their profiles, this indicates that they display very similar expression profiles. In addition, for all genes selected for real-time PCR analysis, the over or under expression observed was always consistent with microarray data. Furthermore, the expression of ef1α, a widely used reference gene, was stable over the preovulatory period. Together, these observations suggest that our overall microarray analysis is extremely robust and reliable.

Identities of identified genes and putative involvement in preovulatory ovarian functions

In the present study, we identified 310 genes exhibiting a differential expression during the preovulatory period. Among them, 220 were down-regulated during oocyte maturation while 90 exhibited an opposite pattern. However, because we decided, as a first step, to focus our analysis on the genes exhibiting the most differential regulation in the periovulatory period, we only present the identity of the 90 genes belonging to 3 specific clusters exhibiting the most remarkable patterns. Among those 90 transcripts we have chosen to discuss the most informative or novel genes based on their identities and/or putative involvement in the rainbow trout preovulatory ovarian functions.

Estrogen synthesis

Among the 32 clones belonging to cluster 1, two clones correspond to rainbow trout ovarian aromatase (cyp19a1). The real-time PCR study confirmed that cyp19a1 was dramatically under expressed during the preovulatory period. This observation is in total agreement with existing data on aromatase expression during this period [19,36]. In addition, a clone putatively encoding for a NADPH-cytochrome P450 reductase (EC 1.6.2.4) was also located in cluster 1. The aromatase enzyme complex is formed from 2 principal protein components. CYP19a1 contains the catalytic domain that binds C19 steroid substrates in the proximity of the heme prosthetic group critical in the activation of molecular oxygen and subsequent substrate hydroxylation. The other essential component is the redox partner flavoprotein, NADPH cytochrome P450 reductase. Interestingly, present data show that both transcripts exhibited an under expression during the rainbow trout preovulatory period, although it should be confirmed that the identified clone is coding for the oxydoreductase protein involved in the aromatase complex.

Other cytochrome P450 genes

Two other cytochrome P450 genes, exhibiting similar expression profiles were found in the same cluster. One clone (# 194) was most similar to rat cytochrome P450 2J3 while the other one (# 202) putatively corresponded to rainbow trout cytochrome P450 1A3 (cyp1a3). Cytochrome P450 1A proteins are ubiquitous proteins that have been associated with the detoxification of several organic compounds such as PCB (polychlorinated biphenyl), PAH (polyaromatic hydrocarbons), and dioxin [37]. In fish, these compounds are able to induce cyp1a gene expression in a variety of tissues. In the rainbow trout immature ovary, a constitutive expression of CYP1A protein was previously reported [38]. Together, previous and present observations suggest that a CYP1A-related detoxification activity in the rainbow trout ovary. From the under expression of cyp1a3 gene observed in the ovary immediately prior to ovulation we could speculate that a decrease of the detoxification activity of the ovary is required before the beginning of the ovulation process. In addition, it was previously shown in rat C6 glioma cells that epoxygenases could inhibit prostaglandin E2 production [39]. Interestingly, C6 cells express epoxygenase mRNAs, CYP1A1, CYP2B1 and CYP2J3, which convert arachidonic acid to epoxyeicosatrienoic acids; those epoxyeicosatrienoic acid being able to inhibit the activity of cyclooxygenase [39]. The role of prostaglandins in the ovulatory process has been thoroughly studied (see [40] for review). Thus, in rainbow trout, prostaglandin F2α was able to induce in vitro ovulation [21,41]. Therefore, the observed down-regulation of cyp1a1 and cyp2j3 genes in the ovary prior to ovulation is therefore totally consistent with available data on the participation of prostaglandins in the ovulatory process.

Ion/water transport genes

In the present transcriptomic analysis, two aquaporin 4 (aqp4) clones were found in cluster 3. Real-time PCR data confirmed that rainbow trout aqp4 gene exhibited a strong over expression in the preovulatory ovary. In mammals, AQP4 is also known as mercurial insensitive water channel (MIWC). It was previously shown that water permeability was strongly increased in African clawed frog oocytes expressing MIWC [42]. In marine fish, a strong oocyte hydration occurs during oocyte maturation [43,44]. In addition, it was recently shown that this oocyte hydration involves an aquaporin1-like protein in seabream [45]. In freshwater species, data on oocyte hydration is more controversial. However, a limited but significant hydration was also observed in several freshwater species including rainbow trout [46]. Our data suggest that, similarly to marine species, the oocyte hydration occurring during oocyte maturation could also be aquaporin-mediated in freshwater species such as rainbow trout. In addition to aqp4 gene, we also observed a dramatic over expression of slc26 gene at the time of meiosis resumption. Solute carrier family 26 member 4 (slc26) is also known as sodium-independent chloride/iodide transporters or pendrin. The over expression of slc26 gene at the time of oocyte maturation is dramatic, as demonstrated by real-time PCR. Together, the strong up-regulation of aqp4 and slc26 genes at the time of meiosis resumption stresses the importance of water and ion transports in the rainbow trout preovulatory ovarian functions. In marine species, the major oocyte hydration occurring before ovulation is probably important for adjusting egg buoyancy. In contrast, in freshwater species laying demersal eggs such as rainbow trout, it has been hypothesized that the limited (25%) oocyte hydration occuring before ovulation could be necessary for the completion of the ovulation process [46]. Thus, the increase of oocyte volume could facilitate the rupture of the follicular walls and subsequently, the release of the oocyte from its follicular layers.

