Skip to main content
The EMBO Journal logoLink to The EMBO Journal
. 2006 Sep 14;25(19):4596–4604. doi: 10.1038/sj.emboj.7601348

The regulator of the F1 motor: inhibition of rotation of cyanobacterial F1-ATPase by the ɛ subunit

Hiroki Konno 1,2, Tomoe Murakami-Fuse 1,2, Fumihiko Fujii 3, Fumie Koyama 1,2, Hanayo Ueoka-Nakanishi 2,*, Chan-Gi Pack 3, Masataka Kinjo 3, Toru Hisabori 1,2,a
PMCID: PMC1589999  PMID: 16977308

Abstract

The chloroplast-type F1 ATPase is the key enzyme of energy conversion in chloroplasts, and is regulated by the endogenous inhibitor ɛ, tightly bound ADP, the membrane potential and the redox state of the γ subunit. In order to understand the molecular mechanism of ɛ inhibition, we constructed an expression system for the α3β3γ subcomplex in thermophilic cyanobacteria allowing thorough investigation of ɛ inhibition. ɛ Inhibition was found to be ATP-independent, and different to that observed for bacterial F1-ATPase. The role of the additional region on the γ subunit of chloroplast-type F1-ATPase in ɛ inhibition was also determined. By single molecule rotation analysis, we succeeded in assigning the pausing angular position of γ in ɛ inhibition, which was found to be identical to that observed for ATP hydrolysis, product release and ADP inhibition, but distinctly different from the waiting position for ATP binding. These results suggest that the ɛ subunit of chloroplast-type ATP synthase plays an important regulator for the rotary motor enzyme, thus preventing wasteful ATP hydrolysis.

Keywords: ATP synthase, ADP inhibition, CF1, rotation, ɛ inhibition

Introduction

F0F1 ATP synthase synthesizes ATP from ADP and inorganic phosphate by way of the proton motive force (pmf) generated across the cytoplasmic membranes of bacteria, thylakoid membranes of chloroplasts and inner membranes of mitochondria (Senior, 1990; Boyer, 1997; Yoshida et al, 2001). This enzyme can transport protons to generate pmf when it hydrolyzes ATP. The enzyme consists of the membrane-embedded portion F0 and the water-soluble portion F1. F0 is composed of three different subunits, a, b and c with a stoichiometry of a1b2c10–14 (Senior, 1990; Stock et al, 1999; Seelert et al, 2000; Jiang et al, 2001; Mitome et al, 2004; Meier et al, 2005), and constitutes the proton translocation device. F1 is composed of five different subunits designated α to ɛ with a stoichiometry of α3β3γ1δ1ɛ1 (Yoshida et al, 1979). The minimum catalytic core, which maintains the property of F1-ATPase, is α3β3γ (Kaibara et al, 1996; Hisabori et al, 1997; Matsui et al, 1997; Du et al, 2001), and the catalytic sites reside on each of the three β subunits at the interface with the α subunits (Abrahams et al, 1994). The rotary catalysis mechanism was first proposed by PD Boyer and co-workers based on detailed analysis of the kinetics of F1-ATPase activity (Grubmeyer et al, 1982). Following determination of the central axis structure of the γ subunit in the α3β3 hexagon (Abrahams et al, 1994), the rotation of the γ subunit during ATP hydrolysis was examined by biochemical crosslinking (Duncan et al, 1995) and polarized fluorescence experiments (Sabbert et al, 1996). Finally, by single molecule observation, the rotation of the γ subunit was conclusively determined to be coupled with ATP hydrolysis (Noji et al, 1997, 1999; Hisabori et al, 1999; Omote et al, 1999). Thorough analysis of rotation of the γ subunit revealed that the γ subunit rotates with discrete 120° step per single molecule ATP consumption and this 120° step consists of further 80° and 40° substeps (Yasuda et al, 1998, 2001). This 80° substep was recently revealed to be induced by ATP binding, whereas ATP cleavage and product release result in a subsequent additional 40° substep (Yasuda et al, 2001; Shimabukuro et al, 2003).

As ATP synthesis is a key reaction required to maintain a number of metabolic pathways, the F0F1 complex must be subject to various regulatory mechanisms required to modulate its activity, in order to optimally accommodate changes in environmental conditions. ADP inhibition of the ATP hydrolysis activity is a common regulatory mechanism that has been found to occur in most species; in such a mechanism, the ATP hydrolysis reaction is inhibited by tight binding of ADP-Mg to the catalytic site(s) (Minkov et al, 1979; Bar-Zvi and Shavit, 1982; Vasilyeva et al, 1982; Malyan and Vitseva, 1983; Feldman and Boyer, 1985; Zhou et al, 1988; Digel et al, 1996; Matsui et al, 1997). Recently, this type of inhibition has been assigned to the pause of the rotation motion at 80° within the 120° catalytic step (Hirono-Hara et al, 2001, 2005). Another regulatory mechanism for the ATP hydrolysis reaction is brought about by the intrinsic inhibitory function of the ɛ subunit (ɛ inhibition), which is well characterized in bacteria and in chloroplasts (Nelson et al, 1972; Richter et al, 1984; Aggeler and Capaldi, 1996; Kato et al, 1997; Nowak et al, 2002). Both ADP inhibition and ɛ inhibition may not affect the ATP synthesis activity of F0F1 (Bald et al, 1998; Tsunoda et al, 2001). However, the ɛ subunit of F1 from thermophilic Bacillus PS3 (TF1) is known to rotate with the γ subunit and the rotation speed of the ɛ subunit attached to the γ subunit is not significantly different to that of the γ subunit without ɛ (Kato-Yamada et al, 1998), and inhibition of rotation of the γ subunit caused by ɛ inhibition has not been characterized in depth at the single molecule level. Furthermore, rotation of the ɛ subunit in Escherichia coli F0F1 has been observed by FRET measurement (Zimmermann et al, 2005). Recently, Nakanishi-Matsui et al (2005) reported the inhibition of rotation of the γ subunit by the ɛ subunit in E. coli F1-ATPase (EF1). They observed a distinct increase in the pausing period of the γ subunit during rotation caused by addition of the ɛ subunit. However, thorough analysis of inhibition by the bacterial ɛ subunit appears difficult because inhibition shows a complicated kinetic profile based on the conformational change of the ɛ subunit by ATP during inhibition of the catalytic reaction (Aggeler and Capaldi, 1996; Kato-Yamada et al, 2000; Suzuki et al, 2003; Iino et al, 2005).

In contrast, ɛ inhibition of the chloroplast-type F1-ATPase is independent of ATP concentration, and ATP hydrolysis activity is inhibited by addition of ɛ subunit alone to the ɛ-free complex (Richter et al, 1984). However, the effect of ɛ binding on the CF1 complex has not been studied from the point of view of rotation because of the lack of an enzyme complex that can be suitably manipulated. For the study of CF1 complex at the molecular level, cyanobacterial F1-ATPase is a suitable alternative, as the active enzyme complex can be reconstituted from the recombinant individual subunits α, β, γ, δ and ɛ (Steinemann et al, 1995). In addition, insertion of a ‘chloroplast-like' regulatory segment responsible for thiol modulation into the γ subunit of F0F1-ATPase of the cyanobacterium Synechocystis sp. PCC6803 at the chromosome level can be used to generate a redox-sensitive F0F1, which is one of the main distinguishing features of the chloroplast-type ATP synthase in vivo (Werner-Grune et al, 1994; Krenn et al, 1995).