The neurophysial hormones arginine vasotocin (AVT) and isotocin (IT) are the fish counterparts of arginine-vasopressin and oxytocin respectively. Vasotocin precursor and isotocin precursor cDNAs were previously cloned in several fish species including chum salmon [47,48]. In fish, AVT is involved in several physiological processes including water conservation and excretion of electrolytes [49]. However, existing data in fish correspond to the local effect, in various tissues, of circulating AVT [49]. Surprisingly, we observed that AVT precursor (avt) mRNA is expressed in the rainbow trout preovulatory ovary. To the best of our knowledge, there is no evidence of non-neural expression of avt mRNA in fish. In addition, it is noteworthy that we also observed a similar over expression of isotocin mRNA precursor in the ovary at the time of oocyte maturation. Further investigations are needed to elucidate the role of AVT and IT in the trout preovulatory ovarian functions.

Inflammation- or ovulation-related genes

Ovulation is a complex process resulting in the release of the oocyte from surrounding follicular layers. Since the early eighties, the similarities between ovulatory and inflammatory processes have been thoroughly discussed [50-52] and it is now well accepted that mammalian ovulation is an inflammatory-like reaction. In fish, despite numerous studies on the hormonal control of spawning, the ovulatory process has been far less documented.

In mammals, ovulation is accompanied by broad-spectrum proteolysis and the implication of several classes of proteases is well documented (see [53] for review). In salmonid fish, several proteases have been identified in the periovulatory ovary [54]. In mammals, there is evidence that mature ovarian follicles contain proteolytic enzymes, including serine proteases. Indeed, serine proteases have been implicated in both ovulatory and inflammatory reactions (see [50] for review). In the present study, serine protease 23 (sp23) gene appears progressively up-regulated during the preovulatory period. To our knowledge, sp23 gene expression was never reported in the periovulatory ovary of any vertebrate species. However, we could speculate that this protease participates in the rainbow trout ovulatory process. Interestingly, our data showed that adam22 metalloprotease-disintegrin gene was sharply up-regulated at the time of oocyte maturation. The metalloprotease-disintegrin protein family (also known as ADAMs: A Disintegrin And Metalloproteinases) is thought to function in cell-cell interactions and in the proteolysis of luminal or extracellular protein domains. In mammals, several ADAMs family members are involved in the ovulatory process. In brook trout (Salvelinus fontinalis), metalloprotease activity increases in the ovary prior to ovulation [8,9]. Together, these observations also suggest that adam22 also participates in the rainbow trout ovulatory process.

Mammalian CXC chemokines, named after a conserved pattern of conserved cysteine residues, have been initially identified as potent mediators of neutrophil chemotaxis [55,56] and are also involved in chemotaxis of monocytes and lymphocytes. They have also been implicated in angiogenesis and, later, in a large variety of functions[57,58]. In mammals, 16 CXC have been described. In Fish, however, several CXC have been identified but only CXCL12 and CXCL14 exhibit unambiguous orthologues [59]. In the present study, we showed that cxcl14 gene expression strongly increases during the preovulatory period. In catfish, RT-PCR data showed that cxcl14 gene was expressed in a wide variety of tissues, including the ovary [60]. In carp, quantitative PCR data showed that cxcl14 was predominantly expressed in the brain [61]. Despite its good conservation throughout vertebrate evolution [59], the number of studies addressing the in vivo role(s) of CXCL14 is limited. As a consequence, a lot of information is still unavailable in fish. In a murine model used to study Crohn's disease, cxcl14 expression is induced during inflammation [62]. Together, these observations suggest that cxcl14 gene expression induction contributes to the inflammatory-like events occurring in the rainbow trout at the time of ovulation. To date the participation of this gene in preovulatory ovarian functions was unsuspected.