In order to carry out a detailed study on the effect of the ɛ subunit on γ subunit rotation, we prepared a ‘purpose-built' F1-ATPase α3β3γ complex using an E. coli-based expression system for synthesis of the thermophilic cyanobacterial ATP synthase complex, which possesses similar properties to the chloroplast ATPase.

Results

Inhibition of ATPase activity of thermophilic cyanobacterial α3β3γ complex by the ɛ subunit

The α3β3γ complex of Thermosynecoccus elongatus was overexpressed in E. coli BL21(DE3)uncΔ702 strains and purified as described (see Materials and methods). Using this complex, we first determined whether the cyanobacterial F1 subcomplex has similar properties to the chloroplast-type F1-ATPase in terms of ɛ inhibition. In the previous study, we found that the ATPase activity of the chimeric complex comprised of the thermophilic bacterial α and β subunits and the spinach chloroplast γ subunit became insensitive to ɛ subunit inhibition upon deletion of the specific additional region of the chloroplast-type γ subunit that contains the two regulatory cysteines (Hisabori et al, 1998). As this result demonstrated the significance of the contribution of additional region of the γ subunit on ɛ inhibition, we hereby prepared a similar mutant of the cyanobacterial α3β3γ complex, α3β3γΔ198–222 (Figure 1B in the Supplementary data). The ATPase activity of α3β3γΔ198–222 was inhibited by 20% by the ɛ subunit when the enzyme activity was measured in the presence of 5 mM ATP, whereas the extent of inhibition was slightly higher when 5 μM ATP was used (Figure 1). In contrast, the wild-type α3β3γ complex was completely inhibited by the ɛ subunit irrespective of the ATP concentrations. This strong inhibitory effect under high ATP concentration was very different from that observed for the thermophilic bacterial enzyme (Kato-Yamada et al, 1999), but similar to that observed for the chloroplast-type ATPase (Richter et al, 1984).

Figure 1.

Figure 1

Effect of the ɛ subunit on the ATP hydrolysis activities of α3β3γwild and α3β3γΔ198–222. α3β3γ subcomplexes (400 nM) were incubated with (closed bar) or without (open bar) 1 μM ɛ subunit for 6 min at 40°C, and the ATP hydrolysis activity was measured in the presence of ATP regenerating system at 40°C. For the assay, 27 nM wild-type complex and 9 nM α3β3γΔ198–222 were used.

In order to determine the cause of the reduction in the extent of the ɛ inhibition in the α3β3γΔ198–222 complex, we calculated the apparent KD values of the interaction between ɛ and the α3β3γ complex based on the extent of inhibition of ATP hydrolysis activity of the complex in the presence of various concentrations of the ɛ subunit (Figure 2A). The estimated KD values were 2.1±0.3 nM for the wild type and 4.2±0.9 nM for the mutant complex. To confirm the difference in affinity, we then examined the binding of the ɛ subunit to this α3β3γΔ198–222 complex using fluorescence correlation spectroscopy (FCS), a valuable method that allows the measurement of the affinity between two protein molecules in solution. For this FCS measurement, a Cys residue was introduced into the ɛ subunit at the position of Q100 (ɛQ100C) and was labeled with Alexa Fluor 488-C5-maleimide. This mutation and the fluorescent dye used did not affect ɛ inhibition (see the Supplementary Figure 2). This direct binding measurement showed that the affinity between the ɛ subunit and the complex decreased 3.5-fold by deletion of the additional region of the γ subunit (Figure 2B). The KD values obtained were 12.5±3.2 nM for the wild type and 44±7.2 nM for the mutant complex. As ɛ inhibition of the α3β3γΔ198–222 complex did not increase even in the presence of 1 μM ɛ subunit (a much higher concentration than the observed KD value), we concluded that the deleted portion of the γ subunit must play a significant role in ɛ-induced inhibition, although the reduced inhibitory effect of the ɛ subunit on the mutant complex might be in part due to decreased binding of the ɛ subunit. To further dissect the properties of the mutant γ subunit, we measured the enzyme activity of the wild type and α3β3γΔ198–222 complex in the presence and absence of the nonionic detergent lauryldimethylamine oxide (LADO) (Figure 3). LADO is a useful indicator of the susceptibility of an enzyme to ADP inhibition (Paik et al, 1993). The mutant was found to be less activated in the presence of LADO, suggesting that, in comparison to the wild type, the α3β3γΔ198–222 complex may be less prone to ADP inhibition. These results suggest that the additional region of the chloroplast-type γ subunit is an important determinant of the susceptibility of the complex to both ɛ inhibition and ADP inhibition.

Figure 2.

Figure 2

Binding of the ɛ subunit to the α3β3γwild and α3β3γΔ198–222 complexes. (A) The extent of inhibition of the ATPase activity of the α3β3γwild (‘Wt', open symbol) and α3β3γΔ198–222 (‘γΔ198–222', closed symbol) complexes were measured in the presence of various concentrations of the ɛ subunit. The results from three independent experiments (circle, triangle and square) are plotted against the concentration of free ɛ subunit (see ‘Materials and methods'). Lines were calculated based on the KD values obtained from the independent measurements above for α3β3γwild (‘Wt', solid line) and for α3β3γΔ198–222 (‘γΔ198–222', dotted line). (B) Binding of the ɛ subunit to the α3β3γ complex was measured by FCS method as a function of the concentration of α3β3γwild (‘Wt', open symbol) and α3β3γΔ198–222 (‘γΔ198–222', closed symbol). For the measurements, the fluorescence-labeled ɛ was fixed at 5 nM. The complex and the ɛ subunit were incubated for 60 min at 40°C, and the FCS measurement was carried out at 37°C. The results from three independent experiments (circle, triangle and square) are plotted. The titration curves for α3β3γwild (‘Wt', solid line) and for α3β3γΔ198–222 (‘γΔ198–222', dotted line) were fitted as described (see Materials and methods).

Figure 3.

Figure 3

Effect of LADO on the ATP hydrolysis activity of the α3β3γwild and α3β3γΔ198–222 complexes. ATP hydrolysis of α3β3γwild and α3β3γΔ198–222 was measured as described in Figure 1 in the presence (closed bar) and the absence (open bar) of 0.1% (w/v) LADO. Steady-state activity was determined from the slope from 180 to 200 s after addition of the enzyme solutions, and the results of three independent experiments were averaged. The extent of the activation by the addition of LADO is indicated on the bars.