In mammals, coagulation factor V participates in the coagulation process. In zebrafish, a coagulation factor V (cf5) cDNA was previously characterized [63]. According to these authors, several lines of evidences including biochemical and phylogenetic analyses suggest that the modern coagulation pathways found in mammals could also be functional in fish. Furthermore, it was previously shown that cultured rabbit macrophages were able to generate factor V procoagulant activity [64]. In the present study, we observed a dramatic increase of cf5 gene expression in the ovary during oocyte maturation. However, no significant difference was observed between late and post-vitellogenesis. From these observations we could speculate that, immediately prior to ovulation, the trout ovary secretes coagulation factors in order to prevent bleeding from ruptured ovarian follicles at the time of ovulation. Interestingly, the transcriptomic analysis showed that a transcript exhibiting sequence similarity with clotting factor C (Clone # 251, Table 3) was also over expressed immediately prior to ovulation.

Angiotensin-converting enzyme (ACE) cleaves Angiotensin I (Ang I) to form Angiotensin II (Ang II). Angiotensin-converting enzyme 2 (ACE2) is a recently described ACE homolog [65]. Both ACE and ACE2 are zinc-dependent peptidases of the M2-metalloprotease family. Within the renin-angiotensin system (RAS), ACE2 competes with ACE because it is capable of hydrolyzing Ang I into the nonapeptide Ang(1–9) [65]. In humans, ace2 gene expression was predominantly detected by Northern blot analysis in kidney, heart and testis [65,66]. In addition, a moderate expression was also observed in several other tissues including the ovary [66]. Using semi-quantitative RT PCR, a wide distribution was observed in rat tissues [67]. In mammals, previous observations suggested that the renin-angiotensin system was functional in the ovary. In cattle, a greater expression of Ang II was observed in large follicles. In addition, several lines of evidence supported the idea of Ang II in blocking the inhibitory effect of theca cells on meiosis resumption of bovine oocytes [68]. In brook trout (Salvelinus fontinalis) salmon Ang I and human Ang II were both able to increase the level of in vitro spontaneous ovulation [69]. In the present transcriptomic study, we observed a dramatic increase of ace2 gene expression during the preovulatory period. This observation was confirmed by real-time PCR data. Together, these observations suggest that the dramatic up-regulation of ace2 gene immediately prior to ovulation is important for the ovulatory process. In mammals, little is know about the role of ACE2 in the ovary. However, it is known in mammals that ACE2 can function as an Ang II degrading enzyme, forming the vasodilatator peptide Ang(1–7) [70,71]. Interestingly, a local vasodilatation is a key characteristics of the inflammatory response that is also observed during the mammalian ovulatory process (see [50] for review). Therefore, it can be hypothesized that the observed increase of ace2 gene expression in the trout preovulatory participates in the vascular dynamics changes that are putatively occurring during the ovulatory process.

Genes involved in the synthesis of egg components

Cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH) is the key enzyme for the synthesis of N-glycolylneuraminic acid. In salmonid eggs, cortical alveoli contain polysialoglycoproteins (PSGP). In rainbow trout, it was previously shown that those PSGP contain N-glycolylneuraminic acid residues [72]. In the present study we observed a significant decrease of cmah gene expression at the time of oocyte maturation. While the presence of cmah gene expression in the ovary is totally consistent with the presence of N-glycolylneuraminic acid in rainbow trout cortical alveoli content, it seems however difficult to speculate on the dynamics of PSGP accumulation in the oocytes.

Conclusion

Our observations further confirmed that a progressive shut down of estrogen synthesis genes expression occurs in the ovary prior to meiosis resumption. In addition to already well studied genes such as aromatase, the present work shows that other genes exhibit a similar down-regulation, thus suggesting their participation in the preovulatory decrease of circulating estrogen levels.

In addition, we observed a strong up-regulation of ion/water transport genes in the preovulatory ovary. The identity of those genes is consistent with the recent identification of aquaporin mediated mechanisms in the fish oocyte hydration process and further supports the recent description of a limited but significant oocyte hydration occurring in the rainbow trout preovulatory ovary.

Finally, in addition to oocyte hydration-related genes, we also observed a strong over expression of several genes such proinflammatory factors, coagulation/clotting factors, vasodilatation factors and proteases in the ovary immediately prior to ovulation. Together, these observations suggest that, similarly to the theory developed in mammals, fish ovulation could also be compared ton an inflammatory-like reaction. In addition, the identification of those genes will allow specific studies leading to a better understanding of the ovulatory process in fish.

In the future, a global analysis of differentially regulated genes, based on their ontologies, is needed to satisfyingly describe preovulatory ovarian mechanisms. In addition, a cellular localization of gene expression will contribute in the understanding of their respective roles in the preovulaory ovarian physiology. Nevertheless, the present study clearly demonstrates that distinct (i.e. steroidogenic, proteolytic, proinflammatory) but concomitant events occur in the preovulatory ovary. Together, all those events concur to achieve the same goal which is the release, at the time of ovulation, of a fully competent oocyte, ready to be fertilized.

Authors' contributions

JM performed the microarray analysis. TN performed the real-time PCR analysis. AF participated in the writing of the manuscript and in the design and coordination of the study. JB supervised the study, participated in the microarray and real-time PCR analyses, performed data mining analysis and drafted the manuscript. All authors read and approved the final manuscript.