Enzyme preparation for single molecule observation and its inhibition by the ɛ subunit

To observe ɛ inhibition of rotation of the γ subunit in detail, two cysteine residues were introduced at the surface of the γ subunit. These two cysteines were used as an attachment site for the beads that are used as a probe to observe the movement of γ. After screening the γ subunit for mutations that would not affect ɛ-induced inhibition, amino-acid positions corresponding to Gly-112 and Ala-125 were used as recipients for introduction of the required cysteine residues, in addition to the substitution of Lys-221 to Ser, which is located in the additional region. Lys-221 appears to be a critical residue of this region of the enzyme, because substitution of this residue to Ser resulted in an increase in ATPase activity, and reduced the susceptibility of the enzyme to ADP inhibition state as observed for the α3β3γΔ198–222 complex. However, the remarkable difference between the K221S mutation and γΔ198–222 was that the former showed no significant difference in the extent of ɛ inhibition (see Figure 1 in contrast to Table I of the Supplementary data). The complex containing the three γ subunit mutations G112C, A125C and K221S (designated α3β3γ-rot) showed 10-fold higher activity than the wild-type complex (Table I of the Supplementary data), and was used for the rotation experiments. Specific biotinylation of the introduced cysteines was confirmed by Western blotting using a streptavidin-conjugated alkaline phosphatase (Figure 3 in the Supplementary data).

Having prepared the experimental system described above, we sought to investigate the kinetic properties of α3β3γ-rot ATPase activity and its inhibition by the ɛ subunit (Figure 4A). The KM and Vmax values obtained for α3β3γ-rot were the following: 85.8 μM and 44.3 s−1 in the absence of the ɛ subunit, 52.2 μM and 32.1 s−1 in the presence of 3 nM ɛ subunit, and 66.5 μM and 21.4 s−1 in the presence of 5 nM ɛ subunit. The ɛ subunit was thus found to inhibit the ATPase activity noncompetitively. Figure 4B shows a typical time course for the ɛ-induced inhibition. The decrease in the activity following addition of ɛ occurred within a few minutes and the obtained curve fitted to a single exponential function. The gradual decrease in activity indicates binding of the ɛ subunit to the complex, and the binding rate constant, kobs, was calculated from these curves. Based on the observed linear relation of kobs against the ɛ concentrations, a kon value of 4.9 × 105 M−1 s−1 was obtained (Figure 4C). Although the extrapolated intercept of Figure 4C gives the theoretical koff value, owing to large experimental fluctuations, it was deemed unsuitable for calculation of the KD value. Instead, the KD value of 3.6 nM obtained from the inhibition of steady-state ATPase activity by the ɛ subunit was used, allowing determination of the koff value, which was found to be 1.8 × 10−3 s−1.

Figure 4.

Figure 4

Inhibition of ATP hydrolysis activity of the α3β3γ-rot complex by the ɛ subunit. (A) S/v-S plots of the rates of ATP hydrolysis with 5–2500 μM ATP are indicated. ATP hydrolysis activity was measured at 25°C. The reaction was initiated by addition of 6 nM α3β3γ-rot and the activity was monitored for 1 min. 0 nM (triangle), 3 nM (square) and 5 nM (circle) of ɛ subunit was then added and the activity in the steady state was determined from the slope from 175 to 200 s following ɛ subunit addition. (B) ATP hydrolysis activity of α3β3γ-rot was measured with 5 mM ATP at 25°C. The reaction was initiated by addition of 1.5 nM α3β3γ-rot and the activity monitored for 1 min. The indicated concentrations of the ɛ subunits were then added. (C) Time course of the inhibition after addition of the ɛ subunit shown in (B) was used for calculation of kon of the ɛ subunit to the complex. The curves are fitted to a single exponential equation: y=a × e−kobs × t+b, where a and b are constants, and kobs is the observed binding rate constant. The association rate constant kon was then obtained from the slope based on the function, kobs=kon × [ɛ subunit]+koff.

Inhibition of rotation of the γ subunit by the ɛ subunit

The rotation of the γ subunit in the α3β3γ-rot complex was observed using a 0.2-μm duplex beads as a probe. The exchange of the buffer was found to have little effects on the rotation behavior of the γ subunit (Figure 5A). In contrast, significant inhibition of rotation was observed when the ɛ subunit was injected into the objective chamber (Figure 5B). No continuous rotation was observed on the 13 glass plates examined after injection of the ɛ subunit, suggesting very tight binding of the ɛ subunit to the immobilized ATPase molecule and efficient inhibition of the rotation of the γ subunit. From the koff value obtained for the ɛ subunit, the half-lifetime of the binding of the ɛ subunit to the complex was calculated as 9.3 min, and the ɛ subunit could easily rebind to the complex when the concentration of the ɛ subunit was 3 μM. Therefore, the occasional detachment of the ɛ subunit from the γ subunit and subsequent resumption of rotation within this experimental period was deemed to be highly unlikely.

Figure 5.

Figure 5

Effect of the ɛ subunit on the rotation of the γ subunit in the α3β3γ complex. Rotations of the beads attached to the γ subunit in the presence or the absence of the ɛ subunit were recorded at 250 nM ATP at 25°C. The buffer without (A) or with (B) 3 μM ɛ subunit was infused into the chamber following an initial 5 min observation of rotation. In general, solution exchange in the flow-chamber took 1–2 min. The total number of observed particles was 17 for A (without ɛ) and 13 for B (with ɛ).

Analysis of the pause position of the γ subunit caused by the ɛ inhibition

When a very low ATP concentration (250 nM) was used for the rotation assay, the movement of the beads attached to the γ subunit showed three discrete pauses, each separated by 120° (Figure 6A). This stepping rotation was not observed when 10 μM ATP was used (Figure 4 in the Supplementary data). The observed 120° pauses can be attributed to ATP binding (Yasuda et al, 1998). The angular position of this 120° pause was not significantly affected by the buffer exchange (Figure 6A–C), indicating that the immobilized ATPase complex does not easily undergo a change in position or direction on the glass surface. The average change in pausing angle of the γ subunit from a prior ATP waiting after buffer exchange was 125.3±17.9° (Table I). We next determined the angular position of the pause when rotation was inhibited by the ɛ subunit. The location of the beads after the ɛ injection was clearly limited (Figure 6D–F), and the pausing angle was approximately 80° forward from that for the ATP binding (Table I).

Figure 6.

Figure 6

Stop angular position of the γ subunit inhibited by the ɛ subunit. Histograms of angular positions of the beads at 250 nM ATP before (A, D) and after (B, E) buffer exchanges are indicated. (C, F) are superimposed histograms of (A, B) and (D, E), respectively. Histograms were taken from rotations observed for 5 min. One of three peak positions of the histogram was set as 0°, and was indicated as the position of the arrow in the traces of the centroid of the beads in the inset figures. In the case of the experiments shown in (D–F), buffer containing 3 μM ɛ subunit was used.

Table 1.

Stop angular position of rotation of the γ subunit inhibited by the ɛ subunit

Buffer exchange Pausing angular position of the γ subunit (mean±s.d.)
−ɛ 125.3±17.9° (n=15)
+ɛ 79.0±20.2° (n=5)
The most common location of the bead during rotation is shown as peaks in Figure 6. Each of the peaks was fitted by Gaussian distributions, and the center of the angular position of the γ subunit from the previous ATP binding position (see the peaks in Figure 6B and E) was averaged on the indicated number of the particles.  

To characterize this 80° pausing position induced by the ɛ inhibition, we analyzed the slow rotation of the γ subunit of the α3β3γ-rot in the presence of 250 nM ATP in detail, and could observe the long pauses (5–45 s) of rotation at 80° from the ATP binding position frequently (Figure 7). These long pauses at 80° seem to be nearly identical to that observed for ADP inhibition state on TF1 (Hirono-Hara et al, 2001), suggesting that the pausing angular position by the ɛ inhibition was identical to that observed for ATP hydrolysis, product release and that for ADP inhibition, but distinctly different from the waiting position for ATP binding.

Figure 7.

Figure 7

Long pause of the rotation of the γ subunit at 80°. Pausing angular position of the beads from the ATP waiting position to the next ATP waiting position (A) or to the ADP inhibition (B) were overlayed (n=10), when 250 nM ATP was used for the assay.

Discussion

Why can CF1-ɛ behave as a strong intrinsic inhibitor?

Based on the observation of the recovery of the ɛ inhibition of TF1, the ɛ subunit is thought to exist in two different states in the complex known as the inhibitory state and the non-inhibitory state (Kato-Yamada et al, 1999). Based on structural analysis, these two states are considered to be the consequence of the two different ɛ subunit conformations: the extended conformation and the contracted conformation, respectively (Suzuki et al, 2003). Therefore, the transition between these two conformations is thought to be a mode of regulation of the F1-ATPase complex (Suzuki et al, 2003; Iino et al, 2005). ATP hydrolysis is strongly inhibited in the F0F1 complex as well, when the ɛ subunit assumes the extended conformation, in which the C-terminal α-helices of the ɛ subunit extend into the α3β3 hexagon ring, whereas the contracted ɛ subunit does not inhibit ATP hydrolysis (Tsunoda et al, 2001). The apparent insensitivity of the TF1 or TF0TF1 to ɛ inhibition observed in the presence of high concentrations of ATP has therefore been attributed to the contracted conformation of the ɛ subunit, which is induced by ATP (Kato-Yamada et al, 2000, 2005). The ATP-dependent conformational change of the C-terminal α-helical part of ɛ has also been shown in EF0EF1 (Schulenberg and Capaldi, 1999).

The results presented here show that, in contrast to the reported ɛ inhibition of the bacterial F1-ATPase, the inhibitory effect of the ɛ subunit on the cyanobacterial α3β3γ complex is not influenced by the concentrations of ATP (Figure 1B), suggesting that the drastic conformational changes of the ɛ subunit from the extended to the contracted conformation is not induced by ATP. This observation is in agreement with the reported inhibitory mechanism of the chloroplast CF1 by the ɛ subunit (Richter et al, 1984). As stated, one of the remarkable differences between the bacterial F1 and CF1 is the existence of an additional ∼40 amino acids located in the middle of the γ subunit. Although the γ subunit of the cyanobacterial F1-ATPase is not redox sensitive, it also contains a 26 amino-acid addition whose sequences are very similar to those of CF1-γ. The additional region of the cyanobacterial and chloroplast γ subunit (Hisabori et al, 2003) may interfere with the conformational change of the ɛ subunit, thus CF1-ɛ can be thought of more as a stationary inhibitory subunit rather than a regulatory one like the bacterial type ɛ-subunit. In the case of CF1, the thiol modulation system constitutes an additional regulatory mechanism of enzyme activity (Nalin and McCarty, 1984), and this regulation ability seemed to be conferred by the molecular evolution of the additional region of the cyanobacterial γ subunit. In plants, this kind of redox regulation mechanism is likely to be of greater importance because CF1 activity can be linked both to the photochemical reactions and electron transport, thus constituting an effective mechanism for the efficient use of light as an energy source for ATP synthesis.

Relation between ɛ inhibition and ADP inhibition

The pausing period observed at 80° is considered to encompass the two sequential events; ATP hydrolysis (Shimabukuro et al, 2003) and product release (Yasuda et al, 2001). Nishizaka et al (2004) recently reported that ATP hydrolysis and/or phosphate release but not ADP release would occur at this 80° pause position. In addition, the TF1 subcomplex showed extended pauses at this angular position caused by ADP inhibition (Hirono-Hara et al, 2001).

Feniouk and Junge (2005) recently proposed that the ɛ subunit acts as a stabilizer of the ADP inhibition state in the F0F1 complex. As the α3β3γ subcomplex also lapses into the ADP inhibition state, ADP inhibition and ɛ inhibition are independent phenomena. However, our results suggest that these two inhibitions may be tightly linked to each other. In this study, we succeeded in determining the discrete stop position caused by the ɛ-induced inhibition of rotation, and found it to be approximately 80° forward from the pause position for ATP binding (Figure 6, Table I), confirming that binding of the ɛ subunit may stabilize ADP inhibition. This conclusion is further supported by the results showing that enzyme activation by LADO was less marked following deletion of additional region of the γ subunit, and this deletion affects ɛ inhibition (Figure 3).

Materials and methods

Materials

Biotin-PEAC5-maleimide was purchased from Dojindo (Kumamoto, Japan). ATP, phosphoenolpyruvate and bovine serum albumin (BSA) were obtained from Sigma. Pyruvate kinase, lactate dehydrogenase and nicotinamide adenine dinucleotide (reduced form) (NADH) were purchased from Roche Diagnostics. Other chemicals were of the highest grade commercially available.

Strains and plasmid

E. coli strains used were JM 109 (TAKARA) for cloning and BL21(DE3)uncΔ702 (Tcr, ATPase mutant, BL21(DE3) uncΔ702, asnA::Tn10) (Joshi et al, 1989; Nichols and Harwood, 1997) for expression of T. elongatus α3β3γ. E. coli BL21(DE3)uncΔ702 strain was kindly gifted from Dr Harwood (University of Iowa). A plasmid pTR19, the expression vector for F0F1 of thermophilic Bacillus PS3 (Suzuki et al, 2002), was used as a template to construct the expression vector for T. elongatus α3β3γ.

Construction of expression plasmids for α3β3γ and ɛ of T. elongatus BP-1

A 948 base pair DNA fragment containing atpC gene, coding for γ subunit of F0F1, was amplified by polymerase chain reaction (PCR) from genomic DNA of T. elongatus BP-1, (a kind gift from Masahiko Ikeuchi, University of Tokyo), using primers 5′-CCGCGGGAATTCGCTTTGCTTAGGAGTTTAAA TTACCATGGCCAATCTCAAAGC-3′ (EcoRI) and 5′-CGCCGGCGGTACCGCTAGCGCAGAGCCTCAGC CCC-3′ (NheI). The restriction sites for the enzyme shown in parentheses are underlined. A 1512 base pair DNA fragment containing atpA gene, coding for α subunit was amplified using primers 5′-GGCGGCGCCATGGAATCTAAGAAGGAGATATA CATATGGTAAGTATCCGACCCGACG-3′ (NcoI) and 5′-CCGCGCCGAATTCTTAGGCAGTGAAGGTAGCT TTGTAC-3′ (EcoRI). A 1449 base pair DNA fragment containing atpB gene, coding for β subunit of F0F1, was amplified by PCR using primers 5′-GGCGGGCGCTAGCATTATGAAGGAGATTAATC AAATGCATCACCATCATCACCATCACCATCACCAT ATGGTCATATCAGCAGAACGAACC-3′ (NheI) and 5′-CCCGCGGAAGCTTCTAAATCTCGACCACACCC CCTGCG-3′ (HindIII). These three DNA fragments for α, β and γ subunits were then ligated into the pTR19 plasmids using the restriction enzymes indicated. Consequently, the genes for TF0TF1 subunits were removed from the plasmid and the plasmid was converted to the expression plasmid for the α3β3γ complex of T. elongatus. The obtained plasmid was named pTR19FW.