Acknowledgments

Acknowledgements

This work was funded by an INRA-AGENAE-IFOP grant to JB. The authors thank INRA-GADIE (Jouy en Josas, France) resource center for manufacturing and providing micro-arrays and the INRA-SIGENAE group (Toulouse, France) for bioinformatic support. The authors also thank all INRA experimental facility personnel (Sizun and Rennes) for animal care.

Contributor Information

Julien Bobe, Email: Julien.Bobe@rennes.inra.fr.

Jerôme Montfort, Email: Jerome.Montfort@rennes.inra.fr.

Thaovi Nguyen, Email: Thao-Vi.Nguyen@rennes.inra.fr.

Alexis Fostier, Email: Alexis.Fostier@rennes.inra.fr.

References

  1. Goetz FW. Hormonal control of oocyte final maturation and ovulation in fishes. In: Hoar WS, Randall DJ, Donaldson EM, editor. Fish Physiology. New York: Academic Press; 1983. pp. 117–170. [Google Scholar]
  2. Goetz FW, Garczynski M. The ovarian regulation of ovulation in teleost fish. Fish Physiology and Biochemistry. 1997;17:33–38. doi: 10.1023/A:1007765902327. [DOI] [Google Scholar]
  3. Jalabert B, Fostier A, Breton B, Weil C. Oocyte Maturation in Vertebrates. In: Pang P, Schreibman M, editor. Vertebrate Endocrinology, Fundamentals and Biomedical Implications. New York: Academic Press; 1991. pp. 23–90. [Google Scholar]
  4. Patino R, Sullivan CV. Ovarian follicle growth, maturation, and ovulation in teleost fish. Fish Physiology and Biochemistry. 2002;26:57–70. doi: 10.1023/A:1023311613987. [DOI] [Google Scholar]
  5. Yamashita M, Mita K, Yoshida N, Kondo T. Molecular mechanisms of the initiation of oocyte maturation: general and species-specific aspects. Prog Cell Cycle Res. 2000;4:115–129. doi: 10.1007/978-1-4615-4253-7_11. [DOI] [PubMed] [Google Scholar]
  6. Patino R, Thomas P, Yoshizaki G. Ovarian follicle maturation and ovulation: an integrated perspective. Fish Physiology and Biochemistry. 2003;28:305–308. doi: 10.1023/B:FISH.0000030565.74702.0a. [DOI] [Google Scholar]
  7. Berndtson AK, Goetz FW, Duman P. In vitro ovulation, prostaglandin synthesis, and proteolysis in isolated ovarian components of yellow perch (Perca flavescens): effects of 17 α, 20 β-dihydroxy-4-pregnen-3-one and phorbol ester. Gen Comp Endocrinol. 1989;75:454–465. doi: 10.1016/0016-6480(89)90181-0. [DOI] [PubMed] [Google Scholar]
  8. Berndtson AK, Goetz FW. Metallo-protease activity increases prior to ovulation in brook trout (Salvelinus fontinalis) and yellow perch (Perca flavescens) follicle walls. Biol Reprod. 1990;42:391–398. doi: 10.1095/biolreprod42.2.391. [DOI] [PubMed] [Google Scholar]
  9. Berndtson AK, Goetz FW. Protease activity in brook trout (Salvelinus fontinalis) follicle walls demonstrated by substrate-polyacrylamide gel electrophoresis. Biol Reprod. 1988;38:511–516. doi: 10.1095/biolreprod38.2.511. [DOI] [PubMed] [Google Scholar]
  10. Bobe J, Goetz FW. A novel osteopontin-like protein is expressed in the trout ovary during ovulation. FEBS Lett. 2001;489:119–124. doi: 10.1016/S0014-5793(01)02090-7. [DOI] [PubMed] [Google Scholar]
  11. Bobe J, Goetz FW. A S100 homologue mRNA isolated by differential display PCR is down-regulated in the brook trout (Salvelinus fontinalis) post-ovulatory ovary. Gene. 2000;257:187–194. doi: 10.1016/S0378-1119(00)00406-6. [DOI] [PubMed] [Google Scholar]
  12. Bobe J, Goetz FW. A tumor necrosis factor decoy receptor homologue is Up-regulated in the brook trout (Salvelinus fontinalis) ovary at the completion of ovulation. Biol Reprod. 2000;62:420–426. doi: 10.1095/biolreprod62.2.420. [DOI] [PubMed] [Google Scholar]
  13. Garczynski MA, Goetz FW. Molecular characterization of a ribonucleic acid transcript that is highly up-regulated at the time of ovulation in the brook trout (Salvelinus fontinalis) ovary. Biol Reprod. 1997;57:856–864. doi: 10.1095/biolreprod57.4.856. [DOI] [PubMed] [Google Scholar]