For the ɛ subunit expression plasmid, a 417 base pair DNA fragment containing atpH gene, coding for the ɛ subunit of F0F1, was amplified by PCR from genomic DNA of T. elongatus BP-1 using primers 5′-GGCGGGCATATGGTGATGACTGTCCGGGTAAT TGCG-3′ (NdeI) and 5′-CCCGCGGAAGCTTCTAAATCTCGACCACACCC CCTGCG-3′ (HindIII). The PCR fragment was digested with NdeI and HindIII and ligated into the plasmid pET21c (Novagen).

Mutant complex preparation

Additional region on the γ subunit corresponding to amino acids 198–222 was deleted from the γ subunit gene on the expression plasmid for α3β3γ using the Mega-primer method (Landt et al, 1990) with the following mutation primers: 5′-GCTCCCCCTCGATCCCCAAGGGACCTCGACGC TGCCGCTCTGC-3′. The obtained plasmid was used for the expression of the α3β3γΔ198–222 complex.

To use the α3β3γ complex for single molecule experiments, all cysteines on the complex were substituted with serine by the Mega-primer method using the following mutation primers: 5′-CCCCTGCACCTGGTATTGTCCAGCGCAAATCT GTGTCCGAGCCATTGCAAACGGG-3′ for α Cys144Ser; 5′-CCAAAAGGGCCAAGACGTGATTTCCGTGTATG TGGCCATTGGTCAAAAAGCCTCC-3′ for αCys194Ser; 5′-GCGGCCGGCTTAGACGTGGCTGTAACCTCCGA AGTGCAACAACTCC-3′ for βCys53Ser and 5′-GGTGGTAACAGGCGATCGCGGGCTGTC CGGCGGTTACAACACTAATGTCATTCGCCG-3′ for γCys90Ser. Substitutions of Gly112 and Ala125 on γ to Cys for Biotin-PEAC5-Maleimide labeling were carried out by the Mega-primer method using the following mutation primers: 5′-GGAACGTCTCCAAGAACTCGAAGCCGAGTGCC TCAAATACACCCTAGT-3′ for γGly112Cys and 5′-GGGATAGTCACGGCGCTGGAAATATTGGCATG CCTTGCGACCC-3′ for γAla125Cys. In addition, Lys221 on γ was substituted with Ser using the following mutation primers: 5′-CATTTGGAAGTCAACCGCGAGTCGGTAACCTC GACGCTGCCCGCTCTGCCC-3′. The plasmid containing the above mutations was named pTR19FR and used for the expression of α3β3γ-rot.

Expression and purification of the α3β3γ complex and the ɛ subunit

E. coli BL21(DE3)uncΔ702 strain was transformed with pTR19FW or pTR19FR, and cultured in 2 × YT medium containing 100 μg/ml ampicillin and 0.2 mM isopropyl-β-D-thiogalactopyranoside at 37°C for 19 h. The desired proteins were purified and labeled with Biotin-PEAC5-maleimide by using the same method as described (Ueoka-Nakanishi et al, 2004) and stored at −80°C. The ɛ subunit was expressed and prepared as described (Hisabori et al, 1997) and stored at −80°C.

Measurement of ATP hydrolysis activity

ATP hydrolysis activity was measured in the presence of an ATP-regenerating system (Stiggall et al, 1979) in 50 mM N-2-hydroxyl piperazine-N′-2-ethane sulfonic acid (HEPES)–KOH, pH 8.0, 100 mM KCl, 2.5 mM MgCl2, 5 mM ATP, 50 μg/ml pyruvate kinase, 50 μg/ml lactate dehydrogenase, 2 mM phosphoenolpyruvate and 0.2 mM NADH. The assay was carried out at 25 and 40°C. The rate of ATP hydrolysis after addition of the enzyme was determined by monitoring the decrease in NADH absorption at 340 nm using a spectrophotometer V-550 (Jasco, Tokyo, Japan).

Estimation of the ɛ binding

The proportion of the complex-bound ɛ subunit was estimated from the extent of the inhibition of the ATPase activity of the complex. ATP hydrolysis was initiated by addition of the complex to the reaction mixture, monitored for 1 min, and various concentrations of the ɛ subunit added. The concentration of the α3β3γ complex was fixed at 5 nM. The rate of ATP hydrolysis in steady state was determined from 260 to 280 s after the addition of the ɛ subunit. The change in the extent of inhibition dependent on the ɛ concentrations were then fitted with the hyperbolic equation, y=[(A × [ɛ]free)/(KD+[ɛ]free)], where y represents the percentage of inhibition, A is the maximum inhibition (%) and KD is the equilibrium dissociation constant for the ɛ subunit. To calculate the concentration of the free ɛ subunit, we assumed that the complex that bound an ɛ subunit is completely inhibited, thus [ɛ]free=[ɛ]add−[complex] × y.

FCS measurement

ɛQ100C was labeled with Alexa Fluor 488-C5-maleimide (Molecular Probes) with a molar ratio of 1:5 in 100 mM K-phosphate, pH 7.0, 5 mM TCEP and 100 mM KCl at 25°C for 2 h. Unbound fluorescent dye was removed from the solution with NAP5 column (Amersham) equilibrated with 50 mM HEPES–KOH, pH 8.0 and 100 mM KCl. The concentrations of the fluorescent dye bound to the ɛ subunit was determined from the absorption using excitation coefficient at 493 nm=72 000 M−1 cm−1 for the dye. The concentrations of the ɛ subunit were determined by BCA protein assay. FCS measurements were performed using ConfoCor2 (Carl Zeiss, Jena, Germany) as described (Pack et al, 1999, 2000). The sample was excited with 62.5 μW of laser power. To prevent nonspecific adsorption of proteins on the surface of the cover glass, the sample chamber was treated with a protein blocker (N101, NOF Corporation, Japan) before measurement. The measured fluorescence autocorrelation functions were fitted by two-component model as described (Pack et al, 2000). In the titration experiment, the duration of measurement was 60 s, and each point on the titration curve is represented by the average of three independent measurements. The titration curves obtained in this study were then fitted with a hyperbolic equation, y=[(B × [ɛ]free)/(KD+[ɛ]free)], where y represents the % of the binding of the complex to the ɛ subunit, B is the maximum occupancy of ɛ with the complex (%) and KD is the dissociation constant for the ɛ subunit. As the concentrations of the complex that bound to the ɛ subunit are obtained directly from the FCS measurement, the concentration of the free ɛ subunit was calculated as [ɛ]free=[ɛ]add−[complex]bound.

Rotation assay

Biotinylated complexes (10 μl) in 20 mM K-phosphate, pH 7.0, 100 mM KCl and 0.2% (w/v) BSA were infused into a flow chamber and were incubated for 2 min at room temperature. The flow chamber was then washed with 50 μl of 20 mM K-phosphate, pH 7.0 and 100 mM KCl to remove unattached complexes. A streptoavidin beads (209 nm) in 20 mM K-phosphate, pH 7.0, 100 mM KCl and 0.2% (w/v) BSA were infused into the flow chamber and were incubated for 15 min. Rotation was initiated by addition of 30 μl of assay buffer (50 mM HEPES–KOH, pH 8.0, 100 mM KCl, 0.5 mM MgCl2, 250 nM ATP, 100 μg/ml pyruvate kinase and 2 mM phosphoenolpyruvate) after washing the flow chamber with 50 μl of 50 mM HEPES–KOH, pH 8.0 and 100 mM KCl. The rotation was monitored for 5 min after which the assay buffer containing 3 μM of the ɛ subunit was infused into the flow chamber to inhibit the enzyme. Rotation of the attached 209 nm duplex beads on the γ subunit was monitored with a conventional optical microscope type IX 71 (Olympus, Tokyo, Japan) with a × 100 objective lens and the images were recorded into a digital video recorder. Recorded images were analyzed by custom software prepared by Yasuda et al (1998).

Supplementary Material

Figure 1B in the Supplementary data

7601348s1.pdf (476.3KB, pdf)

Acknowledgments

We thank Dr C S Harwood (University of Iowa), Dr M Ikeuchi (University of Tokyo), Dr T Suzuki and Dr M Yoshida (ATP System Project, ERATO, JST) for providing us the suitable experimental materials. We also thank Dr B Feniouk, Dr K Yokoyama, Dr H Imamura, Dr R Iino, Dr K Shimabukuro, Dr E Muneyuki, Dr K Motohashi, Dr Y Nakanishi, Dr T Masaike, Dr H Ueno, Ms M Takeda and Dr PGN Romano for fruitful discussions. This work was supported in part by ATP System Project, ERATO, JST, and in part by a Grant-in-aid for Scientific Research (No. 17370015 and No. 17GS0316 to TH) from the Ministry of Education, Culture, Sports, Science and Technology, Japan and by the Japan Society for the Promotion of Science.