  14. Tada T, Endo M, Hirono I, Takashima F, Aoki T. Differential expression and cellular localization of activin and inhibin mRNA in the rainbow trout ovary and testis. Gen Comp Endocrinol. 2002;125:142–149. doi: 10.1006/gcen.2001.7717. [DOI] [PubMed] [Google Scholar]
  15. Wang Y, Ge W. Spatial expression patterns of activin and its signaling system in the zebrafish ovarian follicle: evidence for paracrine action of activin on the oocytes. Biol Reprod. 2003;69:1998–2006. doi: 10.1095/biolreprod.103.020826. [DOI] [PubMed] [Google Scholar]
  16. Choi CY, Takashima F. Molecular cloning and hormonal control in the ovary of connexin 31.5 mRNA and correlation with the appearance of oocyte maturational competence in red seabream. J Exp Biol. 2000;203:3299–3306. doi: 10.1242/jeb.203.21.3299. [DOI] [PubMed] [Google Scholar]
  17. Yoshizaki G, Patino R, Thomas P. Connexin messenger ribonucleic acids in the ovary of Atlantic croaker: molecular cloning and characterization, hormonal control, and correlation with appearance of oocyte maturational competence. Biol Reprod. 1994;51:493–503. doi: 10.1095/biolreprod51.3.493. [DOI] [PubMed] [Google Scholar]
  18. Bobe J, Maugars G, Nguyen T, Rime H, Jalabert B. Rainbow trout follicular maturational competence acquisition is associated with an increased expression of follicle stimulating hormone receptor and insulin-like growth factor 2 messenger RNAs. Mol Reprod Dev. 2003;66:46–53. doi: 10.1002/mrd.10334. [DOI] [PubMed] [Google Scholar]
  19. Bobe J, Nguyen T, Jalabert B. Targeted Gene Expression Profiling in the Rainbow Trout (Oncorhynchus mykiss) Ovary During Maturational Competence Acquisition and Oocyte Maturation. Biol Reprod. 2004;71:73–82. doi: 10.1095/biolreprod.103.025205. [DOI] [PubMed] [Google Scholar]
  20. MacKenzie S, Iliev D, Liarte C, Koskinen H, Planas JV, Goetz FW, Molsa H, Krasnov A, Tort L. Transcriptional analysis of LPS-stimulated activation of trout (Oncorhynchus mykiss) monocyte/macrophage cells in primary culture treated with cortisol. Mol Immunol. 2006;43:1340–1348. doi: 10.1016/j.molimm.2005.09.005. [DOI] [PubMed] [Google Scholar]
  21. Jalabert B. Production of fertilizable oocytes from follicles of rainbow trout (Salmo gairdneri) following in vitro maturation and ovulation. Ann Biol Anim Biochim Biophys. 1978;18:461–470. [Google Scholar]
  22. Jalabert B, Fostier A. The follicular sensitivity in vitro to maturation-inducing hormones in rainbow trout, Salmo gairdneri: role of oestradiol-17β. Aquaculture. 1984;43:1–11. doi: 10.1016/0044-8486(84)90004-8. [DOI] [Google Scholar]
  23. INRA-GADIE http://www-crb.jouy.inra.fr/
  24. Aegerter S, Baron D, Carpentier C, Chauvigne F, Dantec C, Estampes A, Goupil A-S, Jumel A, Jutel I, Mazurais D, Melaine N, Montfort J, Bobe J, Chardon P, Chevalet C, Fauconneau B, Fostier A, Govoroun M, Le Cam A, Le Gac F, Klopp C, Panserat S, Piumi F, Rallière C, Rescan P-Y, Guiguen Y. The INRA AGENAE program and the Agenae trout EST collections: first results applied to fish physiology research. Comp Biochem Physiol A. 2004;137:135–141. [Google Scholar]
  25. Nguyen C, Rocha D, Granjeaud S, Baldit M, Bernard K, Naquet P, Jordan BR. Differential gene expression in the murine thymus assayed by quantitative hybridization of arrayed cDNA clones. Genomics. 1995;29:207–216. doi: 10.1006/geno.1995.1233. [DOI] [PubMed] [Google Scholar]
  26. GEO http://www.ncbi.nlm.nih.gov/projects/geo/
  27. Bertucci F, Bernard K, Loriod B, Chang YC, Granjeaud S, Birnbaum D, Nguyen C, Peck K, Jordan BR. Sensitivity issues in DNA array-based expression measurements and performance of nylon microarrays for small samples. Hum Mol Genet. 1999;8:1715–1722. doi: 10.1093/hmg/8.9.1715. [DOI] [PubMed] [Google Scholar]