References

  1. Abrahams JP, Leslie AG, Lutter R, Walker JE (1994) Structure at 2.8 Å resolution of F1-ATPase from bovine heart mitochondria. Nature 370: 621–628 [DOI] [PubMed] [Google Scholar]
  2. Aggeler R, Capaldi RA (1996) Nucleotide-dependent movement of the ɛ subunit between α and β subunits in the Escherichia coli F1Fo-type ATPase. J Biol Chem 271: 13888–13891 [DOI] [PubMed] [Google Scholar]
  3. Bald D, Amano T, Muneyuki E, Pitard B, Rigaud JL, Kruip J, Hisabori T, Yoshida M, Shibata M (1998) ATP synthesis by FoF1-ATP synthase independent of noncatalytic nucleotide binding sites and insensitive to azide inhibition. J Biol Chem 273: 865–870 [DOI] [PubMed] [Google Scholar]
  4. Bar-Zvi D, Shavit N (1982) Modulation of the chloroplast ATPase by tight ADP binding. Effect of uncouplers and ATP. J Bioenerg Biomembr 14: 467–478 [DOI] [PubMed] [Google Scholar]
  5. Boyer PD (1997) The ATP synthase—a splendid molecular machine. Annu Rev Biochem 66: 717–749 [DOI] [PubMed] [Google Scholar]
  6. Digel JG, Kishinevsky A, Ong AM, McCarty RE (1996) Differences between two tight ADP binding sites of the chloroplast coupling factor 1 and their effects on ATPase activity. J Biol Chem 271: 19976–19982 [DOI] [PubMed] [Google Scholar]
  7. Du Z, Tucker WC, Richter ML, Gromet-Elhanan Z (2001) Assembled F1-(αβ) and hybrid F1-α3β3γ-ATPases from Rhodospirillum rubrum α, wild type or mutant β, and chloroplast γ subunits. Demonstration of Mg2+ versus Ca2+-induced differences in catalytic site structure and function. J Biol Chem 276: 11517–11523 [DOI] [PubMed] [Google Scholar]
  8. Duncan TM, Bulygin VV, Zhou Y, Hutcheon ML, Cross RL (1995) Rotation of subunits during catalysis by Escherichia coli F1-ATPase. Proc Natl Acad Sci USA 92: 10964–10968 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Feldman RI, Boyer PD (1985) The role of tightly bound ADP on chloroplast ATPase. J Biol Chem 260: 13088–13094 [PubMed] [Google Scholar]
  10. Feniouk BA, Junge W (2005) Regulation of the FoF1-ATP synthase: the conformation of subunit ɛ might be determined by directionality of subunit γ rotation. FEBS Lett 579: 5114–5118 [DOI] [PubMed] [Google Scholar]
  11. Grubmeyer C, Cross RL, Penefsky HS (1982) Mechanism of ATP hydrolysis by beef heart mitochondrial ATPase. Rate constants for elementary steps in catalysis at a single site. J Biol Chem 257: 12092–12100 [PubMed] [Google Scholar]
  12. Hirono-Hara Y, Ishizuka K, Kinosita K Jr, Yoshida M, Noji H (2005) Activation of pausing F1 motor by external force. Proc Natl Acad Sci USA 102: 4288–4293 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hirono-Hara Y, Noji H, Nishiura M, Muneyuki E, Hara KY, Yasuda R, Kinosita K Jr, Yoshida M (2001) Pause and rotation of F1-ATPase during catalysis. Proc Natl Acad Sci USA 98: 13649–13654 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hisabori T, Kato Y, Motohashi K, Kroth-Pancic P, Strotmann H, Amano T (1997) The regulatory functions of the γ and ɛ subunits from chloroplast CF1 are transferred to the core complex, α3β3, from thermophilic bacterial F1. Eur J Biochem 247: 1158–1165 [DOI] [PubMed] [Google Scholar]
  15. Hisabori T, Kondoh A, Yoshida M (1999) The γ subunit in chloroplast F1-ATPase can rotate in a unidirectional and counter-clockwise manner. FEBS Lett 463: 35–38 [DOI] [PubMed] [Google Scholar]
  16. Hisabori T, Motohashi K, Kroth P, Strotmann H, Amano T (1998) The formation or the reduction of a disulfide bridge on the γ subunit of chloroplast ATP synthase affects the inhibitory effect of the ɛ subunit. J Biol Chem 273: 15901–15905 [DOI] [PubMed] [Google Scholar]
  17. Hisabori T, Ueoka-Nakanishi H, Konno H, Koyama F (2003) Molecular evolution of the modulator of chloroplast ATP synthase: origin of the conformational change dependent regulation. FEBS Lett 545: 71–75 [DOI] [PubMed] [Google Scholar]
  18. Iino R, Murakami T, Iizuka S, Kato-Yamada Y, Suzuki T, Yoshida M (2005) Real-time monitoring of conformational dynamics of the ɛ subunit in F1-ATPase. J Biol Chem 280: 40130–40134 [DOI] [PubMed] [Google Scholar]
  19. Jiang W, Hermolin J, Fillingame RH (2001) The preferred stoichiometry of c subunits in the rotary motor sector of Escherichia coli ATP synthase is 10. Proc Natl Acad Sci USA 98: 4966–4971 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Joshi AK, Ahmed S, Ferro-Luzzi Ames G (1989) Energy coupling in bacterial periplasmic transport systems. Studies in intact Escherichia coli cells. J Biol Chem 264: 2126–2133 [PubMed] [Google Scholar]
  21. Kaibara C, Matsui T, Hisabori T, Yoshida M (1996) Structural asymmetry of F1-ATPase caused by the γ subunit generates a high affinity nucleotide binding site. J Biol Chem 271: 2433–2438 [DOI] [PubMed] [Google Scholar]
  22. Kato Y, Matsui T, Tanaka N, Muneyuki E, Hisabori T, Yoshida M (1997) Thermophilic F1-ATPase is activated without dissociation of an endogenous inhibitor, ɛ subunit. J Biol Chem 272: 24906–24912 [DOI] [PubMed] [Google Scholar]
  23. Kato-Yamada Y (2005) Isolated ɛ subunit of Bacillus subtilis F1-ATPase binds ATP. FEBS Lett 579: 6875–6878 [DOI] [PubMed] [Google Scholar]
  24. Kato-Yamada Y, Bald D, Koike M, Motohashi K, Hisabori T, Yoshida M (1999) ɛ subunit, an endogenous inhibitor of bacterial F1-ATPase, also inhibits FoF1-ATPase. J Biol Chem 274: 33991–33994 [DOI] [PubMed] [Google Scholar]
  25. Kato-Yamada Y, Noji H, Yasuda R, Kinosita K Jr, Yoshida M (1998) Direct observation of the rotation of ɛ subunit in F1-ATPase. J Biol Chem 273: 19375–19377 [DOI] [PubMed] [Google Scholar]
  26. Kato-Yamada Y, Yoshida M, Hisabori T (2000) Movement of the helical domain of the ɛ subunit is required for the activation of thermophilic F1-ATPase. J Biol Chem 275: 35746–35750 [DOI] [PubMed] [Google Scholar]
  27. Krenn BE, Aardewijn P, Van Walraven HS, Werner-Grune S, Strotmann H, Kraayenhof R (1995) ATP synthase from a cyanobacterial Synechocystis 6803 mutant containing the regulatory segment of the chloroplast γ subunit shows thiol modulation. Biochem Soc Trans 23: 757–760 [DOI] [PubMed] [Google Scholar]
  28. Landt O, Grunert HP, Hahn U (1990) A general method for rapid site-directed mutagenesis using the polymerase chain reaction. Gene 96: 125–128 [DOI] [PubMed] [Google Scholar]
  29. Malyan AN, Vitseva OI (1983) Presteady-state kinetics of ATP hydrolysis by chloroplast CF1-ATPase. Biokhimiia 48: 718–724 [PubMed] [Google Scholar]
  30. Matsui T, Muneyuki E, Honda M, Allison WS, Dou C, Yoshida M (1997) Catalytic activity of the α3β3γ complex of F1-ATPase without noncatalytic nucleotide binding site. J Biol Chem 272: 8215–8221 [DOI] [PubMed] [Google Scholar]
  31. Meier T, Polzer P, Diederichs K, Welte W, Dimroth P (2005) Structure of the rotor ring of F-type Na+-ATPase from Ilyobacter tartaricus. Science 308: 659–662 [DOI] [PubMed] [Google Scholar]
  32. Minkov IB, Fitin AF, Vasilyeva EA, Vinogradov AD (1979) Mg2+-induced ADP-dependent inhibition of the ATPase activity of beef heart mitochondrial coupling factor F1. Biochem Biophys Res Commun 89: 1300–1306 [DOI] [PubMed] [Google Scholar]
  33. Mitome N, Suzuki T, Hayashi S, Yoshida M (2004) Thermophilic ATP synthase has a decamer c-ring: indication of noninteger 10:3 H+/ATP ratio and permissive elastic coupling. Proc Natl Acad Sci USA 101: 12159–12164 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Nakanishi-Matsui M, Kashiwagi S, Hosokawa H, Cipriano DJ, Dunn SD, Wada Y, Futai M (2005) Stochastic high-speed rotation of Escherichia coli ATP synthase F1 sector: the ɛ subunit-sensitive rotation. J Biol Chem 280: 23797–23801 [DOI] [PubMed] [Google Scholar]