  28. Tusher VG, Tibshirani R, Chu G. Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci USA. 2001;98:5116–5121. doi: 10.1073/pnas.091062498. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Eisen MB, Spellman PT, Brown PO, Botstein D. Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci USA. 1998;95:14863–14868. doi: 10.1073/pnas.95.25.14863. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Rexroad CE, Lee Y, Keele JW, Karamycheva S, Brown G, Koop B, Gahr SA, Palti Y, Quackenbush J. Sequence analysis of a rainbow trout cDNA library and creation of a gene index. Cytogenetic and Genome Research. 2003;102:347–354. doi: 10.1159/000075773. [DOI] [PubMed] [Google Scholar]
  31. Sigenae http://www.sigenae.org
  32. Gish W, States DJ. Identification of protein coding regions by database similarity search. Nat Genet. 1993;3:266–272. doi: 10.1038/ng0393-266. [DOI] [PubMed] [Google Scholar]
  33. Swiss-Prot http://www.expasy.org/sprot/
  34. UniGene http://www.ncbi.nlm.nih.gov/UniGene/
  35. Bertucci F, Finetti P, Rougemont J, Charafe-Jauffret E, Cervera N, Tarpin C, Nguyen C, Xerri L, Houlgatte R, Jacquemier J, Viens P, Birnbaum D. Gene expression profiling identifies molecular subtypes of inflammatory breast cancer. Cancer Res. 2005;65:2170–2178. doi: 10.1158/0008-5472.CAN-04-4115. [DOI] [PubMed] [Google Scholar]
  36. Tanaka M, Telecky TM, Fukada S, Adachi S, Chen S, Nagahama Y. Cloning and sequence analysis of the cDNA encoding P-450 aromatase (P450arom) from a rainbow trout (Oncorhynchus mykiss) ovary; relationship between the amount of P450arom mRNA and the production of oestradiol-17 beta in the ovary. J Mol Endocrinol. 1992;8:53–61. doi: 10.1677/jme.0.0080053. [DOI] [PubMed] [Google Scholar]
  37. Mansuy D. The great diversity of reactions catalyzed by cytochromes P450. Comp Biochem Physiol C Pharmacol Toxicol Endocrinol. 1998;121:5–14. doi: 10.1016/S0742-8413(98)10026-9. [DOI] [PubMed] [Google Scholar]
  38. Weber LP, Diamond SL, Bandiera SM, Janz DM. Expression of HSP70 and CYP1A protein in ovary and liver of juvenile rainbow trout exposed to beta-naphthoflavone. Comp Biochem Physiol C Toxicol Pharmacol. 2002;131:387–394. doi: 10.1016/S1532-0456(02)00025-X. [DOI] [PubMed] [Google Scholar]
  39. Toriniwa Y, Lv X, Kodama Y, Ohizumi Y, Yoshida M, Nakahata N. Participation of epoxygenase activation in saikogenin D-induced inhibition of prostaglandin E(2) synthesis. J Pharm Pharmacol. 2006;58:859–866. doi: 10.1211/jpp.58.6.0017. [DOI] [PubMed] [Google Scholar]
  40. Goetz FW, Berndtson AK, Ranjan M. Ovulation: Mediators at the ovarian level. In: Pang PKT, Schreibman MP, editor. Vertebrate Endocrinology: Fundamentals and Biomedical Implications. San Diego, CA: Academic Press; 1991. pp. 127–203. [Google Scholar]
  41. Jalabert B, Szöllösi D. In vitro ovulation of trout oocytes: effect of prostaglandins on smooth muscle-like cells of the theca. Prostaglandins. 1975;9:765–78. doi: 10.1016/0090-6980(75)90113-6. [DOI] [PubMed] [Google Scholar]
  42. Hasegawa H, Ma T, Skach W, Matthay MA, Verkman AS. Molecular cloning of a mercurial-insensitive water channel expressed in selected water-transporting tissues. J Biol Chem. 1994;269:5497–5500. [PubMed] [Google Scholar]
  43. Selman K, Wallace RA. Oogenesis in Fundulus heteroclitus. III. Vitellogenesis. J Exp Zool. 1983;226:441–457. doi: 10.1002/jez.1402260315. [DOI] [PubMed] [Google Scholar]
  44. Watanabe WO, Kuo C-M. Water and ion balance in hydrating oocytes of the grey mullet, Mugil cephalus (L.) during hormone-induced final maturation. J Fish Biol. 1986;28:425–437. doi: 10.1111/j.1095-8649.1986.tb05180.x. [DOI] [Google Scholar]
  45. Fabra M, Raldua D, Power DM, Deen PM, Cerda J. Marine fish egg hydration is aquaporin-mediated. Science. 2005;307:545. doi: 10.1126/science.1106305. [DOI] [PubMed] [Google Scholar]