  35. Nalin CM, McCarty RE (1984) Role of a disulfide bond in the γ subunit in activation of the ATPase of chloroplast coupling factor 1. J Biol Chem 259: 7275–7280 [PubMed] [Google Scholar]
  36. Nelson N, Nelson H, Racker E (1972) Partial resolution of the enzymes catalyzing photophosphorylation. XII. Purification and properties of an inhibitor isolated from chloroplast coupling factor 1. J Biol Chem 247: 7657–7662 [PubMed] [Google Scholar]
  37. Nichols NN, Harwood CS (1997) PcaK, a high-affinity permease for the aromatic compounds 4-hydroxybenzoate and protocatechuate from Pseudomonas putida. J Bacteriol 179: 5056–5061 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Nishizaka T, Oiwa K, Noji H, Kimura S, Muneyuki E, Yoshida M, Kinosita K Jr (2004) Chemomechanical coupling in F1-ATPase revealed by simultaneous observation of nucleotide kinetics and rotation. Nat Struct Mol Biol 11: 142–148 [DOI] [PubMed] [Google Scholar]
  39. Noji H, Hasler K, Junge W, Kinosita K Jr, Yoshida M, Engelbrecht S (1999) Rotation of Escherichia coli F1-ATPase. Biochem Biophys Res Commun 260: 597–599 [DOI] [PubMed] [Google Scholar]
  40. Noji H, Yasuda R, Yoshida M, Kinosita K Jr (1997) Direct observation of the rotation of F1-ATPase. Nature 386: 299–302 [DOI] [PubMed] [Google Scholar]
  41. Nowak KF, Tabidze V, McCarty RE (2002) The C-terminal domain of the ɛ subunit of the chloroplast ATP synthase is not required for ATP synthesis. Biochemistry 41: 15130–15134 [DOI] [PubMed] [Google Scholar]
  42. Omote H, Sambonmatsu N, Saito K, Sambongi Y, Iwamoto-Kihara A, Yanagida T, Wada Y, Futai M (1999) The γ-subunit rotation and torque generation in F1-ATPase from wild-type or uncoupled mutant Escherichia coli. Proc Natl Acad Sci USA 96: 7780–7784 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Pack CG, Aoki K, Taguchi H, Yoshida M, Kinjo M, Tamura M (2000) Effect of electrostatic interactions on the binding of charged substrate to GroEL studied by highly sensitive fluorescence correlation spectroscopy. Biochem Biophys Res Commun 267: 300–304 [DOI] [PubMed] [Google Scholar]
  44. Pack CG, Nishimura G, Tamura M, Aoki K, Taguchi H, Yoshida M, Kinjo M (1999) Analysis of interaction between chaperonin GroEL and its substrate using fluorescence correlation spectroscopy. Cytometry 36: 247–253 [DOI] [PubMed] [Google Scholar]
  45. Paik SR, Yokoyama K, Yoshida M, Ohta T, Kagawa Y, Allison WS (1993) The TF1-ATPase and ATPase activities of assembled α3β3γ, α3β3γδ, and α3β3γɛ complexes are stimulated by low and inhibited by high concentrations of rhodamine 6G whereas the dye only inhibits the α3β3, and α3β3δ complexes. J Bioenerg Biomembr 25: 679–684 [DOI] [PubMed] [Google Scholar]
  46. Richter ML, Patrie WJ, McCarty RE (1984) Preparation of the ɛ subunit and ɛ subunit-deficient chloroplast coupling factor 1 in reconstitutively active forms. J Biol Chem 259: 7371–7373 [PubMed] [Google Scholar]
  47. Sabbert D, Engelbrecht S, Junge W (1996) Intersubunit rotation in active F-ATPase. Nature 381: 623–625 [DOI] [PubMed] [Google Scholar]
  48. Schulenberg B, Capaldi RA (1999) The ɛ subunit of the F1Fo complex of Escherichia coli. Cross-linking studies show the same structure in situ as when isolated. J Biol Chem 274: 28351–28355 [DOI] [PubMed] [Google Scholar]
  49. Seelert H, Poetsch A, Dencher NA, Engel A, Stahlberg H, Muller DJ (2000) Structural biology. Proton-powered turbine of a plant motor. Nature 405: 418–419 [DOI] [PubMed] [Google Scholar]
  50. Senior AE (1990) The proton-translocating ATPase of Escherichia coli. Annu Rev Biophys Biophys Chem 19: 7–41 [DOI] [PubMed] [Google Scholar]
  51. Shimabukuro K, Yasuda R, Muneyuki E, Hara KY, Kinosita K Jr, Yoshida M (2003) Catalysis and rotation of F1 motor: cleavage of ATP at the catalytic site occurs in 1 ms before 40° substep rotation. Proc Natl Acad Sci USA 100: 14731–14736 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Steinemann D, Engelbrecht S, Lill H (1995) Reassembly of Synechocystis sp. PCC 6803 F1-ATPase from its over-expressed subunits. FEBS Lett 362: 171–174 [DOI] [PubMed] [Google Scholar]
  53. Stiggall DL, Galante YM, Hatefi Y (1979) Preparation and properties of complex V. Methods Enzymol 55: 308–315, 819–821 [DOI] [PubMed] [Google Scholar]
  54. Stock D, Leslie AG, Walker JE (1999) Molecular architecture of the rotary motor in ATP synthase. Science 286: 1700–1705 [DOI] [PubMed] [Google Scholar]
  55. Suzuki T, Murakami T, Iino R, Suzuki J, Ono S, Shirakihara Y, Yoshida M (2003) FoF1-ATPase/synthase is geared to the synthesis mode by conformational rearrangement of ɛ subunit in response to proton motive force and ADP/ATP balance. J Biol Chem 278: 46840–46846 [DOI] [PubMed] [Google Scholar]
  56. Suzuki T, Ueno H, Mitome N, Suzuki J, Yoshida M (2002) Fo of ATP synthase is a rotary proton channel. Obligatory coupling of proton translocation with rotation of c-subunit ring. J Biol Chem 277: 13281–13285 [DOI] [PubMed] [Google Scholar]
  57. Tsunoda SP, Rodgers AJ, Aggeler R, Wilce MC, Yoshida M, Capaldi RA (2001) Large conformational changes of the ɛ subunit in the bacterial F1Fo ATP synthase provide a ratchet action to regulate this rotary motor enzyme. Proc Natl Acad Sci USA 98: 6560–6564 [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Ueoka-Nakanishi H, Nakanishi Y, Konno H, Motohashi K, Bald D, Hisabori T (2004) Inverse regulation of rotation of F1-ATPase by the mutation at the regulatory region on the γ subunit of chloroplast ATP synthase. J Biol Chem 279: 16272–16277 [DOI] [PubMed] [Google Scholar]
  59. Vasilyeva EA, Minkov IB, Fitin AF, Vinogradov AD (1982) Kinetic mechanism of mitochondrial adenosine triphosphatase. ADP-specific inhibition as revealed by the steady-state kinetics. Biochem J 202: 9–14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Werner-Grune S, Gunkel D, Schumann J, Strotmann H (1994) Insertion of a ‘chloroplast-like' regulatory segment responsible for thiol modulation into γ-subunit of FoF1-ATPase of the cyanobacterium Synechocystis 6803 by mutagenesis of atpC. Mol Gen Genet 244: 144–150 [DOI] [PubMed] [Google Scholar]
  61. Yasuda R, Noji H, Kinosita K Jr, Yoshida M (1998) F1-ATPase is a highly efficient molecular motor that rotates with discrete 120° steps. Cell 93: 1117–1124 [DOI] [PubMed] [Google Scholar]
  62. Yasuda R, Noji H, Yoshida M, Kinosita K Jr, Itoh H (2001) Resolution of distinct rotational substeps by submillisecond kinetic analysis of F1-ATPase. Nature 410: 898–904 [DOI] [PubMed] [Google Scholar]
  63. Yoshida M, Muneyuki E, Hisabori T (2001) ATP synthase—a marvellous rotary engine of the cell. Nat Rev Mol Cell Biol 2: 669–677 [DOI] [PubMed] [Google Scholar]
  64. Yoshida M, Sone N, Hirata H, Kagawa Y, Ui N (1979) Subunit structure of adenosine triphosphatase. Comparison of the structure in thermophilic bacterium PS3 with those in mitochondria, chloroplasts, and Escherichia coli. J Biol Chem 254: 9525–9533 [PubMed] [Google Scholar]
  65. Zhou JM, Xue ZX, Du ZY, Melese T, Boyer PD (1988) Relationship of tightly bound ADP and ATP to control and catalysis by chloroplast ATP synthase. Biochemistry 27: 5129–5135 [DOI] [PubMed] [Google Scholar]
  66. Zimmermann B, Diez M, Zarrabi N, Graber P, Borsch M (2005) Movements of the ɛ-subunit during catalysis and activation in single membrane-bound H+-ATP synthase. EMBO J 24: 2053–2063 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure 1B in the Supplementary data

7601348s1.pdf (476.3KB, pdf)

Articles from The EMBO Journal are provided here courtesy of Nature Publishing Group

RESOURCES