  46. Milla S, Jalabert B, Rime H, Prunet P, Bobe J. Hydration of rainbow trout oocyte during meiotic maturation and in vitro regulation by 17,20{beta}-dihydroxy-4-pregnen-3-one and cortisol. J Exp Biol. 2006;209:1147–1156. doi: 10.1242/jeb.02094. [DOI] [PubMed] [Google Scholar]
  47. Heierhorst J, Mahlmann S, Morley SD, Coe IR, Sherwood NM, Richter D. Molecular cloning of two distinct vasotocin precursor cDNAs from chum salmon (Oncorhynchus keta) suggests an ancient gene duplication. FEBS Lett. 1990;260:301–304. doi: 10.1016/0014-5793(90)80129-7. [DOI] [PubMed] [Google Scholar]
  48. Hyodo S, Kato Y, Ono M, Urano A. Cloning and sequence analyses of cDNAs encoding vasotocin and isotocin precursors of chum salmon, Oncorhynchus keta: evolutionary relationships of neurohypophysial hormone precursors. J Comp Physiol [B] 1991;160:601–608. doi: 10.1007/BF00571256. [DOI] [PubMed] [Google Scholar]
  49. Balment RJ, Lu W, Weybourne E, Warne JM. Arginine vasotocin a key hormone in fish physiology and behaviour: A review with insights from mammalian models. Gen Comp Endocrinol. 2006;147:9–16. doi: 10.1016/j.ygcen.2005.12.022. [DOI] [PubMed] [Google Scholar]
  50. Espey LL. Ovulation as an inflammatory reaction – A hypothesis. Biol Reprod. 1980;22:73–106. doi: 10.1095/biolreprod22.1.73. [DOI] [PubMed] [Google Scholar]
  51. Espey LL. Current status of the hypothesis that mammalian ovulation is comparable to an inflammatory reaction. Biol Reprod. 1994;50:233–238. doi: 10.1095/biolreprod50.2.233. [DOI] [PubMed] [Google Scholar]
  52. Richards JS, Russell DL, Ochsner S, Espey LL. Ovulation: new dimensions and new regulators of the inflammatory-like response. Annu Rev Physiol. 2002;64:69–92. doi: 10.1146/annurev.physiol.64.081501.131029. [DOI] [PubMed] [Google Scholar]
  53. Ohnishi J, Ohnishi E, Shibuya H, Takahashi T. Functions for proteinases in the ovulatory process. Biochim Biophys Acta. 2005;1751:95–109. doi: 10.1016/j.bbapap.2005.05.002. [DOI] [PubMed] [Google Scholar]
  54. Hajnik CA, Goetz FW, Hsu SY, Sokal N. Characterization of a ribonucleic acid transcript from the brook trout (Salvelinus fontinalis) ovary with structural similarities to mammalian adipsin/complement factor D and tissue kallikrein, and the effects of kallikrein-like serine proteases on follicle contraction. Biol Reprod. 1998;58:887–897. doi: 10.1095/biolreprod58.4.887. [DOI] [PubMed] [Google Scholar]
  55. Walz A, Peveri P, Aschauer H, Baggiolini M. Purification and amino acid sequencing of NAF, a novel neutrophil-activating factor produced by monocytes. Biochem Biophys Res Commun. 1987;149:755–761. doi: 10.1016/0006-291X(87)90432-3. [DOI] [PubMed] [Google Scholar]
  56. Yoshimura T, Matsushima K, Tanaka S, Robinson EA, Appella E, Oppenheim JJ, Leonard EJ. Purification of a human monocyte-derived neutrophil chemotactic factor that has peptide sequence similarity to other host defense cytokines. Proc Natl Acad Sci USA. 1987;84:9233–9237. doi: 10.1073/pnas.84.24.9233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Mackay CR. Chemokines: immunology's high impact factors. Nat Immunol. 2001;2:95–101. doi: 10.1038/84298. [DOI] [PubMed] [Google Scholar]
  58. Onuffer JJ, Horuk R. Chemokines, chemokine receptors and small-molecule antagonists: recent developments. Trends Pharmacol Sci. 2002;23:459–467. doi: 10.1016/S0165-6147(02)02064-3. [DOI] [PubMed] [Google Scholar]
  59. Huising MO, Stet RJ, Kruiswijk CP, Savelkoul HF, Lidy Verburg-van Kemenade BM. Molecular evolution of CXC chemokines: extant CXC chemokines originate from the CNS. Trends Immunol. 2003;24:307–313. doi: 10.1016/s1471-4906(03)00120-0. [DOI] [PubMed] [Google Scholar]
  60. Baoprasertkul P, He C, Peatman E, Zhang S, Li P, Liu Z. Constitutive expression of three novel catfish CXC chemokines: homeostatic chemokines in teleost fish. Mol Immunol. 2005;42:1355–1366. doi: 10.1016/j.molimm.2004.12.012. [DOI] [PubMed] [Google Scholar]
  61. Huising MO, van der MT, Flik G, Verburg-van Kemenade BM. Three novel carp CXC chemokines are expressed early in ontogeny and at nonimmune sites. Eur J Biochem. 2004;271:4094–4106. doi: 10.1111/j.1432-1033.2004.04347.x. [DOI] [PubMed] [Google Scholar]
  62. Abad C, Juarranz Y, Martinez C, Arranz A, Rosignoli F, Garcia-Gomez M, Leceta J, Gomariz RP. cDNA array analysis of cytokines, chemokines, and receptors involved in the development of TNBS-induced colitis: homeostatic role of VIP. Inflamm Bowel Dis. 2005;11:674–684. doi: 10.1097/01.MIB.0000171872.70738.58. [DOI] [PubMed] [Google Scholar]
  63. Hanumanthaiah R, Day K, Jagadeeswaran P. Comprehensive analysis of blood coagulation pathways in teleostei: evolution of coagulation factor genes and identification of zebrafish factor VIIi. Blood Cells Mol Dis. 2002;29:57–68. doi: 10.1006/bcmd.2002.0534. [DOI] [PubMed] [Google Scholar]
  64. Rothberger H, McGee MP. Generation of coagulation factor V activity by cultured rabbit alveolar macrophages. J Exp Med. 1984;160:1880–1890. doi: 10.1084/jem.160.6.1880. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Donoghue M, Hsieh F, Baronas E, Godbout K, Gosselin M, Stagliano N, Donovan M, Woolf B, Robison K, Jeyaseelan R, Breitbart RE, Acton S. A novel angiotensin-converting enzyme-related carboxypeptidase (ACE2) converts angiotensin I to angiotensin 1–9. Circ Res. 2000;87:E1–E9. doi: 10.1161/01.res.87.5.e1. [DOI] [PubMed] [Google Scholar]
  66. Tipnis SR, Hooper NM, Hyde R, Karran E, Christie G, Turner AJ. A human homolog of angiotensin-converting enzyme. Cloning and functional expression as a captopril-insensitive carboxypeptidase. J Biol Chem. 2000;275:33238–33243. doi: 10.1074/jbc.M002615200. [DOI] [PubMed] [Google Scholar]
  67. Riviere G, Michaud A, Breton C, VanCamp G, Laborie C, Enache M, Lesage J, Deloof S, Corvol P, Vieau D. Angiotensin-converting enzyme 2 (ACE2) and ACE activities display tissue-specific sensitivity to undernutrition-programmed hypertension in the adult rat. Hypertension. 2005;46:1169–1174. doi: 10.1161/01.HYP.0000185148.27901.fe. [DOI] [PubMed] [Google Scholar]
  68. Giometti IC, Bertagnolli AC, Ornes RC, da Costa LF, Carambula SF, Reis AM, de Oliveira JF, Emanuelli IP, Goncalves PB. Angiotensin II reverses the inhibitory action produced by theca cells on bovine oocyte nuclear maturation. Theriogenology. 2005;63:1014–1025. doi: 10.1016/j.theriogenology.2004.05.022. [DOI] [PubMed] [Google Scholar]
  69. Hsu S, Goetz FW. Angiotensins stimulate in vitro ovulation and contraction of brook trout (Salvelinus fontinalis) follicles. Fish Physiol Biochem. 1992;10:277–282. doi: 10.1007/BF00004476. [DOI] [PubMed] [Google Scholar]
  70. Vickers C, Hales P, Kaushik V, Dick L, Gavin J, Tang J, Godbout K, Parsons T, Baronas E, Hsieh F, Acton S, Patane M, Nichols A, Tummino P. Hydrolysis of biological peptides by human angiotensin-converting enzyme-related carboxypeptidase. J Biol Chem. 2002;277:14838–14843. doi: 10.1074/jbc.M200581200. [DOI] [PubMed] [Google Scholar]
  71. Zisman LS, Keller RS, Weaver B, Lin Q, Speth R, Bristow MR, Canver CC. Increased angiotensin-(1–7)-forming activity in failing human heart ventricles: evidence for upregulation of the angiotensin-converting enzyme Homologue ACE2. Circulation. 2003;108:1707–1712. doi: 10.1161/01.CIR.0000094734.67990.99. [DOI] [PubMed] [Google Scholar]
  72. Kitajima K, Inoue S, Inoue Y, Troy FA. Use of a bacteriophage-derived endo-N-acetylneuraminidase and an equine antipolysialyl antibody to characterize the polysialyl residues in salmonid fish egg polysialoglycoproteins. Substrate and immunospecificity studies. J Biol Chem. 1988;263:18269–18276. [PubMed] [Google Scholar]

Articles from Reproductive Biology and Endocrinology are provided here courtesy of BMC

RESOURCES